Identification and Characterization of Novel

Home , Block Drug, Nucleotidase

IDENTIFICATION AND CHARACTERIZATION OF NOVEL

ANTIRETROVIRAL COMPOUNDS: FROM SMALL MOLECULE LIBRARY

SCREENING TO RATIONALLY DESIGNED COMPOUNDS

A dissertation submitted to Kent State University in cooperation with the Lerner

Research Institute, Cleveland Clinic Foundation in partial fulfillment of the

requirements

For the degree of Doctor of Philosophy

Oyebisi Jegede

August, 2007

Dissertation written by

Oyebisi Jegede

M.B.B.S., University of Ilorin, 1998

Ph.D., Kent State University, 2007

Approved by

______, Dr. Miguel Quiñones-Mateu, Chair, Doctoral Dissertation Committee

______, Dr. Chun-Che Tsai, Co-Chair, Doctoral Dissertation Committee

______, Dr. Philip Pellett, Member, Doctoral Dissertation Committee

______, Dr. Gail Fraizer, Member, Doctoral Dissertation Committee

______, Dr. Arvind Bansal, Outside Discipline Member

______, Dr. Mary Cismowski, Graduate Faculty Representative

Accepted by

______, Dr. Robert V. Dorman, Director, School of Biomedical Sciences

______, Dr. John Stalvey, Dean, College of Arts and Sciences

ii TABLE OF CONTENTS

LIST OF FIGURES…………………………………..………….…….……...... …vi

LIST OF TABLES………………………………………………………...….....……....ix

ABBREVIATIONS……………………………………………………….……………...x

ACKNOWLEDGEMENTS …………………………………..……………….……....xv

DEDICATION………………………………………………..……………….……....xvii

CHAPTER I: GENERAL INTRODUCTION………………….……………...…...…1

CHAPTER II: IDENTIFICATION AND CHARACTERIZATION OF NOVEL ANTIRETROVIRAL COMPOUNDS FROM HIGH-THROUGHPUT SCREENING OF SMALL MOLECULE LIBRARIES…………….……………...... 48

INTRODUCTION………………….…………………………………………...…..48

MATERIALS AND METHODS…………………………………..……….….…..50

RESULTS….………………………….……………….……………...……..….…...72

HIV-1 susceptibility of hits……………………….…….…..….……...... ………73

Hits were neither cytotoxic nor cytostatic……….…………..……………..…….73

Pre vs. post viral transcription inhibition of HIV-1 replication…….....…..…..…78

Direct effect of hits on HIV-1B-HXB2 virions…………………….….……...….….79

Time of addition ………………………………………………….……...………81

Inhibition of HIV-1 coreceptors, CCR5 and CXCR4……………...... …..……82

iii

In vitro inhibition of HIV-1 reverse transcriptase…...…………..………………84

In vitro inhibition of HIV-1 integrase…………………..….……….….……...…85

In vitro inhibition of HIV-1 protease……………………...…...... ………...89

Drug susceptibility of primary and resistant HIV subtypes…...... …………....…90

In vitro selection for resistant strains……...………………...... …….…….….94

Effect of CBL 26 on other HIV-1 gene targets…………………..……..…...….100

DISCUSSION…………………………………..………...……………..…...….…103

CHAPTER III: CELL-BASED SCREENING OF A SMALL MOLECULE LIBRARY FOR NEW ANTIRETROVIRAL COMPOUNDS PARTICULARLY HIV-1 CORECEPTOR ANTAGONISTS……………………………..…..……..….109

INTRODUCTION……………………………………….……………...... ………109

MATERIALS AND METHODS……………………..…...…………………...... 111

RESULTS……………………………..……………………………..…….……….121

A novel assay to identify HIV-1 inhibitors……………………………………..121

Effect of known antiretroviral drugs on fluorescent viruses……...…….……... 124

Small molecule library screening…………………………...……….…...... 125

Time-of-addition…………………………………..…...……...………....……...129

DISCUSSION………………………....……………..…………………...…..……131

CHAPTER IV: KST 201 AND KST 301: ANALOGUES OF RESVERATROL AS NOVEL ANTIRETROVIRAL COMPOUNDS…………………………...………...137

INTRODUCTION………………..……………………………………….……….137

MATERIALS AND METHODS………………………………....…….……..….139

RESULTS……………………………………...... 144

DISCUSSION……………………………………………….……..…..…....……..151

CHAPTER V: DIVALENT METAL ION CHELATING SMALL MOLECULES AS NOVEL HIV INTEGRASE INHIBITORS……………………………..……….154 INTRODUCTION……………………………....………………….………...……154

MATERIALS AND METHODS…………………….………………...... 155

RESULTS……………………………………………...... 160

DISCUSSION…………………………………..……………....……………….....174

SUMMARY AND PERSPECTIVES…….……………….……………...... ………176

REFERENCES……………….…………………………………….………….………180

LIST OF FIGURES

CHAPTER I

Fig 1.1 Global view of HIV-1 distribution…………………………..…..………..……....3 Fig 1.2 Geographical distribution of HIV-1 genetic forms…………………..……………5 Fig 1.3 Geographical distribution of HIV-1 subtypes…………………..………….….….7 Fig 1.4 Mature HIV-1 virion……………………………………..………………..………8 Fig 1.5 HIV-1 linear genome………………. ………………………………..……….…10 Fig 1.6 HIV-1 lifecycle…………………………………………….…………….………12 Fig 1.7 Native trimeric state of HIV-1 envelope glycoproteins……………...……….….13 Fig 1.8 Multi-step process of HIV-1 entry………………………………….....…………14 Fig 1.9 HIV-1 reverse transcription……………………………….…………....……..…20 Fig 1.10 HIV-1 integration………………………………….……...…………...……….21 Fig 1.11 Assembly and maturation of HIV-1 virion……………………………..………25 Fig 1.12 HAART………………………………...…...………….……………….……...27 Fig 1.13 Targets of antiretroviral drugs…………………………………….……………29 Fig 1.14 Structures of nucleoside reverse transcriptase inhibitors……………..…….….31 Fig 1.15 Structure of tenofovir disoproxil fumarate………………..…..……….….…....34 Fig 1.16 Structures of non-nucleoside reverse transcriptase inhibitors…………….……36 Fig 1.17 Structure of protease inhibitors………………………………..….……….……38 Fig 1.18 Structure of fusion inhibitor…………………………….………….……….….40

CHAPTER II

Fig 2.1 Small molecule library screening protocol…………………..………..…………51 Fig 2.2 Antiviral assays……………………………………………..………….....…..….54 Fig 2.3 Cellular toxicity assays………………………………………………...…..…….56

Fig 2.4 Inhibition of HIV-1 coreceptors assay ………………………………….……….59 Fig 2.5 High-throughput integrase inhibition assay…………………………...... …….61 Fig 2.6 In vitro selection for resistant strains ……………………………….……….…..65 Fig 2.7 Cellular toxicity of hits by cell viability…………………………...... ….……...74 Fig 2.8 Viral susceptibility of hits…………..………………………..…..………….…...75 Fig 2.9 Selectivity indices of hits………………………….……….….………....….…...76 Fig 2.10 Pre vs. post viral transcription inhibition……………………………..…..…….78 Fig 2.11 Direct effect of hits on HIV-1 virions…….….…………………....….……..…79 Fig 2.12 Time of addition assay………….……………...…………………………...…..81 Fig 2.13 Effect on HIV-1 coreceptors….…………………...………………...…..….…..83 Fig 2.14 HIV-1 integrase high-throughput assay………….…………………...……...…86 Fig 2.15 In vitro HIV-1 integrase gel-based electrophoresis……….………….……...…86 Fig 2.16 Effect of CBL 4.3 on HIV-1 integrase in Mg2+………….……………………..87 Fig 2.17 Effect of CBL 4.3 on HIV-1 integrase in Mn2+….………………………..……87 Fig 2.18 In vitro HIV-1 protease inhibition assay………….……………….…...…...….89 Fig 2.19 Selection for resistant HIV-1 strains….……………………….....……….……96 Fig 2.20 Viral growth kinetics………….……………….…………….…………....……99 Fig 2.21 Site directed mutagenesis…….…………...……………..….….………….….101 Fig 2.22 Susceptibility of SDM virus and wild type viruses to CBL 26…….…...... ….102

CHAPTER III

Fig 3.1 Fluorescent viruses……….……………………….………………...…...…..…112 Fig 3.2 Verification of coreceptor usage assay.……….………………...………...……113 Fig 3.3 Plate design ………….………………………………………...…………...…..114 Fig 3.4 Protocol for screening small molecule library….………………………...……115 Fig 3.5 Confirmation of susceptibility of B-HXB2 and C5 to hits….…………….……117 Fig 3.6 Cellular toxicity in U87.CD4.CCR5 and U87.CD4.CXCR4….……….…....…118 Fig 3.7 Result of coreceptor usage verification ….……………………….…………....122 Fig 3.8 Admixtures of multiplicities of HIV-1 fluorescent viruses………….…………123

vii

Fig 3.9 Antiviral activity of known drugs…………….……………………..…….….124 Fig 3.10 Results of the cell-based small library screening….…………………….…..125 Fig 3.11 Time of addition assay …….………………………….………………...…..129

CHAPTER IV

Fig 4.1 Structure of Resveratrol……………….…………………….....……………….144 Fig 4.2 Cellular toxicity in Ghost X4/R5……….…………………...…..…...…...….....145 Fig 4.3 Antiviral activity determined by EGFP expression…………….….…………...148 Fig 4.4 Inhibition of HIV-1 ……………….………………………...…..…………...…149 Fig 4.5 Inhibition of HIV-l coreceptors, CCR5 and CXCR4…….………...…….....….150

CHAPTER V

Fig 5.1 Pre vs. post viral transcription inhibition…….…………………...... …164 Fig 5.2 Effect of BFX 1001-BFX 1004 on HIV-1 coreceptors ….…………...……..…165 Fig 5.3 PCR-based single cycle assays…………….…………...…….……………...... 166 Fig 5.4 Passages of B-HXB2 in increasing concentration of BFX compounds….….…167 Fig 5.5 Restriction analysis by Southern blot on BFX treated acutely infected cells…..169 Fig 5.6 Inhibition of luciferase expression by BFX compounds….….…………...……171 Fig 5.7 Inhibition of strand transfer reaction by drug controls…………………………173

viii LIST OF TABLES

CHAPTER II

Table 1 In vitro inhibition of HIV-1 reverse transcriptase……………..……..….…..….84 Table 2 Antiviral activity of hits against primary HIV-1 &-2 isolates……………….….92 Table 3 Antiviral profile of hits against recombinant MDR viruses………….…..….….93 Table 4 Drug susceptibility of CBL resistant viruses…………………….…….………..98

CHAPTER III

Table 1 Summary of the antiviral and cellular toxicity profiles………………...…..….128 Table 2 Cellular viability, cellular proliferation and antiviral activity…………....……128

CHAPTER IV Table 4.1 Antiviral activity and cellular toxicity……..……………………..…..……...146 Table 4.2 IC of Resveratrol, KST 201 and KST 301 against HIV-1 and HIV-2...…...149 50

CHAPTER V

Table 5.1 CC50 and IC50 of BFX 1001 – BFX 1008……………..………………....…..161

Table 5.2 Summary of the IC50 of BFX 1001 – BFX 1004……………………….....…162

Table 5.3 The IC50 of BFX 1012, BFX 1025 and BFX 1028………………...….…..…173

ABBREVIATIONS

1 or 2-LTR circles circular DNA with either 1 or 2- long terminal repeats 5′-LTR 5′- long terminal repeat 3′-OH 3′- Hydroxyl 5′-PO4 5′- Phosphate A Alanine Abacavir ABC; (-)-(1S,4R)-4-[2-amino-6-(cyclopropylamino)-9H-purin-9- yl]cyclopentene-1- methanol Adefovir PMEA; 9-(2-phosphonylmethoxyethyl)adenine AIDS acquired immune deficiency syndrome AMD3100 [[4 - (1,4,8,11 - tetrazacyclotetradec - 1 - ylmethyl)phenyl]methyl] - 1,4,8,11 tetrazacyclotetradecane octahydrochloride APOBEC-1 apolipoprotein B mRNA editing catalytic subunit 1 ARV antiretroviral drugs BAF barrier to auto-integration factor bp base pair C cysteine CA capsid protein

CC50 50% cytotoxic concentration CCR5 CC-chemokine receptor 5 CD4 cluster of differentiation type 4 CDC Centers for Disease Control and Prevention

CO2 carbon dioxide CPE cytopathogen effect CRF circulating recombinant forms CSW commercial sex worker

CXCR4 CXC-chemokine receptor 4 CypA cyclophilin A DDDP DNA dependent DNA polymerase Didanosine ddI; 2′,3′-Dideoxyinosine Delavirdine DLV; 1-(5-Methanesulphonamido)-1H-indol-2-yl-carbonyl)-4 -[3- (isopropylamino) -2- pyridinyl] piperazine DLS dimer linkage structure DMSO dimethylsulfoxide DNA deoxyribonucleic acid dNTPs deoxyribonucleotide triphosphates dsDNA double stranded DNA Efavirenz DMP 266; α-1,4-dihydro-2H-3,1-benzoxazin-2-one EIAV equine infectious anemia virus Enfuvirtide T20; DP-178 Env envelope gene FIV feline immunodeficiency virus Gag group-specific antigen protein Gp glycoprotein HAART highly active antiretroviral therapy HIV-1 human immunodeficiency virus type 1 HIV-2 human immunodeficiency virus type 2 HLA human leukocyte antigen HMGA1 high-mobility group protein A1 HR1 heptad region 1 HR 2 heptad region 2 HSP 60 heat shock protein 60 HTS high-throughput screening I isoleucine

IC50 50% inhibitory concentration

Ig immunoglobulins IN integrase INDOPY-1 indolopyridone-1 IVDU intravenous drug users K lysine Kb kilo-base pair KDa Kilodalton L leucine Lamivudine 3TC; cis-1-[2′-Hydroxymethyl-5′-(1,3-oxathiolanyl)]cytosine LEDGF lens-derived growth factor LTR long terminal repeats MA matrix protein MCT mother-to-child transmission MHC major histocompatibility complex MMWR mortality and morbidity weekly report MOI multiplicity of infection mRNA messenger ribonucleic acid M-tropic macrophage tropic HIV-1 MTT 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide NC nucleocapsid protein NFV nelfinavir Nef negative factor NIH National Institutes of Health NNRTI non-nucleoside reverse transcriptase inhibitors NMR nuclear magnetic resonance NRTI nucleoside reverse transcriptase inhibitors NVP nevirapine p51 51kDa subunit of HIV-1 RT p66 66kDa subunit of HIV-1 RT

xii

PAGE polyacrylamide gel electrophoresis PBMC peripheral blood mononuclear cells PCR polymerase chain reaction PI protease inhibitor PIC preintegration complex Pol polymerase gene PPT polypurine tract PR protease Q glutamine QSAR quantitative structural activity relationship R short repeat in both 5’ and 3’ LTR RDDP RNA dependent DNA polymerase Rev regulator of protein HIV expression RNA ribonucleic Acid RNase H ribonuclease H RRE rev-response element RT reverse transcriptase RTI reverse transcriptase inhibitor(s) Saquinavir SQV; (-) sss minus strand strong stop (+) sss plus strand stong stop S serine SDS sodium dodecylsulphate SIV simian immunodeficiency virus Stavudine d4T; 2’,3’-didehydro-2’,3’-dideoxythymidine SU surface protein TAM thymidine analogue mutation TAR transactivating response element Tat transcriptional Transactivator of HIV

xiii

TCID50 50% tissue culture infective dose TDF tenofovir TM transmembrane adefovir PMEA; 9-(2-phosphonylmethoxyethyl)adenine tRNA transfer ribonucleic acid T-tropic T-lymphocyte tropic U3 unique region of the 3′ LTR U5 unique region of the 5′ LTR URF unique recombinant forms V valine Vif virion infectivity factor Vpr viral protein R Vpu viral protein U WHO World Health Organization WT wild-type Y tyrosine Zalcitabine ddC; 2’,3’-dideoxycytidine Zidovudine AZT; 3’-azido-2’,3’-dideoxythymidine

xiv

ACKNOWLEDGEMENTS

I would like to thank my advisor Dr. Miguel Quiñones-Mateu, for giving me the opportunity of a lifetime. During the period of my training in his laboratory, he allowed me to have unique access to the best researchers and laboratories in other institutions. I will always be grateful for the nuggets of practical advice he gave me about managing my research and career. He challenged me to be better. In short, I learnt that good is not adequate, if excellent is attainable. I also want to thank my co-advisor in Kent, Dr. Tsai for starting me on this path to antiretroviral research. Despite my very obvious ignorance, he allowed me to work with his compounds, KST201 and KST301. Dr. Tsai has also guided me through many stages and critical decisions about my graduate work. I want to thank my committee members, Dr. Phillip Pellett, Dr. Gail Fraizer, Dr. Arvind Bansal and Dr. Cismowski. I am grateful for the advice, encouragement, patience and significant time you have dedicated for several meetings in order to help me achieve my goals.

