At the Root of Decomposers, Plant Enemies and Mycorrhizae in Trophic Ecology”

The Pennsylvania State University

The Graduate School

CONSUMERS OF LIVING AND DEAD PLANT MATTER: AT THE ROOT

OF DECOMPOSERS, PLANT ENEMIES AND MYCORRHIZAE IN

TROPHIC ECOLOGY

A Dissertation in

Ecology

Rondy J. Malik

Submitted in Partial Fulfillment

of the Requirements

for the Degree of

Doctor of Philosophy

August 2019

The dissertation of Rondy J. Malik was reviewed and approved* by the following:

David M. Eissenstat

Professor of Woody Plant Physiology

Dissertation Co-Adviser

Co-Chair of Committee

Terrence H. Bell

Assistant Professor of Phytobiomes

Dissertation Co-Adviser

Co-Chair of Committee

Mary Ann Bruns

Associate Professor of Soil Microbiology and Biogeochemistry

Alan H. Taylor

Professor of Geography and Vegetation Dynamics

David A.W Miller

Assistant Professor of Wildlife Population Ecology

Chair of Ecology Intercollege Graduate Degree Program

*Signatures are on file in the Graduate School.

Abstract

The basis of trophic ecology stems from animal ecology, but the role of microbes is just as important. Microbes can sway resource economies, and impact entire communities and trophic structure. This body of work applies hypotheses from classical ecology in modern contexts. Through greenhouse, common garden and field experiments, the roles of microbes are assessed from basic to applied perspectives.

Applied aspects of this research provide insights on mycorrhizae in bioprotection, including the interplay of mycorrhizae, plants and natural enemies (Chapter 1); basic aspects of this research elucidate mechanisms of mycorrhizae in modulating herbivore life-histories (Chapter 2). Also, for the first time, the hypothesis of a late classical ecologist is tested on recalcitrant woody litter decomposition. Also, a widely-known hypothesis termed the “Home-field Advantage” is also assessed in a novel context. Here, the home- field advantage hypothesis is coupled with tree bark decomposition to assess microbial succession, especially as it relates to environmental filtration (Chapter 3). In the final research chapter, the “Gadgil Effect”, which hypothesizes that root microbial associations can suppress decomposition through pre-emptive competition, is revisited and examined

(Chapter 4). In this Dissertation, the importance of microbes in community function is elucidated.

iii

Table of Contents

Contents List of Figures……………………………………………………………………………………………ix List of Tables……………………………………………………………………………………………..x Acknowledgement……………………………………………………………………………...... xi Broad overview ...... 1 Background ...... 2 Introduction ...... 6 Prospectus ...... 10 Prospectus Model ...... 12 Statistical Analysis ...... 13 References ...... 15 Chapter 1: Recent Trend, is the Role of Arbuscular Mycorrhizal Fungi in Plant-Enemies Performance Biased by Taxon Usage? ...... 24 Abstract...... 24 1.1. Introduction ...... 26 1.2. Recent trends in taxon usage ...... 28 Fig. 1.21 Recent trend in taxon usage among bioprotection studies...... 30 1.3. Synthesis ...... 31 1.31. Plant hormonal response to ‘plant-trophs’ ...... 31 1.32. Plant enemy response parameters ...... 32 1.33. What may be explaining taxon usage? ...... 33 Acknowledgment ...... 36 References ...... 37 Chapter 2: Mycorrhizal composition influences plant anatomical defense and impacts herbivore growth and survival in a life-stage dependent manner ...... 42 Abstract...... 42 2.1. Introduction ...... 44 2.2. Methods ...... 48 2.21. Study system ...... 48

2.22. Primary consumer: Colorado potato beetle ...... 50 2.23. Microcosm: AM-fungi, plant and early-stage beetle interaction ...... 50 2.24. Experiment 1: early-stage performance ...... 51 2.25. Estimating trichome density at point of infestation ...... 51 2.26. Statistical analysis: early-stage beetle ...... 52 2.27. Experiment 2: late-stage performance ...... 53 2.28. Statistical analysis: late-stage beetle ...... 53 Table 2.21 Experimental Design of Experiment I & II...... 54 2.3. Results ...... 55 2.31. Early life-stage performance of herbivore and the effect AM-fungi ...... 55 2.32. Late life-stage performance of herbivore and the effect AM-fungi ...... 55 Fig. 2.31. The overall effect of arbuscular mycorrhizal (AM) fungi versus control: ...... 57 Table 2.32. Analysis of variance (ANOVA) for Experiment 1: ...... 58 Fig. 2.32. The effect of AM-fungi on Colorado potato beetle’s life stage specific survival. ... 59 Fig. 2.33. Anatomical defense structure (trichomes) and plant tissue consumption by early- stage beetles...... 60 Fig. 2.34. Late-stage Colorado potato beetle growth rate in response to AM-fungal composition...... 61 2.4 Discussion ...... 62 2.41. Stage-class shapes trophic structure ...... 62 2.42. Context dependency of herbivore trophic link ...... 63 2.43. Context dependency of mycorrhizal trophic link ...... 64 2.44. Food-web connectedness ...... 65 2.5. Conclusion ...... 66 Acknowledgements ...... 67 References ...... 68 Chapter 3: “Home-field advantage” - or not, bark decomposition promotes the environmental filtration of microbes in nearby soil communities ...... 75 Abstract...... 75 3.1. Introduction ...... 77 3.2. Methods ...... 81

3.21. Study system ...... 81 3.22. Experimental Design ...... 82 3.23. Bark excision ...... 82 3.24. Bark microbial preparation ...... 83 3.26. Field Experiment ...... 84 3.27. Harvest: adherent soil communities and decomposition ...... 85 3.28. Preparing Initial Bark Sample ...... 85 3.29. Bioinformatic and data assessment ...... 87 3.295. Decomposition analysis and statistics ...... 89 Fig. 3.21. Experimental design...... 90 3.3. Results ...... 91 3.31. Soil community effect on bark decomposition ...... 91 Fig. 3.32. Bark decomposition in soil communities...... 92 3.33. Bark and soil specific clustering of microbial communities ...... 93 Fig. 3.35. Bray-Curtis PCoA analysis of 16S OTU’s ...... 94 Fig. 3.36. Bray-Curtis PCoA analysis of fungal OTU’s ...... 95 Fig. 3.37. Relative abundance of bacterial and fungal OTU’s ...... 96 3.4. Discussion ...... 97 Fig. 3.41. Working Model ...... 98 3.41. Habitat heterogeneity may affect decomposition at a local scale ...... 99 3.42. Decomposition and litter traits may shape community structure ...... 100 3.5. Conclusion ...... 101 Acknowledgement ...... 103 References ...... 104 Chapter 4: No “Gadgil effect”: Temperate tree roots and soil lithology are effective predictors of wood decomposition ...... 111 Abstract...... 111 4.1. Introduction ...... 112 4.2 Methods ...... 116 4.21. Sites of contrasting lithologies ...... 116 Fig. 4.21 Geographic distribution of sites...... 118

Table 4.21. Expected soil characteristics based on soil series ...... 119 4.22. Experimental design ...... 120 4.23. Root+ soil community: subjecting wood substrate to active photosynthate ...... 120 Fig 4.22. Experimental flow chart: ...... 122 4.24. Root– soil community: subjecting wood substrate to inactive photosynthate ...... 123 4.25. Decomposition...... 123 4.26. Statistical analysis ...... 124 4.3. Results ...... 126 4.31. Root effects on wood rot ...... 126 4.32. Root effects on wood mass loss ...... 126 4.33. Lithology effect on decomposition ...... 127 Table 4.31. Source of decomposition ...... 119 Fig. 4.31. The effect of roots on wood decomposition...... 129 Fig. 4.32 The overall influence of soil lithology (site effects) on wood decomposition...... 130 4.4. Discussion ...... 131 4.41. Soil lithology is an effective predictor of decomposition ...... 132 4.42. Roots stimulate decomposition ...... 132 4.43. Roots and fungal interactions ...... 133 4.5. Conclusion ...... 134 Acknowledgement ...... 135 References ...... 136 Concept Review...... 142 5.1 Synopsis and main findings ...... 142 Model of Main Findings ...... 146 5.2. Study limitations ...... 147 Synthesis ...... 149 5.4. Future Directions...... 151 Reference ...... 153

vii

Appendices 156

Appendix A: Examining the field of bioprotection 156

Appendix B: Plant Enemy Performance 157

Appendix C: Mycorrhizae, plant and herbivory 158

Appendix D: White oak and eastern hemlock bark 159

Appendix E: Bark decomposition experiment 160

Appendix F: Bark decomposition experimental design 161

Appendix G: Cylindrical cores for decomposition studies 162

Appendix H: Root exclusion experiment 163

Appendix I: Mycelial colonization wood 164

viii

List of Figures

Fig. 1.21 Recent trend in taxon usage among bioprotection studies 30

Fig. 2.31. The overall effect of arbuscular mycorrhizal (AM) fungi versus control: 57

Fig. 2.32. The effect of AM-fungi on Colorado potato beetle’s life stage specific survival 59

Fig. 2.33. Anatomical defense structure (trichomes) and plant tissue consumption by early-stage beetles 60

Fig. 2.34. Late-stage Colorado potato beetle growth rate in response to AM-fungal composition 61

Fig. 3.21. Experimental design. 90

Fig. 3.32. Bark decomposition in soil communities. 92

Fig. 3.35. Bray-Curtis PCoA analysis of 16S OTU’s 94

Fig. 3.36. Bray-Curtis PCoA analysis of fungal OTU’s 95

Fig. 3.37. Relative abundance of bacterial and fungal OTU’s 96

Fig. 3.41. Working Model 98

Fig. 4.21 Geographic distribution of sites. 118

Fig 4.22. Experimental flow chart: 122

Fig. 4.31. The effect of roots on wood decomposition. 129

Fig. 4.32 The overall influence of soil lithology (site effects) on wood decomposition. 130

Model of Main Findings 146

List of Tables

Table 2.21 Experimental Design of Experiment I & II 54

Table 2.32. Analysis of variance (ANOVA) for Experiment 1: 58

Table 4.21. Expected soil characteristics based on soil series 119

Table 4.31 Source of decomposition variation 128

Acknowledgement

Penn State Button Waller Fellowship, U.S. Department of Energy, DOE Terrestrial

Ecosystems Program, Grant/Award Number: DE-SC001200, US National Science

Foundation Critical Zone Observatory Program grants to C. Duffy (EAR 07-25019) and S.

Brantley (EAR 12-39285, EAR 13-31726), USDA National Institute of Food and Hatch

Appropriations under Project #PEN04651 and Accession #1016233, and the Pennsylvania

State University Department of Ecosystem Science and Management.

Dedication

I dedicate this dissertation to my ancestors, including my late grandparents, Jeanty

(1918 - 1997) & Virgilla (1919 – 2016). Also, much love and respect to their five children, aunt Elaine, uncle Jean-Marie, aunt Margarette, uncle Gerald, and my father Ronald. The journey begins in the mid-1970’s, before my existence, in a lakou of Port-au-Prince, Haiti.

Jean-Marie, the eldest son, decided to move the family from the ‘land of Dessalines’, to the United States. I am thankful for uncle Jean-Marie’s foresight.

Shades of uncle Jean-Marie and his siblings, I also turned out to be an explorer, as

I have always been fascinated with knowledge. Raised by my father, in the Boston neighborhood of Mattapan, the trees seemed bigger, and the stars seemed closer, from the brick building of 785 Cummins Highway, which towered over Brockton and Favre street. When I was old enough to descend from the brick building, my childhood best friend, Daryl, and I, would catch the school bus from Mattapan to Hyde Park. As students of Henry Grew Elementary, I did not know my potential, but I’ve always been fascinated by elements of ecology, including spatial maps that projected the geographical terrain. In class, I marveled at archaeology and paleontology, especially when learning about dinosaurs, volcanoes, and the ancient Roman city of Pompeii. I also enjoyed learning about rock types and volcanoes. In addition, I always been infatuated by weather systems and predictions of meteorology.

xii

Although I did not realize it at the time, I was destined to be a scientist. But as an adolescent, these passions became less relevant, as I faced the reality of young males of

Mattapan. These challenges were also true for my peers of neighboring Dorchester, Hyde

Park and Roxbury. My years as a youth shaped my thirst for success. To quote one of my favorite rappers, “It ain’t hard to tell, I excel and then prevail”.

The outcome of this mission would be impossible without the many mentors that helped shape my thinking, because of this, I am thankful. Also, I’d like to acknowledge all my peers that motivated me along the way, from William Barton Rogers Middle

School in Hyde Park, to the basketball courts and playground of Almont park, Mattapan.

Also, I’d like to thank my friends from Boston Public Schools (Class of 2008) for keeping me motivated. Special thanks to professor(s) and peers of Bunker Hill Community

College, UMass-Boston, Washington University in St. Louis, Indiana University and Penn

State University for being a part of this journey.

Thanks again to the spirit of the ancestor for being with me throughout this journey.

xiii

Broad overview

Microbes are essential to life on earth (Fredrickson and Onstott, 1996, Kowalchuk et al., 2008, Falkowski et al., 2008). At the organismal level, microbes can improve host function and niche breadth (Christian et al., 2019, Kohl et al., 2014). At the ecosystem level, microbes are linchpins to ecosystem cycles (Canfield et al., 2010, Ragsdale, 2007).

Despite this, the role of microbes as mainstays of trophic structure may be understated.

A trophic interaction results in energy transfers from one ecosystem compartment to another (Lindeman, 1942). Elucidating the extent in which microbes can affect this process, may allow a better appreciation of microbes, as ‘strong trophic links’ (Paine,

1980).

Microbial contributions can be evaluated at both basic and applied perspectives.

In applied ecology, microbial control is a subdivision of biological control (Rania et al.,

2016, Eilenberg et al., 2001, Vemmer and Patel, 2013). This field of study uses microbial inoculation to modulate plant-enemy interactions (Malik, 2018). While in basic research, the role of microbes in ecosystem processes can also be observed. This includes decomposition and nutrient cycling (Miltner et al., 2012). Through basic and applied research, the role of microbes in trophic ecology is examined.

Background

Food webs are a construct of many trophic linkages (Paine, 1966, Moore et al.,

2004). Trophic links interact directly and indirectly, but indirect interactions can sometimes have a stronger effect on trophic structure (Barton et al., 2009, Poelman et al.,

2012). For example, in aquatic systems, indirect trophic links such as fish feeding on algae can have a greater influence on insect abundances (indirect link), as opposed to fish feeding directly on insects (Flecker, 1992). In terrestrial systems, indirect and direct trophic linkages can also have community implications, as plant quality may directly affect aphids, while indirectly impacting parasitoids (Bukovinszky et al., 2008). In the below ground, soil organisms ranging from bacteria to microarthropods are beneficiaries of diverse plant communities (Eisenhauer et al., 2013). The interdependence of these interactions are shaped by co-evolutionary forces (Thompson, 2014). This may explain as to why herbivore-insect interactions consisting of deep co-evolutionary history enables higher insect fitness, when compared to insect-plant interactions of recent co- evolutionary history (i.e. invasive species) (Tallamy et al., 2010).

Some trophic interactions are ancient, such as the ones that occur between land plants and arbuscular mycorrhizal (AM) fungi (Redecker et al., 2000, Bonfante and Genre,

2008). AM-fungi can improve plant quality, which may impact higher trophic links

(Reynolds et al., 2003). Plant quality improvement may enable plants to become more

2 attractive to plant enemies, but at the same time, plants may become better defended due to improved nutritional value (Bennett et al., 2006).

Root architecture can directly influence trophic interactions among plants and natural enemies. Lateral root abundance and branching pattern may increase pathogen incidences. Root pathogens have been shown to be relatively successful at parasitizing highly branched root systems (Sikes et al., 2009). Despite this, AM-fungi may provide bioprotection against root pathogens through enhanced cell wall lignification and localized chitinase activity (Gianinazzi-Pearson et al., 1996). But remarkably, fungal feeding organisms can disrupt nutrient allocation from fungi to roots by grazing on common mycorrhizal mycelial networks (Paudel et al., 2016). This type of disruption is common among earthworms and species of collembola (McLean et al., 2006, Rabatin and Stinner, 1988).

The effect of grazers may also depend on whether or not grazing herbivores are generalists or specialists. A distinction between generalist and specialist is that generalist can switch to an alternative resource (Ostfeld, 1982, Kiørboe et al., 1996), while specialists have a limited range of prey. Generalization and specialization may have eco- evolutionary consequences. This may explain as to why plants are less invested in chemical defenses when generalists are more common (Bálint et al., 2016). Meanwhile, specialists are more common where chemical defenses are unique and costly (van der

Meijden, 1996, Cressler et al., 2015). Chemical blends may also interact synergistically

3 with plant physical defense structures, such as trichomes (Lin et al., 1987, Bickford, 2016).

Aside from chemical blends, physical structures can also protect plants. This is especially true among woody plants, as bark provides protection from fire, desiccation, herbivores, and pathogens (Dantas and Pausas, 2013, Cernusak and Cheesman, 2015, Zas et al., 2011,

Pearce, 1996, Mullick, 1977).

Bark originates in the meristematic cork cambium (Harkin and Rowe, 1971), low in nutrient quality (Dossa et al., 2016), its decomposition may influence microbial assemblages, which can impact ecosystem function (Alexander and Arthur, 2010, Cheeke et al., 2016, Cole et al., 1977, Boddy and Watkinson, 1995, Reynolds et al., 2003, Moore et al., 2004b, Crowther et al., 2011). Decomposer activity is partially dependent on abiotic factors such as substrate’s nitrogen and moisture content (Melillo et al., 1982, Tuomi et al., 2011). Soil moisture levels can be reduced through root absorption (Denmead and

Shaw, 1962), but at the same time, arbuscular mycorrhizal (AM) fungi can help retain soil moisture through glomalin production (Rillig et al., 2002, Duchicela et al., 2013). Glomalin production improves water stable aggregates, a soil property that is relevant to soil health. Modulating soil moisture through glomalin production may facilitate optimal decomposer performance.

Root colonizing fungi, termed ectomycorrhizae (EM) may have nutrient turnover capabilities (Clemmensen et al., 2013), as these root dependent fungi are descendants of saprotrophs. The EM-fungal genome encode genes that can express lignocellulolytic enzymes (i.e manganese peroxidase) (Kohler et al., 2015, Bödeker et al., 2014), which corresponds to elevated levels of manganese peroxidase activity in soil organic horizons.

In pure culture, Trojanowski et al. (1984) found that EM-fungi can degrade lignin. But still, root microbial dynamics are complexed, as roots that associate with microbes can compete directly with microbes for nutrients (Kaye and Hart, 1997).

Determining the mechanism in which microbes can influence multitrophic interactions may provide insight into the role of microbes as strong trophic links

Introduction

Trophic interactions are feeding interactions that are pivotal to community construct and ecosystem processes (Paine, 1980, Cohen and Stephens, 1978, Wardle and

Yeates, 1993, de Vries et al., 2013). The full amount of trophic linkages gives rise to the conceptual food-web that characterizes the biotic relationships existing in ecological communities (Nakano et al., 1999, Paine, 1980, Marczak et al., 2007). These dynamic interactions form what is known as the trophic pyramid of ecology (Fath and Killian,

2007, Riede et al., 2011). The trophic pyramid is also known as the Eltonian pyramid, in homage to English zoologist, Charles S. Elton (Richardson, 2011). The basis of these concepts are rooted in animal ecology (Gause, 1935, Elton, 1935, Paine, 1980), but still, the role of plants and their beneficial microbial symbionts are just as important

In terrestrial systems, plants are essential, as these chlorophyll pigmented specimen can capture energy and impact many trophic linkages (Moore et al., 2003). Plant resources can also be allocated to microbes in exchange for soil nutrients (Jakobsen and

Rosendahl, 1990). Beneficial microbes may enable plants to become nutritionally enriched, at the same time, plants may be at risk of enemy exploitation (Bennett et al.,

2005). However, the majority of plant matter goes unconsumed. Unconsumed plant matter is cycled back in the soil environment, and the complexity of plant matter may impact carbon residence time (Schmidt et al., 2011).

Whether or not plant material is alive or dead, heterotrophic consumers, including both decomposers and plant natural enemies, may assimilate and/or mineralize plant content (Moore et al., 2004). On one hand, plant matter is a carbon source for decomposers. On the other hand, plant matter is assimilated by herbivores, and then cycled into the soil environment as frass, or labile nitrogen (Frost and Hunter, 2004). In addition to that, herbivores are also a source of nutrition to higher predators, as herbivores can break down plant structures and provide nutritional value to herbivore consumers. Plant hormonal balance may impact herbivore abundance, as jasmonic acid has been observed to recruit parasitic hymenopterans, as a way to defend plants against grazers (Thaler, 1999). Plant herbivore interactions may also be influenced by abiotic factors, such as atmospheric carbon (Holton et al., 2003). This may suggest a direct link between atmospheric carbon and trophic interactions.

Ecosystem function, including trophic interactions are essential to carbon cycling, especially as it relates to decomposition (Hairston Jr and Hairston Sr, 1993, Daufresne and Loreau, 2001, Vitousek, 1984, Moore et al., 2004). Soil respiration is the flux of carbon from edaphic environment to atmosphere (Jia et al., 2006, Kelting et al., 1998). This process takes place as plants deposit organic material resulting in distinct microhabitats specific to microarthropods and microorganisms (Philippot et al., 2013). Decomposition is a direct trophic link between aboveground and belowground soil food-webs. The relationship between native plant communities and native decomposers may be

7 enhanced when decomposers share a co-localized history with plant litter source (Ayres et al., 2009). This relates to the findings of Hansen (1999) in which red oak litter promoted an assembly of Oribatid mites that increased red oak litter decomposition rates. Similarly, recent studies have shown decomposition to be a predictor of microbial succession

(Kielak et al., 2016). At the same time, decomposer activity may be enhanced by root exudates (Brzostek and Finzi, 2011). In crops, root exudates can increase decomposition by 384% (Cheng et al., 2003).

Plants root associations may also be vital to trophic structure. The association between land plants and root colonizing fungi originated over 460 million years ago

(Arthur et al., 2001). Root colonizing fungi termed, arbuscular mycorrhizae (AM), may have played an integral role in land plants colonization of terrestrial environments

(Bonfante and Genre, 2008). This may have included a mechanism for integrating water and phosphorous into plants from primeval soil (Arthur et al., 2001). To date, it is estimated that 80% of land plants form an association with arbuscular mycorrhizal fungi

(Trappe and Safir, 1987, Wang and Qiu, 2006). This trophic interaction, or plant-fungal association remains stable, as plants allocate up to 20% of photosynthates to mycorrhizal fungi (Jakobsen and Rosendahl, 1990). In exchange, AM-fungi can provision nitrogen and phosphorus to promote plant tolerance to stress, including natural enemies

(Hildebrandt et al., 2007, Wu and Xia, 2006, Nogueira et al., 2002, Yuanjing et al., 2013,

Campos-Soriano et al., 2012, Nair et al., 2014).

Plant roots form an intimate association with mycorrhizal fungi. Briefly, strigalactone is the plant hormone involved in mycorrhizal symbiosis. This hormone is present in dicots and monocots as primitive as Embryophyta and Charales (Delaux et al.,

2012). The release of strigalactone into the soil environment enables mycorrhizal spores, as small as 38 microns to germinate. Spore germination allows a hyphal growth tube to seek out plant roots, and once at the root surface, an appressorium is formed (Harrison,

2005). The stability of this association becomes increasingly apparent, as nuclear repositioning takes place inside root cortical cells (Chabaud et al., 2005). Cortical microtubules reorganize, as thick actin bundles radiate toward the appressorium contact site, thus allowing fungal entrance to take place (Chabaud et al., 2005). The root cortical cell, is the site of this trophic interaction, or nutrient exchange.

The purpose of this dissertation is to elucidate the role of microbes in food-web dynamics. Here, the role of microbes in decomposition and herbivory is studied.

Herbivores and decomposers are interconnected, as herbivory and saprotrophy are both heterotrophic processes resulting in the consumption or degradation of plant matter.

Prospectus

Chapter 1: Microbes may impact trophic interactions, including plant consumers.

In this chapter, the role of arbuscular mycorrhizal (AM) fungi in plant-consumer interactions is investigated. AM-fungi are monophyletic in origin, including 29 genera and 230 species (Oehl et al., 2011, Schüβler et al., 2001, Redecker et al., 2013). Microbial inoculation studies featuring AM-fungi – as bioprotectants, may overly test the same taxa because of their commercial availability. In this chapter, I provide quantitative evidence, inasmuch as the generalizability of microbes in plant bioprotection.

Chapter 2: Microbes termed AM-fungi, can colonize plant roots and are mutually beneficial to plant hosts participating in carbon - resource exchange (Jakobsen and

Rosendahl, 1990, Jakobsen et al., 1992, Wang et al., 2014), but AM-fungi may alter plant- herbivore interactions through indirect modification of plant traits. In this chapter, AM- fungal taxa that are commonly used in bioprotection (Malik, 2018), as well as those that are not, are utilized to assess the role of beneficial microbes in plant-herbivore interactions.

Chapter 3: The majority of plant mass goes unconsumed, and is introduced into the soil environment where it is decomposed and recycled. Microbial assemblages and associations may be impacted by this introduction of plant litter. In this chapter, the effect

10 of litter decomposition on microbial assemblages is assessed, as the outcome of bark decomposition on the soil microbial community is characterized.

Chapter 4: Microbial processes may be stimulated by roots. Microbes form associations with roots, as roots can provision an active supply of photosynthates and dissolved organic carbon (Giesler et al., 2007). In this chapter, root microbial associations are manipulated at three woodlands in central, Pennsylvania, U.S.A. Soil environments are either exposed to active supply of photosynthates (root+), or root inactive supply of photosynthates (root -). The aim here is to unravel the role of roots in microbial activity.

Prospectus Model Below is an interconnected model of the prospectus.

Chapter 1 Objective: Determining the latest trend of mycorrhizal fungi in plant-enemy performance

Chapter 2 Objective: Do mycorrhizal fungi impact herbivore life histories?

Chapter 3 Objective: Does litter decomposability impact microbial assemblages in the adherent soil community?

Chapter 4 Objective: Can root microbial associations impact decomposition?

Statistical Analysis for testing hypothesis

• Analysis of variance

• Kruskal-Wallis

• Pearson Correlation

• Permutational multivariate analysis of variance

Chapter 2: This study was performed under a random block design. Normality and homogeneity in variance were confirmed enabling an analysis of variance (ANOVA).

ANOVA was performed to determine if herbivore responses were impacted by mycorrhizal predictors. ANOVA allowed sources of variability to be isolated in the experiment (Girden 1992). Post-hoc analysis including Tukey HSD and Apriori contrast allowed the testing of herbivore response to mycorrhizal versus non-mycorrhizal treatments. To determine the relationship between herbivore survival and herbivory,

Pearson correlation test was performed. Pearson correlation is a robust test that determines exact significance regardless of the distribution from which the data is drawn

(Good 2009)

Chapter 3: Given normality and homogeneity of variance, analysis of variance (ANOVA) was performed to determine if bark decomposition (response variable) was impacted by soil regime predictors or bark species identity. ANOVA allowed the sources of variability to be isolated in the experiment (Girden 1992). ANOVA’s were decomposed using

Simultaneous Test for General Linear Hypothesis (Hothorn, 2008). This post-hoc analysis tested for decomposition in ‘home’ versus ‘away’ soils, as well as bark species effect.

Permutational multivariate analysis of variance (PERMANOVA) was used to test whether or not there was a difference in soil or bark microbiome. PERMANOVA uses pairwise distances to assess species presence, absence, or quantitative abundance (Kelly,

2015; Anderson, 2001)

Chapter 4: Given normality and homogeneity of variance, analysis of variance was performed to determine if decomposition (response variable) was impacted by soil regime predictors, including the presence or absence of tree roots. ANOVA allowed these sources of variability to be isolated in the experiment (Girden 1992). ANOVA’s were then decomposed using Simultaneous Test for General Linear Hypothesis (Hothorn, 2008).

This post-hoc analysis allowed root and species effect to be tested as sources of variation.

Sites were factored in as a block or a random variable. Wood rot severity index was tested by using Kruskal-Wallis to compare medians of ordinal ranks. Dunn’s test was then used to perform multiple comparisons (Dinno & Dinno, 2017)

References

KELLY, B. J., GROSS, R., BITTINGER, K., SHERRILL-MIX, S., LEWIS, J. D., COLLMAN, R. G., ... & LI, H. (2015). Power and sample-size estimation for microbiome studies using pairwise distances and PERMANOVA. Bioinformatics, 31(15), 2461-2468

ALEXANDER, H. D. & ARTHUR, M. A. 2010. Implications of a predicted shift from upland oaks to red maple on forest hydrology and nutrient availability. Canadian Journal of Forest Research, 40, 716-726.