I am grateful to have met Dr. Hector Rangel-Escalante. He allowed me to observe his work during my early days of learning laboratory work. I learnt several techniques that helped me to the end. I had tons of questions about techniques and Dr. Jan Weber answered all. To his credit, he always took time to explain everything. Patti Kiser always had a smile even on the worst days. Thank you Patti, for your support during one of the toughest times of my life, I will never forget. I must not forget to thank Michael Marotta for being my music buddy in the lab and most especially for lending a helping hand when

xv required, particularly during the screening of the small molecule library. It was always

interesting to discuss science, culture and current events with Muneer Mirza. I would also

like to thank Ana Carolina Vazquez and Alice Valentine for assisting at different times during the course of my research. I am very grateful to our collaborators for their invaluable contributions. Dr Andrei Gudkov, Dr. Mikhail Chernov and Dr. Anna

Khodyakova did the initial screening of the compounds characterized in Chapter 2.

Anatoliy Prokvolit provided access to the small molecule library analyzed in Chapter 3.

Dr. John Babu and Bioflexis, Cleveland synthesized the metal ion chelators of HIV integrase analyzed in Chapter 5. In vitro assays used to characterize inhibition of HIV-1 integrase were performed at the laboratory of Molecular Pharmacology, NIH, Bethesda,

MD, under the supervirsion of Dr. Yves Pommier with the assistance of Christophe

Marchand. Finally, Dr. Luis Menendez-Arias for the inhibition of HIV-1 reverse transcriptase assay.

A big thank you to my friends: Evg. Stella, Dele Adetifa, Femi Adetona, Luxuan

Guo, Yemi and Dayo Akinyemi. Thanks for listening whenever I have needed sympathetic ears and shoulders to lean on. To my private cheer squad, my lovely Mom, siblings (Oyebola, Oyelayo, Oyepeju and Oyeleke) I am very lucky to be part of a wonderful family like ours. You never told me I could not do it. I am grateful for the assistance and support; emotional and financial you have given me over the years. You stood by me all the way through different decisions, even when you did not understand my choices. Thank you.

xvi

Dedication

This dissertation is dedicated to my mother, Eunice Olufunmilayo Jegede, for her love and support through every stage of my life. She has always given me 100% of her love

and encouragement.

xvii CHAPTER I

GENERAL INTRODUCTION

1.1. Discovery of AIDS and HIV

Acquired Immunodeficiency syndrome (AIDS) was described as a clinical entity by Michael D. Gottlieb in a CDC mortality and morbidity weekly report (MMWR) in young, previously healthy homosexual males with pneumocysti pneumonia associated

with leukopenia in the U.S in June, 19812. A month later, another MMWR identified

clusters of previously healthy homosexual men in New York City and California

diagnosed with Kaposi sarcoma, an uncommonly reported malignancy in the United

States1. The same symptoms were later reported in intravenous drug users and

hemophiliacs dependent on blood transfusion72,127. However, the mode of transmission

has since widened to include, heterosexual transmission, mother-to-child transmission

(MCT). The current epidemic is primarily driven by heterosexual transmission with the

almost the same proportion of men and women infected worldwide197. In 1983,

Montagnier and coworkers identified the pathogenic agent of this acquired

immunodeficiency as an internal antigen (p25) containing, magnesium (Mg2+) preferring

1 2

and reverse transcriptase expressing retrovirus isolated from a patient with persistent

generalized lymphadenopathy syndrome (LAS) and designated the virus as the

lymphadenopathy associated virus (LAV)16. LAV, a highly cytopathic virus, infected

and destroyed normal CD4+ T-cells from cord blood and a healthy donor within two

weeks of culture17,101. About the same time, two other research groups identified new retroviruses with similar virulent cytopathic properties. These were described as AIDS- associated retroviruses (ARV) by the Levy group115 and human T-cell leukemia virus III

(HTLV-III) by the Gallo group153. Eventually all three viruses were identified as members of a distinct group of human retroviruses. In 1986, this group of viruses was

officially designated human immunodeficiency virus (HIV) by the International

Committee on Taxonomy of viruses33. In 1986, a second distinct type of HIV prevalent

in certain regions of West Africa was discovered and designated HIV-231.

1.2. AIDS pandemic, a global public health threat

Since 1981 an estimated 60 million individuals have been infected with HIV

globally and over 20 million have died. According to the UNAIDS 2006 report on the

global AIDS epidemic in 2005, 38.6 million (33.4 million-46.0 million) individuals are

estimated to be living with HIV/AIDS worldwide (Fig 1.1). Also in 2005, 4.1 million

people contracted HIV and 2.8 million more lost their lives to HIV/AIDS196. About 29

million cases are expected from 2002-2010 and overall, an estimated 45 million people 3

would be living with HIV/AIDS by 2010195. Although antiretroviral drugs have delayed

death and significantly improved the quality of life of patients83, treatment has only

expanded from 240,000 individuals in 2001 to 1.3 million individuals in 2005197.

Globally, ARV is only available to 20% of eligible individuals and to less than 10% of individuals living with HIV/AIDS in sub-Saharan Africa197.

Figure 1.1: Global view of the distribution of HIV infection. Adapted from 2006 Report on the global AIDS epidemic: May 2006. UNAIDS197.

1.3. Classification of HIV

HIV is a member of the family Retroviridae and the genus lentivirus. It has

genetic and morphologic similarities to other lentiviruses, non-primate immunodeficiency

viruses have been reported in cats: feline immunodeficiency virus (FIV); horses: equine

infectious anemia virus (EIAV); cows: bovine immune deficiency virus; monkeys: simian

immunodeficiency virus (SIV) and sheep: visna/maedi virus114,189. Of these viruses, HIV

is most closely related to SIV, based on viral protein cross-reactivity and genetic

sequence similarities68,81. HIV is classified into two main types, HIV-1 and HIV-2. HIV-

1 was introduced into humans through three separate chimpanzee (SIVcpz) transmission

events to humans starting from 1931 (between 1915-1941)105 and into the United States

in 1968 ±1.4 years165. The earliest HIV-1 sequence on record was obtained from a 1959

sample taken from an adult male with sickle cell trait and glucose-6-phosphate

dehydrogenase (G6PD) deficiency in Leopoldville, Belgian Congo (Kinshasa,

Democratic Republic of Congo)211. Based on analyses of full length viral genomes, HIV-

1 has been subdivided into three distinct and genetically divergent groups; Main - M,

Outliers - O and Non M, Non O viruses - N29,48,184.

1.4. Geographical distribution of HIV-1 subtypes

Figure 1.2: Full length genomes showing the geographic distribution of HIV-1 genetic forms. BR: Brazil, CD: Democratic Republic of Congo; CF: Central African Republic; CN: China; CM: Cameroon; CU: Cuba; ES: Spain; KR: Korea; MM: Myanmar; NG: Nigeria; TD: Chad; UZ: Uzbekistan; ZA: South Africa; FSU: countries of the former Soviet Union. Adapted from Molecular epidemiology of HIV-1 genetic forms and its significance for vaccine development and therapy194

Viruses of the HIV-1 M-group are responsible for the majority of infections and

are further genetically grouped into 9 distinct subtypes labeled A-D, F-H, J and K (Fig

1.2). These subtypes have 25-35% amino acid distances and genotypic diversity in the

env sequences in the envelope gene. Within subtypes A and F subtypes there are sub- subtypes, identified with a number after the letter of the main subtype, A1, A2, A3132, F1 6

and F2194. These sub-subtypes are more similar phylogenetically to other members of

their main subtype, but not distant enough to be considered a new subtype (Fig 1.2)167.

The second group of viruses is the inter-subtype recombinant forms. In some regions, these viruses constitutes more than half of the circulating viruses10. Recombinant forms

could be circulating recombinant forms (CRF) or unique recombinant forms (URF). HIV-

1 infection by the O-subtype is generally limited to Senegal, West Africa and Cameroon,

Central Africa or individuals epidemiologically linked to these sub-regions, while HIV-1

N-subtype is limited to Cameroon, in Central Africa100. At present, HIV/AIDS pandemic

is primarily driven by six strains of HIV-1, subtypes A, B, C and D with CRF01_AE and

CRF02_AG100 (Fig 1.3).

Figure 1.3: Geographical distribution of HIV-1 subtypes. Adapted from Molecular epidemiology of HIV-1 genetic forms and its significance for vaccine development and therapy194.

HIV-2 has been classified into six clades A to F188. The significant clades are the

epidemic-associated HIV-2 subtypes A and B and the non-epidemic subtypes C and D113.

HIV-2 has about 75% homology with simian virus (SIVsm) that infects African sooty mangabeys found in West Africa, Cercocebus atys which is greater than its 40-60% homology to HIV-163,81. HIV-2 is characterized by longer incubation periods and lower

morbidity rates and is mainly localized to West Africa.

1.5 Molecular characteristics and viral replication

Figure 1.4: Mature HIV-1 virion. CA: Capsid; HLA: Human Leukocyte Antigen IN: Integrase; MA:Matrix; NC: Nucleocapsid; PR: Protease; RNA: Ribonucleic acid genome; Reverse Transcriptase; SU: Surface; TM: Transmembrane; gp: glycoprotein; Nef: Negative factor; Vif: virion infectivity factor; Vpu: Viral protein and Vpr: Viral protein R

HIV is an intracellular molecular machine that delivers its ribonucleic acid (RNA)

genome to the target host cell and is composed of an inner cone-shaped core surrounded

by matrix proteins and an outer lipid bilayer. As shown in Fig 1.4, mature HIV-1 virion

spherical, 80-100nm in diameter. Its envelope consists of a bilayer of lipids derived from various host cellular membrane during viral assembly. Cellular membrane proteins described in the envelope of HIV include human lymphocyte antigens (HLA classes I and

II), ubiquitin and actin11. Viral proteins required for infectivity also project from the

envelope. These are the glycoproteins, which are 72 peplomers (spikes or knobs), 8-15nm 9

evenly distributed spikes jutting out of the envelope of the virion30,145. Each spike is a

trimer consisting of the interacting transmembrane (TM), gp 41 and the surface (SU), gp

120 subunits at the rounded tip of each spike58. HIV matrix (MA) makes contact with

viral envelope and an internal capsid. Approximately 2000 copies of the matrix, also known as the p17 proteins, coat the inner walls of the viral envelope. Thus, the matrix protein forms a basic sheet that interacts with the acidic inner ribonucleoprotein core.

Immediately underlying and in contact with the matrix are the capsid proteins (CA), also known as p24. HIV p24 assembles to form the truncated cone-shaped internal core of the mature virion. Approximately 2000 copies of p24 encapsidates viral RNA genome,

nucleocapsid and viral enzymes114. Inside the cone-shaped structure is the two identical, unspliced, positive sense (+), single stranded RNA genome (Fig 1.4).

Closely associated with the viral RNA genome are 2,000 molecules of the nucleocapsid (NC) proteins, p765. HIV nucleocapsid is positively charged with a RNA binding motif. NC recognizes specific packaging signal in the RNA and binds nonspecifically to the RNA genome during viral assembly. Other structural proteins associated with the RNA genome are the spacer protein p6 and 50-100 molecules of viral

RNA-dependent DNA polymerase, reverse transcriptase (RT) p66 and p5134. RT enables

the packaging of reverse transcription primer tRNALys into new HIV-1 virions. Also

associated with viral RNA genome are; the viral enzymes protease (PR), integrase (IN)

and accessory proteins Nef, Vif, Vpu and Vpr (Fig 1.5).

1.6 HIV-1 genome organization

Figure 1.5: Linear organization of HIV-1 genome. CA: Capsid; gp: glycoprotein; IN: Integrase; LTR; Long terminal repeats; Nef: Negative factor; PR: Protease; Rev: Anti- repression transactivator protein; RT: Reverse transcriptase; SU: Surface; TAR: Transactivation response element; Tat: Transactivating regulatory protein; TM: Transmembrane; U3 and U5: Untranslated regions at the 3′ and 5′-ends of the genome; Vif: virion infectivity factor; Vpu: Viral protein U; Vpr: Viral protein R

HIV-1 has a 9.2 Kb genome, containing 9 open reading frames and 3 genes previously associated with other retroviruses; env, gag and pol (Fig 1.5)199. The positive

sense RNA genome is reverse transcribed into an intermediate DNA which is transcribed

into full-length mRNA. HIV mRNA is translated into structural, regulatory and accessory

genes. The structural gene is Gag/p55 or gag-pol/p160. Gag is cleaved by the HIV

protease into MA/p17, CA/p24, and NC/p6/p9 (Fig 1.5).

1.7 Replication and lifecycle

HIV replication must be highly efficient for accurate mRNA copying and virion

production without net loss of genetic information. An estimated 107 to 109 virions are

produced in order to increase the possibility of infection150. Due to small particle size

(<0.2μm) of mature HIV, virions diffuse toward target cells (CD4+ T-lymphocytes, dendritic cells, monocytes and macrophages)65. Free virions entry into target cells occurs at the apical cell surface, but efficient infection spread from cell-to-cell through the lateral junctions (Fig 1.6)65.

Figure 1.6: HIV-1 Lifecycle. CD4: cluster of differentiation, type 4; Gag: group-specific antigen protein; IN: integrase; Nef: negative factor; Pol: polymerase; RT: reverse transcriptase; SU: surface protein; TM: transmembrane protein; Vpr: viral protein R and Vpu: viral protein U.

1.7.1 Viral entry

Figure 1.7: Native trimeric state of HIV-1 envelope glycoproteins (gp120 and gp41). CD4: cluster of differentiation receptor, type 4; HR: heptad repeats; V3: variable loop 3.

HIV-1 entry requires the attachment and fusion of the virion to the host cell

membrane in a series of conformational changes mediated by viral glycoproteins gp120

and gp41 (Fig 1.7). HIV-1 replication in target host cell begins with the recognition and

attachment of viral surface glycoprotein (gp120) to the CD4 receptor present on the mature T-helper lymphocytes and macrophages41,102. The binding of gp120 to the CD4 receptor initiates a conformational change that exposes a high affinity binding site on gp41 for the coreceptor (Fig 1.8)208. CCR5 and CXCR4 are the main coreceptors utilize

in vivo by non-syncytia-inducing and syncytia-inducing strains of HIV-1 respectively151.

Figure 1.8: Multi-step process of HIV-1 is entry induced by a series of conformational changes. During viral entry gp120 binds the CD4 receptor, exposing the binding site of CCR5 or CXCR4. Helical regions (HR) 1 folds on HR 2 on gp41 to expose the fusion peptide that anchors host cell membrane. Formation of a six-helix bundle fuses the viral envelope to host cell membrane.

Two adjacent cysteine molecules characterize the CCR5 coreceptor, while

CXCR4 has two cysteine molecules separated by another amino acid. The natural ligands of CCR5 are β-chemokines (RANTES, MIP-1α and MIP-1β) produced by CD8+

lymphocytes, while SDF-1 is the natural ligand of CXCR432,61. These natural ligands

have been demonstrated to inhibit HIV replication7,39,183. In 1997, CCR5 was identified as the main coreceptor used in by most clinical primary HIV isolates, while viruses that use other coreceptors mainly CXCR4 appear as the disease progresses in 50-60% of patients36,151. Change in coreceptor usage from CCR5 to CXCR4 has been associated

with disease progression and CD4+ lymphocytes decline36. The high affinity gp41-CCR5 15

interaction induces conformational changes in gp41 to expose the fusion peptide located

on the hydrophobic N-terminal ectodomain of gp41131. Between the fusion peptide and

the membrane anchor, gp41 has two 40-60 amino acid hydrophobic heptad repeat regions, HR1 and HR2. HR1 regions (N-peptides, proximal to the N terminus) forms a

trimeric parallel coiled coil structure, HR2 regions (C-peptides, preceeding the

transmembrane portion) folds up on itself and within the HR1 forming a stable six-helix

bundle within a hairpin structure(Fig 1.8)27. The six-helix bundle draws both viral and

host cellular membrane closer for fusion203.

1.7.2 Uncoating of HIV-1 internal core

A partial and progressive uncoating or disassembling of the viral capsid shell from the internal core to release the ribonucleoprotein core follows viral entry (Fig 1.6).

HlV-1 uncoating occurs at the cell membrane and it is mediated by both viral and cellular factors. Mutations, primarily in the capsid, matrix, nucleocapsid, Vif and Nef proteins have been associated with failure of the HIV replication prior to reverse transcription4.

Cyclophilin A (CypA), a member of the peptidyl prolyl isomerase family, mediates the destabilization and core expansion of nucleocapsid to cause the release of the capsid and the initiation of reverse transcription. Although this process is still poorly understood, it is believed that CypA binds to proline characterized by 150 amino acids that form a binding pocket for HIV-1 Gag (amino acid position 151) and catalyzes the cis-to-trans isomerization of the peptide bonds preceeding the proline23. Cyclophilin A Reduced 16

infectivity and loss of wild-type HIV-1 replication have been reported in the absence of

Cyclophilin A4,23.

1.7.3 Reverse transcription

Reverse transcription is believed to occur concurrently with viral uncoating (Fig

1.6)4,142. HIV-1 single stranded (+) RNA genome is reverse transcribed into a full-length

double-stranded intermediate DNA by the viral enzyme reverse transcriptase (Fig 1.6).

Reverse transcription is believed to occur in a nucleoprotein complex in vivo, catalyzed

by HIV reverse transciptase enzyme, but the efficiency of this process is enhanced by

viral and cellular proteins97. The two identical copies of HIV-1 genome are joined head-

to-head around the 5′ region by the dimer linkage structure (DLS)42. HIV genome

Lys contains two copies of the tRNA3 primer for reverse transcription. Binding of the

tRNA primer to the RNA forms a 18-19 base double stranded primer nucleotides of the 3′

terminal of the tRNA binding to the primer binding site86. The structure of the p66 subunit has been described with the same analogy used for the Klenow fragment of

Escherichia coli DNA polymerase I; as a large cleft or an open right hand with fingers,

palm and thumb subdomains, with active sites readily open to the substrate.

The polymerase active site resides in the palm subdomain and characterized by three critical aspartic acid residues (Asp-110, Asp-185 and Asp-186). The connection subdomains of both p66, p51 and the thumb of p51 form the floor of the template-primer binding site88. The basic structures of p66 and p51 are identical. However, p51 lacks 17

RNase H and the spatial conformation of the subdomains in p51 buries the active site of the three aspartic acid residues thus, making it inaccessible for template-primer binding185. Essentially, p66 is catalytic while p51 is structural for binding to the anticodon stems and loops of the tRNA primer110. RT has the capability to function as a

RNA dependent DNA polymerase (RDDP) for RNA directed polymerization; DNA dependent DNA polymerase (DDDP) for DNA directed polymerization; RNase H for the digestion of the RNA template and Helicase65.

The steps of reverse transcription have been extensively characterized as shown in

Fig.1.9:

1. Reverse transcription begins with the binding of the 3′-end of the tRNA primer to

the primer binding site (pbs) on the 5′-end of HIV-1 RNA template to form the

Lys tRNA3 : RT complex and the incorporation of deoxynucleotides into a nascent

DNA chain. Primer discrimination is determined by a pseudo-knot (a secondary

Lys 86 structure) formed by the tRNA3 : HIV RNA complex . Synthesis of the

negative strand DNA from the RNA template by RNA dependent DNA

polymerization starts from the pbs to the 5′-end through the u5 and stops at the

repeat (r) region to generate the 60-150bp long, negative strand strong stop (-sss

DNA). The -sssDNA is complimentary to the repeated R sequence at the both 5′ -

and 3′ -end of the viral genome34,97.

2. RNA template in the hybridized RNA:-sssDNA duplex is degraded by RNase H

exposing the –sssDNA34,97. 18

3. Further synthesis requires a strand transfer (template exchange). Template

exchange facilitates the annealing of the –sssDNA to the 3′-end of the same strand

(intramolecular transfer) or the second strand of the genome (intermolecular

transfer). This exchange is mediated by the repeated (R) sequences at the 5′ and

3′- ends of HIV-1 genome. Following template exchange, DNA synthesis

proceeds in the 5′-end34,97.

4. DNA synthesis on the –sssDNA resumes towards the 5′-end. Synthesis is

accompanied by incomplete RNA template degradation by RNase H from the

RNA:DNA hybrid, after DNA synthesis of the polypurine tract (PPT)34,97.

5. A specific RNA sequence from the polypurine tract primes the beginning of plus-

Lys strand DNA synthesis generated using the tRNA3 as template for a short

sequence of plus-strand strong stop DNA (+sssDNA)34,97.

Lys 6. The tRNA3 primer is removed by RNase, exposing the +sssDNA sequence

generated from the tRNA primer34,97.

7. DNA-dependent DNA polymerization of the plus-strand DNA continues using the

negative-strand DNA as a template. The PBS in the +sssDNA and minus-strand

DNA anneal in the second strand transfer reaction or template exchange34,97.

8. Both plus and minus-strand DNA continues with one strand using the other as

template to produce a double-stranded DNA34,97

9. Completion of synthesis of the plus- and negative- HIV DNA strands by HIV

reverse transcriptase with internal discontinuities in the plus-strand DNA34,97. 19

10. Internal discontinuities in the synthesized double-stranded DNA are probably

repaired by host cellular enzymes to form either a linear double-stranded HIV

DNA or circular DNA products with 1- or 2-LTRs. Both forms of circular DNA

products are incapable of integration into host chromosome34,97.

Figure 1.9: HIV-1 reverse transcription of viral genomic RNA into an intermediate DNA . Adapted from Principles of Virology: Molecular Biology, Pathogenesis, and Control of Animal Viruses, 2nd Edition65. DDDP: DNA dependent DNA polymerase activity of RT; LTR: Long terminal repeats; PBS: Primer binding site; PPT: Polypurine tract; RDDP: RNA dependent DNA polymerase activity of RT; tRNA: transfer RNA; U3 and U5: Untranslated regions. 21

1.7.4 Integration

Figure 1.10: Process of HIV-1 integration consists of three significant steps, following the recognition of the att sequences by HIV-1 integrase. In 3´-end processing, viral DNA is cleaved of the GT dinucleotide to expose the terminal CA dinucleotide. In the strand transfer reaction, cleaved viral DNA is ligated into host chromosome. Host cellular enzymes are believed to repair the 5-bp gap between viral DNA and host chromosome.

Integration marks the beginning of the late phase of HIV-1 lifecycle and occurs following reverse transcription of the viral RNA genome into an intermediate DNA34.

HIV Integrase is transported into the nucleus in a pre-integration complex (PIC)65. Other contents of the PIC include various viral structural proteins such as matrix, Vpr, 22

p7/nucleocapsid, reverse transcriptase, viral RNA and the newly transcribed DNA. The

PIC also contains host proteins cellular proteins such as barrier to auto-integration factor

(BAF), interactor 1, lens derived growth factor (LEDGF), heat shock protein 60 (hsp 60),

high-mobility group protein A1 (HMGA1)65,152. The only viral protein required for DNA

integration into host chromosome is HIV integrase25. HIV-1 virion contains about 50-100

copies of integrase (IN)65. Integration is highly specific for viral DNA; HIV integrase recognizes and binds to a specific, imperfect and inverted sequence in the long terminal repeats (LTR) of reverse transcribed DNA. These recombination sites contain the att sequences, which are 10-20 bases at both ends of the viral DNA152.

The first step is the 3′-processing, an endonucleolytic reaction in which HIV

integrase removes the terminal GT dinucleotide from the 3′ ends of the viral DNA, by a nucleophilic attack on the phosphodiester bond between the deoxyguanosine and deoxyadenosine. This results in a recessed but conserved CA dinucleotide with a free 3′ hydroxyl group at each end of the viral DNA (Fig 1.10). The second step is the strand transfer reaction, in which the recessed 3′-hydroxyl end of the viral DNA act as a nucleophile and attacks the host chromosome. This nucleophillic attack cleaves the host

DNA and ligates the viral 3′-OH end from 3′-end processing to the 5′-end of the cleaved

host DNA (Fig 1.10)96,152. The third step is the repair of the five-base, single-stranded gap

at the junction between integrated viral DNA and host DNA, and a two-base flap at the

end 5′-ends of the viral DNA. This step is carried out by integrase in coordination with

cellular repair enzymes152.

1.7.5 Transcription and nuclear transport

HIV-1 DNA integrated into host chromosome is transcribed by host cellular

RNA polymerase II to yield mRNA. HIV transcription is regulated by complex

interactions between cellular and viral transcriptional factors particularly the HIV

promoter in the LTR region. Transcription is specific and dependent on the integrity of the promoter region65. Within HIV-1 LTR, are three main domains U3, R and U5187.

Transcription is initiated by the 5'-LTR, the 3'-LTR stimulates transcription when the 5'-

LTR is defective. Three elements of the U3 region (-454 to -1), that modulate transcription are, the core or promoter, enhancer and modulatory elements169. The core

element contains the TATA box, (a TA rich sequence located 20-35 bp upstream of the

site of initiation) and three Sp1 binding sites169. The enhancer element contains the two

binding motifs for nuclear factor (NF)-κB (also involved in immune and inflammatory

responses)138. The modulatory elements contain binding sites for constitutive factors;

Sp1, Ets1, LEF1, cyclic AMP response element –binding protein (CREB) and inducible

factors; NF-AT and AP-1. The R region (+1 to +100) contains the trans-activation responsive (TAR) RNA stem-loop structure, which binds to Tat, immediately downstream to the promoter177. Tat is a 15 KDa protein involved in the elongation of the

DNA transcript12. Tat specifically binds to the upper stem loop and bulge of TAR (59

nucleotides in nascent viral RNA)60,159. Binding of Tat to TAR induces conformational

changes in TAR, repositioning important functional groups on the RNA for high affinity

interactions with the protein156. Although binding of Tat to TAR has no effect on the

initiation of transcription, however this interaction increases the efficiency of 24

transcription by a 100-fold. In the absence of Tat, transcription of viral cDNA stops after

the first 60 bases99.

Capping of the 5’-end of the newly synthesized mRNA is a co-transcriptional

function that starts when the mRNA is about 20-30 nucleotides long. Capping prevents

newly synthesized mRNA from 5′-exonuclelytic attack while allowing mRNA

recognition during splicing of 5′-terminal exons. 3′-end polyadenylation, the addition of a

polyA signal (AAUAAA) to the 3′-end of viral mRNA, is a co-translation as well as a

post-transcriptional process that stabilizes viral mRNA155. Efficient HIV-1 gene splicing requires host small ribonuclear proteins to ensure accuracy with no loss of coding sequencing. Splicing of HIV-1 mRNA results in the production of Tat, Rev and Nef proteins176. Rev directs the export of unspliced or singly spliced HIV-1 pre-mRNAs and

mRNA from the nucleus into the cytoplasm64.

1.7.6 Assembly and maturation

Figure 1.11: Budding and maturation of HIV-1 virion. Virion maturation occurs mainly out of host cell, with the final cleavage of the Gag and Gag-Pol polyproteing into structural proteins.

HIV virion assembly and maturation organizes viral RNA genome, enzymes, structural and accessory proteins into new virions (Fig 1.11). The mature virion is essentially the product of viral protease cleavage of the Gag (p55) and Gag-Pol (p160) precursor polyproteins into structural proteins (p24, p2, p17, p7, p1, and p6) and enzymes 26

(protease, reverse transcriptase and integrase)160. The presence of these proteins increases virion infectivity141. Gag promotes the recruitment of itself and other viral proteins such

as Env, tRNA primer, viral RNA and Vpr into the new virion. Gag forms an intermediate

complex with viral RNA genome, that is transported to the plasma membrane and packaged into the new virion.

The process of new virion assembly and maturation consists of the following steps: Gag multimerization; binding of p55 complexes to viral genomic RNA; formation of Gag/Gag-Pol complexes; formation of preassembled complexes containing Vpr associated with the p55, Vif and host cell proteins and transportation of the complexes to the cell membrane24. Transportation to the cellular membrane is facilitated by the

myristolated N-terminal of the MA protein which acts as a localization signal. Vif is

required for virus infectivity due to its inhibitory effect on of a cellular protein,

APOBEC3G (apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like 3G

also known as CEM15) on HIV replication especially in CD4+ T-lymphocytes124.

APOBEC3G exerts its antiviral effects during reverse transcription by triggering the hypermutation of G-to-A by changing deoxycytidine to deoxyuridine in the minus-strand of the nascent cDNA chain. Vif prevents the packaging of APOBEC3G into HIV-1 virions by forming a complex with APOBEC3G125. This complex ubiquitinated and targeted for degradation by a proteasome178.

1.8 Highly active antiretroviral therapy (HAART)

Figure 1.12: Highly active antiretroviral therapy (HAART) is the use of two nucleoside/nucleotide reverse transcriptase inhibitors, a protease or non-nucleoside reverse transcriptase inhibitor with the fusion inhibitor added as required to the treatment plan.

HAART is a triple drug regimen that consists of two NRTI, either a NNRTI or a

PI while the fusion inhibitor is added as required to treatment plan (Fig 1.12). Currently,

there are 21 drugs approved in Europe and the US for treating patients and several others

are in different stages of development. There are many formulations that are one pill per day and single pill combination regimen. HAART has significantly reduced short-term mortality. Mortality rate has decreased by 5% from 1999-2003 following the introduction of HAART. HAART has significantly suppressed viremia; reduced immune activation; restored lymph node architecture; increased patient life expectancy to an average of eight years by maintaining low plasma HIV-1 viral RNA levels; increased CD4+ lymphocytes count75,76,78,111,112,134,135,146; improved patient quality of life by delaying the onset of

opportunistic infections and AIDS106. 28

1.8.1 Disadvantages of HAART

1. High cost of drugs: the average cost of therapy for one patient per year is $18,000,

making antiretroviral treatment out of the reach of the majority of individuals infected

in the developing countries197.

2. Multiple and complicated drug regimens that leads to lack of patient adherence has

been associated more with failure of therapy than the occurrence of resistance191.

Until recently, pill burden was a leading cause lack of adherence. Patients on NNRTI

based therapy usually take 2-3 pills per day for NNRTI based therapy while those on

PI based therapy take 8-9 pills. However, pill burden has been reduced by co-

formulations of different antiretroviral drugs and once a day prescription.

3. Toxicity and pharmacologic interactions: drug toxicities and tolerability differ

according to the different classes of drugs. Potential drug interactions are difficult to

assess in vivo as specific drugs cannot be used in clinical therapy with other drugs.

4. Non-individualization of therapy: patients are often taken off therapy once it fails,

showed toxicities or resistance, without accounting for differences in race, gender or

genetic factors.

5. Incomplete suppression and latency: The obvious goal of any therapy is to reduce

patient viral load to undetectable levels179.

6. All classes of ARV are associated with class specific drug-resistant mutations

therefore, available regimens of drug combination therapy has associated resistance51.

There have been reports of new HIV infections with drug resistant viruses in

treatment-naïve patients (especially NRTIs)121. 29

7. Despite the very obvious benefits of HAART, the number of chronically infected

patients also keeps increasing, therefore forming a large source pool of new infections

in the community89,175.

1.8.2 Antiretroviral drugs and their mechanisms of action

Figure 1.13: Targets of antiretroviral drugs. Current clinically approved antiretroviral drugs target HIV entry, reverse transcriptase and protease. Targets under development target viral binding, integration into host chromosome and virion maturation.

1.8.2.1 Reverse transcriptase inhibitors (RTIs)

HIV-1 reverse transcriptase (RT) has proven to be a critical target in the

treatment of HIV/AIDS. As outlined above, RT catalyzes an important step in HIV-1 replication, the reverse transcription of viral genomic RNA into a double-stranded DNA that is integrated into host chromosome (Fig 1.13). This group includes three main sub-

groups of ARVs that target HIV-1 reverse transcriptase enzyme.

1. Nucleoside/2′,3′ -dideoxynucleosides reverse transcriptase inhibitors.

2. Acyclic nucleoside phosphonates reverse transcriptase inhibitors.

3. Non-Nucleoside reverse transcriptase inhibitors.

1.8.2.1.1 Nucleoside Reverse Transcriptase Inhibitors

O O NH2 CH 3 CH3 NH NH NH

O N O N O N

OH OH OH O O O

N3 Stavudine (d4T) Zalcitabine (ddC) Zidovudine (AZT)

O NH NH2 N N N NH N

N N 2NH N N O N OH OH O O OH S

Didanosine (ddI) Lamivudine (3TC) Abacavir (ABC)

NH2 F N

O N Emtricitabine (FTC) OH S O

Figure 1.14: Structures of nucleoside reverse transcriptase inhibitors (NRTI). 32

As shown in Fig 1.14, this class of drugs consists of nucleotide reverse

transcriptase inhibitors zidovudine (AZT), didanosine (ddI), zalcitabine (ddC), stavudine

(d4T), lamivudine (3TC), abacavir, and emtricitabine (FTC). Synthesis of 3'-azido-2′,3'- dideoxythymidine (AZT, zidovudine) was originally published in 1964 by Jerome P.

Horowitz as an analogue of physiologically important deoxynucleosides in the quest of

more effective cancer chemotherapy84. Prior to 1987, nucleoside RTIs were already in

clinical use as polymerase inhibitors to treat herpes virus infections and malignancies163.

In 1987, NRTIs became first class of drugs to be approved by the Food and Drug

Administration of the United States (FDA) with the approval of AZT which was discovered at the National Institutes of Health to be effective in the treatment of AIDS,

AIDS related complex (former name of pre-AIDS clinical conditions) and HIV infected patients209. Since then, this class of antiretroviral drugs has become the backbone of

therapy and has widened to include a total of eight approved drugs, six combination

formulations and one multi-class combination formulation (Atripla)67. NRTIs are active

against HIV-1, HIV-2 and SIV. The two mechanisms for the inhibition of HIV RT by

NRTIs are direct inhibition of HIV reverse transcriptase by competition pharmacokinetics

and termination of the elongation of viral cDNA chain.