ANDERSON M.J. (2001) A new method for non-parametric multivariate analysis of variance. Aust. Ecol. , 26, 32–46

ARTHUR, S., DANIEL, S. & CHRISTOPHER, W. 2001. A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycological research 105.12 (2001): 1413-1421

AYRES, E., STELTZER, H., SIMMONS, B. L., SIMPSON, R. T., STEINWEG, J. M., WALLENSTEIN, M. D., MELLOR, N., PARTON, W. J., MOORE, J. C. & WALL, D. H. 2009. Home-field advantage accelerates leaf litter decomposition in forests. Soil Biology and Biochemistry, 41, 606-610.

BÁLINT, J., ZYTYNSKA, S. E., SALAMON, R. V., MEHRPARVAR, M., WEISSER, W. W., SCHMITZ, O. J., BENEDEK, K. & BALOG, A. 2016. Intraspecific differences in plant chemotype determine the structure of arthropod food webs. Oecologia, 180, 797-807.

BARTON, B. T., BECKERMAN, A. P. & SCHMITZ, O. J. 2009. Climate warming strengthens indirect interactions in an old-field food web. Ecology, 90, 2346-2351.

BENNETT, A. E., ALERS-GARCIA, J. & BEVER, J. D. 2005. Three-way interactions among mutualistic mycorrhizal fungi, plants, and plant enemies: hypotheses and synthesis. The American Naturalist, 167, 141-152.

BENNETT, A. E., ALERS-GARCIA, J. & BEVER, J. D. 2006. Three-Way Interactions among Mutualistic Mycorrhizal Fungi, Plants, and Plant Enemies: Hypotheses and Synthesis. The American Naturalist, 167, 141-152.

BICKFORD, C. P. 2016. Ecophysiology of leaf trichomes. Functional Plant Biology, 43, 807-814.

BODDY, L. & WATKINSON, S. C. 1995. Wood decomposition, higher fungi, and their role in nutrient redistribution. Canadian Journal of Botany, 73, 1377-1383.

BÖDEKER, I. T., CLEMMENSEN, K. E., DE BOER, W., MARTIN, F., OLSON, Å. & LINDAHL, B. D. D. 2014. Ectomycorrhizal Cortinarius species participate in enzymatic oxidation of humus in northern forest ecosystems. The New phytologist, 203, 245-256.

BONFANTE, P. & GENRE, A. 2008. Plants and arbuscular mycorrhizal fungi: an evolutionary-developmental perspective. Trends in plant science, 13, 492-498.

BRZOSTEK, E. R. & FINZI, A. C. 2011. Substrate supply, fine roots, and temperature control proteolytic enzyme activity in temperate forest soils. Ecology, 92, 892-902.

BUKOVINSZKY, T., VAN VEEN, F. F., JONGEMA, Y. & DICKE, M. 2008. Direct and indirect effects of resource quality on food web structure. Science, 319, 804-807.

CAMPOS-SORIANO, L., GARCÍA-MARTÍNEZ, J. & SAN SEGUNDO, B. 2012. The arbuscular mycorrhizal symbiosis promotes the systemic induction of regulatory defence-related genes in rice leaves and confers resistance to pathogen infection. Molecular plant pathology, 13, 579-592.

CERNUSAK, L. A. & CHEESMAN, A. W. 2015. The benefits of recycling: how photosynthetic bark can increase drought tolerance. New Phytologist, 208, 995-997.

CHABAUD, M., TIMMERS, T., BONFANTE, P. & BARKER, D. G. 2005. Arbuscular mycorrhizal fungi elicit a novel intracellular apparatus in Medicago truncatula root epidermal cells before infection. … The Plant Cell 17.12 (2005): 3489-3499.

CHEEKE, T. E., PHILLIPS, R. P., BRZOSTEK, E. R., ROSLING, A., BEVER, J. D. & FRANSSON, P. 2016. Dominant mycorrhizal association of trees alters carbon and nutrient cycling by selecting for microbial groups with distinct enzyme function. New Phytologist 214.1 (2017): 432-442.

CHENG, W., JOHNSON, D. W. & FU, S. 2003. Rhizosphere effects on decomposition. Soil Science Society of America Journal, 67.

CLEMMENSEN, K. E., BAHR, A., OVASKAINEN, O., DAHLBERG, A., EKBLAD, A., WALLANDER, H., STENLID, J., FINLAY, R. D., WARDLE, D. A. & LINDAHL, B. D. 2013. Roots and associated fungi drive long-term carbon sequestration in boreal forest. Science (New York, N.Y.), 339, 1615-1618.

COHEN, J. E. & STEPHENS, D. W. 1978. Food webs and niche space, Princeton University Press.

COLE, C. V., ELLIOTT, E. T., HUNT, H. W. & COLEMAN, D. C. 1977. Trophic interactions in soils as they affect energy and nutrient dynamics. V. Phosphorus transformations. Microbial Ecology, 4, 373–380.

CRESSLER, C. E., GRAHAM, A. L. & DAY, T. 2015. Evolution of hosts paying manifold costs of defence. Proceedings of the Royal Society of London B: Biological Sciences, 282, 20150065.

CROWTHER, T. W., BODDY, L. & JONES, H. T. 2011. Species-specific effects of soil fauna on fungal foraging and decomposition. Oecologia, 167, 535-545.

DANTAS, V. D. L. & PAUSAS, J. G. 2013. The lanky and the corky: fire-escape strategies in savanna woody species. Journal of Ecology, 101, 1265-1272.

DAUFRESNE, T. & LOREAU, M. 2001. Ecological stoichiometry, primary producer– decomposer interactions, and ecosystem persistence. Ecology, 82, 3069-3082.

DE VRIES, F. T., THÉBAULT, E., LIIRI, M., BIRKHOFER, K., TSIAFOULI, M. A., BJØRNLUND, L., JØRGENSEN, H. B., BRADY, M. V., CHRISTENSEN, S. & DE RUITER, P. C. 2013. Soil food web properties explain ecosystem services across European land use systems. Proceedings of the National Academy of Sciences, 110, 14296-14301.

DELAUX, P.-M. M., XIE, X., TIMME, R. E., PUECH-PAGES, V., DUNAND, C., LECOMPTE, E., DELWICHE, C. F., YONEYAMA, K., BÉCARD, G. & SÉJALON- DELMAS, N. 2012. Origin of strigolactones in the green lineage. The New phytologist, 195, 857-871.

DINNO, A., & DINNO, M. A. (2017). Package ‘dunn. test’.

DENMEAD, O. & SHAW, R. H. 1962. Availability of soil water to plants as affected by soil moisture content and meteorological conditions. Agronomy journal, 54, 385-390.

DOSSA, G. G., PAUDEL, E., CAO, K., SCHAEFER, D. & HARRISON, R. D. 2016. Factors controlling bark decomposition and its role in wood decomposition in five tropical tree species. Scientific reports, 6, 34153.

DUCHICELA, J., SULLIVAN, T. S., BONTTI, E. & BEVER, J. D. 2013. Soil aggregate stability increase is strongly related to fungal community succession along an abandoned agricultural field chronosequence in the Bolivian Altiplano. Journal of Applied Ecology, 50, 1266-1273.

EISENHAUER, N., DOBIES, T., CESARZ, S., HOBBIE, S. E., MEYER, R. J., WORM, K. & REICH, P. B. 2013. Plant diversity effects on soil food webs are stronger than those of elevated CO2 and N deposition in a long-term grassland experiment. Proceedings of the National Academy of Sciences, 110, 6889-6894.

ELTON, C. 1935. Population Theories. JSTOR.

FATH, B. D. & KILLIAN, M. C. 2007. The relevance of ecological pyramids in community assemblages. Ecological Modelling, 208, 286-294.

FROST, C. J. & HUNTER, M. D. 2004. Insect canopy herbivory and frass deposition affect soil nutrient dynamics and export in oak mesocosms. Ecology, 85, 3335-3347.

GAUSE, G. 1935. Experimental demonstration of Volterra's periodic oscillations in the numbers of animals. Journal of Experimental Biology, 12, 44-48.

GIANINAZZI-PEARSON, V., DU-GAUDOT, E., GOLLOTTE, A., ALAOUI, T. A. & GIANINAZZI, S. 1996. Cellular and molecular defence-related root responses to invasion by arbuscular mycorrhizal fungi. New Phytologist, 133, 45-57.

GIESLER, R., HÖGBERG, M. N., STROBEL, B. W., RICHTER, A., NORDGREN, A. & HÖGBERG, P. 2007. Production of dissolved organic carbon and low-molecular weight organic acids in soil solution driven by recent tree photosynthate. Biogeochemistry, 84, 1-12.

GIRDEN, E. R. (1992). ANOVA: Repeated measures (No. 84). Sage

GOOD, P. (2009). Robustness of Pearson correlation. Interstat, 15(5), 1-6.

HAIRSTON JR, N. G. & HAIRSTON SR, N. G. 1993. Cause-effect relationships in energy flow, trophic structure, and interspecific interactions. American Naturalist, 379-411.

HANSEN, R. A. 1999. Red oak litter promotes a microarthropod functional group that accelerates its decomposition. Plant and Soil, 209, 37-45.

HARKIN, J. M. & ROWE, J. W. 1971. Bark and its possible uses. (Research note FPL; 091): 56 p., 91.

HARRISON, M. J. 2005. Signaling in the arbuscular mycorrhizal symbiosis. Annual review of microbiology, 59, 19-42.

HILDEBRANDT, U., REGVAR, M. & BOTHE, H. 2007. Arbuscular mycorrhiza and heavy metal tolerance. Phytochemistry, 68, 139-146.

HOLTON, M. K., LINDROTH, R. L. & NORDHEIM, E. V. 2003. Foliar quality influences tree-herbivore-parasitoid interactions: effects of elevated CO 2, O 3, and plant genotype. Oecologia, 137, 233-244.

HOTHORN, T., BRETZ, F., & WESTFALL, P. (2008). Simultaneous inference in general parametric models. Biometrical Journal, 50, 346–363.

JACKSON, R. B., MOONEY, H. A. & SCHULZE, E. D. 1997. A global budget for fine root biomass, surface area, and nutrient contents. Proceedings of the National Academy of Sciences, 94, 7362-7366.

JAKOBSEN, I., ABBOTT, L. & ROBSON, A. 1992. External hyphae of vesicular-arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. New Phytologist, 120, 371- 380.

JAKOBSEN, I. & ROSENDAHL, L. 1990. Carbon flow into soil and external hyphae from roots of mycorrhizal cucumber plants. New Phytologist, 115, 77-83.

JIA, B., ZHOU, G., WANG, F., WANG, Y., YUAN, W. & ZHOU, L. 2006. Partitioning root and microbial contributions to soil respiration in Leymus chinensis populations. Soil Biology and Biochemistry, 38, 653-660.

KAYE, J. P. & HART, S. C. 1997. Competition for nitrogen between plants and soil microorganisms. Trends in Ecology & Evolution, 12, 139-143.

KELTING, D. L., BURGER, J. A. & EDWARDS, G. S. 1998. Estimating root respiration, microbial respiration in the rhizosphere, and root-free soil respiration in forest soils. Soil Biology and Biochemistry, 30, 961-968.

KIELAK, A. M., SCHEUBLIN, T. R., MENDES, L. W., VAN VEEN, J. A. & KURAMAE, E. E. 2016. Bacterial Community Succession in Pine-Wood Decomposition. Frontiers in microbiology, 7, 231.

KIØRBOE, T., SAIZ, E. & VIITASALO, M. 1996. Prey switching behaviour in the planktonic copepod Acartia tonsa. Marine Ecology-Progress Series, 143, 65-75.

KOHLER, A., KUO, A., NAGY, L. G., MORIN, E., BARRY, K. W., BUSCOT, F., CANBACK, B., CHOI, C., CICHOCKI, N., CLUM, A., COLPAERT, J., COPELAND, A., COSTA, M. D., DORE, J., FLOUDAS, D., GAY, G., GIRLANDA, M., HENRISSAT, B., HERRMANN, S., HESS, J., HOGBERG, N., JOHANSSON, T., KHOUJA, H.-R., LABUTTI, K., LAHRMANN, U., LEVASSEUR, A., LINDQUIST, E. A., LIPZEN, A., MARMEISSE, R., MARTINO, E., MURAT, C., NGAN, C. Y., NEHLS, U., PLETT, J. M., PRINGLE, A., OHM, R. A., PEROTTO, S., PETER, M., RILEY, R., RINEAU, F., RUYTINX, J., SALAMOV, A., SHAH, F., SUN, H., TARKKA, M., TRITT, A., VENEAULT-FOURREY, C., ZUCCARO, A., MYCORRHIZAL GENOMICS INITIATIVE, C., TUNLID, A., GRIGORIEV, I. V., HIBBETT, D. S. & MARTIN, F. 2015. Convergent losses of decay mechanisms and rapid turnover of symbiosis genes in mycorrhizal mutualists. Nature Genetics, 47, 410-415.

LEIFHEIT, E. F., VERBRUGGEN, E. & RILLIG, M. C. 2015. Arbuscular mycorrhizal fungi reduce decomposition of woody plant litter while increasing soil aggregation. Soil Biology and Biochemistry, 81, 323-328.

LIN, S. Y. H., TRUMBLE, J. T. & KUMAMOTO, J. 1987. Activity of volatile compounds in glandular trichomes ofLycopersicon species against two insect herbivores. Journal of Chemical Ecology, 13, 837-850.

LINDAHL, B. J., STENLID, J. A. N., OLSSON, S. & FINLAY, R. 1999. Translocation of 32 P between interacting mycelia of a wood-decomposing fungus and ectomycorrhizal fungi in microcosm systems. New Phytologist, 144, 183-193.

MALIK, R. J. 2018. Recent Trend: Is the Role of Arbuscular Mycorrhizal Fungi in Plant- Enemies Performance Biased by Taxon Usage? The American Midland Naturalist, 180, 306-312.

MARCZAK, L. B., THOMPSON, R. M. & RICHARDSON, J. S. 2007. Meta-analysis: trophic level, habitat, and productivity shape the food web effects of resource subsidies. Ecology, 88, 140-148.

MARSCHNER, H. & DELL, B. 1994. Nutrient uptake in mycorrhizal symbiosis. Plant and soil, 159, 89-102.

MCLEAN, M. A., MIGGE-KLEIAN, S. & PARKINSON, D. 2006. Earthworm invasions of ecosystems devoid of earthworms: effects on soil microbes. Biological invasions, 8(6), 1257-1273

MELILLO, J. M., ABER, J. D. & MURATORE, J. F. 1982. Nitrogen and lignin control of hardwood leaf litter decomposition dynamics. Ecology, 63, 621-626.

MOORE, J. C., BERLOW, E. L., COLEMAN, D. C., DE RUITER, P. C., DONG, Q., HASTINGS, A., JOHNSON, N. C., MCCANN, K. S., MELVILLE, K. & MORIN, P. J. 2004. Detritus, trophic dynamics and biodiversity. Ecology letters, 7, 584-600.

MOORE, J. C., MCCANN, K., SETÄLÄ, H. & DE RUITER, P. C. 2003. Top-down is bottom-up: does predation in the rhizosphere regulate aboveground dynamics? Ecology, 84, 846-857.

MULLICK, D. B. 1977. The non-specific nature of defense in bark and wood during wounding, insect and pathogen attack. The structure, biosynthesis, and degradation of wood. (pp. 395-441). Springer, Boston, MA

NAIR, A., KOLET, S. P., THULASIRAM, H. V. & BHARGAVA, S. 2014. Systemic jasmonic acid modulation in mycorrhizal tomato plants and its role in induced resistance against Alternaria alternata. Plant Biology, 17(3), 625-631

NAKANO, S., MIYASAKA, H. & KUHARA, N. 1999. Terrestrial–aquatic linkages: riparian arthropod inputs alter trophic cascades in a stream food web. Ecology, 80, 2435- 2441.

NOGUEIRA, M. A., CARDOSO, E. & HAMPP, R. 2002. Manganese toxicity and callose deposition in leaves are attenuated in mycorrhizal soybean. Plant and soil, 246(1), 1-10.

OEHL, F., SIEVERDING, E., PALENZUELA, J. & INEICHEN, K. 2011. Advances in Glomeromycota taxonomy and classification. IMA fungus, 2, 191-199.

OSTFELD, R. S. 1982. Foraging strategies and prey switching in the California sea otter. Oecologia, 53, 170-178.

PAINE, R. T. 1966. Food web complexity and species diversity. The American Naturalist, 100, 65-75.

PAINE, R. T. 1980. Food webs: linkage, interaction strength and community infrastructure. The Journal of Animal Ecology, 667-685.

PAUDEL, S., LONGCORE, T., MACDONALD, B., MCCORMICK, M. K., SZLAVECZ, K., WILSON, G. W. T. & LOSS, S. R. 2016. Belowground interactions with aboveground consequences: Invasive earthworms and arbuscular mycorrhizal fungi. Ecology, 97, 605- 614.

PEARCE, R. 1996. Antimicrobial defences in the wood of living trees. New Phytologist, 132, 203-233.

PHILIPPOT, L., RAAIJMAKERS, J. M., LEMANCEAU, P. & VAN DER PUTTEN, W. H. 2013. Going back to the roots: the microbial ecology of the rhizosphere. Nature Reviews Microbiology, 11, 789-799.

POELMAN, E. H., BRUINSMA, M., ZHU, F., WELDEGERGIS, B. T., BOURSAULT, A. E., JONGEMA, Y., VAN LOON, J. J., VET, L. E., HARVEY, J. A. & DICKE, M. 2012. Hyperparasitoids use herbivore-induced plant volatiles to locate their parasitoid host. PLoS Biol, 10, e1001435.

RABATIN, S. & STINNER, B. 1988. Indirect effects of interactions between VAM fungi and soil-inhabiting invertebrates on plant processes. Agriculture, ecosystems & environment, 24, 135-146.

REDECKER, D., KODNER, R. & GRAHAM, L. E. 2000. Glomalean fungi from the Ordovician. Science, 289, 1920-1921.

REDECKER, D., SCHÜßLER, A., STOCKINGER, H., STÜRMER, S. L., MORTON, J. B. & WALKER, C. 2013. An evidence-based consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota). Mycorrhiza, 23, 515-531.

REYNOLDS, H. L., PACKER, A., BEVER, J. D. & CLAY, K. 2003. Grassroots ecology: plant-microbe-soil interactions as drivers of plant community structure and dynamics. Ecology, 84, 2281-2291.

RICHARDSON, D. M. 2011. Fifty years of invasion ecology: the legacy of Charles Elton, John Wiley & Sons.

RIEDE, J. O., BROSE, U., EBENMAN, B., JACOB, U., THOMPSON, R., TOWNSEND, C. R. & JONSSON, T. 2011. Stepping in Elton’s footprints: a general scaling model for body masses and trophic levels across ecosystems. Ecology letters, 14, 169-178.

RILLIG, M. C., WRIGHT, S. F. & EVINER, V. T. 2002. The role of arbuscular mycorrhizal fungi and glomalin in soil aggregation: comparing effects of five plant species. The role of arbuscular mycorrhizal fungi and glomalin in soil aggregation: comparing effects of five plant species. Plant and Soil, 238(2), 325-333

SCHMIDT, M. W., TORN, M. S., ABIVEN, S., DITTMAR, T., GUGGENBERGER, G., JANSSENS, I. A., KLEBER, M., KÖGEL-KNABNER, I., LEHMANN, J. & MANNING, D. A. 2011. Persistence of soil organic matter as an ecosystem property. Nature, 478, 49.

SCHÜΒLER, A., SCHWARZOTT, D. & WALKER, C. 2001. A new fungal phylum, the Glomeromycota: phylogeny and evolution** Dedicated to Manfred Kluge (Technische Universität Darmstadt) on the occasion of his retirement. Mycological research, 105, 1413- 1421.

SIKES, B. A., COTTENIE, K. & KLIRONOMOS, J. N. 2009. Plant and fungal identity determines pathogen protection of plant roots by arbuscular mycorrhizas. Journal of Ecology, 97, 1274–1280.

SONG, Y., ZENG, R., XU, J., LI, J., SHEN, X. & YIHDEGO, W. 2010. Interplant Communication of Tomato Plants through Underground Common Mycorrhizal Networks. PLoS ONE, 5.

TALLAMY, D. W., BALLARD, M. & D'AMICO, V. 2010. Can alien plants support generalist insect herbivores? Biological invasions, 12, 2285-2292

THALER, J. S. 1999. Jasmonate-inducible plant defences cause increased parasitism of herbivores. Nature, 399, 686.

THOMPSON, J. N. 2014. Interaction and coevolution, University of Chicago Press.

TRAPPE, J. & SAFIR, G. 1987. Ecophysiology of VA mycorrhizal plants.

TROJANOWSKI, J., HAIDER, K. & HÜTTERMANN, A. 1984. Decomposition of 14 C- labelled lignin, holocellulose and lignocellulose by mycorrhizal fungi. Archives of Microbiology, 139, 202-206.

TUOMI, M., LAIHO, R., REPO, A. & LISKI, J. 2011. Wood decomposition model for boreal forests. Ecological Modelling, 222, 709-718.

VAN DER MEIJDEN, E. Plant defence, an evolutionary dilemma: contrasting effects of (specialist and generalist) herbivores and natural enemies. Proceedings of the 9th International Symposium on Insect-Plant Relationships, 1996. Springer, 307-310.

VITOUSEK, P. M. 1984. Litterfall, nutrient cycling, and nutrient limitation in tropical forests. Ecology, 65, 285-298.

WANG, B. & QIU, Y.-L. 2006. Phylogenetic distribution and evolution of mycorrhizas in land plants. Mycorrhiza, 16, 299-363.

WANG, E., YU, N., BANO, S. A., LIU, C., MILLER, A. J., COUSINS, D., ZHANG, X., RATET, P., TADEGE, M., MYSORE, K. S., DOWNIE, J. A., MURRAY, J. D., OLDROYD, G. E. & SCHULTZE, M. 2014. A H+-ATPase That Energizes Nutrient Uptake during Mycorrhizal Symbioses in Rice and Medicago truncatula. The Plant cell, 26, 1818-1830.

WARDLE, D. & YEATES, G. 1993. The dual importance of competition and predation as regulatory forces in terrestrial ecosystems: evidence from decomposer food-webs. Oecologia, 93, 303-306.

WU, Q.-S. S. & XIA, R.-X. X. 2006. Arbuscular mycorrhizal fungi influence growth, osmotic adjustment and photosynthesis of citrus under well-watered and water stress conditions. Journal of plant physiology, 163, 417-425.

YUANJING, L., ZHILEI, L., HONGYAN, H., HONG, L., XIANCAN, Z., XUHUI, L., XINGYUAN, H. & CHUNJIE, T. 2013. Arbuscular mycorrhizal fungi-enhanced resistance against Phytophthora sojae infection on soybean leaves is mediated by a network involving hydrogen peroxide, jasmonic acid, and the metabolism of carbon and nitrogen. Acta Physiologiae Plantarum.

ZAS, R., MOREIRA, X. & SAMPEDRO, L. 2011. Tolerance and induced resistance in a native and an exotic pine species: relevant traits for invasion ecology. Journal of Ecology, 99, 1316-1326.

Chapter 1: Recent Trend, is the Role of Arbuscular Mycorrhizal Fungi in Plant-Enemies

Performance Biased by Taxon Usage?

Malik, R. J. (10/2018). Recent Trend: Is the Role of Arbuscular Mycorrhizal Fungi

in Plant-Enemies Performance Biased by Taxon Usage? The American Midland

Naturalist. 2018 Oct;180(2):306-12

Abstract

The potential for arbuscular mycorrhizal (AM) fungi to confer resistance and provide bioprotection against plant pests and pathogens is intriguing to biologists studying at many levels of biological organization, including the organismal, population, and community levels. In recent years, there has been a growing trend to experimentally test the role of AM-fungi in plant-enemy performance. Yet, it remains unclear whether taxon usage in these studies are biasing the results. Here I conducted a survey, while strictly focusing on the effect of AM-fungi, with respect to plant-enemies performance. I found

25% of case studies did not observe a reduction in performance. Interestingly, 75% of studies featured a single AM-fungal taxon, as opposed to multiple taxa. What is even more compelling, 72% of studies featured Rhizophagus irregularis and Funneliformis mosseae. These findings demonstrate a lack of AM-fungal diversity in this area of research and a need for expansion in mycorrhizal taxon usage, to understand more fully the significance of mycorrhizal application in conferring bioprotection. It may be the case

24 that R. irregularis and F. mosseae are the most culturable or readily available, and this may be generating a bias.

1.1. Introduction

Arbuscular mycorrhizal (AM) fungi are monophyletic in origin, and are so far described as five orders, 29 genera, and 230 species (Oehl et al., 2011; Schubler et al., 2001;

Redecker et al.,). Multifunctional, these organisms are the subject of research conducted at both community and molecular levels (Bever et al.,2001; Harrison, 2004). AM-fungi can colonize plant roots and are mutually beneficial to plant hosts participating in carbon- resource exchange (Jakobsen and Rosendahl, 1990; Jakobsen et al.,1992; Wang et al.,2014).

While these fungi often enrich plant quality and nutritional value, mycorrhizal interactions can also induce gene expression patterns that resemble pathogen-associated responses (Jones and Dangl, 2006; Gianinazzi, 1996; Pearson et al.,1996). Consequently, appressorium formation or initial contact between mycorrhizae and plant host may upregulate a myriad of plant defenses (Harrison, 1998; Genre et al.,2008). As chitin is evolutionary conserved among fungi (Lenardon et al.,2010; Bonfante-Fasolo et al.,1990) and exposure to AM-fungi has the potential to prime defenses and confer resistance toward natural enemies (Jung et al.,2012; Campos-Soriano et al.,2012; Zipfel, 2014). While this may seem promising, especially as it relates to bioprotection, discrepancies in mycorrhizal taxa usage maybe biasing this area of research. Biases may be generated from redundancy in taxon usage.

Plant enemies, including pests and pathogens, may be attracted to plants colonized by mycorrhizae given that mycorrhizal plants are often nutritionally enriched (Jakobsen et al.,1992; Bennett et al.,2005). As networks of mycorrhizal mycelia scavenge nitrogen and phosphorus (Hodge et al.,2001; Sanders and Tinker, 1973), these nutritional resources are then exchanged within the confines of plant root cortical cells (Blee and Anderson,

1998; Wang et al.,2014). Improving plant growth and nutritional uptake may improve a plant’s tolerance to natural enemies (Bennett and Bever, 2007; Feng et al.,2002; Middleton et al.,2015), but it may also lead to greater pathogen and herbivore exploitation. Prieto et al. (2016) observed when given a choice, myrid bug (Hemipteran) had a preference for plants colonized by AM-fungi. Meanwhile, Ronsheim (2016) revealed among Allium spp, the genotype that is most susceptible toward Sclerotium cepivorum, the causal agent of onion rot, received greater growth benefit from AM-fungi, in comparison to the genotype that showed resistance.

Although plant-enemies may exploit healthier hosts, mycorrhizal protection may still prevail (Bennett et al.,2006). Arbuscule formation has been shown to provide localized immunity against intracellular pathogens and root feeding herbivores (Pozo et al.,2002; Peña and Echeverría, 2006; Frew et al.,2017). Meanwhile, recent advances in sequence data analysis has shown that AM-fungi reduces pathogen abundance within roots and the corresponding rhizosphere (Jie et al.,2015; Qian et al.,2015). However, aboveground effects are not as straightforward, as systemic acquired resistance includes

27 bioprotection toward enemies antagonizing distal plant tissues (der Ent et al.,2009;

Pieterse et al.,2014; Pozo and Azc ́on-Aguilar, 2007). Considering the effects of a broad range of mycorrhizal taxa on plant-enemy outcomes may provide additional insight onto the robustness of mycorrhizae in systemic acquired resistance. It may be the case that our understanding of mycorrhizal influence on plant-enemy outcomes are limited by redundancy in mycorrhizal taxon usage, as researchers may be dependent on mycorrhizal cultures. For this reason, it is important to investigate taxon usage in this area of research.