All NRTIs require three phosphorylation steps by host cellular enzymes

thymidylate kinase (AZT and d4T), cytosolic dCyd kinase (ddC and 3TC) and cytosolic

5′- nucleotidase (ddI) to generate metabolically active 5′-triphosphates which act as chain terminators when incorporated into the nascent DNA chain during the first or second strand synthesis in reverse transcription15,163. NRTIs act as chain terminators; they lack a 33

3′-hydroxyl group at the sugar (2′-deoxyribosyl) moiety and therefore prevent the

formation of a 3′-5′ phosphodiester bond between the NRTI and incoming 5′- nucleoside

triphosphates. In AZT, the 3′-hydroxyl group is replaced by an azido group (in AZT) or a hydrogen (in ddI or ddC)45,163. Phosphorylated NRTIs are strong competitors with

natural deoxyribonucleotide triphosphates (dNTPs) in binding to viral RT, their efficacy

is dependent on the availability of dNTP pools in the cells and the efficiency of their

phosphorylation, hence their effect is highly variable in individuals and cells lines45.

The major side effects of NRTIs are due to toxicity to cellular mitochondrial

DNA polymerase. These include bone marrow depression and anemia (AZT), peripheral neuropathy (d4T), sporadic pancreatitis (ddI), hepatic transaminase elevation (ddI and d4T), lactic acidosis (AZT, ddI and d4T) to headaches, nausea, vomiting and diarrhea116,179. Drug interactions resulting into additive toxicities and antagonistic activity have been observed in combination therapy with different NRTIs45. HIV resistance to

NRTI is mediated by ATP-dependent pyrophosphorolysis, which is the removal of

NRTIs from the 3′-end of the nascent chain and reversal of chain termination; and increased discrimination between natural deoxyribonucleotides and NRTI-5′- triphosphates. Mutations associated with NRTIs are thymidine analogue associated mutations (TAMs): M41L, D67N, K70R, L210W, T215Y/F and K219Q/E. TAMs especially D67N and K70R promote pyrophosphorolysis and are associated with resistance to all NRTIs. M184V mutation is associated with 3TC containing formulations. 34

A newer generation of NRTIs include (-) dOTC and D-d4FC. D-d4FC, (a d-

enantiomer of dideoxyfluorocytidine), is a cytidine analogue active against AZT- and

3TC-resistant viruses and viruses with thymidine analogue mutations but not against

multi-nucleoside resistant HIV. (-)dOTC, a negative enantiomer of the thiacytidine

derivative dOTC (2′-deoxy-3′-oxa-4′thiocytidine) formerly known as SPD754, is also a

cytidine analogue structurally similar to 3TC and FTC but, active against AZT- and 3TC-

resistant viruses with significantly reduced mitochondrial toxicities122. However, these new generation of drugs are still limited to modest efficacy with less than a 10-fold reduction in viral RNA levels observed in HAART experienced patients.

1.8.2.1.2 Acyclic phosphonate inhibitors of reverse transcriptase

The sub-class is also known as nucleotide inhibitors of HIV reverse transcriptase

(NtRTIs)47. Like nucleoside reverse transcriptase inhibitors, ANPs lack the 3′-hydroxyl

group in the sugar (2′-deoxyribosyl) moiety.

NH2

N N

O N N O O O P O

O O O O 3CH Tenofovir disoproxil fumarate O

Figure 1.15: Structure of nucleotide reverse transcriptase inhibitor. 35

In this group the sugar moiety is replaced by an acyclic aliphatic 2-methoxyethyl

(adefovir) or methoxypropyl group (tenofovir) and therefore also act as terminators of the

elongation of nascent viral DNA46. The only FDA approved NtRTI is tenofovir

disoproxil(Fig 1.15)67. However, unlike nucleoside analogues, these compounds already possess a phosphonate group and therefore will only require only two phosphorylation steps by cellular enzymes to be converted into metabolically active drugs47. The main

adverse effects of ANP therapy are headaches, nausea, vomiting and diarrhea

(Tenofovir)116,179. Clinical therapy with Tenofovir containing formulations has been

associated with the K65R mutation in HIV-1 RT which confers a 3-fold increase in

resistance to Tenofovir179.

1.8.2.1.3 Non-nucleoside reverse transcriptase inhibitors (NNRTI)

Nevirapine, delavirdine and efavirenz are the only three FDA approved NNRTIs

till date (Fig1.16)67. NNRTIs are hydrophobic compounds that indirectly inhibit HIV-1 reverse transcriptase by binding to HIV-1 RT and forming a hydrophobic pocket proximal, but not overlapping the polymerase active site on the enzyme103,192. NNRTIs do

not possess the nucleoside structures, require intracellular metabolism to active products,

interact with cellular polymerases, terminate nascent DNA chains or significantly inhibit

other retroviruses such as HIV-2 and SIV45,103,207.

O CH3 3CH CH3 CH NH 3 SO 2 NH NH N N N N N N N NH O

Nevirapine Delavirdine

F 3C

Cl O

N O H Efavirenz

Figure 1.16: Structure of non-nucleoside reverse transcriptase inhibitors (NNRTI).

NNRTIs interact with a nonsubstrate-binding site proximal to the active site catalytic residues (aspartic acid triad) of on HIV-1 RT, thus changing the spatial conformation of the substrate binding site and reducing the catalyzation of HIV-1 reverse transcription103,186. Rapid emergence of high level NNRTIs associated resistance usually

results from single amino acid substitutions such as Y181C and K103N. Moderate level

resistance has been associated with HIV-1 L100I mutation following clinical therapy

with NNRTIs192. NNRTIs mutations are located in the NNRTI binding pocket in HIV-1

RT and significantly block drug binding192. NNRTIs associated adverse effects are less

severe than NRTIs, the most common adverse effect is pruritic maculopapular rash;

elevation of liver transminases, that is rarely associated with fulminant hepatitis; diarrhea, 37

fever; CNS toxicities such as dizziness and headache45,179. Nevirapine has been reported to reduced mother-to-child transmission during labor and child delivery more significantly than AZT82.

Second generation NNRTIs have been developed specifically to circumvent high levels of resistance generated by single amino acid substitution mutations conferred by clinical therapy with first generation NNRTIs. Two of the second generation NNRTIs under development include TMC 125 (etravirine) and TMC 278. These diarylpyrimidine

(DAYP) derivatives are reported to be active against viruses with cross-resistance to nevirapine (NVP), efavirenz (EFV) and delavirdine (DLV)44. TMC125 has an in vitro

8 IC50 of 1.4nM, long half-life of 30-40 hours . The relative molecular flexibility of

TMC125 compared to other NNRTIs allows TMC125 to bind to the reverse transcriptase despite changes induced by NNRTI-resistant mutations43.

1.8.2.1.4 Protease Inhibitors (PI)

PIs are compounds inhibiting HIV-1 protease proteolytic activity, particularly the processing of gag and gag-pol polyproteins into structural proteins and enzymes

(protease, reverse transcriptase and integrase) required for virion maturation and infectivity38,166. PIs were the first class of rationally designed antiretroviral drugs.

Saquinavir mesylate (Ro 31-8959), was designed, based on the molecular knowledge of the structure and function of HIV-1 protease and its natural substrates166. 38

Ph H OH OH N OH NH Asp NH H N N CH 3 N CH3 O O CH3 Ph NH O O NH

CH Saquinavir 3CH 3 CH3 CH3 Indinavir

OH CH3 H O NH N S OH NH2 O O O H NH O NH N CH Ph OH 3 CH3 Fosamprenavir CH3 O CH PhS O NH 3

3CH Ph S CH 3 O Nelfinavir 3CH N N Val NH S NH O O OH Ph N Ritonavir

3CH 3CH Ph CH3 OH NH2 H OH NH O S NH N O O O H S H O O O O O O CH O Ph 3

Darunavir Tipranavir

3CH CH3 O O CH3 NH O NNH NH O OH 3CH

Lopinavir

Figure 1.17: Structure of protease inhibitors (PI). 39

Currently available formulations include: saquinavir mesylate (SQV), indinavir

(IDV), nelfinavir mesylate (NFV), atazanavir sulfate, ritonavir (RTV), fosamprenavir and lopinavir boosted with ritonavir (LPV/r). Two new PIs, tipranavir and darunavir (DRV) also known as TMC114 have recently been approved for treating HAART-experienced patients especially those on PI-based regimens67. Three of the nine cleavage sites of HIV-

1 protease occur between phenylalanine–proline peptide bond and most PIs have been

designed to mimic this peptide bond. In general all PIs, except tipranavir are reversible

peptidomimetic compounds containing non-cleavable cores with nonhydrolyzable

functional group (usually a hydroxyl group hydroxyethylene or hydroxyethylamine moiety that is used as the basic core).

Tipranavir is a non-peptidomimetic drug that binds with high affinity and selectivity to HIV-1 PR and demonstrates little cross-resistance to other PIs37. Darunavir

(TMC114) is a bis-tetrahydrofuranyl PI active against both HIV-1 and HIV-2. Power 2

study ( 24-week phase IIb trials) have shown that 39% of HAART experienced patients

with 1 or more PI mutations have undetectable plasma HIV RNA compared to 7% in the

control arm of the trial206. All protease inhibitors have similar adverse effects, namely,

hyperlipidemia, hyperbilirubinemia, hepatic damage, lipodystrophy73.

1.8.2.1.5 Entry inhibitors

Enfuvirtide (T-20, DP-178), a synthetic peptide approved by the FDA in 2003, is

the sole member of this class of drugs67. Enfuvirtide, synthesized through the condensation of peptide fragments, corresponds to 36-amino-acids found in the C-

terminus of residues 127-162 of gp41 (position 643-678 of HIV-1LAI gp160 precursor)204,205. HIV-1 transmembrane protein (gp41) plays an important role in both

virus-mediated cell-cell fusion and infection of by cell-free virus. Enfurvirtide selectively

inhibits HIV-1 above HIV-2 or SIV205.

O NH2

CH3

ONH2 O OH CH3 OH CH OH 3 CH 3 OH O O CH O O O O 3 O O NH NH NH NH NH NH NH NH NH NH NH NH NH O NH NH O NH O O O O NH O O 2 CH 3CH 2NH 3 OH N O OH CH3 NH CH3 O NH O CH3 O OH O OH

NH O

2NH NH

O O

NH NH 2 2NH

OH O OH 3CH 3CH

O O CH O NH 3 CH CH 3 3 CH O 3 CH O O 3 CH NH O O 3 N NH NH NH NH NH NH NH NH H NH NH NH O O O O O O CH3 NH 2NH O NH O OH OH O O CH 3 O NH2 OH O NH

NH NH O 2

Figure 1.18: Structure of Fusion inhibitor (Enfuvirtide/T-20). 41

Enfuvirtide binds to the N-terminal domain of gp41 and prevents gp41 zipping, i.e. the folding of the HR2 domains of gp41 on itself and its association with HR1 domains to form the six helix bundle. Due to the rapid emergence of high level resistance to enfuvirtide, T-20 monotherapy is impossible. Unlike other antiretroviral agents, enfuvirtide is administered by twice daily subcutaneous injection and thus is associated with injection site reactions (ISR)107,109. Mutations associated with T-20 therapy include amino acid substitutions at gp41 positions 32 (Q to R/H), 36 (G to S), 38 (V to A) and 39

(Q to R)129.

1.8.3 New antiretroviral compounds under development

1.8.3.1 Coreceptor antagonists

As previously described, HIV entry is a multi-step process of conformational

changes, however efficient HIV-1 entry and infection depends on the integrity of

chemokine receptors acting as HIV-1 coreceptors in addition to the CD4 receptor41,102.

Various research groups are studying new coreceptor antagonists such as Maraviroc (UK-

427,857) that selectively inhibits all CCR5-tropic viruses. Maraviroc is currently in phase

III clinical trials.

1.8.3.2 Integrase inhibitors

Extensive work has been done to identify inhibitors of HIV integration. HIV integration is a particularly desirable target it is required viral replication and 42

continuity198. Deleterious integrase mutations in highly conserved single amino acid have

been shown to impact affect viral replication181. Accumulated unintegrated viral DNA

products of integration are degraded in cells within 12-24 hours. The products of HIV-1

integration include linear and unintegrated DNA, 1- and 2-LTR circles formed by the

ligation of the LTR ends of the linear HIV genome and therefore contain one or two

copies of the viral long terminal repeats181. Most importantly, HIV-1 integrase has no

known human equivalent and offers the possibility of high drug specificity with limited

cellular toxicity, thus reducing the possibility of drug toxicities and interactions.

MK0518, a potent inhibitor of the strand transfer reaction during HIV-1 cDNA

integration into host chromosome. MK0518 is currently in phase II clinical trials136.

1.8.3.3 Nucleotide competing reverse transcriptase inhibitors

Are non-nucleoside competitors of natural nucleoside substrates that bind to the active site of HIV-1 reverse transcriptase and inhibit nucleoside binding93. These compounds are still in the in vitro testing phase.

1.8.3.4 Virion maturation inhibitors

The mature virion is essentially the product of the cleavage of the gag (p55) and gag-pol (p160) precursor polyproteins into structural proteins and enzymes (protease, reverse transcriptase and integrase)160. Gag polyprotein is synthesized on cytosolic

polysomes, targeted towards the plasma membrane. The products of HIV-1 gag are p17 43

(MA), p24 (CA), p7 (NC) and a small proline-rich peptide as well as p1 and p2 (spacer

proteins)24,160. The first member of this class of antiretroviral compounds is PA-457

(Bevirimat), an selective inhibitor of the final cleavage of capsid-p2 precursor from the

assembled gag170, thus preventing the cleavage of p25 to mature capsid p24, that is

required for viral infectivity5,6,117. Mutations conferring drug resistance to PA-457 occur

in residues around the p25-p2 cleavage site118,210. The antiretroviral activity of this

compound has been suggested to due to its binding to the p25-p2 cleavage site, thus

delaying the cleavage of p25 to p24 and the preventing the formation of a stable cores210.

Levels of p25 and matrix-capsid protein (p41) increase following the inhibition of Gag processing. It is currently in phase 2b clinical trials5.

1.9 Identification and characterization of new antiretroviral drugs

There is an urgency to identify new drugs belonging to established drug classes or

new mode of action in the treatment of HIV/AIDS. The side effects associated with

HAART have made the search for simpler and less toxic alternatives imperative. There

are also new priorities in the HAART era to develop:

1. More potent therapy to attain more easily sustained antiviral effects; prevent

establishment of latent infection and possibly eradicate infection.

2. Additional classes of drugs to enable class sparing and reduce the occurrence of

therapy failure.

3. Compounds that balance efficacy and toxicity, particularly with greater target specificity. 44

1.9.1 Methods of drug screening

1.9.1.1 High-throughput screening (HTS)

High-throughput screening uses fluorescence and scintillation-based biological assaysamenable to automation to identify potential new compounds for development143.

HTS allows the rapid screening of compounds library containing more than 100,000 molecules. HTS and computional chemistry have improved the efficiency of determining drug targets with rapid turnover. According to the Lipinsky rule of five, orally bioavailable marketed drugs have molecular weight less than 500 daltons, hydrogen bond acceptors less than 10 (sum of N and O), hydrogen bond donors less than 5 (sum of NH and OH), calculated octanol/water partition coeffient (cLogP) less than 5120. HTS-derived

hits have drug-like properties but generally have MW less than 100, 1 or 2 rings and

more lipophilicity to allow for additions to the compounds during lead optimization193.

The Lipinsky rule of five improves the understanding the bio-physicochemical properties, i.e., administration, distribution, metabolism and excretion (ADME) properties of lead compounds. It also allows the optimization of lead compounds for the production of drug-like candidate compounds with higher MW comparable to drugs.

1.9.1.2 Fragment-based lead discovery

This is a newer and more efficient method of drug discovery. It identifies smaller scaffolds that could be optimized to generate larger, lead-like compounds with desirable physicochemical properties. These compounds could be further optimized into drug-like 45

molecules59. The fragment-based strategy is used to screen fewer molecules, identify

smaller-molecule compounds, low affinity hits for chemical synthesis of higher

molecular weight and affinity leads59,161. Fragment-based drug discovery like

conventional HTS uses bioassays, in addition to biophysical assays such as NMR, mass

spectroscopy and x-ray crystallography133. Unlike the Lipinsky rule of five for drug-like leads generated by conventional HTS, compounds analyzed by fragment-based lead discovery are characterized by the rule of 3, i.e., molecular weight less than 300 (100-

250), three or less hydrogen acceptors or donors and calculated logP (CLogP) less than 3 at concentrations between 250 -1000μM more than 10-30μM analyzed for conventional

HTS35.

1.9.2 Target-driven vs. diversity-driven drug synthesis

The traditional method of drug discovery is the target-driven drug discovery; this

process involves the identification of compounds against a specific protein target. It is a

laborious linear process where modulators of an identified protein target are synthesized,

characterized and developed. Diversity-driven drug discovery is used to simultaneously

identify various protein targets and their small molecule regulators174. Diversity-driven

drug discovery has been developed and improved by rapid DNA sequencing,

combinatorial chemistry, efficient and automated syntheses. It has also been improved by

efficient purification of reaction products, incorporation of multiple drug targets into

biochemical or cell-based assays, quantitative structure-activity relationships (QSAR),

increased knowledge of basic pathophysiology [nuclear magnetic resonance spectroscopy 46

(NMR), x-ray crystallography, proteomics and bioinformatics] and automated high-

throughput screening123.