1.2. Recent trends in taxon usage

A survey was conducted to determine the latest trends in mycorrhizal plant-enemy performance. The terms “Mycorrhiz* AND biocontrol OR insect OR pathogen OR nematode” were used for query in Google Scholar. Articles considered in this survey were published between 2014 and 2017 to uncover recent bioprotection trends. The survey included all articles reporting plant-enemy performance with respect to mycorrhizae (presence of AM-fungi) versus mycorrhizal control (absence of mycorrhizal fungi). Studies that reported plant tolerance to biotic stress, or trophic links that did not directly interact with the plant host, were not included in this survey. A total of 42 studies were identified in which herbivore, pathogen, or nematode performance was assessed in

28 the presence or absence of AM-fungi. The results revealed that mycorrhizae did not reduce plant-enemy performance in 25% of case studies. In addition, the majority of studies that quantified plant-enemy performance featured fungal pathogens or herbivores, while few studies featured viruses and bacterial pathogens. Interestingly,

75% of plant-enemy performance studies featured a single species of AM-fungi, and perhaps even more compelling is the observation that the majority of studies featured either Rhizophagus irregularis or Funneliformis mosseae (Fig. 1.21). Given that there are approximately 230 described species, it is compelling that only two make up the majority of case studies. This suggests the latest trends in mycorrhizal bioprotection may not be as robust as one might expect, due to redundancy in taxon usage.

Fig. 1.21. Recent trend in taxon usage among bioprotection studies.

Studies assessing plant-enemy performance were evaluated. All taxa nomenclature presented in this chart were updated according to INVAM and MycoBank.

1.3. Synthesis

1.31. Plant hormonal response to ‘plant-trophs’

While the role of AM-fungi in plant-herbivore interactions may depend on ecological context, realized bioprotection may also depend on feeding guild. Herbivores of a phloem feeding guild are likely to evade plant defenses, while chewers may be more vulnerable toward plant immune responses (Ali and Agrawal, 2012). For example, in

Plantago lanceolata, chewing herbivores were observed to induce secondary metabolites.

Meanwhile, phloem feeders were observed to down regulate these compounds (Sutter and Müller, 2011). This may relate to the fact that chewers induce the transcription of jasmomic acid-dependent genes, while phloem feeders are more likely to induce the transcription of salicylic acid-dependent genes (Heidel and Baldwin, 2004).

Among pathogens there is also a similar dichotomy with respect to trophic guild.

Biotrophic pathogens that effectively feed on living cells induce defense genes of the salicylic acid pathway, whereas necrotrophs that effectively feed on dead cells, induce defense genes of the jasmonic acid defense pathway (Spoel and Dong, 2008). These plant defense pathways may allow mycorrhizae to modulate resistance toward pathogens.

Rhizobacteria’s microbial-associated molecular patterns, including flagella and lipopolysaccharides, may elicit plant defenses and confer induced systemic resistance

(Van Weesetal.,2008). Similarly, AM-fungi may enable systemic acquired resistance by localizing PATHOGENESIS RELATED-1 protein to the site of pathogen attack (Cordier et al.,1998). By reducing the negative effect of pathogens at distal plant tissues, mycorrhizae may effectively facilitate bioprotection. However, the role of mycorrhizae in these interactions are a bit complex. As mycorrhizae may induce a plant’s salicylic acid- dependent genes during the initial stages of root colonization, but then relax its effect on this plant hormonal pathway, to then induce jasmonic acid–dependent genes during mature stages of colonization, including arbuscule formation (Pozo and Azcón-Aguilar

2007). This may suggest bioprotection provisioned by mycorrhizae may also depend on development and life-stage position.

1.32. Plant enemy response parameters

Among pathogens, change in density or transcript level may be an effective measure of plant enemy performance (Jie et al.,2015; Qian et al.,2015; Malik et al.,2016).

However, herbivores may be a bit more intricate. As herbivore growth rate, development time, consumption, mass, fecundity, survival, oviposition preference, plant damage, or density may all yield different outcomes with respect to bioprotection (Koricheva et al.,2009). For example, Bennett et al. (2016) found AM-fungi did not reduce density of a phloem feeder (aphid). Despite this, AM-fungi improved parasitoid attack on aphids via oviposition preference. This suggests if the parameter used to report plant-enemy

32 performance is parasitism, then the role of AM-fungi in bioprotection is validated, but if the parameter is aphid density, then bioprotection is not validated. Regardless of the specific measure utilized, the majority of recent studies support reduction in plant-enemy performance by AM-fungi, perhaps suggesting a promising role for AM-fungi in mediating tolerance or resistance toward plant enemies. However, there is still a need to expand these studies beyond single species of AM-fungi, as a way to determine potential synergistic and antagonistic relationships that may exist among AM-fungal combinations, especially as these relationships pertain to fungal communities. At the community level, species that provide bioprotection may be outcompeted by cheater taxa that do not provide protection. Competition effects may explain the observation by Malik et al. (2016), that Entrophospora infrequens provides bioprotection against foliar pathogen, but is ultimately outcompeted by F. mosseae, a nonprotective mycorrhizal taxon.

1.33. What may be explaining taxon usage?

Anthropogenic disturbances, including land cultivation and agricultural practices, may be limiting mycorrhizal biodiversity (Duchicela et al., 2013). As a result, altered soil physical properties due to agricultural practices may favor F. mosseae. This is supported by Helgason et al. (1998), which found F. mosseae is most abundant at agricultural sites, such that F. mosseae makes up 92% of OTU’s. Rosendahl et al. (2009) provides additional evidence that suggests F. mosseae’s range expansion and global distribution is attributed

33 to agriculture. Rhizophagus irregularis, another taxon that is often used in studies is also observed to be over-represented in agricultural soils with high clay content (Mathimaran et al., 2005). It may be the case that mycorrhizal taxa that experience the greatest taxon usage, also happen to be the taxa that benefit the most from land cultivation. F. mosseae and R. irregularis environmental abundances may also be attributed to their ability to outcompete other mycorrhizal taxa. Malik et al. (2016) showed that when Glycine max was inoculated with a mycorrhizal consortium that included F. mosseae, as well as three other mycorrhizal taxa (Entrophospora infrequens, Claroideoglomus claroideum, and Racocetra fulgida), sporulation was only detected for F. mosseae, suggesting that F. mosseae can compete effectively for plant resources that are necessary to promote its own abundance.

Similarly, co-inoculation with R. irregularis and Glomus aggregatum lead to greater R. irregularis intraradical and extraradical colonization (Engelmoer et al.,2014).

By de facto, R. irregularis, and F. mosseae may be mycorrhizal model organisms.

Despite the fact this classification is rarely used when referring to mycorrhizae. In addition, mycorrhizal taxon usage is rarely justified in article methodologies, this lack of justification may be due to a ‘snowball effect’, such that contemporary taxon usage is modelled off past taxon usage. Thereby, favoring the high usage rates of R. irregularis and

F. mosseae. Alternatively, this trend in taxon usage may be a technical issue, in that R. irregularis and F. mosseae may be the most culturable of the ~230 species of AM-fungi. If this is indeed the case, practical solutions for expanding culture collections may be to

34 classify species by their local environmental conditions. This may include soil moisture, heavy metals and native vegetation, but researchers should not only depend on what is commercially available.

The survey presented here suggests bioprotection studies are biased toward R. irregularis and F. mosseae (Fig. 1.21). Although it may be the case that these two species are most efficient at providing bioprotection, this generalization cannot be made without an increase in taxon usage, pairwise comparisons, and fungal community treatments.

Moving forward, studies in this area of research should draw conclusions based on multiple AM-fungal taxa and follow the approach of Sundram et al. (2015), which showed R. irregularis, a taxon of high usage rate (Fig. 1.21), reduces stem rot in tropical trees. Whereas Rhizophagus clarus (formerly Glomus clarum), a taxon of low usage rate, does not. The advantage of this approach is that generalizations about AM-fungi are not based on a single overrepresented taxon (Fig. 1.21). Therefore, studies addressing the role of AM-fungi in bioprotection should take into account multiple AM-fungal taxa to better understand mycorrhizal mediated effects on plant-enemy performance.

Acknowledgment

Penn State Button Waller Fellowship, and reviewers at The American Midland

Naturalist. Also, James D. Bever and Sidney L. Sturmer for taxonomic support. Also, thanks to Logan W. Cole for encouragement and helpful discussions.

References

ALI, J. G. AND A. A. AGRAWAL. 2012. Specialist versus generalist insect herbivores and plant defense. Trends Plant Sci., 17:293–302.

BENNETT, A. E., J. ALERS-GARCIA, AND J.D. BEVER. 2006. Three-way interactions among mutualistic mycorrhizal fungi, plants, and plant enemies: hypotheses and synthesis. Am. Nat., 167:141–152.

BENNETT, A. E., AND J.D. BEVER. 2007. Mycorrhizal species differentially alter plant growth and response to herbivory. Ecology, 88:210–218.

BENNETT, A. E., N.S. MILLAR, E. GEDROVICS, AND A.J. KARLEY. 2016. Plant and insect microbial symbionts alter the outcome of plant–herbivore–parasitoid interactions: implications for invaded, agricultural and natural systems. J. Ecol., 104:1734–1744.

BEVER, J. D., P.A. SCHULTZ, A. PRINGLE, AND J.B. MORTON. 2001. Arbuscular Mycorrhizal Fungi: More Diverse than Meets the Eye, and the Ecological Tale of Why. BioScience, 51:923.

BLEE, K. A. AND A.J. ANDERSON. 1998. Regulation of arbuscule formation by carbon in the plant. Plant J.,16:523–530.

BONFANTE-FASOLO, P., A. FACCIO, S. PEROTTO, AND A. SCHUBERT. 1990. Correlation between chitin distribution and cell wall morphology in the mycorrhizal fungus Glomus versiforme. Mycol. Res., 94:157–165.

CAMPOS-SORIANO, L., J. GARCIÁ-MARTINEZ, AND B. SAN SEGUNDO. 2012. The arbuscular mycorrhizal symbiosis promotes the systemic induction of regulatory defence-related genes in rice leaves and confers resistance to pathogen infection. Mol. Plant Pathol., 13:579–592.

CORDIER, C., M. J. POZO, J. M. BAREA, S. GIANINAZZI, AND V. GIANINAZZI- PEARSON. 1998. Cell Defense Responses Associated with Localized and Systemic Resistance to Phytophthora parasitica Induced in Tomato by an Arbuscular Mycorrhizal Fungus. Mol. Plant Microbe In., 11.

DER ENT, V. S., S.C.M. WEES, AND C.M.J. PIETERSE. 2009. Jasmonate signaling in plant interactions with resistance-inducing beneficial microbes. Phytochemistry, 70:1581–1588.

DUCHICELA, A. J., T.S. SULLIVAN, E. BONTTI, J.D. BEVER, AND S. WAN. 2013. Soil aggregate stability increase is strongly related to fungal community succession along an abandoned agricultural field chronosequence in the Bolivian Altiplano. J. Appl. Ecol., 50:1266–1273.

ENGELMOER, D. J. P., J.E. BEHM, AND E.T. KIERS. 2014. Intense competition between arbuscular mycorrhizal mutualists in an in vitro root microbiome negatively affects total fungal abundance. Mole. Ecol., 23:1584–1593.

FENG, G., F. ZHANG, X. LI, C. TIAN, C. TANG, AND Z. RENGEL. 2002. Improved tolerance of maize plants to salt stress by arbuscular mycorrhiza is related to higher accumulation of soluble sugars in roots. Mycorrhiza,12:185–190.

FREW, A., J.R. POWELL, I. HILTPOLD, P.G. ALLSOPP, N. SALLAM, AND S.N. JOHNSON. 2017. Host plant colonisation by arbuscular mycorrhizal fungi stimulates immune function whereas high root silicon concentrations diminish growth in a soil- dwelling herbivore. Soil Biol. Biochem., 112:117–126.

GENRE, A. M., M. CHABAUD, A. FACCIO, D.G. BARKER, AND P. BONFANTE. 2008. Prepenetration apparatus assembly precedes and predicts the colonization patterns of arbuscular mycorrhizal fungi within the root cortex of both Medicago truncatula and Daucus carota. Plant Cell, 20:1407–1420.

GIANINAZZI-PEARSON, V., E. DU-GAUDOT, A. GOLLOTTE, T.A. ALAOUI, AND S. GIANINAZZI. 1996. Cellular and molecular defence-related root responses to invasion by arbuscular mycorrhizal fungi. New Phytol., 133:45–57.

HARRISON, M. J. 1998. Development of the arbuscular mycorrhizal symbiosis. Curr. Opin. Plant Biol., 1:360–365.

HARRISON, M. J. 2004. Signaling in the arbuscular mycorrhizal symbiosis. Annul. Rev. Microbiol., 59:19–42.

HEIDEL, A. J. AND I.T. BALDWIN. 2004. Microarray analysis of salicylic acid- and jasmonic acid-signalling in responses of Nicotiana attenuata to attack by insects from multiple feeding guilds. Plant, Cell, Environ., 27:1362–1373.

HELGASON, T., T. J. DANIELL, R. HUSBAND, A.H. FITTER, AND J.P.W. YOUNG. 1998. Ploughing up the wood-wide web?Nature, 394:431.

HODGE, A., C.D. CAMPBELL, AND A.H. FITTER. 2001. An arbuscular mycorrhizal fungus accelerates decomposition and acquires nitrogen directly from organic material. Nature, 413:297–299.

JAKOBSEN, I., L. ABBOTT, AND A. ROBSON. 1992. External hyphae of vesicular- arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. New Phytol., 120:371–380.

JAKOBSEN, I., AND L. ROSENDAHL. 1990. Carbon flow into soil and external hyphae from roots of mycorrhizal cucumber plants. New Phytol., 115:77–83.

JIE, W., L. BAI, W. YU, AND B. CAI. 2015. Analysis of interspecific relationships between Funneliformis mosseae and Fusarium oxysporum in the continuous cropping of soybean rhizosphere soil during the branching period. Biocontrol Sci. Tech., 25, 1036–1051.

JONES, J.D. AND J.LDANGL. 2006. The plant immune system. Nature, 444:323–329.

JUNG, S. C., A. MARTINEZ-MEDINA, J.A. LOPEZ-RAEZ, AND M.J. POZO. 2012. Mycorrhiza-induced resistance and priming of plant defenses. J. Chem. Ecol., 38:651–664.

KORICHEVA, J., A.C. GANGE, AND T. JONES. 2009. Effects of mycorrhizal fungi on insect herbivores: a meta analysis. Ecology, 90:2088–2097.

LENARDON, M. D., C.A. MUNRO, AND N.A. GOW. 2010. Chitin synthesis and fungal pathogenesis. Curr. Opin. Microbiol., 13:416–423.

MALIK, R. J., M.H. DIXON, AND J.D. BEVER. 2016. Mycorrhizal composition can predict foliar pathogen colonization in soybean. Biol. Control, 103:46–53.

MATHIMARANN., R. RUH, P. VULLIOUD, E. FROSSARD, AND J. JANSA. 2005. Glomus intraradices dominates arbuscular mycorrhizal communities in a heavy textured agricultural soil. Mycorrhiza, 16:61–66.

MIDDLETON, E. L., S. RICHARDSON, L. KOZIO, C.E. PALMER, Z. YERMAKOV, J.A. HENNING, P.A. SCHULTZ, AND J.D. BEVER. 2015. Locally adapted arbuscular mycorrhizal fungi improve vigor and resistance to herbivory of native prairie plant species. Ecosphere, 6:1–16.

OEHL, F., E. SIEVERDING, J. PALENZUELA, AND K. INEICHEN. 2011. Advances in Glomeromycota taxonomy and classification. IMA fungus, 2:191–199.

Peña, D. E. and S.R. Echeverría. 2006. Mechanism of control of root-feeding nematodes by mycorrhizal fungi in the dune grass Ammophila arenaria. New Phytol., 169:829–840.

PIETERSE, C. M., C. ZAMIOUDIS, R.L. BERENDSEN, D.M. WELLER, S.C. VAN WEES, AND P.A. BAKKER. 2014. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol., 52:347–375.

POZO, M. J., AND C. AZCÓN-AGUILAR. 2007. Unraveling mycorrhiza-induced resistance. Curr. Opin. Plant Biol.,10:393–398.

POZO, M. J., C. CORDIER, E. DUMAS-GAUDOT, S. GIANINAZZI, J.M. BAREA, AND C. AZCON-AGUILAR. 2002. Localized versus systemic effect of arbuscular mycorrhizal fungi on defence responses to Phytophthora infection in tomato plants. J. Exp. Bot., 53:525–534.

PRIETO, J. D., C. CASTANE, C. CALVET, A. CAMPRUBI, D. BATTAGLIA, V. TROTTA, AND P. FANTI. 2016. Tomato belowground–aboveground interactions: Rhizophagus irregularis affects foraging behavior and life history traits of the predator Macrolophus pygmaeus (Hemiptera: Miridae). Arthropod-Plant Inte., 1–8.

QIAN, L., W.J. YU, J. Q. CUI, W. G. JIE, AND B.Y. CAI. 2015. Funneliformis mosseae affects the root rot pathogen Fusarium oxysporum in soybeans. Acta Agric. Scand. B., 65:321–328.

REDECKER, D., A. SCHUBLER, H. STOCKINGER, S.L. STURMER, J.B. MORTON, AND C. WALKER. 2013. An evidence-based consensus for the classification of arbuscular mycorrhizal fungi (Glomeromycota). Mycorrhiza, 23:515–531.

RONSHEIM, M. L. 2016. Plant Genotype Influences Mycorrhiza Benefits and Susceptibility to a Soil Pathogen. Am. Midl. Nat., 175:103–112.

ROSENDAHL, S., P. MCGEE, AND J. B. MORTON. 2009. Lack of global population genetic differentiation in the arbuscular mycorrhizal fungus Glomus mosseae suggests a recent range expansion which may have coincided with the spread of agriculture. Mole. ecol., 18:4316–4329.

SANDERS, F. E. AND B. P. TINKER. 1973. Phosphate flow into mycorrhizal roots. Pesticide Sci., 4:385–395.

SCHUBLER, A., D. SCHWARZOTT, AND C. WALKER. 2001. A new fungal phylum, the Glomeromycota: phylogeny and evolution** Dedicated to Manfred Kluge (Technische Universität Darmstadt) on the occasion of his retirement. Mycol. Res., 105:1413–1421.

SPOEL, S. H. AND X. DONG. 2008. Making sense of hormone crosstalk during plant immune responses. Cell Host Microbe, 3:348–351.

SUNDRAM, S., S. MEON, I.A. SEMAN, AND R. OTHMAN. 2015. Application of arbuscular mycorrhizal fungi with Pseudomonas aeruginosa UPMP3 reduces the development of Ganoderma basal stem rot disease in oil palm seedlings. Mycorrhiza, 25:387–397.

SUTTER, R. AND C. MÜLLER. 2011. Mining for treatment-specific and general changes in target compounds and metabolic fingerprints in response to herbivory and phytohormones in Plantago lanceolata. New Phytol., 191:1069–1082.

VAN WEES, S. C., S. VAN DER ENT, AND C.M. PIETERSE. 2008. Plant immune responses triggered by beneficial microbes. Curr. Opin. Plant Biol., 11:443–448.

WANG, E., N. YU, S.A. BANO, C. LIU, A.J. D. MILLER, X. COUSINS, X. ZHANG, P. RATET, TADEGE, M. S. MYSORE, J.A. DOWNIE, J.D. MURRAY, G.E. OLDROYD, AND M. SCHULTZE. 2014. A H+-ATPase That Energizes Nutrient Uptake during Mycorrhizal Symbioses in Rice and Medicago truncatula. Plant Cell, 26:1818–1830. ZIPFEL, C. 2014. Plant pattern-recognition receptors. Trends Immunol., 35:345–351.

Chapter 2: Mycorrhizal composition influences plant anatomical defense and impacts herbivore growth and survival in a life-stage dependent manner

Malik, R. J. et al. (01/2018) Mycorrhizal composition influences plant anatomical defense and impacts herbivore growth and survival in a life-stage dependent manner.

Pedobiologia. 2018 Jan 1; 66:29-35.

Abstract

While arbuscular mycorrhizal (AM) fungi may have a prominent role in trophic ecology, mycorrhizal improvement or reduction on herbivore growth and survival may also be dependent on herbivore’s stage of development. Solanum lycopersicum (tomato) was grown on sterile background soil treated with either mycorrhizal inoculant (AM+) or non-mycorrhizal control (AM−). Mycorrhizal treatments included four single species of AM-fungi (Entrophospora infrequens, Funneliformis mosseae, Claroideoglomus claroideum, and Racocetra fulgida) and a mixture of all four species (fungal community). To determine if mycorrhizal treatment indirectly alters the ability of beetle larvae (Leptinotarsa decemlineata) to access plant resources, plant damage and trichome density were quantified as plants were infested with a single neonate (early-stage) for 96 hours (h). In a second experiment, beetle growth rate was assessed as plants were infested with a single third-instar (late-stage). After 72 h of late-stage beetle infestation, beetle mass was measured. It was found that early-stage beetles inflicted more damage on AM+ tomatoes.

Interestingly, this corresponds with fewer trichomes on AM+ tomatoes, as well as higher

42 early-stage beetle survivorship. Specifically, AM taxon, C. claroideum increases herbivory and thereby reduces beetle mortality. Among late-stage beetles, C. claroideum does not improve beetle growth nor rate of survival. This suggests that AM taxa that are beneficial to early-stage beetles may not necessarily provide an advantage to late-stage beetles.

Taken together, these findings highlight potential dependencies of AM-fungal effects on herbivory and herbivore life history, including growth and life-stage specific survival.

2.1. Introduction

While ecological communities are at risk of restructuring due change in species composition and food web dynamics (Brault and Bourget, 1985; Myers et al., 2007; Smith-

Ramesh, 2017; Závada et al., 2017), biotic factors influencing community interactions remain vital to a sustainable ecosystem (Hairston et al., 1960; Paine, 1966; Moore et al.,

2004; Mouillot et al., 2013). In terrestrial systems, plant quality, or nutritional value, indirectly influence higher trophic classes (Bukovinszky et al., 2008; Gange and West,

1994). At the same time, plants are impacted by soil organisms that inhabit the root-soil interface (Reynolds et al., 2003; Wagg et al., 2014). Root colonizing fungi, termed arbuscular mycorrhizae (AM), play a pivotal role in trophic interactions, as they can enhance nutritional value of specific resources and impact ecosystem function (Wilson et al., 2009; Bardgett and Van Der Putten, 2014). Through phosphorous enrichment, AM- fungi can sway multiple nutrient economies of multiple trophic links (Hoffmannet al.,

2011), which may improve herbivore growth and survival (Borowicz, 1997).

Alternatively, AM-fungi may increase plant defense allocation, since enriching the carbon-nutrient balance may make defense budgeting less costly (Gange and West, 1994;

Bennett et al.,2006). The first line of plant defense includes volatile organic compounds, the plant cell wall and epidermal protuberances known as trichomes (Dalin et al., 2008;

Pozo et al., 2002; Huang et al., 2012). Although trichome density can deter herbivores

(Sato and Kudoh,2017), it is possible that the efficacy of these structures may also depend on herbivore age or development stage.

Determining ways in which AM-fungi can influence herbivory at discrete stages of development may provide additional insight into the role of AM-fungi as it pertains to trophic ecology. As a strong trophic link (Paine, 1980), AM-fungi have the indirect ability to influence pollination, plant-dormancy, nutrient cycles, and even the development rate of holometabolous insects (Barber et al., 2013; Wilson et al., 2009; Rock-

Blake et al., 2017; Vannette and Hunter, 2013). For example, the indirect ability of AM- fungi to increase caterpillar’s growth rate (Vannette and Hunter, 2013) has broad implications as it pertains to food web dynamics. Hence, insect retention period in a particular stage-class may result in vulnerability toward predators or parasitoids that specialize on that particular stage-class (Murdoch et al., 1987). Thus, the ability of AM- fungi to indirectly alter the rate of insect development may relax predation and parasitization pressures. Similarly, plant-age can affect resistance or tolerance to natural enemies, including herbivores (Kearsley and Whitham, 1989; Kus et al., 2002), due to greater densities of trichomes on young leaf tissue as opposed to mature leaf tissue

(Woodman and Fernandes, 1991; Levin, 1973). Meanwhile, the efficacy of these structures may be strengthened or weakened by select AM-fungal communities.

Though AM-fungal associations can result in plant nutritional enhancement

(Jakobsen et al., 1992), colonization of plant roots by AM-fungi can yield induced

45 systemic resistance (ISR) via upregulation of plant defenses (Pieterse et al., 2014; Cameron et al., 2013; Campos-Soriano et al., 2012; Jung et al., 2012). This altered plant physiological state can also enhance density independent mortality, also known as hard selection

(Wallace, 1975; Wade, 1985). Hence, upregulation of a given plant defense pathway (i.e. salicylic acid), may prove to be less effective toward a herbivore or a pathogen that is normally deterred by an antagonistic plant defense pathway (i.e. jasmonic acid) (Rojo et al.,2003; Pozo and Azcón-Aguilar, 2007; Campos-Soriano et al., 2012; Wang et al., 2015).

For example, AM-fungal colonization increases myrid bug (Hemipteran) performance and survivorship on tomato (Prieto et al., 2016), but when tomato was challenged with beet armyworm (Lepidopteran), AM-fungi lessened herbivore performance (Shrivastava et al.,

2015). These examples demonstrate the inconsistencies of ISR. With respect to AM-fungi and foliar pathogen interaction, AM-fungal spp., Rhizophagus irregularis has been reported to exacerbate disease symptoms in plants challenged with Botrytis cinera and tobacco mosaic virus (Shaul et al., 1999), while in another study, AM-fungal spp.

Funneliformis mosseae was found to mitigate disease symptoms of plants challenged with cucumber mosaic virus (Elsharkawy et al., 2012).

To date, studies addressing the role of AM-fungi in trophic dynamics support the importance of resource provisioning as a means of influencing plant enemy interactions

(Borowicz,1997; Bennett et al., 2006; Malik et al., 2016). Applied studies have focused on identifying AM-fungal isolates that mediate bioprotection (Sowik et al., 2016; Spagnoletti

46 et al., 2016; Tchabi et al., 2016; Yuan et al., 2016; Sharma and Sharma, 2016; Mustafa et al.,

2016). Though these studies have contributed to our understanding of the role of AM- fungi in plant enemy interactions, very few studies have characterized the differences that may exist when mycorrhizal plants interact with herbivores of two stages of development. Understanding these stage-class interactions can provide insight into life- stage specific trophic dynamics.

In this study, we sought to determine whether AM-fungi affect early or late-stage

Colorado potato beetle’s (Leptinotarsa decemlineata) life history, as development stage is related to maturation and self-replacement. Here, the following questions are posed (1)

Does AM-fungi influence survivorship of early-stage Colorado potato beetle (neonate);(2) can AM-fungi alter the growth rate of late-stage Colorado potato beetle, that has yet to reach adulthood (third instar) (3); if so, can these outcomes be explained by the indirect effect of AM-fungi on trichomes? It is hypothesized that the indirect effect of AM-fungi on trichomes and phytochemical balance will impact lesser-sized neonates. Meanwhile, improvement of plant quality through AM-fungal nutrient provisioning will indirectly increase the growth rate of larger third instars.

2.2. Methods

2.21. Study system

Solanum lycopersicum (tomato) was the host plant used in this study, primarily because of susceptibility to defoliation by Colorado potato beetle, Leptinotarsa decemlineata, (Coleoptera: Chrysomelidae). These beetles are native to Mexico, but have expanded their range throughout the United States and into Europe and Asia (Alyokhin,

2009). As herbivores, these beetles are oligophagous and specialize on family Solanaceae.

Colorado potato beetle damage is most severe following adult emergence and maternal ovipositioning (Hare, 1980). This makes Solanaceae plants most vulnerable toward beetles of multiple stage-classes, and warrants the basis of our stage-class trophic interaction study.

The four species of AM-fungi chosen in this study (E. infrequens, F.mosseae, C. claroideum, and R. fulgida) were previously isolated from Kankakee Sands prairie reserve in Indiana, U.S.A. Species identity was previously confirmed morphologically, and with next generation sequencing technology. In addition, these isolates were worthy candidates because of comparable levels of colonization (Vogelsang et al.,2006) and they are representative of the phylogenetic and genetic diversity of AM-fungi (House et al.,

2016; Krüger et al., 2012).

Prior to the experiment, fungal cultures were prepared and bulked on sorghum roots for a full growing season under glasshouse conditions. Sorghum was chosen because it has been previously observed by our research group to promote high spore yield. Mycorrhizal cultures were harvested following senescence of sorghum, which enhanced mycorrhizal sporulation. Aboveground sorghum tissue was then removed, while the belowground soil and mycorrhizal root mix was stored at 4 °C prior to use.