1.9.3 Hits versus leads

Hits are usually compounds with non-optimized pharmacokinetic profiles that

elicit a positive response from a screening process on a target protein that could be used

to identify more leads55,123. Leads are compounds derived from hits that continue to show

the initial response in more complex models (in vivo pharmacological models which

could be cells and/or animals) in a dose-dependent manner, but their pharmacokinetic

properties have not been fully optimized 55,123. Leads are usually low-level potency

compounds optimized by sequential structure-based analyses and affinity fingerprinting

to synthesize or identify analogues with increased potency, safety and binding than the

lead compound to identify candidate drugs52. Rapid virtual screening following HTS, using computational chemo-informatics and biochemical assays, have increased the reliability of HTS with the ability to identify most leads14,144. In general, computation is

less expensive than starting and failing with each new compound98,98. Target validation shortens the time of drug discovery, while increasing the efficiency of the system. The therapeutic value and relevance of each target is evaluated using biology-based assays to determine the effect of the “hits” on their targets, as the same target could be associated with several physiological or pathological processes. 47

1.9.4 Successful drug discovery

A successful hit would have IC50 ≤ 10μM. Lead optimization is used to further

98 reduce the IC50 to 1-10nM . The acceptable success rate of HTS is below 0.1% of the

total molecules screened. However, bioassays are associated with a high rate of false

positives and negatives, due to compound toxicity, non-specific binding and compound

interference with the bioassays, such as fluorescent compounds in a fluorescence-based

biological assay164. Often encountered limitations of HTS are compound degradation,

evaporation and inadequate molecule concentrations in test plates. Other limitations include the difficulty in maintaining plate reproducibility (cellular and replicator

problems), solvent interference and subjective analysis of screening read-out system and

results14.

The goal of small-molecule screening should be to develop credible and

reproducible protocols for drug library screening to identify “hits”, determine the

efficacy, potency and toxicity of various leads. The bedrock of HTS is no longer the

number of compounds screened per day, but designing robust assays and testing

structurally diversed, large compounds libraries. Thus, the quality of lead generated is

better than the quantity (number of leads)144. CHAPTER II

IDENTIFICATION AND CHARACTERIZATION OF NOVEL HIV-1 INHIBITORS FROM THE HIGH-THROUGHPUT SCREENING OF SMALL MOLECULE LIBRARIES

INTRODUCTION

The goal of this project was to characterize new antiretroviral compounds identified from a small molecule library screening project. Thirty-four compounds or hits were identified from the screening of two small molecule sub-libraries using a VSV- pseudotyped lentiviral vector, by a novel high-throughput method designed and performed by Anna Khodyakova and Mikhail Chernov in the laboratory of Andrei

Gudkov, Dept. of Molecular Genetics, Lerner Research Institute, Cleveland Clinic

Foundation. Three additional compounds or leads were optimized from the one of these hits. Therefore, aims of this study were to characterize the antiviral activity and mechanism of action of CBL 4.0, CBL 4.1, CBL 17, CBL 21 and CBL26. These five compounds were selected due to their potent antiviral activity.

48 49

The activity of hits was examined against wild-type and ARV resistant HIV strains. Their cellular toxicity was determined in stimulated primary cells and T-lymphoid cells lines by direct trypan blue exclusion and indirect MTT assay. Several in vitro biochemical assays were performed to assess the effect of hits on major HIV-1 life cycle events, such as reverse transcription, integration into host cell chromosome, and virion assembly and maturation. Serial passages of increasing concentrations of these compounds were also performed to identify their specific viral targets. CBL 26 was determined to be very unique; therefore, site-directed mutagenesis was used to evaluate the effect of this compound against other HIV-1 targets.

This chapter describes the protocols and results of the extensive characterization of these 5 compounds and also explores the potential of these compounds as viable drug candidates that could be developed and marketed for the treatment and management of

HIV/AIDS.

MATERIALS AND METHODS

Plasmid and lentiviral vector used for small molecule library screening

A three-plasmid expression system was used to generate a GFP-tagged lentivirus

that expresses the GFP reporter gene under control of a CMV promoter140. The packaging

construct contains a viral genome that lacks the envelope (env) and accessory (Vpu)

genes. Expression of the GFP reporter gene and the packaging construct of the lentivirus

are driven by the CMV promoter. Viral particles were also pseudotyped with G protein of

vesicular stomatitis virus to expand the choice of target cells 140.

Compounds

A small molecule library of 74,000 polycyclic “drug-like” compounds obtained from Chembridge Corporation (San Diego, CA). CBL 4.0, CBL 4.1, CBL 4.3, CBL 17,

CBL 21 and CBL 26 were synthesized and purchased from Chembridge Corporation (San

Diego, CA).. Nucleoside/nucleotide and non-nucleoside RT inhibitors (zidovudine,

lamivudine, tenofovir, nevirapine, delavirdine), Entry inhibitors (enfuvirtide, TAK 779

and AMD 3100), Protease inhibitors (Saquinavir and nelfinavir) were obtained from NIH

AIDS reagents program. L-870,810, an integrase inhibitor was obtained from Merck

research laboratories. Nevirapine used for RT inhibition assay was obtained from

Boehringer Ingelheim. All compounds were dissolved in 100% DMSO, filtered and

stored in 10-100mM stock solution. 51

High throughput screening

Figure 2.1: The small molecule library screening protocol. 80 compounds were screened per 96-well flat-bottom plate. HeLa cells preteated with 5mg/ml of each compound were infected with a GFP-tagged VSV-pseudotyped lentivirus, GFP expression and methylene blue assay assessed antiviral activity and cellular toxicity respectively after 48 hours. Thirty-four compounds, demonstrated similar cellular toxicity and antiviral activity to AZT, were selected for further characterization.

The high-throughput screening illustrated above was performed by our

collaborators in the laboratory of Andrei Gudkov at the Cleveland Clinic. This method

utilized the expression of green fluorescent protein (GFP) inserted into a recombinant 52

VSV-pseudotyped GFP-tagged to screen 74,000 structurally diverse, organic polycyclic

small molecules66. HeLa cells were seeded in 96-well flat-bottom plates for 20 hours at

37°C with 5%CO2. In parallel experiments, HeLa cells were infected with a lentiviral

vector for 2 hours, treated with AZT and library compounds at a concentration of 5mg/ml

of each compound. Eighty compounds were applied to each 96-well plates using prong replicators. Each plate was evaluated for infection efficiency by measuring GFP

fluorescence and cytotoxicity by methylene blue assay after 48 hours (Fig 2.1).

Cells

Human T-lymphoblastoid cell lines MT4, MT2 and C8166 were used because of

fast duplication times, high susceptibility to HIV infection and strong cytopathic effects,

especially in MT-2 and C8166 cells. Peripheral blood mononuclear cells (PBMC) used

for both cytotoxocity and antiviral assays were isolated from HIV-seronegative donors

using Ficoll-Hypaque and gradient centrifugation of heparin-treated venous blood.

PBMC were mitogen- stimulated with 2µg/ml of phytohemagglutinin (PHA; Gibco

BRL), in the presence of 1ng/ml interleukin-2 (IL-2, Gibco, BRL) for 72 hours at 37°C

prior to antiviral and cytotoxicity assays. All cells were maintained in RPMI 1640/2 mM

L-glutamine medium (Cellgro; Mediatech, Herndon, VA) supplemented with 10% fetal

bovine serum (Cellgro), 10mM HEPES buffer (N-2-hydroxyethylpiperazine-N-2-

ethanesulfonic acid; Sigma), 100U of penicillin/mL and 100μg of streptomycin/mL

(Gibco). U87.CD4.CCR5 and U87.CD4.CXCR4 cells were maintained in DMEM 53

medium, 15% FBS, 100U of penicillin/mL and 100μg of streptomycin/mL, puromycin

and geneticin.

Plasmids and viruses

All plasmids and viruses were obtained through the NIH AIDS research &

reference reagent program. HIV-1B-HXB2, HIV-1B-92US026, HIV-1N119 and HIV-1NL-4.3DsRed2

were amplified in MT4. HIV-1C5 and HIV-1Y-U2EGFP were amplified in U87.CD4.CCR5.

HIV-2CBL-20 was cultured in C8166. Primary HIV-1 isolates, obtained from the WHO

were amplified in U87.CD4.CCR5 (R5 viruses) or MT4 (X4 viruses).

A panel of 12 infectious multidrug resistant HIV-1 reverse transcriptase (RT)

recombinant clones was obtained in 1ml glycerol stock was amplified and purified57.

Viruses were generated by transfecting 5μg of each multidrug RT resistant plasmid into fresh, regularly split five million C8166 cells suspended in 0.4ml of electroporation medium (RPMI 1640 without phenol red and glutamine) for 25 milliseconds at 1000μF and 250V in 0.4 cm diameter cuvettes in a Biorad Gene Pulser Xcell. Post transfection, cells were added to 9.5ml of complete RPMI and incubated at 37°C in 5%CO2. Viral production was monitored every 3 to 4 days for RT activity and cytopathic effects. HIV replication was assessed by reverse transcriptase assay on viral culture supernatant every

3 days. Culture supernatant was harvested, filtered using a 0.45μm Steriflip PVDF membrane (Millipore), aliquoted and frozen at -80°C before determining the 50% tissue culture infective dose (TCID50).

Antiviral activity

Incubation of MT4 cells or PBMC with Infection with HIV-1: Incubation @ 37oC, increasing + B-HXB2 (MT4) 5% CO for 6 days concentrations of the B-92US026 (PBMC) 2 (monitoring daily for different compounds (2 hr) Wash (o/n) 3 x

50% inhibitory concentration (IC50) was determined measuring RT-activity in the cell-free supernatant and/or p24 capsid EIA

Figure 2.2: Antiviral Assays. Compound pre-treated cells were infected with various HIV strains at a multiplicity of infection of 0.01. Three washes with 1x PBS required to was out unadsorbed virions. Antiviral activity was determined after 6 days of incubation by reverse transcriptase assay. IC50 is the concentration that inhibits 50% of HIV reverse transcriptase actvity, relative to the no drug, virus only controls. 5% CO2: carbondioxide; CPE: cytopathic effects; EIA: enzyme immunoassay; IC50: 50% inhibitory concentration and RT: reverse transcriptase.

Initial antiviral activity of compounds “hits” selected from the high-throughput

assay was determined in MT4 cells and PBMC. IL-2 and PHA stimulated PBMC (1x105 per well) and MT4 cells (9x104 per well) in 96-well plates were incubated with serial

dilutions of compounds for 16 hours (Fig.3). HIV-1 was added at a multiplicity of

infection of (MOI) 0.01IU/cell and 0.02IU/cell (1μl and 25μl of B-HXB2 and B-

92US026 respectively) to cells and compounds in a 96-well plate. Following a 2 hours 55

incubation at 37°C in 5% CO2, infected cells were washed three times with 1x phosphate-

buffered saline (PBS) and incubated in fresh medium containing the same concentration

of compounds. On day 5, new virus production was quantified from cell-free supernatant

by reverse transcriptase activity and HIV p24 enzyme linked immunosorbent assay. 50% inhibitory concentration (IC50) is the concentration of drug that inhibits 50% of viral

infection as measured by reverse transcriptase activity or HIV-1 p24 (Fig 2.2). IC50 was calculated for each compound using SigmaPlot software (SPSS Inc.).

Reverse transcriptase (RT) assay

Reverse transcriptase assay is an indirect quantification of virus replication that uses endogenous viral reverse transcriptase to extend an exogenous DNA primer on an

RNA template. RT assay was performed by incubating 10µl of cell-free viral culture supernatant with 25μl of reverse transcriptase mix containing 1M Tris–HCL pH 7.8, 2M

U/ml ug/mol KCl, 1M DTT, 200mMgCl, 1 /100 Poly(rA)·P(dT)12-18 (Amersham), Igepal/NP40

32 (Sigma), deionized H2O and 1μl of αP dTTP 10mCi/ml (ICN) for 2 hours at 37°C with

71 5% CO2 . 9μl of the culture-RT mix was spotted onto a DEAE filtermat (PerkinElmer) and allowed to dry for 10 minutes. DEAE filtermat was washed five times with 1x SSC

buffer and two times with 85% ethanol on a platform shaker for 5min during each wash.

DEAE filtermat was dried and exposed to a blue film with an intensifier screen in a -80

freezer and subsequently developed in a series x-ray film developer (TI-BA, series 35).

Quantiscan software (Biosoft, Cambridge, UK) was used to measure HIV reverse 56

transcriptase activity and IC50 values were calculated using the SigmaPlot software

(SPSS Inc.).

Cellular toxicity

Cellular toxicity was determined by the assessment of;

1. Cell viability by Trypan blue exclusion.

2. Cellular proliferation by the indirect 3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyltetrazolium bromide (MTT) colorimetric assay method.

Incubation of MT4

cells or PBMC with o increasing Incubation @ 37 C, concentrations of the 5% CO2 for 6 days different compounds

50% cytotoxic concentration (CC50) was determined by measuring cell viability by typan blue exclusion and cellular proliferation by MTT assay

Figure 2.3: Cellular Toxicity Assays. Compound treated cells were incubated for 6 days at 37°C in 5% CO2. 50% cytotoxic concentration (CC50) was determined by direct trypan blue exclusion and indirect MTT method. CC50 is the concentration toxic to 50% of the cell population, relative to the no drug controls.

Cell viability by trypan blue exclusion method

PBMCs and MT4 cells were plated at a density of 40,000 and 30,000 cells per

well respectively and incubated with serial dilutions of compounds in 96-well flat-bottom

microtiter plates. After 5 days, trypan blue exclusion was determined by applying a 3:1:1

mixture of 1x PBS, Cells and 0.2% trypan blue solution to a hemocytometer counting

chamber (Fig 2.3). The ratio of viable (transparent cells with well-defined ovoid bodies)

to non-viable, opaque cells (stained with trypan blue) were calculated as previously

69 described . 50% cytotoxic concentration (CC50) was calculated using SigmaPlot

software (SPSS Inc.).

Cellular proliferation by MTT colorimetric assay

MTT measures cellular proliferation and assesses stasis in cell division. The effect

of compound cytotoxicity on cellular proliferation was measured by 3-(4,5-

dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) colorimetric method. The formazan reaction transforms the yellow MTT to purple formazan precipitate following the cleavage of the tetrazolium ring by mitochondrial enzymes148. PBMC and MT4

previously incubated with various concentrations of compounds for 5 days were

centrifuged at 20°C using 1500 rpm for 5 minutes. Cells were exposed to 100μl of

4mg/ml of MTT solution for 4 hours. 50μl of DMSO was added to each well and further

incubated for 30 minutes. Purple formazan precipitate is dissolved in DMSO and its

optical density measured at 540nm using a multiscanner spectrophotometric 96-well plate

autoreader (Victor V, PerkinElmer). 50% cytotoxic concentration (CC50), defined as the 58

concentration that inhibited cellular proliferation by 50% made relative to the no drug,

cell only controls, was calculated using SigmaPlot software (SPSS Inc.).

Direct effect of compounds on HIV-1 virions

This is an in vitro assay used to determine the direct effect of compounds on HIV-

1 virions in the absence of a cellular interface28. In 96-well plates, 5μl of 10μM of each

compound was incubated with 5μl of HIV-1HXB2 (MOI of 0.05) for 2 hours in 96-well

round-bottom plates. 5μl of HIV-1HXB2 and PBS were used as the positive and negative

controls respectively. 25μl of reverse transcriptase mix was incubated with the virus- compound mix for an additional 2 hours. HIV reverse transcriptase activity was determined as previously described.

Pre vs. post-integration of HIV-1 inhibition

An EGFP-tagged virus was used to divide HIV-1 lifecycle into two broad lifecycle phases; pre- and post- integration steps as previously reported40. Briefly, 1.8

x105 MT4 cells were pre-treated with various concentrations of compounds 16 hours

prior to infection. HIV-1NL-4.3EGFP, a replication competent virus expressing EGFP protein

202 inserted into a backbone of HIV-1NL-4.3 was used to infect cells . MT4 cells were

infected with 36μl of HIV-1NL-4.3EGFP at a multiplicity of infection of 0.02IU/cell. Cells

were washed three times with 1x PBS and further incubated with compounds for 72

hours. EGFP expression was determined by fluorescent microscopy using a Leica

DMIRB inverted upright wide-field fluorescence microscope (Heidelberg, Germany). 59

Effect of hits on HIV-1 coreceptors, CCR5 and CXCR4

Figure 2.4: Inhibition of HIV-1 Coreceptors Assay. Co-cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 cells were pre-treated with 1µM and 10µM of compounds for 2 hours. Cells were infected with green and red fluorescent viruses at a multiplicity of infection (MOI) of 0.01. After 5 days, inhibition of viral replication was monitored by fluorescent microscopy.

2,500 U87.CD4.CCR5 and 2,500 U87.CD4.CXCR4 cells were seeded overnight

in 96-well plates. Cells were incubated for 2 hours in the presence and absence of various concentrations of compounds at 37°C in 5%CO2. Cells were infected with an admixture

of DsRed2-tagged CXCR4-using and EGFP-tagged CCR5-using viruses at a multiplicity of infection of 0.01 IU/cell for 5 days (Fig 2.4). Infection was monitored with a Leica

DMIRB inverted upright wide-field fluorescence microscope (Heidelberg, Germany)92.

In vitro HIV-1 reverse transcriptase inhibition assay

The recombinant wild-type HIV-1 RT (strain BH10) was coexpressed with HIV-1

protease in Escherichia coli to get p66/p51 heterodimers, which were later purified by

affinity chromatography as described22,128. DNA polymerase activity assays were carried

out in 50mM Tris-HCl (pH 8.0), 20mM NaCl, 10mM MgCl2, 8 mM dithiothreitol, 1%

3 DMSO, 2µM dTTP (3– 5µCi/ml [ H]dTTP), and 1µM poly(rA)/oligo(dT)20

(concentration expressed as 3´-hydroxyl primer termini), as previously described158.

Inhibitors (diluted in DMSO) were included in the reaction mixture at concentrations in the range of 0 to 200 µM, depending on the assay. 30µl of reactions were initiated by adding 8 – 40pmol of enzyme, incubated at 37 ºC for 2 – 20 minutes, and terminated by adding 20 µl of 0.5 M EDTA. The amount of polymerized deoxynucleotide was determined by acid insoluble precipitation. The IC50 values were obtained by plotting the

initial velocities against the inhibitor concentration and fitting the data to a hyperbola

using the SigmaPlot software (SPSS Inc.).

In vitro HIV-1 integrase inhibition assays

The inhibitory activity of compounds on HIV-1 integrase was analyzed by;

1. Bioveris high-throughput assay to determine compound effect on HIV-1 strand

transfer reaction

2. Electrophoresis to assess 3 ′-end processing and strand transfer reactions.

1. HIV-1 integrase high-throughput assay

Figure 2.5: In vitro HIV-1 Integrase high-throughput assay. Purified HIV-1 integrase was bound to the immobilized double-stranded donor DNA. Biotin labeled target DNA was applied to the integrase-donor DNA complex. Inhibition of HIV-1 integration was measured by chemiluminescence. Adapted from Pommier et al, Integrase inhibitors to treat HIV/AIDS152

HIV-1 integration strand transfer reaction was assessed by a high throughput

method, using a purified 21-oligodeoxynucleotide (5′-GTGTGGAAAATCTCTAGCA-

3′) primer derived from HIV-1 U5 long terminal repeat (LTR) and the Bioveris® protocol152. Dynabeads (M-280 Streptavidin magnetic beads) were reconstituted and

bound to oligodeoxynucleotide (donor DNA) on a micro-titre 96-well plate. Briefly,

donor DNA-bead complex was generated by complexing 10μM of donor DNA with

Dynabeads in 40μl of H2O and vortexed at 1,300 rpm (Eppendorf Thermomixer).

Mixture was placed on a magnetic separator for 2 minutes, supernatant was removed and 62

beads were resuspended in 1ml of integrase (IN) assay buffer; 5% PEG 8000, 25mM

MOPS pH7.2, DEPC-treated H2O, 23 mM NaCl, 10mM MgCl2, 10% DMSO and again

vortexed at full speed before being placed on the magnetic separator for 2 minutes.

Supernatant was removed and beads were resuspended in 500μl of IN assay buffer,

vortexed at full speed and stored at 4°C. Purified integrase was added to the donor DNA-

bead complex. 100μl of Donor DNA-Bead complex was added to 20μl of wild-type IN

diluted in 80μl IN dilution buffer combined with 100µl of 0.1M of fresh DTT in 900ml of

IN assay buffer. This reaction was incubated for 30m at 37°C and could be stored at 4°C

for 24 hours. 1.2ml of the Enzyme-Donor DNA-Beads mixture was added to 7.8ml of IN

assay buffer. 10μl of increasing concentrations of compounds was added to each well in

96-well flat-bottom plates, with 10μl DMSO as control. 80μl of diluted Enzyme-Donor

DNA-Beads and 10μl of 2μM target DNA was to each well. Reaction was incubated for

60 minutes at 37°C and stopped with 100μl of integrase stop buffer. Integrase Stop

buffer; 50mM EDTA (50ml of 0.5M), 150 mM/1M K2HPO4/KH2PO4 pH 7.8, 150mM

NaCl made up to 500ml with H2O and filtered. Reaction luminescence was measured

with the Bioveris machine152.

2. Electrophoretic assessment of HIV-1 integrase reactions

Inhibition of wild type HIV-1 integrase by compounds was assessed in both Mg2+ and Mn2+ by gel electrophoresis using a 20mM of a 21-oligodeoxynucleotide, as both

donor and target DNA radiolabeled with γATP-32P and T4 polynucleotide kinase at its 5′- 63

terminus152. Briefly, 1μl of 10μM PAGE purified deoxyoligonucleotides was incubated

32 with 1μl T4K, 5μl of 10x T4K buffer, 5μl of γATP-P , and 38μl of H2O for 3 hours.

50μl of reaction products was loaded onto a G-25 Oligospin column. Annealing reaction

of 1μl of 10μM complementary strand B was annealed to strand A at 95°C for 4 minutes.

Reaction products were gradually cooled to room temperature within 10 minutes. 1μl of

Radiolabeled DNA was complexed and incubated in the presence and absence of

compounds for 1 hour in 9μl of 25mM MOPS (pH 7.2) containing either 7.5mM MgCl or

7.5mM MnCl, 14.3mM β-mercaptoethanol and 400mM of purified WT HIV-1 integrase

at 37°C. The reaction was stopped with 10μl of EDTA-formamide stop solution and

resolved on 20% polyacrylamide gel. Inhibition of strand transfer reaction was quantified

a phosphorimaging scanner152.

In vitro HIV-1 protease inhibition assays

2 x 105 293T cells were maintained at 50% confluence in 2ml of Dulbecco’s minimal Eagle’s medium (DMEM)/2mM glutamine supplemented with 10% heat- inactivated fetal calf serum, 100U/ml penicillin, 100μg/ml streptomycin. 1μg of HIV-1

pNL4.3 and 0.15 μg of pCMV-βlacZ reporter were transfected into 293T cells using

3.5μl of FuGene transfection reagent (Roche). Both plasmids were incubated in 96.5ml of

serum-free DMEM and FuGene for 15 minutes at room temperature. Culture supernatants

removed and replaced with medium containing test drug. Plasmid-FuGene-DMEM

mixture was added to the culture drop-wise and further incubated for 48 hours and culture 64

supernatant was harvested for a Western blot analysis104. Compound activity on viral

protein processing was assessed by Western blot analysis of lysed total cellular proteins

with an affinity-purified monoclonal mouse HIV-1 p24 and a secondary purified anti-

mouse antibody. Expression of HIV-1 p24 was correlated to the inhibition of the

proteolytic cleavage of HIV-1 Gag polyprotein by each compound.

Time-of-addition assay

2 x 105 U87.CD4.CCR5 cells were seeded into 96-well flat-bottom microtitre plates overnight. The cells were infected with 60μl of HIV-1 NL4-3YU-2-fluc2 (a firefly luciferase expressing R5 virus) at a multiplicity (MOI) of 0.2 and incubated for 2 hours at

37°C with 5% CO2 in the presence and absences of compounds. Cells were washed three

times in 1x PBS to remove nonadsorbed viral innoculum. 100x IC50 of CBL 4.0, CBL

4.1, CBL 4.3, CBL 17, CBL 21 and CBL 26 which corresponds to 2.5, 1.7, 2.6, 2.4, 8.4

and 2.9μM respectively, were added at time points; 0, 2, 4, 8, 12 and 24 hours post-

infection into parallel wells using; enfuvirtide (T20), zidovudine, tenofovir, nevirapine,

L-870,810 and nelfinavir as controls. Virus production was measured after 48 hours

postinfection by RT assay of culture supernatant and luciferase assay (Promega) of lysed

culture cells28,49. Briefly, culture supernatant was removed from wells and cells were

washed with 1x PBS. 20μl of 1x lysis buffer (Promega) was added to each well, plates

were shaken at a very low speed for 15 minutes on a platform shaker. 100μl of

reconstituted luciferase reagent was added to each well. Plates were covered with

aluminum foil, shaken for an additional 5 seconds and read in multiplate scanner Victor 65

V (PerkinElmer). A second reading of each plate was performed 5 minutes after the

initial reading.

In vitro selection for drug resistant variants

In vitro passage in the presence of different concentrations of In vitro selection of drug-resistant viruses drug monitored by RT assay and CPE (HIV-1 B-HXB2 in Harvest, store cells C8166 cells) and supernatant separately from

Sequencing of the pol Estimation of HIV-1 replicative gene for all compounds fitness using growth competition Drug and env and accessory experiments susceptibility genes for CBL 26 analyses (IC50)

Figure 2.6: In vitro selection for resistant strains. Increasing concentrations compounds were passaged in HIV-1B-HXB2 infected C8166 cells to select for drug-resistant strains every 4 – 6 days. Culture viability was monitored by observing viral cytopathic effects and reverse transcriptase activity. Biological properties such as drug susceptibility, gene sequence analyses and viral growth experiments, of resistant viruses were determined to identify specific drug targets. Accessory genes in addition to HIV-1 pol were sequenced from CBL 26 resistant virus.

5 2.5x10 C8166 cells (T-lymphocytic cell line) were infected with HIV-1HXB2

(MOI of 0.01) in 48-well plates. Compounds were added to infected cells starting at a sub-inhibitory concentration of drug equal to 1/128th of IC50. Cultures were maintained 66

and scored microscopically on HIV-1 induced cytopathic effects (CPE) by syncytia

formation and reverse transcriptase (RT) activity every 4 to 6 days (Fig 2.6). When both

RT and CPE were observed, cell-free culture supernatant was used to infect fresh C8166

cells in the presence of equal or higher concentration of the compound. In the absence of

both CPE and RT activity, the infected culture is maintained at the same or lower

compound concentration. Drug susceptibility assays using viruses generated from serial

passages and wild-type parental virus were performed to compare their IC50 values.

Specific HIV-1 gene regions, particularly RT, were PCR amplified and sequenced

to identify nucleotide and/or amino acid changes associated with drug resistance

mutations (Fig 2.6). The RT gene of the resistant viruses generated was amplified with 5

Prot FM (5’- CAAGGGAAGGCCAGGGAATTT-3’; 2112-2132) and 3′ half RT (5’-

TATTTCTGCTATTAAGTCTTTTGATGGGTCA-3’; 3506-3536) for the external PCR with the following thermocycyling conditions: 95°C – 2 minutes; 95°C – 30 seconds,

55°C – 30 seconds and 72°C – 2 minutes for 35 cycles and 72°C – 10 minutes. 1μl of

purified total cellular DNA isolated from each resistant virus was amplified in 25μl of

PCR mix. 5μl of product obtained from the external PCR was amplified with 5′

SP66OUT (5’-GACCTACACCTGTCAACATAAT-3’; 2485-2506) and 3′ half POL (5’-

TCTGCCAGTTCTAGCTCTGCTT- 3’; 3442-3463) with the same thermocycling

conditions used in the external reaction. Nested PCR products were purified and

sequenced. 67

In addition to the sequencing the RT region, additional genes were sequenced from CBL 26 resistant virus (Fig 2.6). RT, RNase H, Integrase, Vpu, Nef and Tat were amplified from 1μl of purified viral DNA with the following primer pairs.

- 5′SP66 (AGATATCAGTACAATGTGCT; 2976-2995) and

P2-AS (TAGCAAAAGAAATAGTAGCCAG; 4324-4345).

- HP4149 (CATGGGTACCAGCACACAAAGG; 4150–4171) and

PCRC (CCCAAATGCCAGTCTCTTTCTCCTG; 5261-5285)

- EnvA (GGCTTAGGCATCTCCTATGGCAGGAAGAA; 5954-5982) and E125

(CAATTTCTGGGTCCCCTCCTGAGG; 7315-7338)

- HIV8749(ACATACCTAGAAGAATAAGACAGG; 8749-8772) and

HIV9544 (5’-GTCCCCAGCGGAAAGTCCCTTGTA-3’; 9444-9429)

- EnvM (5’- TAGCCCTTCCAGTCCCCCCTTTTCTTTTA-3’; 9068-9096) and gp41F (5’-TCTTAGGAGCAGCAGGAAGCACTATGGG-3’; 7789-7816)

- Vpr1F(5’-GAGACTGGCATTTGGGTCA-3’;5270-5288) and

Vpr1R TTTGTAAAGGTTGCATTACAT; 6077-6057

For all reactions except for Vpr 1F and Vpr 1R, PCR thermocycling reactions were 95°C - 2min; 95°C – 30 seconds, 55°C – 30 seconds and 72°C – 2 minutes for 35 cycles; 72°C – 10 minutes. For Vpr 1F and Vpr 1R, thermocycling conditions were 95°C

– 2 minutes; 95°C -1 minute, 55°C -1 minute and 72°C – 1.5 minutes for 35 cycles; 72°C

– 10 minutes.

Viral replication kinetics

The replicative fitness of drug-resistant variants was determined by comparing

mono infections in the absence of compounds to the replicative pattern of wild type virus

(Fig 2.6). Briefly, 10,000 MT4 cell were infected with drug resistant viruses using wild-

type virus HIV-1B-HXB2 at a multiplicity of infection (MOI) of 0.001 IU/cell for 2 hours at

37°C, 5% CO2. Cells were subsequently washed with 1x PBS three times to remove nonadsorbed viral innoculum and were resuspended in culture medium. 10μl of clarified culture supernatant was harvested daily for 10 days and stored at -80°C for further analysis. Viral replication pattern was assessed by reverse transcriptase assay and quantified as previously described.

Site directed mutagenesis to create p83-10VPUA63S

Site directed mutagenesis (SDM) was used to study the significance of point mutation observed in the Vpu of CBL 26r following serial passages. PfuUltra high fidelity DNA polymerase [QuikChange ® II XL site directed mutagenesis kit

(Stratagene)] was used to create and amplify a point mutation in HIV-1 p83-10 plasmid

(NIH AIDS Reagents, catalog number 2480), a 6253 bp double stranded vector template, using two primers derived from HIV-1 pNL4.3 with the mutant base inserted. Vpu-SDM-

F (5′-GAGTGAAGGAGAAGTATCATCACTTGTGGAGATGGGGGT-3′) and Vpu-

SDM-R (5′-ACCCCCATCTCCACAAGGATGGATACTTCTCCTTCACTC-3′) as forward and reverse primers respectively. Vpu-SDM primers were used to amplify 5ng, 69

10ng, 20ng and 50ng of p83-10 with the following thermocycling conditions, 95°C – 1

minute for one cycle, 18 cycles of 95°C – 50 seconds, 60°C – 50 seconds and 68°C – 6.3

minutes and one cycle of 68°C for 7 minutes. PCR products were treated with Dpn I to

digest the p83-10 parental template. XL10-gold ultracompetent E.Coli was transformed

with the Dpn I treated DNA and cultured on ampicillin-LB agar. Two colonies from each

were cultured at 37°C, in 3ml of LB-ampicillin medium overnight and shaken at 225

rpm. Minipreps were prepared from culture using Quaigen miniprep kit. Miniprep

product was verified by Hind III enzymatic digestion. Briefly, for each reaction, 2μl of

miniprep DNA product was added to 0.5μl of Hind III, 2μl of NE buffer # 2, 15.5μl of

H2O and incubated for 2 hours at 37°C. Digestion product was resolved on 1% agarose by gel electrophoresis.

The DNA sequence of miniprep DNA product was amplified using Env A (5’-

GGCTTAGGCATCTCCTATGGCAGGAAGAA-3’; 5954-5982). After verifying the

sequence, one-shot E.coli was transformed with mutant plasmid, amplified in 100ml of

ampicillin fortified Luria Broth and shaken at 225 rpm in an overnight incubation at

37°C. Plasmid DNA was purified using a midiprep kit (Qiagen) and its sequence verified

again using the Env A primer.

Linearization of plasmids (p83-2 and p83-10VPUA63S)

Plasmids p83-2 (NIH AIDS reagents catalog number 2379) and p83-10VPUA63S were linearized at the shared EcoRI site in each plasmid. 10μg of each plasmid was resuspended in 6μl of EcoRI, 20μl, made up to 200μl with deionized H2O and incubated 70

for 2 hours at 37°C (maximum digest time 4 hours). 1% agarose gel was used to confirm

linearization using 20μl of digested product and compared with was applied to each 1ul

of uncut DNA. Two bands were observed from EcoRI digested DNA compared to the

single band from the uncut DNA. 200μl of each linearized plasmid was combined to give

a total volume of 400μl. Plasmids were precipitated in 900μl of Ethanol, 44μl of 3M

sodium acetate, deionized H2O made up to 2000μl and immediately frozen at -80°C for

30 minutes. Precipitate was spun for 10 minutes at 14,000rpm, washed with 1ml of 70%

Ethanol and resuspended in 20μl of sterile H2O.