Similar to Malik et al. (2016), 50 cm3 of fungal spores and sorghum root mix were placed between 450 cm3 of heat sterile back-ground soil (Pennsylvania clay-loam: sand (1:1)). It is not believed this procedure promoted any significant nutritional difference, since the inoculum is made of similar proportions of clay: loam: sand. At any rate, sand was added to improve drainage in pots and reduce nutrient levels, while increasing plant functional response to AM-fungi. Pot dimensions were 10.8 cm2 by 10.8 cm in height. Fungal community treatment included an even mixture of all four-fungal species. The control treatment was inoculated with bacteria present in the mycorrhizal inoculum. Similar to

Borowicz (1997), bacteria were isolated by washing AM-fungal inoculum through a 38

μm sieve. This fluid was subsequently filtered through Whatman glass fibers (0.7μm) to remove any remnant fungal structures that may have passage through the 38 μm sieve in the previous step. Thus, the filtered wash ensured that the control (AM−) was positive for bacteria but negative for fungi. AM– microbial wash was then applied to heat sterile control soils. After harvest, presence or absence of mycorrhizae was confirmed with

49 trypan blue staining, but colonization rate was not quantified since these species have been shown to have similar colonization capability by our research group (Vogelsang et al.,2006). Trypan blue staining was done for a subset of blocks to qualitatively confirm colonization (AM+) or non-colonization (AM−).

2.22. Primary consumer: Colorado potato beetle

Colorado potato beetles were isolated from potato fields of Pennsylvania (Chung et al., 2013b). Similar to Chung and Felton (2011) beetles were maintained on tomatoes conditioned in glass house and segregated by stages of development. Since emergence of neonates is related to ambient temperature (Schalk and Stoner, 1979), beetles were manipulated to oviposit eggs under growth chamber conditions (16 h light/8 h dark photo-cycle at 25 °C). Prior to experimental infestation, newly laid eggs were collected from the underside of tomato leaflets and incubated in a Petri dish within a growth chamber. Newly hatched neonates were then infested on plants soon after their emergence.

2.23. Microcosm: AM-fungi, plant and early-stage beetle interaction

Two experiments were performed simultaneously in a glass house in a random block design (Table 2.21). In the first experiment, six-week-old tomato (Arabason organic

F1, Harris Seeds) were grown on six mycorrhizal treatments (10 replicates). Plants were first germinated on heat sterile potting soil (Metromix). After two weeks, seedlings were transplanted to experimental or control microcosms where they were assigned treatment

50 groups and exposed to AM+ or AM− for four weeks. After a total of six weeks, single newly hatched beetles (neonate) were placed on tomato where they foraged for 96 h.

2.24. Experiment 1: early-stage performance

Upon neonate emergence from eggs, a single neonate individual was placed on the terminal leaf of youngest fully emerged vegetative stem. At the same time, cages made of nylon mesh were put in place to confine beetle to tomato aerial tissue. This enabled beetles to roam and graze on the entire plant. Damage, or plant tissue consumption varied from single leaf tissue to multiple leaf tissues. Final damage or tissue consumption was estimated after 96 h with imageJ 1.46r by quantifying the area of tissue damage or complete tissue removal. This duration (96 h) was chosen to establish adequate pixels of damage. In addition, 96 h have been previously shown to promote differences among AM-fungal species modulating plant enemy interactions (Malik et al.,

2016).

2.25. Estimating trichome density at point of infestation

Proximal to the point of infestation, a leaf disc (0.4 cm in diameter) was excised from all tomato plants of Experiment 1 (Table 2.21). Leaf discs were consistently excised from terminal leaf of the youngest fully emerged vegetative stem. It is noted that while the damage done by this excision may induce non-constitutive plant defenses, the damage was equally applied to all plants and therefore does not confound our inoculation treatments. However, as a result of this damage, we cannot differentiate the

51 effect of inoculation on constitutive versus induced plant defense (Bennett et al., 2009).

Trichomes of the adaxial interveinal region were enumerated with stereo microscope at

4× magnification.

2.26. Statistical analysis: early-stage beetle

Normality of measures for proportion leaf area damage and trichome density were improved with rank transformation prior to analysis. With the rank transformation, analysis of variance can test differences of medians and is comparable to non-parametric analyses, but with the flexibility of including both block and treatment as predictors

(Conover and Iman, 1981). This analysis allowed the assessment of differences between

AM+ and AM− among the average of individual species and species mixtures using a priori contrasts. Early stage survivorship was analyzed using general linear models in proc GLIMIX in SAS 9.4. Significance of correlations between response variables were tested via Pearson product-moment correlation coefficient.

2.27. Experiment 2: late-stage performance

Beetles were maintained until reaching third instar stage of development. At the time of experiment 2, third instars were starved for 4 h prior to infestation. This window of time has been previously shown to yield consistent foraging responses − up to 17 h

(Visser, 1976). After the 4 h starvation period, initial mass was recorded, and a single third instar was infested onto a tomato individual. Since this experiment was performed at the same time as experiment 1, we extrapolated trichome effects of first experiment onto experiment 2. Thus, trichomes were not sampled from tomato individuals used in experiment 2 (Table 2.21). Moreover, third instars foraged on plants treated with either

AM+ or AM− inoculant. Beetles were allowed to forage for 72 h. This narrow window of time was chosen to limit the chance of third instar pupation, which would have suspended foraging. After 72 h, third instar survivors were scored for proportionate change in weight mass to assess beetle growth rate.

2.28. Statistical analysis: late-stage beetle

Differences between third instar’s initial and final mass was assessed via paired sampled t-test to ensure the effectiveness of this time period on foraging. With respect to soil treatment, mean differences between third instar’s initial and final mass was divided by mean initial mass (delta mass/initial mass). This determined proportionate change in third instar mass. Mycorrhizal treatment was held as the explanatory variable while block was held as a covariate. Together, these factors were used to assess proportionate change

53 in beetle mass (response variable). Levene’s test was performed to assess equal variance.

This enabled further examination via analysis of variance (ANOVA) and Tukey HSD post-hoc analysis in R version 3.3.3.

Table 2.21 Experimental Design of Experiment I & II

Experiment 1 assesses neonate damage (tissue consumption) on tomato in response to mycorrhizal treatment, as well as the ability of mycorrhizae to improve or reduce trichome density. Meanwhile, Experiment 2 assesses third instar performance in response to mycorrhizal treatment. Number of replicates are in parentheses. Also, since only live beetles were assessed for biomass, late-stage cohort was reduced from 10 to the quantity observed in parentheses.

2.3. Results

2.31. Early life-stage performance of herbivore and the effect AM-fungi

Early-stage beetle (neonate) imposed more damage on AM+ plants (Fig. 2. 31A,

Table 2.32, F1,45= 4.91, p= 0.03, AM+ vs AM−). AM+ plants also had fewer anatomical defense structures (Fig. 2.31B) in comparison to AM- control (Table 2.32, F1,45= 3.88, p =

0.05 ANOVA, AM+ vs AM−). Early-stage beetle survival (Fig. 2.32A) was improved on plants colonized by AM fungi, while lessened on AM–control (F1,45= 3.60, p = 0.06, AM+ vs AM−). In fact, survival was close to zero percent among early-stage beetles inhabiting control microcosms (Fig. 2.32A). Early-stage survival was significantly correlated with leaf damage across the AM species composition (Fig. 2.32A, Pearson correlation coefficient r = 0.96, n = 6, p= 0.0029)

2.32. Late life-stage performance of herbivore and the effect AM-fungi

2 h was adequate for observing change in late-stage beetle mass (Paired sample t- test, initial mass, M = 70.44 mg, SD = 18.33; final mass M = 117.23 mg, SD = 21.857; 95% CI

[-54,-38] p= 1.532e-13). However, mycorrhizal composition had an insignificant effect on third instar’s growth rate (Fig. 2.34, F6,19= 1.19, p= 0.12, ANOVA). Hence, the observed AM- fungal induced changes in trichome density (Fig. 2.33B) did not appear to influence the late-stage beetle performance (Fig. 2.32B). Although third instar’s growth rate was greater on E. Infrequens in comparison to C. claroideum, these differences were marginal (Fig. 2.34,

95%CI [−0.01,0.99], p = 0.06, Tukey HSD, post-hoc analysis). In addition, an insignificant

55 relationship was also observed between third instar growth rate and third instar survival

(Fig. 2.32B, Pearson correlation coefficient r =−0.21, n = 6, p= 0.68).

Fig. 2.31. The overall effect of arbuscular mycorrhizal (AM) fungi versus control:

Depicted here is a plot of early-stage herbivory and plant anatomical defense structure. Plant tissue was consumed at a greater rate on AM+ plants A. At the same time, anatomical defense was observed to be reduced in plants treated with AM+ (an asterisk indicates significance at an alpha of 0.05) B. Error bars are depicted as standard error.

Table 2.32. Analysis of variance (ANOVA) for Experiment 1:

Demonstrated here is the effect of Mycorrhizal treatment on trichomes and plant damage. Plant damage and trichome density were analyzed as response variables of 6 different mycorrhizal treatments, including a control. An asterisk indicates significance

(alpha = 0.05)

Fig. 2.32. The effect of AM-fungi on Colorado potato beetle’s life stage specific survival.

Depicted here is a plot of early (neonate) and late-stage (third instar) beetle’s foraging response to plants of varying microbial communities. Plants treated with AM- fungi or non-mycorrhizal controls were challenged by beetles of two life-stages. The relationship between neonate survival and plant tissue damage (resource accessibility) was assessed after 4 weeks of mycorrhizal conditioning. Meanwhile the relationship between third instar survival and growth rate (resource quality) was also assessed after

4 weeks of mycorrhizal conditioning. It was unveiled that neonate survivorship correlates significantly with plant tissue consumption (p = 0.0029, Pearson product- moment correlation coefficient) A. However, the relationship between third instar growth rate and beetle survival was insignificant B.

Fig. 2.33. Anatomical defense structure (trichomes) and plant tissue consumption by early-stage beetles. Boxplots are positioned from left to right with respect to the upper quartile.

Depicted above is the effect of AM-fungi on anatomical defense and early-stage herbivory. These two parameters are used to determine the degree to which resource accessibility is affected by AM-fungi. In light of this, anatomical defense is represented as trichomes per unit area. Meanwhile, early-stage herbivory is represented as plant tissue damage per unit area. It was observed that trichome density was greatest in the absence of AM-fungi (purple bar) B. Interestingly, this corresponds to less damage among AM-fungi A. (an asterisk indicates significance at an alpha of 0.05, ANOVA contrast, AM+ vs AM−).

Fig. 2.34. Late-stage Colorado potato beetle growth rate in response to AM-fungal composition.

Boxplots are positioned from left to right with respect to the lower quartile.

Depicted above is the influence of AM-fungal composition on beetle growth rate. This parameter was chosen to approximate resource quality. In light of this, increase in beetle growth is represented as change in beetle mass divided by initial mass. Given this parameter, it was found that mycorrhizal treatment had an insignificant effect on late- stage beetle growth rate (p = 0.12, ANOVA). Interestingly, beetles foraging on E. infrequens treated plants marginally differed from C. claroideum (p = 0.06, Tukey HSD).

2.4 Discussion

AM-fungi (AM+) improved plant tissue consumption and early-stage beetle survival. This comes as no surprise since trichome density was reduced in AM+ plants.

AM+ improvement of plant tissue consumption may be an indicator of the degree to which beetles can access plant resources via mycorrhizal modulation. Thus, early-stage beetle’s accessibility to plant resources is improved when plants are associated with AM- fungi. As for late-stage beetles, AM+ did not improve beetle growth-rate relative to control levels. Perhaps, marginal differences in beetle growth rate as a response to AM- fungal taxa may be an indicator of slight disparity in resource quality. Taken together, these findings suggest that the effect of AM-fungi on herbivore survival is life-stage dependent.

2.41. Stage-class shapes trophic structure

Neonates struggled with trichomes in an attempt to access plant resources and avoid being dehydrated. At the same time, beetle saliva and beetle specific microbes

(Chung et al., 2013) may have interacted with phytohormones induced by AM-fungi

(Jung et al., 2012, Gianinazzi-Pearson, 1996). Trichome density was less among AM+ plants, which resulted in greater plant tissue consumption (Fig. 2.3A and 2.3B). This may

62 explain as to how early-stage beetle’s ability to inflict damage on plant tissue enables access to resources, and survivorship into later stages of Coleopteran development.

Meanwhile, the inability of trichomes to deter late-stage beetles may be due to the overwhelming size and strength of third instar’s mouth-parts in comparison to that of early-stage beetles. As early-stage beetles survive into later stages of development, trichome defense may become less of a factor leading to the context dependency of life- stage when assessing herbivore-plant interactions. In addition, glandular trichomes may also play a role. These defense structures have been shown to produce chemical compounds that elicit herbivore counter defenses (Hurley and Dussourd,2015). This may elucidate a potential mechanism in which AM+ influences early-stage beetle’s foraging and survival through alteration in plant chemical composition

2.42. Context dependency of herbivore trophic link

AM-fungi have been shown to positively affect herbivores across systems. Meta- analysis suggests these interactions may depend on feeding guild and the parameter used to assess herbivory (Koricheva et al., 2009). This may explain why differences in performance were observed when assessing resource quality (as represented by larval growth rate, Fig. 2.34) versus resource accessibility (as represented by tissue consumption, Fig. 2.33A). Resource accessibility, or its lack thereof, appears to have limited early-stage beetle survival. This is presumably the case since early-stage beetles must overcome trichomes to gain nutrient access (Levin, 1973). However, newly hatched

63 beetles are not always immediately challenged by trichomes, instead, they often perform intra-clutch cannibalism as a source of nutrients and maternal supplements (Tigreros et al., 2017). It is possible that a clutch meal prior to trichome confrontation would have provided the proper energetics needed to gain nutrient access.

2.43. Context dependency of mycorrhizal trophic link

Context dependency has been observed among other trophic links. For example, wild onion genotypes that benefit from AM+ nutritional enrichment have been shown to be more susceptible toward root pathogen incidence (Ronsheim, 2016). Meanwhile, mycorrhizal improvement of Mexican bean beetle survivorship is believed to be dependent on the amount of phosphorous in the soil environment (Borowicz, 1997). This study demonstrates that herbivore stage-class can play a role in determining the outcome of plant-herbivore interactions and suggests that mycorrhizal composition can be important as well. Here, the AM-fungal species, C. claroideum was shown to be most advantageous toward early-stage Colorado potato beetles (Fig. 2.32A). Meanwhile in soybean, the same isolate of C. claroideum does not effect on pathogen levels (Malik et al.,

2016)

2.44. Food-web connectedness

While the context of AM+ in plant enemy interactions is gaining traction (Jung et al., 2012; Gange et al., 2003; Bennett et al., 2006), AM-fungi remain pivotal to trophic structure and food web dynamics. Improving herbivore quality has been shown to promote predator fitness (Hoffmann et al., 2011). Similarly, aphids feeding on AM+ plants have been shown to be more at risk toward parasitization (Bennett et al., 2016) and carnivore recruitment (Schausberger et al., 2012). Still, the effect of AM-fungi on trophic ecology is not always as straightforward. For example, while we did not observe strong differences between AM-fungal taxa in their effect on trichome density, AM-fungi have been shown to vary in their ability to indirectly induce plant chemical defenses (Bennett et al., 2009). Hence, C. candidum, a species that improves plant growth rate, does not affect herbivore response, while, A. trappei, a species that increases plant tolerance to herbivory, does not influence plant growth rate (Bennett and Bever, 2007). While ecotypic variation may also play a role in modulating AM-fungal effects (Al Agely and Sylvia, 2008), AM- fungal effects may also depend on the mode of the plant-enemy interaction. Here, it was observed that E. infrequens promotes beetle growth rate. In contrast to another study, where E. infrequens reduced leaf pathogen levels (Malik et al., 2016). These inconsistencies make it difficult to accurately predict the role of AM-fungi in trophic ecology. However, the findings of this study put forth the notion that herbivore life-stage also play a role in plant-enemy outcome

2.5. Conclusion

Although our findings provide additional insight into the role of AM-fungi as a strong trophic link (Paine, 1980), these outcomes are likely dependent on herbivore life- stage. Our findings suggest AM-fungi influence herbivore life histories at early development stages, specifically, by means of survival and resource access. In addition, changes in trichome density may provide a potential mechanism for relaxed density independent mortality. We encourage environmental and herbivore life-history context be taken into consideration when assessing the role of AM-fungi in plant defense. In this study, it was observed that AM-fungal taxa that provide a life-history advantage toward early-stage beetle, do not necessarily provide an advantage toward late-stage beetle.

Specifically, C. claroideum did not improve growth of late-stage beetles, although C.

Claroideum improved survival and resource access of early-stage beetles. These outcomes may have direct community implications, as improvement of herbivore quantity through increased survivorship directly benefits secondary consumers. Taken together, these findings provide insight into the role of AM-fungi as an integral species that can help shape community structure and food web connectedness.

Acknowledgements

Collaborators: JG. Ali and J.D. Bever. Penn State University greenhouse staff and the Penn

State University Bunton Waller Fellowship for providing funding and support. Special thanks to all reviewers for providing comments and helping strengthen this article, and special thanks to Henry Klepser, Swayamjit Ray and Xin Chen for providing technical support.

References

AL AGELY, A. & SYLVIA, D. M. 2008. Compatible host/mycorrhizal fungus combinations for micropropagated sea oats: II. Field evaluation. Mycorrhiza, 18, 257.

ALYOKHIN, A. 2009. Colorado potato beetle management on potatoes: current challenges and future prospects. Fruit, Vegetable and Cereal Science and Biotechnology, 3.

BARBER, N. A., KIERS, E. T., HAZZARD, R. V. & ADLER, L. S. 2013. Context- dependency of arbuscular mycorrhizal fungi on plant-insect interactions in an agroecosystem. Frontiers in plant science, 4, 338.

BARDGETT, R. D. & VAN DER PUTTEN, W. H. 2014. Belowground biodiversity and ecosystem functioning. Nature, 515, 505-511.

BENNETT, A. E. & BEVER, J. D. 2007. Mycorrhizal species differentially alter plant growth and response to herbivory. Ecology, 88, 210-218.

BENNETT, A. E., BEVER, J. D. & BOWERS, M. D. 2009. Arbuscular mycorrhizal fungal species suppress inducible plant responses and alter defensive strategies following herbivory. Oecologia, 160, 771-779.

BENNETT, A. E., MILLAR, N. S., GEDROVICS, E. & KARLEY, A. J. 2016. Plant and insect microbial symbionts alter the outcome of plant–herbivore–parasitoid interactions: implications for invaded, agricultural and natural systems. Journal of Ecology, 104, 1734– 1744.

BOROWICZ, V. A. 1997. A fungal root symbiont modifies plant resistance to an insect herbivore. Oecologia, 112, 534-542.

BRAULT, S. & BOURGET, E. 1985. Structural changes in an estuarine subtidal epibenthic community: Biotic and physical causes. Marine ecology progress series. Oldendorf, 21, 63-73.

BUKOVINSZKY, T., VAN VEEN, F. F., JONGEMA, Y. & DICKE, M. 2008. Direct and indirect effects of resource quality on food web structure. Science, 319, 804-807.

CAMERON, D. D., NEAL, A. L., VAN WEES, S. C. & TON, J. 2013. Mycorrhiza-induced resistance: more than the sum of its parts? Trends in plant science, 18, 539-545.

CHUNG, S., ROSA, C., HOOVER, K., LUTHE, D. S. & FELTON, G. W. 2013a. Colorado potato beetle manipulates plant defenses in local and systemic leaves. Plant signaling & behavior, 8.

CHUNG, S. H. & FELTON, G. W. 2011. Specificity of induced resistance in tomato against specialist lepidopteran and coleopteran species. Journal of chemical ecology, 37, 378-386.

CHUNG, S. H., ROSA, C., SCULLY, E. D., PEIFFER, M., TOOKER, J. F., HOOVER, K., LUTHE, D. S. & FELTON, G. W. 2013b. Herbivore exploits orally secreted bacteria to suppress plant defenses. Proceedings of the National Academy of Sciences, 110, 15728- 15733.

CONOVER, W. J. & IMAN, R. L. 1981. Rank transformations as a bridge between parametric and nonparametric statistics. The American Statistician, 35, 124-129.

DALIN, P., ÅGREN, J., BJÖRKMAN, C., HUTTUNEN, P. & KÄRKKÄINEN, K. 2008. Leaf trichome formation and plant resistance to herbivory. Induced plant resistance to herbivory. Springer.

ELSHARKAWY, M. M., SHIMIZU, M. & TAKAHASHI, H. 2012. The plant growth- promoting fungus Fusarium equiseti and the arbuscular mycorrhizal fungus Glomus mosseae induce systemic resistance against Cucumber mosaic in Cucumber plants. Plant and soil, 361, 397-409.

GANGE, A. & WEST, H. 1994. Interactions between arbuscular mycorrhizal fungi and foliar-feeding insects in Plantago lanceolata L. New Phytologist, 128, 79-87.

GANGE, A. C., BROWN, V. K. & APLIN, D. M. 2003. Multitrophic links between arbuscular mycorrhizal fungi and insect parasitoids. Ecology Letters, 6, 1051-1055.

GIANINAZZI-PEARSON, V. 1996. Cellular and molecular defence-related root responses to invasion by arbuscular mycorrhizal fungi. New Phytologist, 133, 45-57.

HAIRSTON, N. G., SMITH, F. E. & SLOBODKIN, L. B. 1960. Community structure, population control, and competition. American naturalist, 94, 421-425.

HARE, D. J. 1980. Impact of defoliation by the Colorado potato beetle on potato yields. Journal of Economic Entomology, 73, 369-373.

HOFFMANN, D., VIERHEILIG, H. & SCHAUSBERGER, P. 2011. Mycorrhiza-induced trophic cascade enhances fitness and population growth of an acarine predator. Oecologia, 166, 141-149.

HOUSE, G. L., EKANAYAKE, S., RUAN, Y., SCHÜTTE, U. M., KAONONGBUA, W., FOX, G., YE, Y. & BEVER, J. D. 2016. Phylogenetically structured differences in rRNA gene sequence variation among species of arbuscular mycorrhizal fungi and their implications for sequence clustering. Applied and environmental microbiology, 82, 4921- 4930.

HUANG, M., SANCHEZ-MOREIRAS, A. M., ABEL, C., SOHRABI, R., LEE, S., GERSHENZON, J. & THOLL, D. 2012. The major volatile organic compound emitted from Arabidopsis thaliana flowers, the sesquiterpene (E)-β-caryophyllene, is a defense against a bacterial pathogen. The New phytologist, 193, 997-1008.

HURLEY, K. W. & DUSSOURD, D. E. 2015. Toxic geranium trichomes trigger vein cutting by soybean loopers, Chrysodeixis includens (Lepidoptera: Noctuidae). Arthropod-Plant Interactions, 9, 33-43.

JAKOBSEN, I., ABBOTT, L. & ROBSON, A. 1992. External hyphae of vesicular-arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. New Phytologist, 120, 371- 380.

JUNG, S. C., MARTINEZ-MEDINA, A., LOPEZ-RAEZ, J. A. & POZO, M. J. 2012. Mycorrhiza-induced resistance and priming of plant defenses. Journal of chemical ecology, 38, 651-664.

KEARSLEY, M. J. & WHITHAM, T. G. 1989. Developmental changes in resistance to herbivory: implications for individuals and populations. Ecology, 70, 422-434.

KORICHEVA, J., GANGE, A. C. & JONES, T. 2009. Effects of mycorrhizal fungi on insect herbivores: a meta analysis. Ecology, 90, 2088-2097.

KRÜGER, M., KRÜGER, C., WALKER, C., STOCKINGER, H. & SCHÜßLER, A. 2012. Phylogenetic reference data for systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level. New phytologist, 193, 970-984.

KUS, J. V., ZATON, K., SARKAR, R. & CAMERON, R. K. 2002. Age-related resistance in Arabidopsis is a developmentally regulated defense response to Pseudomonas syringae. The Plant Cell, 14, 479-490.

LEVIN, D. A. 1973. The role of trichomes in plant defense. Quarterly Review of Biology, 48, The Quarterly Review of Biology, Vol. 48, No. 1, Part 1 (Mar., 1973), pp. .

MALIK, R. J., DIXON, M. H. & BEVER, J. D. 2016. Mycorrhizal composition can predict foliar pathogen colonization in soybean. Biological Control, 103, 46-53.

MOORE, J. C., BERLOW, E. L., COLEMAN, D. C. & RUITER, P. C. 2004. Detritus, trophic dynamics and biodiversity. Ecology letters, 7, 584-600.

MOUILLOT, D., GRAHAM, N. A., VILLÉGER, S., MASON, N. W. & BELLWOOD, D. R. 2013. A functional approach reveals community responses to disturbances. Trends in Ecology & Evolution, 28, 167-177.

MURDOCH, W., NISBET, R., BLYTHE, S., GURNEY, W. & REEVE, J. 1987. An invulnerable age class and stability in delay-differential parasitoid-host models. American Naturalist, 263-282.

MUSTAFA, G., RANDOUX, B., TISSERANT, B., FONTAINE, J., MAGNIN-ROBERT, M., SAHRAOUI, A. L.-H. & REIGNAULT, P. 2016. Phosphorus supply, arbuscular mycorrhizal fungal species, and plant genotype impact on the protective efficacy of mycorrhizal inoculation against wheat powdery mildew. Mycorrhiza, 1-13.

MYERS, R. A., BAUM, J. K., SHEPHERD, T. D., POWERS, S. P. & PETERSON, C. H. 2007. Cascading effects of the loss of apex predatory sharks from a coastal ocean. Science, 315, 1846-1850.

PAINE, R. T. 1966. Food web complexity and species diversity. The American Naturalist, 100, 65-75.

PAINE, R. T. 1980. Food webs: linkage, interaction strength and community infrastructure. Journal of Animal Ecology, 49, 667-685.

PIETERSE, C. M., ZAMIOUDIS, C., BERENDSEN, R. L., WELLER, D. M., VAN WEES, S. C. & BAKKER, P. A. 2014. Induced systemic resistance by beneficial microbes. Annual review of phytopathology, 52, 347-375.

POZO, M. J. & AZCÓN-AGUILAR, C. 2007. Unraveling mycorrhiza-induced resistance. Current opinion in plant biology, 10, 393-398.

POZO, M. J., CORDIER, C., DUMAS-GAUDOT, E., GIANINAZZI, S., BAREA, J. M. & AZCÓN-AGUILAR, C. 2002. Localized versus systemic effect of arbuscular mycorrhizal fungi on defence responses to Phytophthora infection in tomato plants. Journal of experimental botany, 53, 525-534.

PRIETO, J. D., CASTAÑÉ, C., CALVET, C., CAMPRUBI, A., BATTAGLIA, D., TROTTA, V. & FANTI, P. 2016. Tomato belowground–aboveground interactions: Rhizophagus irregularis affects foraging behavior and life history traits of the predator Macrolophus pygmaeus (Hemiptera: Miridae). Arthropod-Plant Interactions, 1-8.

REYNOLDS, H. L., PACKER, A., BEVER, J. D. & CLAY, K. 2003. Grassroots ecology: plant-microbe-soil interactions as drivers of plant community structure and dynamics. Ecology, 84, 2281-2291.

ROCK-BLAKE, R., MCCORMICK, M. K., BROOKS, H. E., JONES, C. S. & WHIGHAM, D. F. 2017. Symbiont abundance can affect host plant population dynamics. American Journal of Botany.

ROJO, E., SOLANO, R. & SÁNCHEZ-SERRANO, J. J. 2003. Interactions between signaling compounds involved in plant defense. Journal of Plant Growth Regulation, 22, 82-98.

RONSHEIM, M. L. 2016. Plant Genotype Influences Mycorrhiza Benefits and Susceptibility to a Soil Pathogen. The American Midland Naturalist, 175, 103-112.

SATO, Y. & KUDOH, H. 2017. Herbivore-Mediated Interaction Promotes the Maintenance of Trichome Dimorphism through Negative Frequency-Dependent Selection. Herbivore-Mediated Interaction Promotes the Maintenance of Trichome Dimorphism through Negative Frequency-Dependent Selection.

SCHALK, J. & STONER, A. 1979. Tomato production in Maryland: Effect of different densities of larvae and adults of the Colorado potato beetle. Journal of Economic Entomology, 72, 826-829.

SCHAUSBERGER, P., PENEDER, S., JUERSCHIK, S. & HOFFMANN, D. 2012. Mycorrhiza changes plant volatiles to attract spider mite enemies. Functional Ecology, 26, 441-449.

SHARMA, I. P. & SHARMA, A. 2016. Physiological and biochemical changes in tomato cultivar PT-3 with dual inoculation of mycorrhiza and PGPR against root-knot nematode. Symbiosis, 1-9.

SHAUL, O., GALILI, S., VOLPIN, H., GINZBERG, I., ELAD, Y., CHET, I. & KAPULNIK, Y. 1999. Mycorrhiza-induced changes in disease severity and PR protein expression in tobacco leaves. Molecular Plant-Microbe Interactions, Volume 12, 1000-1007.

SHRIVASTAVA, G., OWNLEY, B. H., AUGÉ, R. M., TOLER, H., DEE, M., VU, A., KÖLLNER, T. G. & CHEN, F. 2015. Colonization by arbuscular mycorrhizal and endophytic fungi enhanced terpene production in tomato plants and their defense against a herbivorous insect. Symbiosis, 65, 65-74.

SMITH-RAMESH, L. M. 2017. Invasive plant alters community and ecosystem dynamics by promoting native predators. Ecology, 98, 751-761.

SOWIK, I., BORKOWSKA, B. & MARKIEWICZ, M. 2016. The activity of mycorrhizal symbiosis in suppressing Verticillium wilt in susceptible and tolerant strawberry (Fragaria x ananassa Duch.) genotypes. Applied Soil Ecology, 101, 152-164.

SPAGNOLETTI, F. N., BALESTRASSE, K., LAVADO, R. S. & GIACOMETTI, R. 2016. Arbuscular mycorrhiza detoxifying response against arsenic and pathogenic fungus in soybean. Ecotoxicology and Environmental Safety, 133, 47-56.

TCHABI, A., HOUNTONDJI, F. C., OGUNSOLA, B., LAWOUIN, L., COYNE, D., WIEMKEN, A. & OEHL, F. 2016. Effect of two species of arbuscular mycorrhizal fungi inoculation on development of micro-propagated yam plantlets and suppression of Scutellonema bradys (Tylenchideae). Journal of Entomology and Nematology, 8, 1-10.

TIGREROS, N., NORRIS, R. H., WANG, E. H. & THALER, J. S. 2017. Maternally induced intraclutch cannibalism: an adaptive response to predation risk? Ecology Letters, 20, 487– 494.

VANNETTE, R. L. & HUNTER, M. D. 2013. Mycorrhizal abundance affects the expression of plant resistance traits and herbivore performance. Journal of Ecology, 101, 1019-1029.

VISSER, J. 1976. THE DESIGN OF A LOW-SPEED WIND TUNNEL AS AN INSTRUMENT FOR THE STUDY OF OLFACTORY ORIENTATION IN THE COLORADO BEETLE (LEPTINOTARSA DECEMLINEATA). Entomologia experimentalis et applicata, 20, 275-288.

VOGELSANG, K. M., REYNOLDS, H. L. & BEVER, J. D. 2006. Mycorrhizal fungal identity and richness determine the diversity and productivity of a tallgrass prairie system. New Phytologist.

WADE, M. J. 1985. Soft selection, hard selection, kin selection, and group selection. The American Naturalist, 125, 61-73.

WAGG, C., BENDER, S. F., WIDMER, F. & VAN DER HEIJDEN, M. G. 2014. Soil biodiversity and soil community composition determine ecosystem multifunctionality. Proceedings of the National Academy of Sciences, 111, 5266-5270.

WALLACE, B. 1975. Hard and soft selection revisited. Evolution, 465-473.

WANG, M., BEZEMER, T. M., VAN DER PUTTEN, W. H. & BIERE, A. 2015. Effects of the Timing of Herbivory on Plant Defense Induction and Insect Performance in Ribwort Plantain (Plantago lanceolata L.) Depend on Plant Mycorrhizal Status. Journal of chemical ecology, 41, 1006-1017.

WILSON, G. W., RICE, C. W., RILLIG, M. C., SPRINGER, A. & HARTNETT, D. C. 2009. Soil aggregation and carbon sequestration are tightly correlated with the abundance of

73 arbuscular mycorrhizal fungi: results from long-term field experiments. Ecology Letters, 12, 452-461.

WOODMAN, R. L. & FERNANDES, G. W. 1991. Differential mechanical defense: herbivory, evapotranspiration, and leaf-hairs. Oikos, 60, 11-19.

YUAN, S., LI, M., FANG, Z., LIU, Y., SHI, W., PAN, B., WU, K., SHI, J., SHEN, B. & SHEN, Q. 2016. Biological control of tobacco bacterial wilt using Trichoderma harzianum amended bioorganic fertilizer and the arbuscular mycorrhizal fungi Glomus mosseae. Biological Control, 92, 164-171.

ZÁVADA, T., MALIK, R. J. & KESSELI, R. V. 2017. Population structure in chicory (Cichorium intybus): A successful US weed since the American revolutionary war. Ecology and Evolution.

Chapter 3: “Home-field advantage” - or not, bark decomposition promotes the environmental filtration of microbes in nearby soil communities

Abstract

Bark decomposition may be a key factor to determining rates of carbon storage, as bark chemical properties may act as an environmental filter for select microbial assemblages. Upon litter introduction, the soil microbiome may respond to decomposer activity, as plant chemical compounds are liberated, solubilized and dispersed into the soil environment. It is hypothesized that solubilization of plant mass, through decomposition, will shift soil microbial assemblages. To test whether or not litter introduction and degradation can shape microbial community assemblages, a full factorial design featuring 2 species * 2 soil communities * 25 tree replicates was used in this study. The experiment was conducted at a temperate mixed hardwood forest, at the

Shale Hills Catchment in the Susquehanna-Shales Hills Critical Zone observatory in central Pennsylvania. The study featured 2 tree species, or bark types (eastern hemlock,

Tsuga canadensis and white oak, Quercus alba), and 2 soil communities (Eastern hemlock and white oak). When bark type matched the soil environment of its parent tree, this was denoted as ‘home’ soil environment. When bark type did not match the soil environment of its parent tree, this was denoted as ‘away’ soil environment. These combinations allowed the examination of the main effect of both bark type and soil communities on

75 decomposition. Bark microbial assemblages were characterized by sequencing of 16S rRNA and fungal ITS gene fragments, as were assemblages in the adherent soil after 12 months of bark decomposition (mass loss). Results showed that bark decomposition rates varied at the local scale, as decomposition was suppressed in soil communities beneath the canopy of Eastern hemlock, but at the same time, enhanced in soil communities beneath the canopy of white oak. In addition, PCoA analysis revealed that adherent soil microbial assemblages assorted according to species bark identify, as opposed to canopy tree’s soil regime. Taken together, these findings suggest recalcitrant litter decomposition may shift microbial assemblages, and therefore provide additional insight into ecosystem function.

3.1. Introduction

Ninety percent of plant organic carbon is decomposed or sequestered as dead organic matter (Cebrian, 1999, Gessner et al., 2010), but still nutrient mobilization and its biological availability are essential to ecosystem processes (Read and Perez-Moreno,

2003, Treseder and Lennon, 2015). Microbial communities may influence biogeochemical cycles both directly and indirectly through trophic linkages (Swift et al., 1979, Wall and

Moore, 1999, Waldrop and Firestone, 2004, d’Annunzio et al., 2008, Shah et al., 2016).

There are multiple hypotheses that attempt to elucidate factors governing nutrient mobilization, especially as it pertains to decomposition (Chapman et al., 2003,

Hättenschwiler et al., 2011, Sinsabaugh and Shah, 2011, Freschet et al., 2012, Fanin et al.,

2016, Malik, 2019, Sulman et al., 2017). Co-localized adaptation is foundational to the

“home-field advantage” hypothesis (Diepen et al., 2017, Strickland et al., 2009, Ayres et al., 2009), which suggests decomposition is advanced when litter source and decomposers originate from the same environment.

While the support for this hypothesis is credible, primarily with leaf litter, the role of recalcitrant litter remains unclear. Wood represents a major component of carbon storage (Perez-Garcia et al., 2007, Lewis et al., 2009), but much of it is protected by bark.

Bark can impact decomposer accessibility and wood’s retention of moisture (Dossa et al.,

2018, Ulyshen et al., 2016). Through decomposition, degradation of bark can lead to

77 liberation of bark chemical extracts (Kumbhare et al., 2012, Royer et al., 2011, Sultana et al., 2007), which may influence microbial community composition.

Determining the ecological underpinnings that are relevant to bark decomposition can elucidate mechanisms of community function. Diverse in chemical composition, bark represents 9 to 15% of stem volume (Harkin and Rowe, 1971) Bark can also protect stems from fire, desiccation, herbivores, and pathogens (Dantas and Pausas, 2013, Cernusak and Cheesman, 2015, Zas et al., 2011, Pearce, 1996, Mullick, 1977), but bark can also be fragmented by several factors, including free-thaw events, as well as invertebrate and vertebrate animals. Bark fragmentation and displacement, creates a litter source that can impact community development (Harmon, 1989, Shorohova and Kapitsa, 2014, Dossa et al., 2018). Bark is low in nutrient quality (Dossa et al., 2016), and its decomposition and chemical extracts may negatively affect microbial diversity. On the other hand, bark has cross-linked polyesters, including cutin and suberin (Feng et al., 2013), which may increase decomposer function through improved quality in moisture content. Through suberin, retention of substrate moisture content may have positive effects, as higher moisture content often corresponds to microbial activity (Schimel et al., 1999, Holden et al., 2015)

Bark degradation may also depend on the influence of bark litter traits on microbial function. Bark tannin extracts are of a relatively high molecular weight, compared to wood (Feng et al., 2013). As an anti-microbial compound, tannins were

78 observed to lower mycotoxin production and suppress nitrogen mineralization (Peng et al., 2018, Zhang and Laanbroek, 2018). With respect to the fate of carbon, tannins were found to increase carbon storage during poplar litter decay (Shay et al., 2018). Plant emergent properties, including bark stoichiometry and quality may also impact microbial assemblages (García-Palacios et al., 2016). Hence, bark stoichiometry and quality may influence microbial competition, resource partitioning and environmental filtration

(Prosser et al., 2007, Hibbing et al., 2010, Dumbrell et al., 2010), and thereby help construct, the so-called “home-field advantage”.

To date, many studies have expanded our understanding of ecological underpinnings that are foundational to the “home-field advantage” hypothesis (Hobbie et al., 2006, Fanin et al., 2016, Veen et al., 2018, Diepen et al., 2017, Ayres et al., 2009).

However, most studies that attempt to test this hypothesis, often hinge on labile litter models, and do not take into account recalcitrant litter, let alone bark. To advance our understanding of this process, this study integrates bark decomposition in the context of the “home-field advantage” hypothesis. Here, we addressed two questions. (1) Is the

‘home’ environment a key factor in determining rates of bark decomposition? (2) Does decomposition and the liberation of bark chemical components act as an environmental filter and affect microbial assemblages in the adherent soil community? To address these questions, bark decomposability of a softwood tree species, eastern hemlock, and hardwood tree-species, white oak, were reciprocally transplanted into ‘home’ and ‘away’

79 environments, in a mixed hardwood forest in central Pennsylvania. We hypothesized that (1) the ‘home’ environment will increase decomposition rates, and (2) liberation of bark chemical content will impact microbial assemblages in the soil community.

3.2. Methods

3.21. Study system Mature white oak and eastern hemlock are widespread at the Susquehanna - Shale

Hills Critical Zone Observatory (40°39′N, 77°54′W) in central Pennsylvania. The average temperature in this region is 10 degrees Celsius and the annual mean precipitation is

1,006 mm. The underlying soil is derived from shale parent rock residuum (Hasenmueller et al., 2017). Common soils series at this site is Berks–Weikert (Order: Inceptisol, Great

Group: Dystrudepts). Percentages of channery shale has been reported to increase with soil depth (White et al., 2015). The pH in the top 10 cm of soil is about 4.0 (Malik, 2019). Bark from eastern hemlock (Tsuga canadensis) and white oak (Quercus alba) were used for this study, as these two species have both contrasting life histories and emergent properties.

On one hand, eastern hemlock is a softwood, late successional, gymnosperm. On the other hand, white oak is a hardwood, mid-successional, angiosperm. In addition, these two species differ in environmental challenges. Eastern hemlock is on the decline from an invasive sap-sucking Hemipteran, known as hemlock wooly adelgid (Mahan et al.,

2004). Meanwhile, white oak is on the decline as a result of fire suppression (Abrams,

2003). Also, these two species differ in common litter input. Eastern hemlock deposits chemically recalcitrant needles, whereas white oak deposits more labile broad leaves.

Differences in common litter input may shape microbial communities, and make these two species relevant for contrasting ‘home’ environment effects on bark decomposition.

3.22. Experimental Design This experiment tested for the interactive effect of bark type and soil communities.

A full factorial design featuring 2 species by 2 soil communities with 25 tree replicates was the experimental design, for total of 100 observations. Since bark volume has been shown to correspond with stem diameter (Paine et al., 2010), mid-late successional trees were used, so that stem-diameter was relatively consistent across individual trees. The soil community beneath the canopy of each sampled tree was also used for this study.

Bark was reciprocally transplanted among eastern hemlock and white oak. When bark type matched the soil environment of the parent tree, this was denoted as ‘home’ soil environment (Fig. 4.21). When bark type did not match its parent tree’s soil environment, this was denoted as an ‘away’ environment (Fig. 4.21).

3.23. Bark excision Bark was excised from 50 individual trees, with an excision no deeper than 1.5 cm.

The depth of the excision was consistent across tree individuals, and included bark tissue from the dead cell exterior to the outer cambium. After each excision, tools and gloves were sprayed with 75% ethanol. The excised bark was then split in half, with one portion being placed in the soil community beneath its parent tree (‘home’ environment), and the remaining proportion placed in ‘away’ soil environment (Fig. 3.21). Prior to introduction into either home or away soil environment, bark was recovered in cylindrical cores and

82 returned to the lab for initial assessment of bark mass and eventually the microbial community.

3.24. Bark microbial preparation

While using aseptic technique, 1 gram of bark was sampled and stored in a freezer at – 20 C˚. This sample was later used to characterize barks microbial composition via next generation sequencing. The remaining bark tissue was not to be used for microbial assessment, instead it was used to assess decomposability. Bark tissue length and width were about ~ 5cm * ~2.5cm, while the depth was not greater than 1.5 cm. The dimensions were made to be consistent, since decomposability may relate to surface area (Dossa et al., 2018).While still encased in cylindrical cores, bark was oven dried for 20 h at 40 degrees C˚. This measure was taken since water content has been shown to vary across species (Rosell et al., 2015), let alone individual samples. Initial dry mass was recorded for each bark sample, so that mass loss could be expressed as a proportion. On average, dried bark had initial mass of about 1.5 g.

3.25. ‘Home’ and ‘away’ conditions

The study was conducted from July 2017 to June 2018 using the full factorial experimental design that was previously mentioned (Fig. 3.21). While still contained in cylindrical cores (10 cm length by 5 cm diameter) with 0.5 × 0.5 cm window openings, dried bark tissue was returned to the field (10 cm length by 5 cm diameter). Two

83 cylindrical cores were contrasted together with electrical tape to pair ‘home’ and ‘away’ bark (Fig 3.21). In each soil community, one cylindrical core contained a bark type that was approximately 37.5 cm away from the stem of its parent tree, while another cylindrical core would include a bark type that was not derived from the aforementioned parent tree (Fig. 3.21). This allowed one bark type to interact with decomposers of co- localized history. Meanwhile, the ‘away’ bark type interacted with decomposers of a non- co-localized history.

3.26. Field Experiment

Beneath the canopy of eastern hemlock or white oak, an excavation was made to accommodate the cylindrical cores. The cylindrical cores and the excavation sites that would contain them, were of comparable sizes. Similar to Malik (2019), each excavation site was made to be approximately 37.5 cm from the reference tree's stem (eastern hemlock or white oak). The juxtaposed cylindrical cores were then filled with non-sterile soil from beneath the canopy of eastern hemlock or white oak. The non-sterile soils contained detritus and native microbes. Cylindrical cores were buried in a horizontal position. The depth of each excavation was made to 10 cm since decomposing woody debris occurs frequently at shallow depths (Posada et al., 2012). After 12 months of excavation, cores were removed from the field and brought to the laboratory for analysis.

3.27. Harvest: adherent soil communities and decomposition

After cylindrical cores were removed from the field and brought back to the laboratory, bark substrate was removed from each cylindrical core and soil colloids in direct contact with bark substrate were transferred into 1.5 ml Eppendorf tube and stored at – 20 degrees. The samples were used to characterize adherent soil microbial communities. After soil colloid removal, bark was dried for 96 hrs at 90 degrees C˚. Bark dry mass was then weighed to assess decomposition, or proportional mass loss.

3.28. Preparing Initial Bark Sample

Initial bark that had been stored at -20 degree C˚ was used to characterize the initial microbial community. Bark debris was then placed in 15ml of sterile water and then agitated overnight at 300 rpm. Bark was then spun down for 30 minutes at 21,000 rpm.

The supernatant was removed and the pellet was used for DNA extraction protocol. Both the bark pellet and the soil colloids from the adherent soil communities underwent standard DNA extraction protocol.

To examine the bacterial and fungal composition of the bark and adherent soil communities a two-step approach was used in the initial amplification step and universal bacterial primers 515F (5’-GTGYCAGCMGCCGCGGTAA-3’) and 806R

(GGACTACNVGGGTWTCTAAT) were used to target the v4 region of the 16S rRNA

85 gene (Apprill et al., 2015, Parada et al., 2016). At the same time, amplification step and universal fungal primers ITS1F (5’–CTTGGTCATTTAGAGGAAGTAA–3’) and 58A2R

(5’-CTGCGTTCTTCATCGAT-3’) were made to target the ITS1 region of the ribosomal

RNA gene (Gardes and Bruns, 1993, Martin and Rygiewicz, 2005). The forward and reverse primers were designed with overhangs that allowed the attachment of barcodes and standard Illumina overhang adaptors in a second PCR step. But first, a primary PCR step was conducted in which conditions were set as follows: 8 μl of 5Prime HotStart

MasterMix (Quanta BioSciences Inc., Beverly, MA, USA), 0.2 to 4 μl of template DNA, 1

μl of each primer from 10 μM stocks, and the appropriate volume of molecular biology grade water to bring the reaction to 20 μl. Thermal cycler, Mastercycler Nexus Gradient

PCR machines (Eppendorf, Hamburg, Germany) was utilized under the following conditions: 94° C for 3 min; 25 cycles of 94° C for 30 sec, 55° C for 30 sec, and 72° C for 45 sec; and then a final elongation for 10 min at 72° C and a hold a 4° C. After the PCR, amplicons were purified using Mag-Bind TotalPure NGS (Omega Bio-Tek, Norcross, GA,

USA) clean up beads. Next, standard Illumina overhang adaptors and unique indexing barcodes were provisioned to amplicons from each sample during the second PCR step.

Hence, 5 μl of cleaned PCR product, 12.5 μl of 5Prime Hotstart Mastermix, 2.5 μl of water, and 2.5μl of index primer (10 μM) were added to the reactions and amplified under the following conditions: 98° C for 1 minute; 8 cycles of 98° C for 15 seconds, 55° C for 30 seconds, and 72° C for 20 seconds; this was proceeded by a final elongation for 5 minutes

86 at 72° C and a hold at 4° C. Amplicons were barcoded and normalized using the

SequalPrep Normalization Plate Kit (Invitrogen, Carlsbad, CA, USA). Amplicons were then pooled together. The pool was concentrated using a Savant SpeedVac (Thermo

Scientific, Waltham, MA, USA) for 3 hours at 50° C and subsequently ran on an agarose gel (1.2%). The band was of expected size, it was then purified using the PureLink Quick

Gel Extraction kit (Invitrogen, Carlsbad, CA, USA).

At Cornell University, sequencing was performed at the Biotechnology Resource

Center Genomics Facility. Briefly, Illumina MiSeq (2 x 250 cycle v2 kit) was used in accordance with manufacturer’s recommendations. Bacterial 16s rRNA sequencing yielded a total of 4,541,319 contigs following the merger of forward and reverse reads for

90 libraries. After quality filtering, 631,548 total reads were obtained across 90 samples.

This provided an average of 7,017 reads/sample. With respect to ITS sequencing, a total of 5,386,484 contigs were obtained after merging forward and reverse reads for 90 libraries. After quality filtering, we obtained 2,302,039 total reads across 90 samples, providing an average of 25,578 reads/sample.

3.29. Bioinformatic and data assessment

Processing of reads including data analyses were performed as described by

Howard et al. (2017). Briefly, forward and reverse reads were merged and primer sequences trimmed (pdiffs = 2, maxambig = 0) in Mothur v1.39.5 (Schloss et al., 2009) as

87 singletons were removed. Reads were then split by sample and into individual files for downstream processing in MacQIIME v1.9.1 (Caporaso et al., 2010). Individual files were concatenated, as Qiime-formatted labels were added using add_qiime_labels.py. Soon after, a modified Brazilian Microbiome Project (BMP) pipeline was used to perform OTU clustering (Pylro et al., 2014). This allowed sequences to be dereplicated with VSEARCH v2.3.4 (Rognes et al., 2016), as 97% of OTUs were picked with USEARCH v7 (Edgar, 2010).

16S rRNA gene copy numbers were examined and inferred, according to 16S rRNA gene copy number dataset from the PICRUSt pipeline (Langille et al., 2013). Precalculated files with the Mothur-compatible May 2013 release (13_8_99) of Greengenes (McDonald et al.,

2012). OTUs were then assigned taxonomy in Mothur v1.39.5 using the modified taxonomy file. OTUs classified as Archaea, Eukaryota, chloroplast, mitochondria, and

‘unknown’ were excluded from the dataset. The resulting OTU and taxonomy tables were analyzed using R v3.4.4. Samples were then rarefied. Diversity indices and Bray-Curtis dissimilarities were determined using principal-coordinates analyses (PCoA) using the vegan v2.4.4 package (Oksanen et al., 2013). The effect of initial bark and soil treatments on microbial community composition was tested with PERMANOVA (Anderson, 2001), while using the adonis function in vegan. Finally, measures of alpha diversity were also calculated in vegan

3.295. Decomposition analysis and statistics Decomposition was assessed as proportionate change in mass (Δ mass/ initial mass). The effect of soil environment on decomposition was assessed using analysis of variance (ANOVA). Normality was assessed by way of graphical analysis using kernel density plot in R version 3.3.3 and Levene’s test was employed to assesses for homogeneity of variance. For analysis of variance (ANOVA), the tree species (oak and hemlock) and soil environment (‘home’ and ‘away’) was set as predictors or explanatory variable. At the same time, decomposition was set as the response variable. The explanatory variable consisted of four levels, hemlock bark in hemlock soil; hemlock bark in white oak soil; white oak bark in white oak soil; and white oak bark in hemlock soil. Tukey's HSD was used for post-hoc analysis. ANOVA model was then decomposed into apriori contrasts by way of multcomp package (Hothorn et al., 2013) followed by simultaneous tests of general linear hypotheses (Hothorn et al., 2008). Contrasts included the means of

‘eastern hemlock soil environment’ versus ‘white oak soil environment’; means of ‘eastern hemlock bark substrate’ versus ‘white oak bark substrate’; means of ‘eastern hemlock bark substrate in home soil’ versus means of ‘eastern hemlock bark substrate in away soil’; and the means of ‘white oak bark substrate in home soil’ versus ‘white oak bark substrate in away soil’.

Fig. 3.21. Experimental design.

Bark litter was introduced into the soil environment of its parent tree or the environment of a non-conspecific. When bark litter matched the environment of parent tree, this was denoted as ‘home’ soil. When bark litter did not match the environment of parent tree this was denoted as ‘away’ soil environment.

3.3. Results

3.31. Soil community effect on bark decomposition

The combination of soil regime and bark litter were significant predictors of bark decomposition (ANOVA, F 3,96 = 5.15, p = 0.002). Significant differences were also observed when comparing eastern hemlock bark in ‘away’ soils versus white oak bark in ‘away’ soils (Fig. 3.32A; ANOVA, Tukey HSD, 95% CI [0.05, 0.28], p = 0.0009). In terms of the “home- field advantage”, the experiment yielded mixed results. Eastern hemlock bark appeared to degrade faster in ‘away’ soils (Fig. 3.32A), whereas white oak degraded faster in ‘home’ soils (Fig. 3.32A). Apriori contrasts revealed that differences between white oak at ‘home’ versus ‘away’ trended toward significance (ANOVA, Simultaneous Tests for GLH, oak home versus oak away’, 95% CI [-0.20, 0.10], p = 0.09). Meanwhile, eastern hemlock at ‘home’ versus ‘away’ was outside of this trend (ANOVA, Apriori contrasts, Simultaneous Tests for GLH, Hem. soil versus oak soil 95% CI [-0.19, 0.01], p = 0.12). Interestingly, differences between specific soil communities were observed. When white oak soil communities were compared to their eastern hemlock counterpart, eastern hemlock soils were found to significantly suppress decomposition (ANOVA, Simultaneous Tests for GLH, Hem. soil versus oak soil 95% CI [-0.33, -0.03], p = 0.01). The main effect of bark species was also characterized. Irrespective of soil regime, decomposition of eastern hemlock bark was greater than white oak (Fig. 3.32B, ANOVA, Apriori contrasts, Hem. bark versus oak bark

Simultaneous Tests for GLH, 95% CI [-0.30, 0.00], p = 0.05).

Fig. 3.32. Bark decomposition in soil communities.

The decomposability of eastern hemlock and white oak was observed in ‘home’ and ‘away’ soils. Boxplots with hash-marks are oak soil treatments, non-hash-marks are eastern hemlock soil treatments. Analysis of variance (ANOVA) unveiled that these treatments significantly impacted bark decomposition. (F 3, 96 = 5.15, p = 0.002). B) The main effect of bark species is contrasted. Three asterisks indicate a p value less than

0.0001, one asterisks indicate a p value of less than 0.05

3.33. Bark and soil specific clustering of microbial communities

Bray-Curtis PCoA analysis of 16S OTU’s suggest bacteria that constituted eastern hemlock bark was different from bacteria that constituted white oak bark. Differences were also observed in the adherent soil communities (Fig. 3.35, PERMANOVA, F 5, 74 =

16.01, p = 0.0009). Similarly, Bray-Curtis PCoA analysis of ITS OTU’s suggest fungi that constituted the eastern hemlock bark was different from bacteria that constituted white oak bark. Similar to bacteria, fungal differences persisted in the adherent soil communities, and proved to be significant (Fig. 3.36, PERMANOVA, F 5, 78 = 5.58, p =

0.0009). Across bark and soil treatments, bacterial communities had more phylum richness than fungi (Fig. 3.37).

Fig. 3.35. Bray-Curtis PCoA analysis of 16S OTU’s Depicted here is similarities and dissimilarities among bacterial communities

Fig. 3.36. Bray-Curtis PCoA analysis of fungal OTU’s

Depicted here is similarities and dissimilarities among fungal communities

Fig. 3.37. Relative abundance of bacterial and fungal OTU’s

Relative abundance of bacterial and fungal OTU’s with respect to eastern hemlock adherent soil communities, initial bark and white oak adherent soil communities.

3.4. Discussion

Bark is external to the vascular cambium (Feng et al., 2013). Bark decomposition corresponds to lignocellulose solubilization and the liberation of bark antimicrobial compounds (Pointing et al., 2003, Pearce, 1996). Throughout the course of decomposition, bark material and chemical content is transformed and returned to the soil environment.

This on-going cycle is likely to shape the ‘home’ soil. Surprisingly, the findings of this study yielded mixed results, as a “home-field advantage” may have been detected for white oak, but the same could not be remotely declared for eastern hemlock (Fig. 3.32A).

Specifically, decomposers in eastern hemlock’s ‘home’ soil, underperformed when degrading eastern hemlock bark. Soil microbial assemblages were observed to assort according to the identity of introduced bark, as opposed to the underlying soil regime

(Fig. 3.35 & Fig 3.36). Perhaps suggesting that the liberation of bark soluble compounds may act as an environmental filter. Taken together, these findings suggest that inherent bark composition may influence microbial succession, especially when considering bark degradation.

Fig. 3.41. Working Model

Decomposition liberates bark content and influences microbial community composition

3.41. Habitat heterogeneity may affect decomposition at a local scale

Environmental factors that shape litter traits, may influence microbial community assemblages, which may impact decomposer performance (Strickland et al., 2009,

Hansen, 1999a). In ‘home’ environments, decomposers are thought to be more efficient at mineralizing litter (Strickland et al., 2009). The so-called “home-field advantage” has been implicated at the ecosystem scale (García-Palacios et al., 2016, Ayres et al., 2009), but compellingly, bark decomposition effects may vary at a local scale. Eastern hemlock is commonly found on steep slopes at wet cool sites (Mahan et al., 2004), but this does not explain as to why bark decomposition was suppressed in eastern hemlock soils (Fig.