Transfection of p83-2-10VPUA63S

1 x 107 fresh and regularly split MT4 cells were spun down at 1500rpm, 20°C,

washed with 1x PBS and resuspended in 400μl of transfection medium (RPMI without

phenol red). Resuspended cells were applied to a 0.4cm2 cuvette on ice. 20μl of mixed

linearized plasmid DNA was added into cell suspension and impulsed at 0Ω, 1000uF and

250V. Cells were resuspended in 5ml complete RPMI with 3x105 fresh MT4.

Amplification of 83-2-10VPUA63S and antiviral assay

Viral culture was maintained for 7 days and monitored with reverse transcriptase

assay every 3 days. Virus was harvested on day 7 and filtered with 0.4μm PVDF Steriflip

vacuum filter. Virus was stored as 1ml aliquots at -80°C. Viral sequence verified using

after PCR amplification using the Env A and E125 primer pair (as previously described).

The tissue culture infective dose of the virus was determined in MT4. Antiviral assay to 71

determine the IC50 of CBL 26 was performed in MT4 cells infected with HIV-183-2-

10VPUA63S, parental p83-2-10 virus, HXB2 virus and CBL 26R virus generated from in vitro selection for resistant strains.

RESULTS

2.1 Result of small molecule library screening

Thirty-four compounds were identified out of a total of 74,000 polycyclic “drug-

like” small molecules analyzed with the VSV-pseudotyped GFP-expressing lentiviral

vector in Dr. Gudkov’s laboratory at the Lerner Research Institute, Cleveland Clinic

Foundation. These 34 compounds were handed to our laboratory for the evaluation of

their cytotoxicity and antiviral activity. Of these, we identified CBL 4.0, CBL 17, CBL

21 and CBL 26 as potent antiretroviral compounds from these assays.

2.2 Hit optimization of CBL 4.0 to lead compound

Due to the especially potent antiretroviral activity of CBL 4.0, its structure was

further optimized to identify structural derivatives, CBL 4.1, CBL 4.2 and CBL 4.3. CBL

4.1, CBL 4.2 and CBL 4.3 were non-cytotoxic to MT4 cells as determined by their effect

on cellular viability and proliferation. Their CC50 values were higher than 50μM, the maximum concentration analyzed in both assays. However, the IC50 of CBL 4.2 was

above 50μM when analyzed against either the laboratory adapted HIV-1B-HXB2 in MT4 or primary isolate HIV-1B-92US026 in PBMC. Therefore, CBL 4.1 and CBL 4.3 were selected

in addition to CBL 4.0 for further characterization. Thus, CBL 4.0 was successfully

transformed from a hit into a lead compound for the synthesis and discovery of more

potent anti-HIV-1 compounds. 73

2.3 CHARACTERIZATION OF HITS

2.3.1 Viral susceptibility of hits

The antiviral activity of these 6 compounds was assessed against primary and

laboratory adapted HIV-1 isolates. Their IC50 values obtained ranged from 0.15 - to-

1.9μM in both PBMC and MT4 (Fig. 2.8). CBL 4.3 had the highest IC50 (1.9μM) in MT4,

while CBL 17 had the highest IC50 (1.9μM) in PBMC.

2.3.2 Hits were neither cytotoxic nor cytostatic

Cytotoxicity, the noxious effect of compound on both primary and transformed

cells was assessed ex vivo, using trypan blue exclusion and MTT assay. In these cellular

toxicity assays, all six compounds were relatively non-cytotoxic following incubation in

PBMC and MT4 cells in the presence of increasing compound concentration, for 6 days

(Fig 2.7a). CC50 of all compounds, except CBL 26 (CC50; 30μM) was higher than 50μM by cell viability in MT4. In stimulated primary mononuclear cells, all compounds were non-cytotoxic, CC50 was ≥ 50μM and percentage relative cell viability clustered around

75%-100% of the no drug controls (Fig 2.7b). Cellular toxicity determined by MTT showed that CBL 4.3 and 26 were relatively cytotoxic to MT4, while CBL 4.1, CBL 4.3,

CBL 17 and CBL 26 were toxic to PBMC. Hits were also relatively non-cytotoxic to

U87.CD4.CCR5 (Results not shown).

CC50

Figure 2.7: Cellular toxicity of hits determined by trypan blue exclusion assay in MT4 and PBMC as described in the materials and methods section. Ratio of viable to non- viable cells for each concentration was determined and made relative to the no drug control. For all compounds analyzed, CC50 was ≥ 30μM. CC50, is the concentration toxic to 50% of the no drug, cell only control. Results represent mean ± SD from 3 independent experiments, each of triplicate determinations.

IC50

Figure 2.8: Susceptibility of B-subtype, HIV-1 isolates to CBL compounds. Compound pre-treated MT4 and PBMC were infected with B-HXB2 and B-92US026 at a multiplicity of infection (MOI) 0.01 for 5 days respectively. IC50 values of all compounds against both viruses less than 2µM. IC50 is the concentration that inhibited 50% of reverse transcriptase activity calculated relative to the no drug, virus infected cells. Results presented are mean ± SD of triplicate determinations for 3 independent experiments.

2.3.3 Selectivity indices (SI)

Figure 2.9: Selectivity indices of hits, ratio of CC50:IC50, calculated from CC50 obtained from trypan blue exclusion and IC50 values obtained from MT4 and PBMC infected with B-HXB2 and B-92US026 respectively. Selectivity indices of hits ranged from 26- to 333- fold, which was comparable to the calculated SI of known antiretroviral compounds.

The selectivity index of a compound, is a calculated ratio (CC50/IC50) obtained from

cellular toxicity and antiviral assays, used to quantify the preferential inhibition of viral

progeny production54. The calculated SI of a compound from in vitro experiments is

useful in predicting the potential clinical usefulness of new compounds. The SI of these 77

compounds ranged from 26- to 333-fold, these values were comparable to the selectivity indices marketed antiretroviral compounds (Fig 2.9). This is very remarkable as these compounds are still unoptimized hits.

2.3.4 Pre- versus post- viral integration inhibition

Negative Positive Nevirapine L-870,810 Nelfinavir

CBL 4.0 CBL 4.1 CBL 4.3 CBL 17 CBL 21 CBL 26

Figure 2.10: Replication competent HIV-1EGFP used to divide viral lifecycle into pre- and post-integration stages. 10µM (100x of IC50) of CBL compounds significantly inhibited viral replication comparably to the same concentration of pre-integration inhibitors such as nevirapine, a non-nucleoside RT inhibitor and L-870,810, an integrase inhibitor. Nelfinavir, a protease inhibitor permitted at least a round of replication before inhibition. CBL 4.1 formed fluorescent crystals at concentrations ≥ 1µM (result not shown).

In this assay, an EGFP-tagged virus was used to divide HIV-1 lifecycle into two,

pre- and post- transcription steps as previously reported40. Inhibition of EGFP expression

signifies a viral target pre-viral DNA integration into host chromosome rather than post-

integration. All six compounds significantly inhibited multiple rounds of HIV-1

replication with reduced EGFP expression at concentrations between 0.1μM – 1μM (data

not shown). However, CBL 4.1 was especially potent as it significantly inhibited

antiretroviral activity at 0.1μM (Fig 2.10). Based on this result, it could be postulated that these compounds are likely pre-integration HIV inhibit 79

2.3.5 Direct effect of hits on HIV-1B-HXB2 virions

Figure 2.11: Direct inhibition of compounds on HIV-1B-HXB2 in a cell-free experiment showed significant dose-dependent inhibition of HIV-1 reverse transcriptase by CBL 4.0 and CBL 4.1. 10µM of CBL 4.0 and CBL 4.1 inhibited more than 50µM of zidovudine (AZT) and nevirapine (NVP). Results presented are mean ± SD of triplicate determinations.

This is the assessment of the direct effect of these six compounds on the reverse transcriptase of replication competent HIV-1 virions in the absence of a cellular interface using a modified RT assay previously described79. This in vitro, endogenous reverse transcriptase reaction was used to rapidly and specifically identify inhibitors of HIV-1 reverse transcriptase. Serial dilutions of these six compounds inhibited 25% to 95% of endogenous HIV-1 (Fig 2.11). The most significant RT inhibitors identified were CBL

4.0, CBL 4.1, CBL 17 and CBL 21. These three compounds inhibited HIV-1 RT activity 80

in a dose-dependent manner as seen in the reverse transcriptase activity of virions treated

with zidovudine (AZT) and nevirapine (NVP). Unlike ex vivo antiviral assays had

previously shown, CBL 26 did not directly impact HIV-1 virions in this assay (Fig 2.11).

As expected, inhibition by nelfinavir a protease inhibitor was unremarkable.

2.3.6 Time-of-addition assay

HIV-1 replication was significantly inhibited when CBL 4.0, CBL 4.1, CBL 17,

CBL 21 and CBL 26 were added to viral cultures 4 hours post infection (Fig 2.12). Delay

of addition of these compounds beyond this point resulted in a 3- to 4-fold increase in

HIV-1 replication. This profile was most similar to that of nevirapine (NVP), a non-

nucleoside RT inhibitior. Although nucleoside/nucleotide inhibitors of RT [zidovudine

(AZT) or tenofovir (TDF)] inhibited viral replication 4 hours post-infection, the level of

inhibition was lower than observed with nevirapine. Enfuvirtide (T20), an entry inhibitor

inhibited replication when added at the time of infection, while L-870,810 an integrase

inhibitor inhibited HIV-1 replication significantly when added 12 hours post infection. As

expected nelfinavir, a protease inhibitor did not significantly inhibit HIV-1 replication in

this assay. The effect of nelfinavir can not be demonstrated in a short cycle replication

assay like the luciferase-based assay used in this study that was terminated after 48 hours

(Fig 2.12). 81

Figure 2.12: Time of addition of compounds determined by luciferase chemiluminenscence in of serially treated wells. Cells were infected with a luciferase expressing virus at a multiplicity of infection of 0.2, treated with 100x IC50 concentrations at specific timepoints and cultures were maintained for 48 hours. CBL compounds inhibited when addition is delayed up to 4 hours post infection. This profile was very similar to the profile of nevirapine, a non-nucleoside reverse transcriptase inhibitor. Results presented are mean ± SD of triplicate determinations. 82

2.3.7 Inhibition of HIV-1 coreceptors, CCR5 and CXCR4

Antagonists of CCR5 and CXCR4 receptors are highly desirable antiretroviral

agents. Therefore, the ability of the CBL 4.0, CBL 4.1, CBL 4.3, CBL 17, CBL 21 and

CBL 26 to inhibit either or both coreceptors was analyzed as one the important lifecycle

targets preceeding reverse transcription. Inhibition of the co-infection two recombinant

fluorescent replicative competent viruses, HIV-1NL4.3DsRed2 (X4-using) and HIV-1YU-2EGFP

(R5-using) by these compounds was assessed by fluorescent microscopy. At 10μM, all 6 compounds inhibited both R5-using and X4-using viruses with no evidence of differential inhibition of either coreceptor (Fig 2.13).

0.1µM 1µM 10µM

CBL

1 2

CBL

BL1 C

4.3

CBL

4.1

CBL

4.0

CBL

Positive Negative

Figure 2.13: Inhibition of HIV-1 coreceptors. Co-cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 were infected with a mixture of HIV-1NL4.3DsRed2 (X4-using) and HIV- 1YU-2EGFP (R5-using) in the presence of increasing compound concentrations for 5 days. No differential inhibition of either virus observed. Fluorescent crystals observed in CBL 4.1 treated wells at 10µM. Pictures were taken at 10x magnification.

2.3.8 In vitro inhibition of HIV-1 reverse transcriptase

Table 1: In vitro Inhibition of purified HIV-1 RT by compounds

HIV reverse transcriptase primer extension assay is a biochemical assay used to

identify inhibitors of purified HIV reverse transcriptase. This test assesses the inhibition

of the incorporation of deoxyribonucleotide triphosphates (dNTP) into nascent DNA

chains by HIV reverse transcriptase. CBL 17 was the most potent inhibitor of purified

HIV-1 reverse transcriptase in this group of hits. The average IC50 of CBL 17 was

0.75μM which was 2.37-fold higher than the IC50 of nevirapine in assay (Table 1). No

inhibition was observed with CBL 4.3, this could be due to reduced compound potency.

2.3.9 Inhibition of HIV-1 integrase

Using the high-throughput method, increasing concentrations of all six compounds were

tested against HIV-1 IN using Pa6, a known integrase inhibitor as the drug control. Only

CBL 4.3 of the entire six compounds in this panel extinguished more than 50% of

chemiluminescent signal ≥ 111μM when compared to the no drug, DMSO control (Fig

2.14). However, by gel electrophoresis resolution, none of these compounds inhibited purified HIV-1 integrase at 333μM in the presence of Mg2+. None of the hits inhibited

either 3′-end processing or the strand transfer reaction when compared to Pa6, an

integrase inhibitor (Fig 2.15). However, the effect of CBL 4.3 on purified integrase was

tested by gel electrophoresis resolution in the presence of Mg2+ and Mn2+. In this assay,

both 3′-end processing and strand transfer reactions were assessed in both divalent ions.

333, 111, 37, 12.3 and 4.1μM of CBL 4.3 were tested in Mg2+ (Fig 2.16) and Mn2+ (Fig

2.17). CBL 4.3 inhibited neither 3′-end processing nor strand transfer reaction of HIV-1 integrase in both divalent ions when compared to BFX-1012, an integrase inhibitor.

CBL 4.0 CBL 4.1 CBL 4.3 on CBL 17 CBL 21 nhibiti i CBL 26 %

Concentration (µM)

Figure 2.14: In vitro inhibition of the strand transfer reaction of HIV-1 integration using a high-throughput method. A streptavidin labeled, 21-mer donor DNA was incubated with purified HIV-1 integrase and a biotinylated, 21-mer target DNA for 1 hour. Inhibition was measured as the extinguished signal of the streptavidin-biotin reaction and made relative to the no drug, DMSO reaction. Only CBL 4.3 inhibited >50% of strand transfer reaction at >111µM.

Figure 2.15: In vitro HIV-1 3′-end processing and strand transfer reactions of integration in the presence of Mg2+ by PAGE. 21-mer donor and target DNA were incubated with purified HIV-1 integrase for 1 hour in the presence of 333μM of each compound, using Int, a known inhibitor as the control. None of the CBL compounds inhibited either reaction in vitro. 87

Figure 2.16: Effect of CBL 4.3 on 3′-end Processing and Strand Transfer HIV-1 Integrase Mg2+.

Figure 2.17: Effect of CBL 4.3 on 3′-end Processing and Strand Transfer HIV-1 Integrase in Mn2+.

Figures 2.16 & 2.17: Increasing concentrations of CBL 4.3 were incubated with donor and target DNA in the presence of purified HIV-1 integrase. In the previous high- throughput assay, CBL 4.3 inhibited the strand transfer reaction at concentrations >111µM. Therefore PAGE was performed to confirm the activity of CBL 4.3 against purified HIV-1 integrase, using BFX 1012 (a known integrase inhibitor) as the control in presence of either Mg2+ or Mn2+. No inhibition observed by CBL 4.3 of either the 3´-end processing or strand transfer reactions.

2.3.10 In vitro HIV-1 protease inhibition assay

Figure 2.18: Western blot analysis of the effect of hits on HIV-1 protease. 1µM and 10µM of CBL compounds were incubated with 293T cells transfected with HIV-1 pNL4.3 for 48 hours. HIV-1 p24 EIA was assessed to evaluate viral protease processivity. None of the CBL compounds inhibited the final cleavage of Gag and Gag- Pol polyproteins into the capsid (p24) protein when compared to 1µM saquinavir (SQ), a known protease inhibitor.

Western blot results from lysed 293T cells showed that none of the six compounds inhibited the proteolytic cleavage activity of HIV-1 protease either at 1μM or

10μM. In the presence of these compounds, Gag polyprotein was fully cleaved into matrix-capsid (p41) and capsid (p24) proteins (Fig 2.18). However, the potent effect of a true protease inhibitor was observed with 1μM of saquinavir (a known protease inhibitor, reviewed under antiretroviral therapy). Saquinavir inhibited the final cleavage of the matrix-capsid (p41) protein to the capsid (p24) protein, which is essential for viral infectivity. 90

2.3.11 Drug susceptibility of primary HIV isolates

As shown in Table 2, the IC50 values of these compounds were compared against

various subtypes and recombinant forms of HIV-1 and -2. HIV-2 was resistant to the

CBL compounds. HIV-2 susceptibility reduced 13.7-fold - 208-fold. This was

comparable to the resistance of 20-fold to AZT, 55.6-fold to 3TC and 1000-fold to NVP.

Based on the results obtained from this panel of antiviral assays, these compounds could

broadly be divided into 2 groups. In this first group, CBL 4.0, CBL 4.1 and CBL 4.3 were

active against all viruses analyzed in this panel. O-MVP5180 was observed to be

hypersusceptible by 250-fold and 17.0-fold to CBL 4.0 and CBL 4.1 respectively.