3.32A). Perhaps differences in the litter chemistry of eastern hemlock needles versus white oak broad leaves may have played a role. The legacy of the soil regime, including nutrient availability, may impose an effect on decomposers. At a mountainous sub-arctic birch forest, inorganic nitrogen amendments decreased decomposer activity (Bödeker et al.,

2014). This pattern was also observed at a boreal Scots pine forest (Bödeker et al., 2014).

At ecosystems of lower latitudes, specifically a New England temperate deciduous forest, inorganic nitrogen additions also decreased decomposer activity (Diepen et al., 2017).

This may suggest nitrogen form or abundance may have influenced results of the present study, as bark decomposition varied at a mixed hardwood forest in central Pennsylvania.

On the other hand, our findings may be purely due to litter type.

3.42. Decomposition and litter traits may shape community structure

Decomposition and the liberation of bark chemical contents may select for distinct microbial assemblages. Dossa et al. (2018) reported bark decomposition to influence faunal community assemblages, which suggest environmental filtration can be mediated by recalcitrant litter. In this study, bark decomposition may have also acted as an environmental filter. The relative abundance of Ascomycota in the initial bark was lesser than that of the adherent soil community (Fig 3.37, right panel). A similar trend was observed among bacteria, as the initial bark had less Actinobacteria than the adherent soil community (Fig 3.37, left panel).

The transient nature of decomposition may help shape microbial succession. As decomposition progresses, there is a change in substrate’s rigidness, density and mass

(Pyle and Brown, 1998), which has been shown to correspond with nitrogen mineralization and lignocellulose solubilization (Melillo et al., 1982, Pointing et al., 2003).

Progressive change in litter traits may reflect the interconnectedness of organisms that make up the soil food web. Among fungal communities, Zygomycota was undetected in the initial bark of white oak, but present in the initial bark of eastern hemlock (Fig. 3.37).

With respect to bacterial communities, TM7 and Bacteroidetes were detected in initial bark of white oak, but were at minimum levels in the initial bark of eastern hemlock (Fig. 3.37).

This may suggest that bark physical traits influence microbial colonization and

100 succession, and that these physical traits are species-specific, which may explain the difference in eastern hemlock and white oak bark microbiome.

Bark traits including thickness, looseness, fissure index, water storage capacity and pH may have also played a role in community structure, as these traits have been shown to impact faunal community composition (Zuo et al., 2016). Similarly, these traits are likely to influence microbial community composition. Microbial and faunal organisms may work together to recycle litter. This may explain as to why isopods were found to be most effective at decomposing litter that had been previously conditioned by microbial organisms (Wensem et al., 1993). Although this study mainly focuses on microbial response to decomposition, higher trophic consumers of the soil food web are likely to play a role in nutrient cycling.

3.5. Conclusion

Common history among decomposers and fallen litter is foundational to the

“home-field advantage” hypothesis (Strickland et al., 2009, Ayres et al., 2009). Though this hypothesis may hinge on labile litter input, mixed results were observed in this decomposition study. Hence, the “home-field advantage” was observed to be species specific, as white oak decomposition was advanced in ‘home’ soil. However, a “home- field advantage” was undetected for eastern hemlock tissue. These results may also be due to soil conditions that may have been conditioned by canopy trees.

101

Decomposition may also act as an environmental filter, as bacterial and fungal assemblages depended on bark type, as opposed to the underlying soil regime (Fig. 4.35 and 4.36). Taken together, these findings suggest that bark structural and chemical content can a exert a stronger influence on microbial assemblage then the soil legacy.

102

Acknowledgement

Collaborators: RV Trexler, DM Eissenstat and TH Bell. College of Agricultural

Sciences and Huck Institute of Sciences - Ecology Program. Special thanks to Mary Ann

Bruns, Armen Kemanian, Alan H. Taylor and David Munoz for helpful discussions.

103

References

ABRAMS, M. D. 2003. Where has all the white oak gone? BioScience, 53, 927-939.

ANDERSON, M. J. 2001. A new method for non-parametric multivariate analysis of variance. Austral ecology, 26, 32-46.

APPRILL, A., MCNALLY, S., PARSONS, R. & WEBER, L. 2015. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquatic Microbial Ecology, 75, 129-137.

AYRES, E., STELTZER, H., SIMMONS, B. L., SIMPSON, R., STEINWEG , M., WALLENSTEIN , M., MELLOR , N., PARTON , W., MOORE , J. & WALL, D. 2009. Home- field advantage accelerates leaf litter decomposition in forests. Soil Biology and Biochemistry, 41, 606-610.

BLAGODATSKAYA, Е. & KUZYAKOV, Y. 2008. Mechanisms of real and apparent priming effects and their dependence on soil microbial biomass and community structure: critical review. Biology and Fertility of Soils, 45, 115-131.

BÖDEKER, I., CLEMMENSEN, K. E., BOER, W., MARTIN, F., OLSON, Å. & LINDAHL, B. D. 2014. Ectomycorrhizal Cortinarius species participate in enzymatic oxidation of humus in northern forest ecosystems. New Phytologist, 203, 245-256.

CAPORASO, J. G., KUCZYNSKI, J., STOMBAUGH, J., BITTINGER, K., BUSHMAN, F. D., COSTELLO, E. K., FIERER, N., PENA, A. G., GOODRICH, J. K. & GORDON, J. I. 2010. QIIME allows analysis of high-throughput community sequencing data. Nature methods, 7, 335.

CEBRIAN, J. 1999. Patterns in the fate of production in plant communities. The American Naturalist, 154, 449-468.

CERNUSAK, L. A. & CHEESMAN, A. W. 2015. The benefits of recycling: how photosynthetic bark can increase drought tolerance. New Phytologist, 208, 995-997.

CHAPMAN, S. K., HART, S. C., COBB, N. S., WHITHAM, T. G. & KOCH, G. W. 2003. Insect herbivory increases litter quality and decomposition: an extension of the acceleration hypothesis. Ecology, 84, 2867-2876.

D’ANNUNZIO, R., ZELLER, B., NICOLAS, M., DHÔTE, J.-F. & SAINT-ANDRÉ, L. 2008. Decomposition of European beech (Fagus sylvatica) litter: Combining quality theory and 15N labelling experiments. Soil Biology and Biochemistry, 40, 322-333.

DANTAS, V. D. L. & PAUSAS, J. G. 2013. The lanky and the corky: fire-escape strategies in savanna woody species. Journal of Ecology, 101, 1265-1272.

104

DIEPEN, L. T. A., FREY, S. D., LANDIS, E. A., MORRISON, E. W. & PRINGLE, A. 2017. Fungi exposed to chronic nitrogen enrichment are less able to decay leaf litter. Ecology, 98, 5-11.

DOSSA, G. G., SCHAEFER, D., ZHANG, J. L., TAO, J. P., CAO, K. F., CORLETT, R. T., CUNNINGHAM, A. B., XU, J. C., CORNELISSEN, J. H. & HARRISON, R. D. 2018. The cover uncovered: Bark control over wood decomposition. Journal of Ecology, 106, 2147- 2160.

DUMBRELL, A. J., NELSON, M., HELGASON, T., DYTHAM, C. & FITTER, A. H. 2010. Relative roles of niche and neutral processes in structuring a soil microbial community. The ISME journal, 4, 337.

EDGAR, R. C. 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics, 26, 2460-2461.

FANIN, N., FROMIN, N. & BERTRAND, I. 2016. Functional breadth and home-field advantage generate functional differences among soil microbial decomposers. Ecology.

FENG, S., CHENG, S., YUAN, Z., LEITCH, M. & XU, C. C. 2013. Valorization of bark for chemicals and materials: A review. Renewable and Sustainable Energy Reviews, 26, 560- 578.

FRESCHET, G. T., AERTS, R. & CORNELISSEN, J. H. 2012. Multiple mechanisms for trait effects on litter decomposition: moving beyond home-field advantage with a new hypothesis. Journal of Ecology, 100, 619-630.

GARCÍA-PALACIOS, P., MCKIE, B. G., HANDA, I. T., FRAINER, A. & HÄTTENSCHWILER, S. 2016. The importance of litter traits and decomposers for litter decomposition: a comparison of aquatic and terrestrial ecosystems within and across biomes. Functional Ecology, 30, 819-829.

GARDES, M. & BRUNS, T. D. 1993. ITS primers with enhanced specificity for basidiomycetes-application to the identification of mycorrhizae and rusts. Molecular ecology, 2, 113-118.

GESSNER, M. O., SWAN, C. M., DANG, C. K., MCKIE, B. G., BARDGETT, R. D., WALL, D. H. & HÄTTENSCHWILER, S. 2010. Diversity meets decomposition. Trends in ecology & evolution, 25, 372-380.

105

HANSEN, R. A. 1999. Red oak litter promotes a microarthropod functional group that accelerates its decomposition. Plant and Soil, 209, 37-45.

HARKIN, J. M. & ROWE, J. W. 1971. Bark and its possible uses. (Research note FPL; 091): 56 p., 91.

HARMON, M. E. 1989. Effects of bark fragmentation on plant succession on conifer logs in the Picea-Tsuga forests of Olympic National Park, Washington. American Midland Naturalist, 112-124.

HASENMUELLER, E. A., GU, X., WEITZMAN, J. N., ADAMS, T. S., STINCHCOMB, G. E., EISSENSTAT, D. M., DROHAN, P. J., BRANTLEY, S. L. & KAYE, J. P. 2017. Weathering of rock to regolith: The activity of deep roots in bedrock fractures. Geoderma, 300, 11-31.

HÄTTENSCHWILER, S., COQ, S., BARANTAL, S. & HANDA, I. T. 2011. Leaf traits and decomposition in tropical rainforests: revisiting some commonly held views and towards a new hypothesis. New Phytologist, 189, 950-965.

HIBBING, M. E., FUQUA, C., PARSEK, M. R. & PETERSON, S. B. 2010. Bacterial competition: surviving and thriving in the microbial jungle. Nature reviews microbiology, 8, 15.

HOBBIE, S. E., REICH, P. B., OLEKSYN, J., OGDAHL, M., ZYTKOWIAK, R., HALE, C. & KAROLEWSKI, P. 2006. Tree species effects on decomposition and forest floor dynamics in a common garden. Ecology, 87, 2288-2297.

HOLDEN, S. R., BERHE, A. A. & TRESEDER, K. K. 2015. Decreases in soil moisture and organic matter quality suppress microbial decomposition following a boreal forest fire. Soil Biology and Biochemistry, 87, 1-9.

HOTHORN, T., BRETZ, F. & WESTFALL, P. 2008. Simultaneous inference in general parametric models. Biometrical journal, 50, 346-363.

HOTHORN, T., BRETZ, F., WESTFALL, P., HEIBERGER, R. M., SCHUETZENMEISTER, A. & SCHEIBE, S. 2013. multcomp: simultaneous inference in general parametric models. R package version 1.2-18. Foundation for Statistical Computing, Vienna, Austria.

HOWARD, M. M., BELL, T. H. & KAO-KNIFFIN, J. 2017. Soil microbiome transfer method affects microbiome composition, including dominant microorganisms, in a novel environment. FEMS microbiology letters, 364.

KUMBHARE, M., GULEHA, V. & SIVAKUMAR, T. 2012. Estimation of total phenolic content, cytotoxicity and in–vitro antioxidant activity of stem bark of Moringa oleifera. Asian Pacific Journal of Tropical Disease, 2, 144-150.

106

LANGILLE, M. G., ZANEVELD, J., CAPORASO, J. G., MCDONALD, D., KNIGHTS, D., REYES, J. A., CLEMENTE, J. C., BURKEPILE, D. E., THURBER, R. L. V. & KNIGHT, R. 2013. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nature biotechnology, 31, 814.

LEWIS, S. L., LOPEZ-GONZALEZ, G., SONKÉ, B., AFFUM-BAFFOE, K., BAKER, T. R., OJO, L. O., PHILLIPS, O. L., REITSMA, J. M., WHITE, L. & COMISKEY, J. A. 2009. Increasing carbon storage in intact African tropical forests. Nature, 457, 1003.

MAHAN, C., SULLIVAN, K. L., BLACK, B., KIM, K. C. & YAHNER, R. H. 2004. Overstory tree composition of eastern hemlock stands threatened by the hemlock woolly adelgid at Delaware Water Gap National Recreation Area. Castanea, 69, 30-38.

MALIK, R. J. 2019. No “Gadgil effect”: Temperate tree roots and soil lithology are effective predictors of wood decomposition. Forest Pathology, e12506.

MARTIN, K. J. & RYGIEWICZ, P. T. 2005. Fungal-specific PCR primers developed for analysis of the ITS region of environmental DNA extracts. BMC microbiology, 5, 28.

MCDONALD, D., PRICE, M. N., GOODRICH, J., NAWROCKI, E. P., DESANTIS, T. Z., PROBST, A., ANDERSEN, G. L., KNIGHT, R. & HUGENHOLTZ, P. 2012. An improved Greengenes taxonomy with explicit ranks for ecological and evolutionary analyses of bacteria and archaea. The ISME journal, 6, 610.

MELILLO, J. M., ABER, J. D. & MURATORE, J. F. 1982. Nitrogen and lignin control of hardwood leaf litter decomposition dynamics. Ecology, 63, 621-626.

MULLICK, D. B. 1977. The non-specific nature of defense in bark and wood during wounding, insect and pathogen attack. The structure, biosynthesis, and degradation of wood. Springer.

OKSANEN, J., BLANCHET, F. G., KINDT, R., LEGENDRE, P., MINCHIN, P. R., O’HARA, R., SIMPSON, G. L., SOLYMOS, P., STEVENS, M. H. H. & WAGNER, H. 2013. Package ‘vegan’. Community ecology package, version, 2.

PAINE, C. E. T., STAHL, C., COURTOIS, E. A., PATIÑO, S., SARMIENTO, C. & BARALOTO, C. 2010. Functional explanations for variation in bark thickness in tropical rain forest trees. Functional Ecology, 24, 1202-1210.

PARADA, A. E., NEEDHAM, D. M. & FUHRMAN, J. A. 2016. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environmental microbiology, 18, 1403-1414.

PEARCE, R. 1996. Antimicrobial defences in the wood of living trees. New Phytologist, 132, 203-233.

107

PENG, K., JIN, L., NIU, Y. D., HUANG, Q., MCALLISTER, T. A., YANG, H. E., DENISE, H., XU, Z., ACHARYA, S., WANG, S. & WANG, Y. 2018. Condensed Tannins Affect Bacterial and Fungal Microbiomes and Mycotoxin Production during Ensiling and upon Aerobic Exposure. Applied and Environmental Microbiology, 84, e02274-17.

PEREZ-GARCIA, J., LIPPKE, B., COMNICK, J. & MANRIQUEZ, C. 2007. An assessment of carbon pools, storage, and wood products market substitution using life-cycle analysis results. Wood and Fiber Science, 37, 140-148.

POINTING, S. B., PARUNGAO, M. M. & HYDE, K. D. 2003. Production of wood-decay enzymes, mass loss and lignin solubilization in wood by tropical Xylariaceae. Mycological Research, 107, 231-235.

POSADA, R. H., MADRIÑAN, S. & RIVERA, E.-L. 2012. Relationships between the litter colonization by saprotrophic and arbuscular mycorrhizal fungi with depth in a tropical forest. Fungal biology, 116, 747-755.

PROSSER, J. I., BOHANNAN, B. J., CURTIS, T. P., ELLIS, R. J., FIRESTONE, M. K., FRECKLETON, R. P., GREEN, J. L., GREEN, L. E., KILLHAM, K. & LENNON, J. J. 2007. The role of ecological theory in microbial ecology. Nature Reviews Microbiology, 5, 384.

PYLRO, V. S., ROESCH, L. F. W., MORAIS, D. K., CLARK, I. M., HIRSCH, P. R. & TÓTOLA, M. R. 2014. Data analysis for 16S microbial profiling from different benchtop sequencing platforms. Journal of microbiological methods, 107, 30-37.

READ, D. & PEREZ-MORENO, J. 2003. Mycorrhizas and nutrient cycling in ecosystems– a journey towards relevance? New Phytologist, 157, 475-492.

ROGNES, T., FLOURI, T., NICHOLS, B., QUINCE, C. & MAHÉ, F. 2016. VSEARCH: a versatile open source tool for metagenomics. PeerJ, 4, e2584.

ROSELL, J. A., CASTORENA, M., LAWS, C. A. & WESTOBY, M. 2015. Bark ecology of twigs vs. main stems: functional traits across eighty-five species of angiosperms. Oecologia, 178, 1033-1043.

ROYER, M., DIOUF, P. N. & STEVANOVIC, T. 2011. Polyphenol contents and radical scavenging capacities of red maple (Acer rubrum L.) extracts. Food and Chemical Toxicology, 49, 2180-2188.

SCHIMEL, J. P., GULLEDGE, J. M., CLEIN-CURLEY, J. S., LINDSTROM, J. E. & BRADDOCK, J. F. 1999. Moisture effects on microbial activity and community structure in decomposing birch litter in the Alaskan taiga. Soil Biology and Biochemistry, 31, 831- 838.

108

SCHLOSS, P. D., WESTCOTT, S. L., RYABIN, T., HALL, J. R., HARTMANN, M., HOLLISTER, E. B., LESNIEWSKI, R. A., OAKLEY, B. B., PARKS, D. H. & ROBINSON, C. J. 2009. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol., 75, 7537-7541.

SHAH, F., NICOLÁS, C., BENTZER, J., ELLSTRÖM, M., SMITS, M., RINEAU, F., CANBÄCK, B., FLOUDAS, D., CARLEER, R. & LACKNER, G. 2016. Ectomycorrhizal fungi decompose soil organic matter using oxidative mechanisms adapted from saprotrophic ancestors. New Phytologist, 209, 1705-1719.

SHAY, P.-E., CONSTABEL, C. P. & TROFYMOW, J. 2018. Evidence for the role and fate of water-insoluble condensed tannins in the short-term reduction of carbon loss during litter decay. Biogeochemistry, 137, 127-141.

SHOROHOVA, E. & KAPITSA, E. 2014. Mineralization and fragmentation rates of bark attached to logs in a northern boreal forest. Forest ecology and management, 315, 185- 190.

SINSABAUGH, R. L. & SHAH, J. J. F. 2011. Ecoenzymatic stoichiometry of recalcitrant organic matter decomposition: the growth rate hypothesis in reverse. Biogeochemistry, 102, 31-43.

STRICKLAND, M. S., LAUBER, C., FIERER, N. & BRADFORD, M. A. 2009. Testing the functional significance of microbial community composition. Ecology, 90, 441-451.

SULMAN, B. N., BRZOSTEK, E. R., MEDICI, C., SHEVLIAKOVA, E., MENGE, D. N. & PHILLIPS, R. P. 2017. Feedbacks between plant N demand and rhizosphere priming depend on type of mycorrhizal association. Ecology letters, 20, 1043-1053.

SULTANA, B., ANWAR, F. & PRZYBYLSKI, R. 2007. Antioxidant activity of phenolic components present in barks of Azadirachta indica, Terminalia arjuna, Acacia nilotica, and Eugenia jambolana Lam. trees. Food Chemistry, 104, 1106-1114.

SWIFT, M. J., HEAL, O. W., ANDERSON, J. M. & ANDERSON, J. 1979. Decomposition in terrestrial ecosystems, Univ of California Press.

TRESEDER, K. K. & LENNON, J. T. 2015. Fungal traits that drive ecosystem dynamics on land. Microbiol. Mol. Biol. Rev., 79, 243-262.

ULYSHEN, M. D., MÜLLER, J. & SEIBOLD, S. 2016. Bark coverage and insects influence wood decomposition: Direct and indirect effects. Applied Soil Ecology, 105, 25-30.

109

VEEN, G., KEISER, A. D., VAN DER PUTTEN, W. H. & WARDLE, D. A. 2018. Variation in home-field advantage and ability in leaf litter decomposition across successional gradients. Functional ecology, 32, 1563-1574.

WALDROP, M. P. & FIRESTONE, M. K. 2004. Microbial community utilization of recalcitrant and simple carbon compounds: impact of oak-woodland plant communities. Oecologia, 138, 275-284.

WALL, D. H. & MOORE, J. C. 1999. Interactions underground: soil biodiversity, mutualism, and ecosystem processes. BioScience, 49, 109-117.

WENSEM, J., VERHOEF, H. A. & STRAALEN, N. M. 1993. Litter degradation stage as a prime factor for isopod interaction with mineralization processes. Soil Biology and Biochemistry, 25, 1175-1183.

WHITE, T., BRANTLEY, S., BANWART, S., CHOROVER, J., DIETRICH, W., DERRY, L., LOHSE, K., ANDERSON, S., AUFDENDKAMPE, A. & BALES, R. 2015. The role of critical zone observatories in critical zone science. Developments in earth surface processes. Elsevier.

ZAS, R., MOREIRA, X. & SAMPEDRO, L. 2011. Tolerance and induced resistance in a native and an exotic pine species: relevant traits for invasion ecology. Journal of Ecology, 99, 1316-1326.

ZHANG, Q.-F. & LAANBROEK, H. J. 2018. The effects of condensed tannins derived from senescing Rhizophora mangle leaves on carbon, nitrogen and phosphorus mineralization in a Distichlis spicata salt marsh soil. Plant and soil, 433, 37-53.

ZUO, J., BERG, M. P., KLEIN, R., NUSSELDER, J., NEURINK, G., DECKER, O., HEFTING, M. M., SASS-KLAASSEN, U., VAN LOGTESTIJN, R. S. & GOUDZWAARD, L. 2016. Faunal community consequence of interspecific bark trait dissimilarity in early- stage decomposing logs. Functional ecology, 30, 1957-1966.

110

Chapter 4: No “Gadgil effect”: Temperate tree roots and soil lithology are effective predictors of wood decomposition

Malik, R. J. (06/2019). No “Gadgil effect”: Temperate tree roots and soil lithology are effective predictors of wood decomposition. Forest Pathology. 2019 Jun;49(3):e12506.

Abstract

The “Gadgil effect” hypothesizes that woody root microbial associations may slow down decomposition through pre-emptive competition. In the context of recalcitrant litter decomposition, specifically coarse wood debris, it is uncertain as to what is the relative importance of soil communities associated with living roots when compared to those without roots. Here, it is hypothesized that the presence of live roots and active photosynthates will enhance wood decomposition. To test this hypothesis, the presence or absence of temperate tree roots was used in this study. Sugar maple (Acer saccharum) and white oak (Quercus alba) roots were manipulated at three sites of either limestone or shale parent rock residuum. At each site, wood substrate was placed in soils beneath the canopy of either A. saccharum or Q. alba, while in the presence of roots (root+). At the same time, wood substrate was placed in the same soil community, but live root exposure was eliminated by trenching (root−). This eliminated active photosynthate supply to the soil

111 microbial community. Results determined that live root exposure promoted faster decomposition and greater mycelial colonization of wood substrate. Also, sites of shale parent rock residuum had higher rates of decomposition in comparison with limestone parent rock residuum. Although additional work is needed to determine the extent in which roots and lithology can facilitate wood decomposition, these findings suggest that living roots impact decomposers and provide a pathway towards humus and soil organic matter formation.

4.1. Introduction

Community and organismal symbioses are widely studied at many scales of organization (Christian, Herre, Mejia, & Clay, 2017; Cirimotich et al., 2011; Hairston,

Smith, & Slobodkin, 1960; Moore, Berlow, Coleman, & Ruiter, 2004; Paine, 1980); yet, the outcome of living roots on decomposer activity remains to be fully understood. Woody roots and their associated microbes have led to considerable controversy in the realm of litter decomposition (Brzostek, Dragoni, Brown, & Phillips, 2015; Conn & Dighton, 2000;

Gadgil & Gadgil, 1971; Koide, Sharda, Herr, & Malcolm, 2008). With respect to leaf litter, roots and their associated fungi may stimulate or suppress decomposition through phytochemicals and rhizodeposits (Bird, Herman, & Firestone, 2011; Cheng & Kuzyakov,

2005; Helal & Sauerbeck, 1986; Paterson, 2003). While the effects of rhizodeposition on foliar litter decay may be driven by simple sugars, amino acids and root cells (Farrar,

112

Hawes, Jones, & Lindow, 2003; Jaeger, Lindow, Miller, Clark, & Firestone, 1999), there is very limited understanding as to how rhizodeposits may influence decomposition of coarse wood debris. Rhizodeposits may enable the establishment of a biodiverse soil community which may have long-term effects on ecosystem function. As roots release low molecular weight compounds, these compounds can impose selection on soil immediately adjacent to roots (Chaparro, Badri, & Vivanco, 2014; Micallef, Channer,

Shiaris, & Colón-Carmona, 2009). Selection, or the environmental filtration of microbes by rhizodeposits, may not only influence soil microbial community composition

(Christensen, Bjørnlund, & Vestergård, 2007; Glavatska et al., 2017), but also its functionality. Perhaps function may be dependent on root effects on nutrient cycling, especially, as it pertains to decomposition and the transformation of edaphic materials.

Determining the manner in which root-stimulated environments may affect recalcitrant litter decomposition can provide insight onto symbiosis among brown food web decomposers. Hence, soils rich in recalcitrant litter may be beneficial towards fungi and bacteria that use these compounds as substrate. As wood decomposition progresses, bacterial abundance has been shown to increase (Kielak, Scheublin, Mendes, Veen, &

Kuramae, 2016). At the community level, transforming woody substrate into labile forms enables nutrient mobilization, including a pathway towards humus and organic matter formation (Cotrufo et al., 2015; Dungait, Hopkins, Gregory, & Whitmore, 2012). Wood is not readily degradable, as its recalcitrance is due to high lignin and tannin content

113

(Guillén, Martínez, Gutiérrez, & Rio, 2005; Pérez, Munoz-Dorado, Rubia, & Martinez,

2002). These structural compounds can be degraded by few classes of organisms, including invertebrates and fungi (Rubino & McCarthy, 2003; Ulyshen, 2016; Yuan et al.,

2017). This may explain the findings of Griffiths, Bracewell, Robertson, and Bignell (2013), where high levels of lignin derived from beech and pine were detected in termite

(Zootermopsis nevadensis) frass, as even these organisms are partially dependent on microbial symbionts in order to metabolize wood (Brune & Dietrich, 2015; Poulsen et al.,

2014).

Fungi can also be major decomposers of woody tissue. White rot fungi effectively degrade lignin through oxidative enzymes that selectively cleave lignin C–C bonds

(Blanchette, 1984; Munk, Sitarz, Kalyani, Mikkelsen, & Meyer, 2015; Tien & Kirk, 1984).

Similarly, brown rot fungi can selectively degrade cellulose and depolymerize lignin through Fenton redox chemistry (Filley et al., 2002; Jensen, Houtman, Ryan, & Hammel,

2001), where Fe2+ is initially oxidized to Fe3+, sequentially leading to a series of chain reactions between Fe3+ and H2O2 (Arantes, Jellison, & Goodell, 2012). Similar to brown rot fungi, known species of root-associated ectomycorrhizal (EM) fungi may also degrade wood via Fenton redox chemistry (Lindahl & Tunlid, 2015; Rineau et al., 2012). However, due to the evolutionary divergence and local adaptation of various ectomycorrhizal lineages, decomposer activity may depend on life histories, including the retention and

114 expression of lignocellulolytic genes in mycelial networks, as well as the transfer of mineralized N to the host-plant roots (Pellitier & Zak, 2018).

Aside from roots, soil lithology and parent rock material may influence decomposition, as these geological properties can influence soil pH, clay mineralogy and drainage (Jenny, 1994). For example, fungal to bacterial ratios are greatest when soil pH is low (Cheeke et al., 2017), and decomposer activity is directly related to clay mineralogy and soil moisture (Griffin, 1977; Lavelle, Blanchart, Martin, Martin, & Spain, 1993). As it relates to soil moisture, roots may impose a “drying effect” on the soil environment

(Cheng & Kuzyakov, 2005; Koide & Wu, 2003), thereby constraining decomposition. To some degree, this may explain the findings of Gadgil and Gadgil (1971), where the presence of ectomycorrhizal Pinus radiata roots suppressed decomposition. This is known as the “Gadgil effect” (Fernandez & Kennedy, 2016).

To date, many studies addressing root effects on decomposition have looked at either foliar degradation or root-stimulated activity to make inferences regarding root- mediated decomposition (Brzostek et al., 2015; Cheng, Johnson, & Fu, 2003; Conn &

Dighton, 2000; Hodge, Campbell, & Fitter, 2001). Here in this study, roots beneath the canopy of two temperate tree species were chosen, as the aim was to determine whether root presence accelerates wood decomposition. Using roots directly beneath the canopy of Acer saccharum and Quercus alba, the following questions are posed: (a) Do the presence of live roots increase decomposition of wood substrate? and (b) What is the role of soil

115 parent rock residuum? Here, it is hypothesized that: (a) wood decomposition will be accelerated due to root's active supply of photosynthate, (b) and soil lithology and parent rock residuum are underlying factors that may help predict wood decomposition.

4.2 Methods

4.21. Sites of contrasting lithologies

Roots beneath the canopy of Acer saccharum (sugar maple) and Quercus alba (white oak) were used at three sites within a 20 km distance (Fig 4.21). Sites were located in

Centre County, Pennsylvania. Sites were of limestone or shale parent rock residuum

(Table 4.21). The average temperature in this region is 10 degrees Celsius. Annual mean precipitation is 1,006 mm. Across sites, wood substrate was exposed to root zone soil communities beneath the canopy of 75 tree individuals (Acer saccharum and Quercus alba) for six months. Beneath each canopy (n = 75), the root exposure treatment (root+) was coupled with a non-root (root−) exposure treatment. Thus, soil communities harboring wood debris were either subjected to an active supply of plant photosynthate (root+) or the contrary, where the source of photosynthate was made inactive (root−).

Hartley Woods (40°48′N 77°52′W) is a flat continuous site. The soil is derived from limestone parent rock residuum. The soil series is primarily Opequon rock, with a 0–8 percent slope (Order: Alfisols, Greatgroup: Hapludalfs). The pH of this soil series is

116 commonly found to be in the range of 6.2 and 6.3 at shallow depths. Hartley Woods are a remnant forest with oak canopy species as old as 300 years.

Common Garden (40°42′N, 77°57′W) is a flat continuous site comprised of silt loam.

This site is on semi-active mesic Typic Hapludalf (Cheng et al., 2016). The soil is derived from limestone parent rock residuum. Soil commonly found at this site is Hagerstown 0–

3 percent slope (Order: Alfisols, Greatgroup: Hapludalfs). Moreover, the soil pH at this site is normally a pH of 6. Also, previous land use at this site was grassy hay-field prior to becoming a research site (Cheng et al., 2016). This site has about 20 trees species, including oaks and maples, that are evenly distributed and maintained for research purposes.

Shale Hill's Critical Zone Observatory (Shale Hills, 40°39′N, 77°54′W) rests on a ridge with north- and south-facing slopes. The soil at this site is derived from shale parent rock residuum (Hasenmueller et al., 2017). Soil commonly found at this site is Berks–Weikert

(Order: Inceptisol, Great Group: Dystrudepts). These soils are well drained with percentages of channery shale increasing with soil depth (White et al., 2015). The pH is about 5.8 at shallow depths. Above ground the aerial environment includes oak (Quercus), hickory

(Carya) and pine (Pinus) canopy species.

117

Fig. 4.21 Geographic distribution of sites.

Map was created with RgoogleMaps package

118

Table 4.21. Expected soil characteristics based on soil series

119

4.22. Experimental design

Roots beneath the canopy of sugar maple and white oak were used for this study.

To account for edaphic variation, this study also included sites of contrasting parent rock residuum, as parent rock material is known to effect soil production, composition, pH and edaphic community diversity (Bulgarelli et al., 2012; Jenny, 1994). The experimental design consisted of 2 trees species*15 replicates*3 sites*2 root levels (± roots) for a total of

180 observations. However, sugar maple at Hartley Woods was lost due to flag removal, reducing the experiment to a total of 149 observations for analysis. This did not affect experimental balance since root+ and root – treatments were equally misplaced.

4.23. Root+ soil community: subjecting wood substrate to active photosynthate

The study was conducted from 1 November 2016 to 1 June 2017 under the following experimental design (Fig. 4.22). Dried commercial wood chips derived from white oak were weighed for initial mass and inserted into cylindrical cores (10 cm length by 5 cm diameter) with 0.5 × 0.5 cm window openings. Each core contained commercial wood chips of 5.5 g with the approximate dimension of 2.5 × 2.5 × 0.25 cm. Beneath the canopy of sugar maple or white oak, an excavation was made to accommodate each core.

This allowed excavation and core to be of comparable sizes. Each excavation was made to be at a distance of 37.5 cm from the reference tree's stem. Cylindrical cores were also filled with native soil beneath the canopy of each tree individual. Soils were untreated while containing detritus and native microbes. Cylindrical cores were buried in a

120 horizontal position. The depth of the excavation was 10 cm because decomposing woody debris tends to be greatest at shallow depths (e.g., Posada, Madriñan, and Rivera (2012)).

After 6 months in the excavated burial, cores were removed from the field and brought to the laboratory for analysis.

121

Fig 4.22. Experimental flow chart:

The experimental procedure performed in this study is shown in the flow chart

122

4.24. Root– soil community: subjecting wood substrate to inactive photosynthate

Cylindrical cores containing commercial wood chips were prepared as described above, but to control for root exposure (root−), a trenching approach was used (Fernandez

& Kennedy, 2016). The purpose of the trench was to eliminate an active supply of photosynthate to soil microbes including obligate mycorrhizae. The trench was made at the time of the experiment. An excavation was made to accommodate a corrugated pipe that would restrict live root effects. Root cores were housed in the trenches of 10 cm diameter. The corrugated pipe was 10 cm in height, which was consistent with the depth of the excavation. The diameter of the pipe was also 10 cm, which was exactly the same as the length of the core. Finally, trenches were filled in with untreated native soils.

4.25. Decomposition

After six months of field incubation, wood substrate was harvested and brought back to the laboratory. The substrate was scored for wood rot or fungal colonization as follows: weak to non-colonization, partial colonization or dense colonization. Weak to non-colonization, hereafter referred to as non-colonization, was classified as wood substrate void of a mycelial sheath, with respect to the naked eye. Partial colonization was classified as wood substrate positive for mycelial cover, but less than 50% cover, also with respect to the naked eye. Dense colonization was classified as wood substrate with greater than 50% mycelial cover. Microscopic detection of mycelium was not needed since microscopic colonization would have been classified as weak to non-colonization,

123 with respect to the ranking system described. Mycelium and soil colloids adhering to wood chips were preserved in 1.5-microlitre Eppendorf tubes for pH analysis. A total of

18 random samples (six per site) were assessed to confirm soil pH across sites at the time of the study. The pH of soil colloids adhering to wood surfaces were extracted using 0.01

M CaCl2 (Houba, Temminghoff, Gaikhorst, & Vark, 2000), at a 1:2 to ratio (soil: CaCl2 solution). Afterwards, remnant soil colloids were washed away from wood surfaces with a squirt bottle and slight rubbing with nylon gloves. Wood substrate was then oven-dried for 5 days at 40°C. After the drying period, final wood mass was recorded and decomposition was computed. Wood decomposition was quantified by assessing relative mass loss ((initial mass–final mass)/initial mass).

4.26. Statistical analysis

Graphical analysis assessed normality using kernel density plot in R version 3.3.3.

Change in wood mass was square-root transformed to meet assumptions of normality.

Levene's test was performed to analyze for homogeneity of variance. The ANOVA model included proportionate mass loss as the response or outcome variable, while soil community treatment was the explanatory variable. Sites were held as a covariate and assessed for an interaction with soil community treatment. Tukey's HSD was used for post hoc analysis. After the aforementioned analyses, the ANOVA model was then decomposed into apriori contrasts using the Rstudio's multcomp package (Hothorn et al.,

2013)—followed by simultaneous tests of general linear hypotheses (Hothorn, Bretz, &

124

Westfall, 2008). Contrasts included the means of sugar maple versus white oak; means of sugar maple root+ versus sugar maple root−; means of white oak root+ versus white oak root−; and the overall means of root+ versus root−. Soil colloid pH was assessed separately because it only included six random samples from each of the three sites. Site was held as the explanatory variable and pH the response variable. This was also followed up by Tukey HSD post hoc analysis. Mycelial density was analyzed using ordinal ranks for levels of colonization. Non-colonization was the lowest rank, 0. Partial colonization was an intermediate rank, 1. Dense colonization was the highest rank, 2. Chi- square analysis via Dunn.test package in rstudio was used for multiple comparisons using sum of ranks (Dinno, 2015). This enabled Kruskal–Wallis analysis with Bonferroni correction for multiple group comparisons.

125

4.3. Results

4.31. Root effects on wood rot

Mycelial cover was greatest in soil communities with living roots (Fig. 4.31a;

Kruskal–Wallis chi‐squared = 11.3084, df = 3, p = 0.01). Hence, mycelial colonization differed significantly between sugar maple root– and two other treatments, sugar maple root− versus sugar maple root+ (Kruskal–Wallis, Bonferroni correction, p < 0.05), as well as sugar maple root− versus white oak root+ (Kruskal–Wallis, Bonferroni correction, p < 0.05).

Overall, mycelial cover was widespread in root+, in contrast to root− treatments (Fig.

4.31a, c).

4.32. Root effects on wood mass loss

Roots had a significant effect on wood mass loss, or decomposition (Table 3.31,

F3,139 = 2.664, p = 0.05), as decomposition was greatest in soil communities with living roots

(root+), as compared to soil communities without living roots (root−) (Fig. 4.31c). These results were mainly due to limited decomposition observed in white oak root− (Fig.

4.31b). Hence, white oak root− had 3.5% less decomposition than white oak root+ (apriori contrasts, p = 0.03). White oak root− also differed from sugar maple root+. Hence, white oak root− soil communities decomposed wood substrate at a lesser rate than sugar maple root+ soil communities. In fact, the rate of decomposition differed between these two

126 treatments by about 2.4% (Tukey HSD, p = 0.04). Despite these differences (Fig. 4.31b), overall decomposition among sugar maple roots did not significantly differ from white oak roots (ANOVA, white oak vs. sugar maple apriori contrasts, p > 0.05).

4.33. Lithology effect on decomposition

Difference in pH was found across sites of varying lithologies (ANOVA F 2,15 = 8.33, p = 0.00389), as pH was lowest at Shale Hills and highest at the common garden. Lithology also had a significant effect on mycelial colonization, as mycelial cover was greatest at

Shale Hills (Kruskal‐Wallis, Bonferroni correction, chi-squared = 6.2099, df = 2, p = 0.04).

Lithology also had a significant effect on decomposition (ANOVA, F 2,139 = 7.24, p =

0.00102, Fig. 4.32). Specifically, Shale Hills yielded a decomposition rate that was 2.5% greater than the common garden and 2.4% greater than Hartley Woods (Fig. 4.32, Shale

Hills vs. common garden, Tukey HSD p = 0.002; Shale Hills vs. Hartley Woods, Tukey

HSD p = 0.018).

127

Table 4.31 Source of decomposition variation

The presence (root+) or absence (root−) of sugar maple and white oak roots was used to assess the role of active photosynthate in decomposition. Site effects were held as a covariate and assessed for an interaction. Asterisk indicates significance (alpha ≤ 0.05).

128

Fig. 4.31. The effect of roots on wood decomposition.

The effect of roots on wood decomposition. (a) Levels of wood rot were characterized by a severity index. Sugar maple root− versus sugar maple root+ was significant (p = 0.03) as was sugar maple root− versus white oak root+ (p = 0.02). (b) Wood decomposition was measured as proportionate mass loss. Asterisks indicate significance at an alpha of 0.05. The notch in the boxplots is representative of 95% CI around the mean.

The upper edge and lower edge of each boxplot is the upper and lower median, or quartile. The whiskers represent 1.5× the interquartile. Points beyond the whiskers are outliers. (c) Depicted here is average decomposition of wood substrates in soil communities with or without living roots. The outer bars represent proportionate mass loss (±SE) after 6 months. Inner bars represent severity of wood rot, after 6 months. o white

129 here is average decomposition of wood substrates in soil communities with or without living of woo, after 6 months

Fig. 4.32 The overall influence of soil lithology (site effects) on wood decomposition.

Depicted here is a boxplot of wood mass loss across sites. Also, the average soil pH for colloids adhering to wood substrate was assessed at each site using

CaCl2 extraction method.

130

4.4. Discussion

Although roots may be essential for establishing biodiverse soil communities, their presence may also play a role in sustaining ecosystem function, specifically, as it pertains to decomposition. In this study, decomposition was quantified as proportionate mass loss, which has been previously shown to correspond to nitrogen mineralization and lignocellulose solubilization (Melillo, Aber, & Muratore, 1982; Stephen & Parungao,

2003). Here, it was observed that living roots accelerated wood mass loss (Fig. 4.31c). This suggests that roots provide a pathway towards humus and soil organic matter formation.

The mechanism at play is believed to be an active supply of photosynthate, including small molecular weight compounds, specifically amino acids and simple sugars that are believed to stimulate soil microbial communities (McNear, 2013). This is supported by the evidence presented here, as roots increased decomposition by about 3% (Fig. 4.31b).

These findings contrast the “Gadgil effect” and “drying effect” hypotheses, which infers that woody roots can slow down decomposition through pre-emptive competition.

Absorptive roots can reduce soil moisture via xylem transpiration (Denmead & Shaw,

1962), as this “drying effect” is believed to slow down decomposition. However, the opposite effect was observed in the root+ treatment where decomposition was actually increased. Soil lithology may also be an underlying factor (Table 4.21), as sites of contrasting parent rock residuum were significant predictors of wood decomposition

131

(Table 3.31). Moving forward, models should incorporate root effects and soil lithology as predictors of wood decomposition.

4.41. Soil lithology is an effective predictor of decomposition

The weathering of parent rock material gives rise to soil series, which can then be used to estimate soil properties including pH (Lyon & Buckman, 1922). Sites of varying soil series were significant predictors of wood decomposition. Shale parent rock residuum had the greatest rate of decomposition, as opposed to sites of limestone parent rock residuum (Fig. 4.32). This makes sense since the Shale Hills site was predicted to have the lower pH (Table 4.21). This prediction was supported by pH analysis reported in this present study, as the site of shale parent rock residuum indeed had the lower pH when compared to sites of limestone parent rock residuum (Fig. 4.32). In line with this, fungal abundance has been shown to be greatest in soils of a rather low pH (Cheeke et al., 2017), perhaps suggesting that soil lithology can be used to project rates of wood decomposition.

4.42. Roots stimulate decomposition

Roots influence decomposition. In theory, AM-associated sugar maple and EM- associated white oak should differ in their ability to impact soil microbial communities.

AM-associated sugar maple has been previously shown to have a lower root chemical leaching rate in comparison to EM-associated white oak (Yin, Wheeler, & Phillips, 2014).

Thus, it is feasible that EM-associated white oak can support more microbes through

132 higher root exudation. However, Yin et al. (2014) found this to only be true for summer months. Previous models have shown roots to enhance decomposition while decreasing soil organic carbon (Moore et al., 2015). Similarly, the findings of this study suggest that roots accelerate decomposition. The mechanism at play is likely to include rhizodeposits and root chemical leachates that may act as environmental filters to promote select microbial assemblages of capable trophic guilds (Bever et al., 2010; Philippot,

Raaijmakers, Lemanceau, & Putten, 2013; Van Der Heijden, Bardgett, & Straalen, 2008).

In this study, it was also observed that roots increased mycelial colonization of wood substrate, which supports the notion that roots promote soil community function.

4.43. Roots and fungal interactions

Although wood is recalcitrant, it is a vital resource for its colonizers and the soil food web. Roots can influence microbial processes that are pertinent to nutrient mobilization (McNear, 2013). Roots may modulate humus and soil organic matter formation through nutrient release or sequestration (Fontaine et al., 2011). In addition, this may lead to interactions between facultative and obligate fungi. The interplay between roots and wood decomposers may provide further insight into nutrient cycling and trophic dynamics (Cairney & Meharg, 2002; Cheeke et al., 2017; Crowther, Boddy, &

Jones, 2011; Moore et al., 2004). The evidence presented in this study suggests roots provide a pathway towards humus and soil organic matter formation.

133

4.5. Conclusion

Although the root–soil interface may be the most biodiverse place in the soil environment, its function is driven by root stimuli (Philippot et al., 2013; Van Der Heijden et al., 2008). This is supported by the observation that soil communities with living roots enhance both decomposition and mycelial colonization. The mechanistic underpinning is likely to include photosynthates, such as small molecular weight compounds, amino acids and simple sugars that affect soil microbes. Nevertheless, these findings suggest that roots can enhance nutrient cycling and promote nutrient mobilization, even if the carbon-based material is woody and recalcitrant. This contrasts the so-called “Gadgil effect” and “drying effect,” which suggest that roots slow down decomposition. Here, decomposition was quantified as proportionate mass loss, which corresponds to nitrogen mineralization and lignocellulose solubilization (Melillo et al., 1982; Stephen & Parungao,

2003). Although additional work is needed to provide context as to the extent in which roots can enhance wood decomposition, these findings suggest that parent rock residuum is also a key factor, as parent rock residuum can shape soil properties (Jenny,

1994), including soil pH, drainage and clay mineralogy (Griffin, 1977; Lavelle et al., 1993).

Thus, soil lithology coupled with roots may be effective predictors of humus and soil organic matter formation. Taken together, it is strongly encouraged that roots and soil lithology be included in models that project rates of wood decomposition, especially as it relates to global change.

134

Acknowledgement

This study was conducted in Penn State's Stone Valley Forest, Hartley Woods and

Russel E. Larsen Agricultural Research Center. These sites are funded by Penn State's

College of Agriculture Sciences and managed by Penn State's Department of Ecosystem

Science and Management. Special thanks to Sue L. Brantley and David M. Eissenstat for helpful discussions. Also, David Despot, Weille Chen and Grady Zuiderveen for technical support. Financial support was also provided by National Science Foundation

Grant EAR – 1331726 (S. Brantley), and Penn State's Button Waller Fellowship.

135

References

ARANTES, V., JELLISON, J., & GOODELL, B. ( 2012). Peculiarities of brown-rot fungi and biochemical Fenton reaction with regard to their potential as a model for bioprocessing biomass. Applied Microbiology and Biotechnology, 94, 323– 338.

BEVER, J. D., DICKIE, I. A., FACELLI, E., FACELLI, J. M., KLIRONOMOS, J., MOORA, M., … ZOBEL, M. ( 2010). Rooting theories of plant community ecology in microbial interactions. Trends in Ecology & Evolution, 25, 468– 478.

BIRD, J. A., HERMAN, D. J., & FIRESTONE, M. K. ( 2011). Rhizosphere priming of soil organic matter by bacterial groups in a grassland soil. Soil Biology and Biochemistry, 43, 718– 725.

BLANCHETTE, R. A. (1984). Screening wood decayed by white rot fungi for preferential lignin degradation. Applied and Environmental Microbiology, 48, 647– 653.

BRUNE, A., & DIETRICH, C. ( 2015). The gut microbiota of termites: Digesting the diversity in the light of ecology and evolution. Annual Review of Microbiology, 69, 145– 166.

BRZOSTEK, E. R., DRAGONI, D., BROWN, Z. A., & PHILLIPS, R. P. ( 2015). Mycorrhizal type determines the magnitude and direction of root-induced changes in decomposition in a temperate forest. New Phytologist, 206, 1274– 1282.

BULGARELLI, D., ROTT, M., SCHLAEPPI, K., THEMAAT, E. V. L., AHMADINEJAD, N., ASSENZA, F., … SCHMELZER, E. ( 2012). Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature, 488, 91.

CAIRNEY, J. W. G., & MEHARG, A. A. ( 2002). Interactions between ectomycorrhizal fungi and soil saprotrophs: implications for decomposition of organic matter in soils and degradation of organic pollutants in the rhizosphere. Canadian Journal of Botany, 80, 803– 809.

CHAPARRO, J. M., BADRI, D. V., & VIVANCO, J. M. ( 2014). Rhizosphere microbiome assemblage is affected by plant development. The ISME Journal, 8, 790.

CHEEKE, T. E., PHILLIPS, R. P., BRZOSTEK, E. R., ROSLING, A., BEVER, J. D., & FRANSSON, P. ( 2017). Dominant mycorrhizal association of trees alters carbon and nutrient cycling by selecting for microbial groups with distinct enzyme function. New Phytologist, 214, 432– 442.

CHENG, L., CHEN, W., ADAMS, T. S., WEI, X., LI, L., MCCORMACK, M. L., … EISSENSTAT, D. M. (2016). Mycorrhizal fungi and roots are complementary in foraging within nutrient patches. Ecology, 97, 2815– 2823.

136

CHENG, W., JOHNSON, D. W., & FU, S. ( 2003). Rhizosphere effects on decomposition. Soil Science Society of America Journal, 67, 1418.

CHENG, W., & KUZYAKOV, Y. ( 2005). Root effects on soil organic matter decomposition. In R. W. Zobel, & S. F. Wright (Eds.), Roots and soil management: Interactions between roots and the soil ( 119– 143). San Antonio, TX: American Society of Agronomy.

CHRISTENSEN, S., BJØRNLUND, L., & VESTERGÅRD, M. ( 2007). Decomposer biomass in the rhizosphere to assess rhizodeposition. Oikos, 116, 65– 74.

CHRISTIAN, N., HERRE, E. A., MEJIA, L. C., & CLAY, K. ( 2017). Exposure to the leaf litter microbiome of healthy adults protects seedlings from pathogen damage. Proceedings of the Royal Society B: Biological Sciences, 284.

CIRIMOTICH, C. M., DONG, Y., CLAYTON, A. M., SANDIFORD, S. L., SOUZA-NETO, J. A., MULENGA, M., & DIMOPOULOS, G. ( 2011). Natural microbe-mediated refractoriness to Plasmodium infection in Anopheles gambiae. Science, 332, 855– 858.

CONN, C., & DIGHTON, J. ( 2000). Litter quality influences on decomposition, ectomycorrhizal community structure and mycorrhizal root surface acid phosphatase activity. Soil Biology and Biochemistry, 32, 489– 496.

COTRUFO, M. F., SOONG, J. L., HORTON, A. J., CAMPBELL, E. E., HADDIX, M. L., WALL, D. H., & PARTON, W. J. ( 2015). Formation of soil organic matter via biochemical and physical pathways of litter mass loss. Nature Geoscience, 8, ngeo2520.

CROWTHER, T. W., BODDY, L., & JONES, H. T. ( 2011). Species-specific effects of soil fauna on fungal foraging and decomposition. Oecologia, 167, 535– 545.

DENMEAD, O., & SHAW, R. H. ( 1962). Availability of soil water to plants as affected by soil moisture content and meteorological conditions. Agronomy Journal, 54, 385– 390.

DINNO, A. (2015). dunn test: Dunn’s test of multiple comparisons using rank sums. R package version, 1.

DUNGAIT, J. A., HOPKINS, D. W., GREGORY, A. S., & WHITMORE, A. P. ( 2012). Soil organic matter turnover is governed by accessibility not recalcitrance. Global Change Biology, 18, 1781– 1796.

FARRAR, J., HAWES, M., JONES, D., & LINDOW, S. ( 2003). How roots control the flux of carbon to the rhizosphere. Ecology, 84, 827– 837.

FERNANDEZ, C. W., & KENNEDY, P. G. ( 2016). Revisiting the ‘Gadgil effect’: Do interguild fungal interactions control carbon cycling in forest soils? New Phytologist, 209, 1382– 1394. https://doi.org/10.1111/nph.13648

137

FILLEY, T., CODY, G., GOODELL, B., JELLISON, J., NOSER, C., & OSTROFSKY, A. ( 2002). Lignin demethylation and polysaccharide decomposition in spruce sapwood degraded by brown rot fungi. Organic Geochemistry, 33, 111– 124.

FONTAINE, S., HENAULT, C., AAMOR, A., BDIOUI, N., BLOOR, J., MAIRE, V., … MARON, P. ( 2011). Fungi mediate long term sequestration of carbon and nitrogen in soil through their priming effect. Soil Biology and Biochemistry, 43, 86– 96.

GADGIL, R. L., & GADGIL, P. ( 1971). Mycorrhiza and litter decomposition. Nature, 233, 133.

GLAVATSKA, O., MÜLLER, K., BUTENSCHOEN, O., SCHMALWASSER, A., KANDELER, E., SCHEU, S., … RUESS, L. ( 2017). Disentangling the root- and detritus- based food chain in the micro-food web of an arable soil by plant removal. PLoS One, 12( 7), e0180264. https://doi.org/10.1371/journal.pone.0180264

GRIFFIN, D. ( 1977). Water potential and wood-decay fungi. Annual Review of Phytopathology, 15, 319– 329.

GRIFFITHS, B., BRACEWELL, J., ROBERTSON, G., & BIGNELL, D. ( 2013). Pyrolysis– mass spectrometry confirms enrichment of lignin in the faeces of a wood-feeding termite, Zootermopsis nevadensis and depletion of peptides in a soil-feeder, Cubitermes ugandensis. Soil Biology and Biochemistry, 57, 957– 959. https://doi.org/10.1016/j.soilbio.2012.08.012

GUILLÉN, F., MARTÍNEZ, M. J., GUTIÉRREZ, A., & RIO, J. ( 2005). Biodegradation of lignocellu-losics: Microbial, chemical, and enzymatic aspects of the fungal attack of lignin. International Microbiology, 8, 195– 204.

HAIRSTON, N. G., SMITH, F. E., & SLOBODKIN, L. B. ( 1960). Community structure, population control, and competition. The American Naturalist, 94, 421– 425.

HASENMUELLER, E. A., GU, X., WEITZMAN, J. N., ADAMS, T. S., STINCHCOMB, G. E., EISSENSTAT, D. M., … KAYE, J. P. ( 2017). Weathering of rock to regolith: The activity of deep roots in bedrock fractures. Geoderma, 300, 11– 31.

HELAL, H., & SAUERBECK, D. ( 1986). Effect of plant roots on carbon metabolism of soil microbial biomass. Journal of Plant Nutrition and Soil Science, 149, 181– 188.

HODGE, A., CAMPBELL, C. D., & FITTER, A. H. ( 2001). An arbuscular mycorrhizal fungus accelerates decomposition and acquires nitrogen directly from organic material. Nature, 413, 297– 299.

HOTHORN, T., BRETZ, F., & WESTFALL, P. ( 2008). Simultaneous inference in general parametric models. Biometrical Journal, 50, 346– 363.

138

HOTHORN, T., BRETZ, F., WESTFALL, P., HEIBERGER, R. M., SCHUETZENMEISTER, A., & SCHEIBE, S. ( 2013). multcomp: Simultaneous inference in general parametric models. R package version 1.2-18. Vienna, Austria: Foundation for Statistical Computing.

HOUBA, V., TEMMINGHOFF, E., GAIKHORST, G., & VARK, W. ( 2000). Soil analysis procedures using 0.01 M calcium chloride as extraction reagent. Communications in Soil Science and Plant Analysis, 31, 1299– 1396.

JAEGER, C., LINDOW, S., MILLER, W., CLARK, E., & FIRESTONE, M. ( 1999). Mapping of sugar and amino acid availability in soil around roots with bacterial sensors of sucrose and tryptophan. Applied and Environmental Microbiology, 65, 2685– 2690.

JENNY, H. (1994). Factors of soil formation: A system of quantitative pedology. Chelmsford, MA: Courier Corporation.

JENSEN, K. A., HOUTMAN, C. J., RYAN, Z. C., & HAMMEL, K. E. ( 2001). Pathways for extracellular Fenton chemistry in the brown rot basidiomycete Gloeophyllum trabeum. Applied and Environmental Microbiology, 67, 2705– 2711.

KIELAK, A. M., SCHEUBLIN, T. R., MENDES, L. W., VEEN, J. A., & KURAMAE, E. E. ( 2016). Bacterial community succession in pine-wood decomposition. Frontiers in Microbiology, 7, 231.

KOIDE, R. T., SHARDA, J. N., HERR, J. R., & MALCOLM, G. M. ( 2008). Ectomycorrhizal fungi and the biotrophy–saprotrophy continuum. New Phytologist, 178, 230– 233.

KOIDE, R., & WU, T. ( 2003). Ectomycorrhizas and retarded decomposition in a Pinus resinosa plantation. New Phytologist, 158, 401– 407.

LAVELLE, P., BLANCHART, E., MARTIN, A., MARTIN, S., & SPAIN, A. ( 1993). A hierarchical model for decomposition in terrestrial ecosystems: Application to soils of the humid tropics. Biotropica, 130– 150. https://doi.org/10.2307/2389178

LINDAHL, B. D., & TUNLID, A. ( 2015). Ectomycorrhizal fungi–potential organic matter decomposers, yet not saprotrophs. New Phytologist, 205, 1443– 1447.

LYON, T. L., & BUCKMAN, H. O. ( 1922). The nature and properties of soils: A college text of edaphology. London, UK: Macmillan.

MCNEAR, D. H. ( 2013). The rhizosphere-roots, soil and everything in between. Nature Education Knowledge, 4, 1.

MELILLO, J. M., ABER, J. D., & MURATORE, J. F. ( 1982). Nitrogen and lignin control of hardwood leaf litter decomposition dynamics. Ecology, 63, 621– 626.

139

MICALLEF, S. A., CHANNER, S., SHIARIS, M. P., & COLÓN-CARMONA, A. ( 2009). Plant age and genotype impact the progression of bacterial community succession in the Arabidopsis rhizosphere. Plant Signaling & Behavior, 4, 777– 780.

MOORE, J. C., BERLOW, E. L., COLEMAN, D. C., & RUITER, P. C. ( 2004). Detritus, trophic dynamics and biodiversity. Ecology Letters, 7, 584– 600.

MOORE, J. A., JIANG, J., PATTERSON, C. M., MAYES, M. A., WANG, G., & CLASSEN, A. T. ( 2015). Interactions among roots, mycorrhizas and free-living microbial communities differentially impact soil carbon processes. Journal of Ecology, 103, 1442– 1453.

MUNK, L., SITARZ, A. K., KALYANI, D. C., MIKKELSEN, J. D., & MEYER, A. S. ( 2015). Can laccases catalyze bond cleavage in lignin? BiotechnologyAdvances, 33, 13– 24.

PAINE, R. T. ( 1980). Food webs: Linkage, interaction strength and community infrastructure. Journal of Animal Ecology, 49, 667– 685.

PATERSON, E. (2003). Importance of rhizodeposition in the coupling of plant and microbial productivity. European Journal of Soil Science, 54, 741– 750.

PELLITIER, P. T., & ZAK, D. R. ( 2018). Ectomycorrhizal fungi and the enzymatic liberation of nitrogen from soil organic matter: Why evolutionary history matters. New Phytologist, 217, 68– 73. https://doi.org/10.1111/nph.14598

PÉREZ, J., MUNOZ-DORADO, J., RUBIA, T., & MARTINEZ, J. ( 2002). Biodegradation and biological treatments of cellulose, hemicellulose and lignin: An overview. International Microbiology, 5, 53– 63.

PHILIPPOT, L., RAAIJMAKERS, J. M., LEMANCEAU, P., & VAN DER PUTTEN, W. H. ( 2013). Going back to the roots: The microbial ecology of the rhizosphere. Nature Reviews Microbiology, 11, 789.

POSADA, R. H., MADRIÑAN, S., & RIVERA, E.-L. ( 2012). Relationships between the litter colonization by saprotrophic and arbuscular mycorrhizal fungi with depth in a tropical forest. Fungal Biology, 116, 747– 755.

POULSEN, M., HU, H., LI, C., CHEN, Z., XU, L., OTANI, S., … SCHINDLER, P. M. ( 2014). Complementary symbiont contributions to plant decomposition in a fungus- farming termite. Proceedings of the National Academy of Sciences of the United States of America, 111, 14500– 14505.

RINEAU, F., ROTH, D., SHAH, F., SMITS, M., JOHANSSON, T., CANBÄCK, B., … LINDQUIST, E. ( 2012). The ectomycorrhizal fungus Paxillus involutus converts organic

140 matter in plant litter using a trimmed brown-rot mechanism involving Fenton chemistry. Environmental Microbiology, 14, 1477– 1487.

RUBINO, D. L., & MCCARTHY, B. C. ( 2003). Composition and ecology of macrofungal and myxomycete communities on oak woody debris in a mixed-oak forest of Ohio. Canadian Journal of Forest Research, 33, 2151– 2163.

STEPHEN, B., & PARUNGAO, M. M. ( 2003). Production of wood-decay enzymes, mass loss and lignin solubilization in wood by tropical Xylariaceae. Mycological Research, 107, 231– 235.

TIEN, M., & KIRK, T. K. ( 1984). Lignin-degrading enzyme from Phanerochaete chrysosporium: Purification, characterization, and catalytic properties of a unique H2O2- requiring oxygenase. Proceedings of the National Academy of Sciences of the United States of America, 81, 2280– 2284.

ULYSHEN, M. D. ( 2016). Wood decomposition as influenced by invertebrates. Biological Reviews, 91, 70– 85.

VAN DER HEIJDEN, M. G., BARDGETT, R. D., & VAN STRAALEN, N. M. ( 2008). The unseen majority: Soil microbes as drivers of plant diversity and productivity in terrestrial ecosystems. Ecology Letters, 11, 296– 310.

WHITE, T., BRANTLEY, S., BANWART, S., CHOROVER, J., DIETRICH, W., DERRY, L., ... KUMAR, P. ( 2015). The role of critical zone observatories in critical zone science. In Developments in earth surface processes (Vol. 19, pp. 15– 78). Oxford, UK: Elsevier.

YIN, H., WHEELER, E., & PHILLIPS, R. P. ( 2014). Root-induced changes in nutrient cycling in forests depend on exudation rates. Soil Biology and Biochemistry, 78, 213– 221.

YUAN, J., ZHENG, X., CHENG, F., ZHU, X., HOU, L., LI, J., & ZHANG, S. ( 2017). Fungal community structure of fallen pine and oak wood at different stages of decomposition in the Qinling Mountains, China. Scientific Reports, 7, 13866.

141

Concept Review Soil organisms are integral to aboveground and belowground processes. Root symbionts, may help maintain plant quality through carbon-resource exchange, and therefore effect on higher trophic levels (Gadgil and Gadgil, 1971, Bennett et al., 2005,

Jakobsen and Rosendahl, 1990). At the same time, unconsumed plant tissues are recycled back into the soil environment through a process known as decomposition. Consumers of living and dead plant matter can influence trophic structure.

5.1 Synopsis and main findings 1. The potential for mycorrhizae to modulate plant-enemy performance may present

an ecological paradox. On one hand, mycorrhizae may increase plant nutritional

quality, which may lead to greater plant-enemy exploitation (Bennett et al., 2005).

On the other hand, mycorrhizae may prime plant defenses, which may promote

bioprotection. The field of bioprotection is rather interesting, arbuscular

mycorrhizal fungi may have a stabilizing role in organic agriculture, such that

intense fertilization and pesticide use is reduced. In this chapter, a pattern relevant

to researchers in this field of study is uncovered. The findings revealed that 75 %

of the time, studies found a reduction in plant enemy performance, with respect

to mycorrhizal fungal application. Interestingly, these studies only featured ~ 2

percent of all mycorrhizal taxa. This may lead to considerable controversy, as

redundancy in taxon usage may have biased this area of research. It is encouraged

that fellow investigators make this area of research generalizable by including

142

species of both high and low usage rates. Although an argument can be made that

pathogen associated molecular patterns (PAMP) are conserved across fungi, and

therefore an increase in taxon usage is unnecessary, still investigators should

account for variation that may exist across species and genera.

2. Practice what you preach, is an intercultural idiom that means to take one’s advice.

In this experimental chapter, the suggestion(s) of chapter 1 are taken into account

and incorporated into an experimental design. Mycorrhizae of high and low usage

rates were tested to offset confounding effects that may or may not exist. By testing

a broad phylogenetic spectrum (four genera and four species), the findings of this

chapter are generalizable in regards to phylogenetic variation.

This study sought to determine ways in which a diverse range of fungi may impact

the survivorship of herbivores of two discrete stage-classes. Stage-class specificity

is directly related to life-history. For example, herbivores may have a constant

mortality rate throughout their ontogeny or development, as an alternative, high

rates of mortality may be stage-class specific. The results of this study suggest that

mycorrhizae can be impactful to herbivore survival, particularly cohorts of an

early stage class. The mechanism believed to be at play is a plant anatomical

defense structure, known as trichomes. The findings of this study suggest that

arbuscular mycorrhizal fungi may modulate plant defenses in a manner that can

impact herbivore growth and survival. Together, this suggests that mycorrhizal

143

fungi may influence trophic structure, by impacting the rate in which herbivores

make it to adulthood, which may directly impact herbivore rate of replacement

and population growth rate parameters.

3. Although herbivores are dependent on plants for growth and survival, the

majority of plant mass is unconsumed and recycled back into the soil environment

as dead plant matter. Dead plant matter includes leaves, foliage, and wood debris.

Wood decomposition contributes to carbon cycling, but for woody debris to

undergo this process, decomposers must overcome a protective layer known as

bark. Bark protects living plants from dehydration and natural enemies.

This study sought to determine ways in which the liberation of bark chemical

content may influence soil microbial assemblages. The results showed that bark

decomposition can act as an environmental filter, resulting in shifts in soil

microbial assemblages. These results are likely to be explained by the

solubilization of polyphenolics, including antimicrobial tannins.

4. Soil communities can be regulated by litter input, as well as roots that stimulate

the soil environment. Roots provide an active source of dissolved organic carbon

and small molecular weight compounds that may impact microbial processes.

Detached root caps, exudates and border cells; can influence below ground

processes, including decomposition. The “Gadgil effect” is an advocate of plant

root - microbial associations, as inhibitors of decomposition. To the investigator’s

144 knowledge, this is the first field-study to test the “Gadgil effect” on wood debris.

In Chapter 4, the results of this study did not concur the “Gadgil effect” hypothesis. Instead, root – microbial associations were shown to stimulate decomposition, which resulted in an increase in fungal colonization of wood debris. These findings suggest that roots provide a pathway toward humus and soil organic matter formation. As a caveat, it is important to point out that the

“Gadgil effect” model built on leaf litter decomposition. Meanwhile, this study assessed recalcitrant woody litter decomposition.

145

Model of Main Findings 1. Microbes and their association with roots had a positive effect on herbivores, but

this depended on stage class (+/0). This may suggest that microbes can impact

herbivore life-history and shape trophic structure.

2. Unconsumed plant matter, or litter (bark) can influence soil microbial assemblages

(✔), perhaps through the release and solubilization of plant chemical

compounds. This suggests that litter can indeed act as an environmental filter and

promote select microbial assemblages, which may yield a “home-field advantage”

3. Plant root microbial associations can influence microbial activity, as it relates to

wood decomposition (+), perhaps due to an active supply of photosynthate being

provisioned by roots. This contrasts the “Gadgil effect”, which suggests that root

microbial

associations are

inhibitors of

decomposition. 2

Numbers in the figure correspond to points in “Model of main findings”

146

5.2. Study limitations

1. The area of study known as bioprotection is booming, and seems promising. In

Chapter 1, fellow investigators are encouraged to broaden this area of research by

increasing the range of mycorrhizal taxa used in this area of study. However, this

field od study is still limited, as greenhouse and growth chamber studies are not

representative of field conditions. In field settings, mycorrhizae are at-risk of

predation. Meanwhile, the burrowing of earthworms may disrupt mycelial

networks (Paudel et al., 2016), which can disrupt the provisioning of nutrients

necessary for plant defenses, including nitrogen based secondary metabolites.

2. Mycorrhizae may impact herbivore life-histories through the alteration of plant

anatomical defenses. In the Chapter 2, plant anatomical defenses known as

trichomes, were reported to influence herbivore performance, specifically,

mycorrhizae reduced trichome density, while stabilizing trophic structure

through the reduction of beetle mortality. However, trichomes are multifunctional

and their influence may be context dependent, as trichomes can also help plants

cope with solar irradiance and water loss (Bickford, 2016). In the context of this

study, the experiment endured a heat-wave (July 2016, University Park, PA,

U.S.A.), which may have acted as a stressor to plants and perhaps enabled an

interaction with heat stress and mycorrhizae. Although this is highly speculative,

future studies should take into account abiotic factors to better understand food

147

webs and trophic ecology. Abiotic factors may also include soil fertility, which

may be confounded by the mycorrhizal inoculum

3. Unconsumed plant material, especially recalcitrant stem tissue, play a major role

in carbon storage, as these materials are recycled back into the soil environment

and undergo decomposition. In Chapter 3, it was observed that decomposition of

introduced plant material, specifically bark, influenced soil microbial community

composition. However, this study does not account for recalcitrant heartwood and

tissues of the vascular cambium. These tissues play a major role in carbon storage,

and uncovering ways in which decomposition vary across layers of stem tissue,

may lead to a better understanding of carbon storage.

4. Plants capture carbon from the atmosphere, which can be stored in leaves, stems

and roots. As of consequence, roots release dissolved organic carbon into the soil

environment, which may influence microbial activity. In Chapter 4, root stimuli

were observed to enhance wood decomposition, but it is unclear how seasonality

may affect this result. The findings of this study included the influence of winter

months, as well as portions of fall and spring. Summer months were not included

in this study. Summer months may differ in root exudation rates, which may yield

interesting results that are relevant to day-length. In addition, geological aspects

such as north and south facing slopes may also influence ways in which roots

stimulate soil organisms. This may be especially true in mid-latitudes of the

148

northern hemisphere, where plants on southern facing slopes are exposed to an

increase in solar radiation.

Synthesis

Coevolution among land plants and mycorrhizal symbionts originated over 460 million years ago (Schüβler et al., 2001). Through hyphal networks, nutrients are scavenged by mycorrhizae (AM-fungi). Within root cortical cells, AM-fungi supplements host-plants with phosphorous (P) in exchange for carbohydrates. Approximately 20% of photosynthates are assimilated by AM-fungi (Jakobsen and Rosendahl, 1990). As AM- fungi increases plant vigor, plants may become better defended, which is paramount to the field of bioprotection. Mycorrhizal bioprotection yields resistance or tolerance toward insects, parasites, and pathogens (Ryan et al., 1994, Pozo et al., 1999, Harrier and Watson,

2004, Zhang et al., 2008); as a result of heightened plant defenses, crop loss and pesticide use may be attenuated.

Symbiosis among AM-fungi and land plants goes beyond nutrient exchange. The outcome of this interaction is impactful to many trophic linkages. Understanding the consequence of AM-fungal colonization on plant – enemy interactions may shed insight on the prospective role of AM-fungi in an applied context. Plants have anatomical defenses, including trichomes which may deter herbivores. In the second chapter, trichomes were observed to influence Colorado potato beetle growth and survival.

149

Trichomes are multifunctional, and what determines the efficacy of these structures may vary. Hence, trichomes can interact with the environment, as temperature and photoperiod may influence trichome density in Solanaceae (Gianfagna et al., 1992). It is not believed that temperature played a role, although the study performed in Chapter

2 persisted through July 2016, which included a six-day heat wave, where temperatures exceeded 32.2 C (90 F) between July 21, 2016 and July 27, 2016 (State College, PA, U.S.A).

Despite this caveat, trichome densities were observed to be associated with mycorrhizal colonization, as photoperiod and temperature regimes were held constant, and mycorrhizal associations were manipulated. This enabled mycorrhizal effects to be decoupled from temperature and light factors. Aside from the environment, plant age may have also played a role in trichome production. Vannette and Hunter (2013) reported

AM-fungi increased trichome production on three-week-old plants. In contrast, the present study saw a decrease in trichome production on six-week-old plants. Future studies addressing the role of microbes in multitrophic interactions should consider environmental factors, as well as plant age.

Microbial activity may also correspond to root dynamics, specifically, as it relates to decomposition of fine wood debris. In chapter 4, living roots were observed to increase wood decomposition by about 3 %. This may suggest that roots may provide a pathway toward humus and soil organic matter formation. Roots may regulate microbial activity through rhizodeposition. Rhizodeposits and root chemical leachates may enable

150 environmental filtration of microbes, which may promote microbial assemblages of select trophic guilds, perhaps yielding a home-field advantage to decomposers that share a co-localized history with the litter source (Van Der Heijden et al., 2008, Philippot et al.,

2013, Bever et al., 2010). Whether or not a home-field advantage is achieved, environmental filtration, as it relates to community construct, is consistent with niche theory (Colwell and Futuyma, 1971), as opposed to a stochastic model (Caswell, 1976).

The provisioning of nutrients from plants to microbes has food web implications.

As microbial mass increases, the population of fungivores and higher trophic consumers are sure to increase (Crowther and Grossart, 2015, McLean et al., 2006, Rabatin and

Stinner, 1988, Bakhtiar et al., 2001, Cesarz et al., 2015). The transient nature of decomposition may help shape ecological communities, as decomposition is sure to result in nitrogen mineralization and lignocellulose solubilization (Stephen and Parungao,

2003, Melillo et al., 1982). Progressive change in litter traits may reflect the interconnectedness of organisms that make up the soil food web. For example, isopods were reported to be most effective at decomposing litter, when litter had been conditioned by microbes (Wensem et al., 1993).

5.4. Future Directions Plants and animals help shape ecosystem processes, trophic structure and food web dynamics; but still, the role of microbes is just as essential. Follow-up studies should consider the role of soil microbes in response to enriched atmospheric CO2. Enriched

151 atmospheric CO2 may affect plant allocation to below ground soil organisms, as bacteriovores and protozoans feed on edaphic microbes, and may be sensitive toward carbon inputs (Christensen et al., 2007). Atmospheric CO2 may increase fungal mass, which is sure to influence trophic structure of below ground food-webs (Dong et al.,

2018). This is believed to be the case, since increase in fungal biomass will likely increase the biomass of fungal feeders (Cesarz et al., 2015). Atmospheric CO2 can also inflate plant

C:N ratio (Coviella et al., 2002), and therefore impact the quality of litter being introduced into the soil environment, as well as rates of decomposition (Van Groenigen et al., 2014). At the same time, enrichment in atmospheric CO2 may impact the balance of carbon-based secondary metabolites (i.e. phenols) versus nitrogen-based secondary metabolites (i.e. alkaloids). Given these potential scenarios, future studies should consider the role of atmospheric CO2 in bioprotection, nutrient cycling and belowground food-web dynamics.

152

Reference

BAKHTIAR, Y., MILLER, D., CAVAGNARO, T. & SMITH, S. 2001. Interactions between two arbuscular mycorrhizal fungi and fungivorous nematodes and control of the nematode with fenamifos. Applied Soil Ecology, 17, 107-117. BENNETT, A. E., ALERS-GARCIA, J. & BEVER, J. D. 2005. Three-way interactions among mutualistic mycorrhizal fungi, plants, and plant enemies: hypotheses and synthesis. The American Naturalist, 167, 141-152. BEVER, J. D., DICKIE, I. A., FACELLI, E., FACELLI, J. M., KLIRONOMOS, J., MOORA, M., RILLIG, M. C., STOCK, W. D., TIBBETT, M. & ZOBEL, M. 2010. Rooting theories of plant community ecology in microbial interactions. Trends in Ecology & Evolution, 25, 468-478. BICKFORD, C. P. 2016. Ecophysiology of leaf trichomes. Functional Plant Biology, 43, 807-814. CASWELL, H. 1976. Community structure: a neutral model analysis. Ecological monographs, 46, 327-354. CESARZ, S., REICH, P. B., SCHEU, S., RUESS, L., SCHAEFER, M. & EISENHAUER, N. 2015. Nematode functional guilds, not trophic groups, reflect shifts in soil food webs and processes in response to interacting global change factors. Pedobiologia, 58, 23-32. CHRISTENSEN, S., BJØRNLUND, L. & VESTERGÅRD, M. 2007. Decomposer biomass in the rhizosphere to assess rhizodeposition. Oikos, 116, 65-74. COLWELL, R. K. & FUTUYMA, D. J. 1971. On the measurement of niche breadth and overlap. Ecology, 52, 567-576. COVIELLA, C. E., STIPANOVIC, R. D. & TRUMBLE, J. T. 2002. Plant allocation to defensive compounds: interactions between elevated CO2 and nitrogen in transgenic cotton plants. Journal of Experimental Botany, 53, 323-331. CROWTHER, T. W. & GROSSART, H. 2015. The role of bottom-up and top-down interactions in determining microbial and fungal diversity and function. Trophic ecology: bottom-up and top-down interactions across aquatic and terrestrial systems (eds Hanley T, Pierre KL, editors.), 260-287. DONG, Y., WANG, Z., SUN, H., YANG, W. & XU, H. 2018. The Response Patterns of Arbuscular Mycorrhizal and Ectomycorrhizal Symbionts Under Elevated CO2: A Meta-Analysis. Frontiers in Microbiology, 9, 1248. GADGIL, R. L. & GADGIL, P. 1971. Mycorrhiza and litter decomposition. Nature, 233, 133. GIANFAGNA, T. J., CARTER, C. D. & SACALIS, J. N. 1992. Temperature and photoperiod influence trichome density and sesquiterpene content of Lycopersicon hirsutum f. hirsutum. Plant Physiology, 100, 1403-1405.

153

HARRIER, L. A. & WATSON, C. A. 2004. The potential role of arbuscular mycorrhizal (AM) fungi in the bioprotection of plants against soil-borne pathogens in organic and/or other sustainable farming systems. Pest Management Science, 60. JAKOBSEN, I. & ROSENDAHL, L. 1990. Carbon flow into soil and external hyphae from roots of mycorrhizal cucumber plants. New Phytologist, 115, 77-83. MCLEAN, M. A., MIGGE-KLEIAN, S. & PARKINSON, D. 2006. Earthworm invasions of ecosystems devoid of earthworms: effects on soil microbes. Biological invasions. MELILLO, J. M., ABER, J. D. & MURATORE, J. F. 1982. Nitrogen and lignin control of hardwood leaf litter decomposition dynamics. Ecology, 63, 621-626. PAUDEL, S., LONGCORE, T., MACDONALD, B., MCCORMICK, M. K., SZLAVECZ, K., WILSON, G. W. & LOSS, S. R. 2016. Belowground interactions with aboveground consequences: Invasive earthworms and arbuscular mycorrhizal fungi. Ecology, 97, 605-614. PHILIPPOT, L., RAAIJMAKERS, J. M., LEMANCEAU, P. & VAN DER PUTTEN, W. H. 2013. Going back to the roots: the microbial ecology of the rhizosphere. Nature Reviews Microbiology, 11, 789. POZO, M. J., AZCÓN-AGUILAR, C., DUMAS-GAUDOT, E. & BAREA, J. M. 1999. β-1, 3-glucanase activities in tomato roots inoculated with arbuscular mycorrhizal fungi and/or Phytophthora parasitica and their possible involvement in …. Plant Science. RABATIN, S. & STINNER, B. 1988. Indirect effects of interactions between VAM fungi and soil-inhabiting invertebrates on plant processes. Agriculture, ecosystems & environment, 24, 135-146. RYAN, M. H., CHILVERS, G. A. & DUMARESQ, D. C. 1994. Colonisation of wheat by VA-mycorrhizal fungi was found to be higher on a farm managed in an organic manner than on a conventional neighbour. Plant and Soil. SCHÜΒLER, A., SCHWARZOTT, D. & WALKER, C. 2001. A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycological Research, 105. STEPHEN, B. & PARUNGAO, M. M. 2003. Production of wood-decay enzymes, mass loss and lignin solubilization in wood by tropical Xylariaceae. Mycological Research, 107, 231-235. VAN DER HEIJDEN, M. G., BARDGETT, R. D. & VAN STRAALEN, N. M. 2008. The unseen majority: soil microbes as drivers of plant diversity and productivity in terrestrial ecosystems. Ecology letters, 11, 296-310. VAN GROENIGEN, K. J., QI, X., OSENBERG, C. W., LUO, Y. & HUNGATE, B. A. 2014. Faster decomposition under increased atmospheric CO2 limits soil carbon storage. Science, 344, 508-509. VANNETTE, R. L. & HUNTER, M. D. 2013. Mycorrhizal abundance affects the expression of plant resistance traits and herbivore performance. Journal of Ecology, 101, 1019-1029.

154

WENSEM, J., VERHOEF, H. A. & STRAALEN, N. M. 1993. Litter degradation stage as a prime factor for isopod interaction with mineralization processes. Soil Biology and Biochemistry, 25, 1175-1183. ZHANG, L., ZHANG, J., CHRISTIE, P. & LI, X. 2008. Pre-inoculation with arbuscular mycorrhizal fungi suppresses root knot nematode (Meloidogyne incognita) on cucumber (Cucumis sativus). Biology and Fertility of Soils.

155

Appendices

Appendix A: Examining the field of bioprotection

Examining the field of bioprotection: How robust is the role of mycorrhizae in plant enemy interactions

▪ Survey was conducted to determine the latest trends in mycorrhizal plant-enemy performance

▪ Identified over 40 recently published studies

Depicted above is pie-chart showing the relative frequency of plant – enemy performance studies.

156

Appendix B: Plant Enemy Performance

Plant enemy performance: How well did the plant-pests perform on mycorrhizal plants?

Pest performance Pests performance Pests were unaffected reduced enhanced Mycorrhizal affect on plant-pests

Depicted above is the relative outcome of mycorrhizae on plant pests

157

Appendix C: Mycorrhizae, plant and herbivory

Neonate damage

AM+/- old tomato (6 week old) Third instar beetle mass Herbivore6 introduction

In this case study (Chapter 2), tomato was grown in the greenhouse while in the presence or absence of mycorrhizae (left panel). After 6 weeks, neonate damage was resultant of neonate introduction (left panel, top right corner). In a parallel experiment, third-instars were starved, then weighed, and then introduced to tomato. This allowed third-instars to graze and be weighed for change in mass (middle panel). Nylon cages enabled the containment of beetle to plant (right panel).

(photo credit: Rondy J. Malik)

158

Appendix D: White oak and eastern hemlock bark

Study system

White oak Eastern Hemlock

Depicted above is an image of white oak and eastern hemlock bark. The two tree species were used in Chapter 3 (photo credit: Rondy J. Malik).

159

Appendix E: Bark decomposition experiment

Visual of Chapter 3: Bark removal, bark recovery (cylindrical cores), and bark introduction into soil environment (photo credit: Rondy J. Malik)

160

Appendix F: Bark decomposition experimental design

Experimental Design: Soil regime versus litter source

https://store.speedtree.com/store/white_oak_forest/

https://www.pinterest.com/pin/3 66480488406823693/?lp=true

Eastern Hemlock White oak soil soil

Home Home Away Away Here is a schematic of the 13-month bark decomposition study (Chapter 3). Eastern hemlock and white oak bark were transplanted into soil communities of parent or non- parent tree. (photo credit: Rondy J. Malik)

161

Appendix G: Cylindrical cores for decomposition studies

In this 6-month wood decomposition study, commercial wood chips derived from white oak were used (Chapter 4). (photo credit: Rondy J. Malik)

162

Appendix H: Root exclusion experiment

Treatment

+ Roots - Roots The aim of this study (Chapter 4) was to determine if roots, and their active supply of photosynthates can influence decomposition. In the right panel, cylindrical cores containing wood debris were exposed to living roots. In the right panel, root exposure was limited by utilizing a corrugated pipe. (photo credit: Rondy J. Malik)

163

Appendix I: Mycelial colonization wood

Depicted here is an observation in which mycelium colonization of wood debris was

assessed (Chapter 4). This observation was characterized as dense mycelium colonization. (photo credit: Rondy J. Malik)

164

CURRICULUM VITAE|RONDY MALIK

Email: [email protected]

OBJECTIVE: Integrating plant-microbe associations into food-web complexes

EDUCATION

EXPECTED AUGUST 2019 Ph.D. ECOLOGY, THE PENNSYLVANIA STATE UNIVERSITY University Park, PA Thesis Advisor (s): Terrence H. Bell, Ph.D. and David M. Eissenstat, Ph.D. Thesis: “Consumers of living and dead plant matter: at the root of decomposers, plant enemies and mycorrhizae in trophic ecology”

AWARDED APRIL 2016 M.Sc. EVOLUTION, ECOLOGY AND BEHAVIOR, INDIANA UNIVERSITY Bloomington, IN Thesis Advisor: James D. Bever, Ph.D. Concentration: Evolution Thesis: “Mycorrhizal Composition can predict foliar pathogen propagation and density”

AWARDED MAY 2013 B.Sc. BIOLOGY, UNIVERSITY OF MASSACHUSETTS – BOSTON Dorchester, MA B.Sc. Biology, Cum Laude, Biology Honors Senior Thesis: “Invasive Species (Spotted Knapweed) and a weedy challenger (Chicory): acquiring resources and driving the soil biota” Thesis Advisor: Rick V. Kesseli, Ph.D.

AWARDED JUNE 2011 A.Sc. BIOTECHNOLOGY, BUNKER HILL COMMUNITY COLLEGE Charlestown, MA

165