However, further studies are required to confirm this observation. In the second group,

the most significant observation was seen in the profile of CBL 17, CBL 21 and CBL 26

against HIV-1C-98IN022.Against this virus, the IC50 of CBL 17, CBL 21 and CBL 26 were

4.5-fold, 6.7-fold and 9.6-fold respectively higher than observed against HIV-1B-HXB2.

This was particularly interesting since these 3 compounds were active against other viruses except HIV-1O-MVP5180 which was 20.8-fold resistant to CBL 17.

The activity of these compounds was evaluated against a panel of RT, PR and

fusion inhibitor resistant viruses. The antiviral activity of hits was analyzed against a sub-

panel of 8 recombinant viruses, with an average of 6 NRTI mutations, isolated from individuals heavily treated with nucleoside RT inhibitors. The drug susceptibility pattern of these compounds was determined and compared to their profile against the wild-type

B-HXB2. Resistance was defined as a 4-fold increase in IC50 over the inhibitiory

concentration determined against HIV-1B-HXB2, using AZT, 3TC and NVP as known drug 91

controls. Again, these compounds could be broadly divided into two groups. All reverse transcriptase, protease and entry inhibitor resistant viruses were relatively susceptible to

CBL 4.0, CBL 4.1 and CBL 4.3. In contrast, CBL 17, CBL 21 and CBL 26 were relatively resistant to viruses containing non-nucleoside reverse transcriptase inhibitor

mutations (N119, 2AG, 12AG and 14AG). The high level resistance demonstrated by

CBL 17 could be attributed to the presence of single nucleotide, high level resistance associated with NNRTI mutations such as K103N and Y181C, common to these viruses.

Compared to CBL 17, resistance to CBL 21 was high against 2AG, 12AG and N119.

However, 14AG was remarkably sensitive to CBL 21. The difference in CBL 21 activity could be attributed to the presence of the Y181C mutation in N119, 2AG and 12AG, but

not in 14AG. As expected, 83-2/HXB2 env R-T20r, the recombinant entry inhibitor

resistant virus was susceptible to all compounds (Table 3).

Table 2: Drug susceptibility of primary HIV-1 and HIV-2 isolates to CBL compounds, using zidovudine (AZT), nevirapine (NVP) and lamivudine (3TC) as drug controls. Drug treated cells were infected at multiplicity of infection (MOI) of 0.01 for 6 days. Susceptibility was assessed by reverse transcriptase assay. IC50 was calculated at the concentration of each compound that inhibited 50% of the RT activity of each virus made relative to the no drug, virus only controls. HIV-2 was resistant to all compounds, while C-98IN022 was relatively resistant to CBL 21 and CBL 26. Results are mean ± SD from triplicate determinations.

Table 3: Drug susceptibility of multi-drug resistant HIV-1 isolates to CBL compounds, using zidovudine (AZT), nevirapine (NVP) and lamivudine (3TC) as drug controls. Drug treated cells were infected at multiplicity of infection (MOI) of 0.01 for 6 days. Susceptibility was assessed by reverse transcriptase assay. IC50 was calculated at the concentration of each compound that inhibited 50% of the RT activity of each virus made relative to the no drug, virus only controls. CBL 4.0 and CBL 4.1 were active against all viruses; however, CBL 17, CBL 21 and CBL 26 were inactive against viruses harboring NNRTI associated mutations such as Y181C, G190S, and K103N. Results are mean from triplicate determinations.

2.3.12 In vitro selection for resistant HIV-1 strains

A total of 19 serial passages of CBL 4.0, CBL 4.1 and 4.3 in HIV-1B-HXB2 were performed to generate drug-resistant HIV-1 strains. Again, based on pattern of resistance,

CBL 4.0, CBL 4.1 and CBL 4.3 were toxic to the virus when concentrations were rapidly increased. Cytopathic effects and positive reverse transcriptase assay results were not observed when the concentrations of these compounds were doubled after the 8th passage.

Therefore, subsequent passages were reduced to 0.1-fold increases on the previous concentrations. Passages were recommenced at 0.4μM, 0.05μM and 0.528μM for CBL

4.0, CBL 4.1 and CBL 4.3 respectively (Fig 2.19). The A62V mutation was observed in sequences isolated from CBL 4.0 (CBL 4.0r) and CBL 4.1 (CBL 4.1r) resistant viruses.

In CBL 4.0r, it was the majority virus identified in 3 sequences analyzed from the DNA of infected cells. As shown in Fig 2.19, A62V was also identified from CBL 4.1R, as the majority virus in global sequences obtained from the last passage (passage 19). However, upon regrowing the resistant virus for 7 days to generate more volume for IC50 experiments, this mutation reverted to a minority population. It is also significant to note that although CBL 4.3R was 10-fold resistant to, no mutation was identified from RT sequences of CBL 4.3r viruses. Unlike the CBL 4 series, CBL 17, CBL 21 and CBL 26 rapidly selected resistant strains within 16 passages. At the last passage, their concentrations ranged from 42-fold, 24-fold and 69-fold of their IC50 values respectively

(Fig 2.19). L100I and Y181C mutations were consistently identified from the DNA

sequences of CBL 17r and CBL 21r respectively (Fig 2.19). However, T128N and E138K 95

were identified just once from CBL 26r after the virus was amplified in MT4 cells for 7 days.

Figure 2.19: Selection for resistant HIV-1B-HXB2 strains by passaging increasing concentration of compounds in virus infected C8166 (a T-lymphoid cell line). Passages th commenced at 1/128 of IC50 of all compounds. A total of 19 serial passages were performed, each lasting 4 – 6 days per passage. Concentration of compounds after ranged from 6.6- to 69-fold of IC50. Reverse transcriptase gene was sequenced from RNA and DNA sequences after passages 17 and 19. A62V, a nucleoside reverse transcriptase associated mutation was identified from CBL 4.0r and CBL 4.1r. Non-nucleoside reverse transcritase associated mutations L100I, E138K and Y181C were identified from CBL 17r, CBL 26r and CBL 21r respectively. T128N was a unique mutation identified from CBL 26. However, no mutation was observed in CBL 4.3r sequences.

Biological Properties of Resistant Viruses

Resistant viruses generated from serial passages were assessed to determine the impact of

observed mutations on viral replication in the presence and absence of drug pressure.

Biological properties assessed were drug susceptibility and viral growth kinetics.

2.3.13 Drug susceptibility of resistant viruses

The drug susceptibility of resistant viruses generated from serial passages was

determined by reverse transcriptase activity and compared with the susceptibility of

known antiretrovirals such as zidovudine (AZT), lamivudine (3TC), tenofovir (TDF),

delavirdine (DLV), efavirenz (EFV) and nevirapine (NVP). Significant drug resistance

was defined as a 10-fold increase in IC50 of a compound compared to its IC50 against the

wild-type virus (HIV-1B-HXB2). The IC50 values of CBL 4.0, CBL 4.1, CBL 17, CBL 21

and CBL 26 increased more than 10-fold when each compound was assessed against its

resistant virus (Table 4). Based on these results, fold increase was greater in the IC50 values of CBL 17, CBL 21 and CBL 26 when compared to CBL 4.0, CBL 4.1 and CBL

4.3. As shown in Table 4, CBL 4.0r, CBL 4.1r and CBL 4.3r were relatively more resistant to AZT than CBL 17r, CBL 21r and CBL 26r. All CBL-hit viruses were resistant to NVP, particularly CBL 17r, CBL 21r and CBL 26r; IC50 values against these viruses ranged from 14- to 1000-fold (Table 4).

Table 4: Drug susceptibility of resistant CBL viruses to CBL compounds, using zidovudine (AZT) and nevirapine (NVP) as drug controls. Resistant CBL viruses generated after 19 serial passages in C8166 cells. IC50 of CBL increased 5.9 – to 208– fold from IC50 against wild-type HIV-1B-HXB2. IC50 is the concentration that inhibited 50% reverse transcriptase activity. Results are mean from triplicate determinations.

2.3.14 Viral Growth Kinetics

Viral growth kinetics was determined and compared with wild-type HIV-1B-HXB2, in order to understand the impact of observed mutations on viral replication in the absence of drug pressure. The fitness of CBL-resistant viruses was very similar to the fitness of B-HXB2 with no appreciable statistical difference observed (Fig 2.20).

Figure 2.20: Viral Growth Kinetics curve. MT4 cells were infected with CBL resistant viruses at a low multiplicity of infection (MOI) of 0.001 for 7 days in the absence of compounds. 10µl of viral culture supernant was harvested daily and stored at -80°C. Viral replicative fitness was determined by reverse transcriptase activity. Results presented are mean ± SD from triplicate determinations.

100

2.4 Effect of CBL 26 on other HIV-1 gene targets

CBL 26 was particularly interesting because of the absence of known drug resistance mutations despite a >10-fold increase in IC50 and obvious resistance to known ARV drugs. Although T128N and E138K in the RT region were identified after passage number 16, these mutations were not observed by passage 19. Therefore, other HIV-1 genes were sequenced from total cellular DNA isolated from CBL 26r-infected MT4 cells. These were compared to the genese of wild-type B-HXB2. In addition to codons 1 to 286 of reverse transcriptase previously sequenced, HIV accessory genes were also sequenced. No nucleotide or amino acid changes were observed in the RT, integrase, Vif and Vpr genes of CBL 26 resistant virus. However, the following mutations were observed:

Tat- A58P

Vpu- A63S

Nef- A33V and E65K

Env- D57Y, R696K, V698F, Q718H and I756M

The next step was to study the contribution of each of these mutations to high level of drug resistance observed in CBL 26r virus, particularly for Tat, Nef and Vpu mutations. A63S mutation was successfully created in the Vpu of p83-10. However, it was discovered that the CBL 26r mutations in Nef were native to p83-10, while the Tat sequence of p83-10 was highly divergent from the Tat sequences of CBL 26r and its wild type virus, thus making the creation of site-directed Tat mutant impossible within the limited time available to this project. 101

2.4.1 Site directed mutagenesis (SDM)

SDM was used to create a Vpu mutant expressing the A63S mutation identified from sequencing the accessory genes of CBL 26r. The best result, a clean sequence without additional mutations, was obtained from amplifying 50ng of p83-10. No mutation was observed when 5ng and 10ng of p83-10 was amplified, while additional amino acid changes were observed when 20ng of plasmid was amplified (Fig 2.21).

Figure 2.21: Site directed mutagenesis of the Vpu gene of HIV-1p83-10. Sequences of site directed mutants compared to the sequence of wild type virus, p83-10. Transformation of 50ng of plasmid DNA yielded a clean sequence containing the desired mutation.

Viral susceptibility to CBL 26

Drug susceptibility of CBL 26 was assessed against p83-2-10VPUA63S and its IC50 was compared with its antiviral activity against wild type p83-2-10, as the two mutations in the Nef of CBL 26r are native to this virus. In the same experiment, the antiviral susceptibility of CBL 26 was also assessed against CBL 26r and its wild type virus B- 102

HXB2. Remarkably, A63S mutation in Vpu was found have very limited contribution to the resistance exhibited by CBL 26r (Fig 2.22).

Figure 2.22: Drug susceptibility of the mutant 83-2-10VPUA63S to increasing concentrations of CBL 26 was compared to the susceptibility of its wild-type virus, 83-2- 10 to CBL 26. It was also compared to the activity of CBL 26 against its resistant virus generated from serial passages, CBL 26r and the wild-type virus, HIV-1B-HXB2. All viruses were analyzed at a multiplicity of 0.01. 83-2-10VPUA63S has limited contributions to the high level resistance of CBL 26r to CBL 26. Results presented are mean ± SD from triplicate determinations.

103

DISCUSSION

We have identified and characterized six novel compounds, CBL 4.0, CBL 4.1,

CBL 4.3, CBL 17, CBL 21 and CBL 26, following a high-throughput screening of two small molecule libraries of 76,000 randomly selected compounds using a new read-out system and recombinant GFP lentiviral vector. Thirty-four compounds were identified to be highly active against the VSV-pseudotyped lentiviral vector was determined by measuring GFP expression and cellular toxicity by methylene blue assay in HeLa cells

(unpublished data by Khodyakova et al, 2006). Of these, CBL 4.0, CBL 17, CBL 21 and

CBL 26 were selected following correlation of low cellular toxicity and significant antiretroviral activity. Lead optimization of CBL 4.0’s chemical structure produced two additional compounds, CBL 4.1 and CBL 4.3.

These 6 compounds were highly active against B-HXB2 and B-92US026, laboratory and primary HIV-1 strains respectively. Variations in IC50 values obtained

from viral cultures in MT4 and PBMC could be explained by the difference in nucleotide

pool levels present in donor PBMC. It has been previously reported that all parameters,

including IC50 values vary according to nucleotide pools present in the seronegative

donor’s primary mononuclear cells70,157. “Hits” were relatively non-cytotoxic at 50µM, the highest concentration assessed, to primary mononuclear cells (PBMC), T-lymphoid cell line (MT4), and a glioma cell line (U87.CD4.CCR5). The calculated selectivity indices of these compounds were also highly comparable to those of established 104

antiretroviral drugs currently used in the clinical treatment of HIV/AIDS. We began

characterizing these compounds by assessing their direct effect on the HIV-1 reverse

transcriptase activity in the absence of a cellular interface. CBL 4.0, CBL 4.1, CBL 17

and CBL 21 reduced the HIV-1 reverse transcriptase processivity when directly

incubated with virions in a cell-free environment. Their pattern of inhibition was similar

nevirapine’s, a non-nucleoside reverse transcriptase inhibitor. Thus, it was initially postulated that these compounds were active post-viral entry.

Several other methods were used to determine the specific HIV-1 target(s) inhibited by these compounds and most showed the target of these compounds to be pre- integration into host chromosome. These methods included, inhibition of replication competent fluorescent viruses, PCR amplification of specific HIV-1 genes and the time of addition assay28,49. Replication competent HIV-1 expressing EGFP was used to divide

HIV-1 lifecycle into pre- and post-viral integration events, however, the use of this assay was extremely limited by its non-specifity and broad range of targets pre-integration40.

The use of PCR quantification of specific HIV-1 genes amplified from the infected DNA was also very limiting, as we could not observe significant differences in the quantity of our gel-resolved DNA products (results not shown). The time of addition assay was the most successful method in our hands. We used this assay to determine the lifecycle event targeted by our “hits” and known controls by quantifying the expression of luciferase protein. From previous publications, it has been shown that HIV entry occurs within 2 hours, reverse transcription within 4 hours, integration within 6 hours, maturation and exit of the virion from host cell within 18 hours of infection49,119. Addition of CBL 105

compounds could only be delayed for 4 hours post infection. This profile was similar to

the reverse transcriptase inhibitors, particularly nevirapine. From these results, it could be

inferred that CBL 4.0, CBL 4.1, CBL 17, CBL 21 and CBL 26 possibly target viral

reverse transcription.

Biochemical assays were also used to determine the effect of these compounds on

established HIV-1 target(s) such as reverse transcription, integration and virion

maturation. Reverse transcriptase inhibition assays determined CBL 17 to be the most

active against purified HIV-1 RT, more than nevirapine. CBL 4.0, CBL 4.1, CBL 4.3,

CBL 21 and CBL 26 were relatively inactive in this assay. HIV-1 integrase (IN) is a highly desirable therapeutic target in the antiretroviral drug development because of its uniqueness to the virus and absence in humans. Therefore, during the early days of this project, we focused on characterizing the effect of these compounds on this target.

However, none of these compounds significantly inhibited either 3´-end processing or strand transfer reactions of HIV-1 integrase. Similarly against HIV-1 protease, none of

these compounds inhibited the cleavage of HIV-1 Gag-Pol and Gag polyprotein into structural proteins such as the capsid protein (p24), required for virion infectivity.

Next, we determined the pattern of inhibition of various HIV-1 primary and drug- resistant viruses against these compounds. CBL 4.0 and CBL 4.1 were highly active against all wild-type, NRTI, NNRTI, PR and fusion inhibitor resistant HIV-1 isolates.

Identification of the activity of these compounds against subtypes B and C viruses is important because the current worldwide epidemic is primarily driven by subtype C infections, although the B-subtype is most common in North America and Western 106

Europe130. Our most significant finding was that a C-subtype virus, C-98IN022 was

relatively resistant to CBL 17, CBL 21 and CBL 26. This was especially significant as

these 3 compounds were also highly resistant to non-nucleoside reverse transcriptase

inhibitor resistant (NNRTI) resistant viruses. These viruses contained the K103N,

Y181C, L100I and the G190S mutations13,56,147,163. Previous studies have suggested that

C-subtype viruses have drug-resistance mutations that are not observed in B-subtypes

following NNRTI treatment74. This pattern of susceptibility further indicated that CBL

17, CBL 21 and CBL 26 were possibly non-nucleoside reverse transcriptase inhibitors. In vitro selection of resistant HIV-1 strains yielded the most useful information about the targets of these compounds. CBL 4.0, CBL 4.1 and CBL 4.3 had a higher barrier to developing resistance than CBL 17, CBL 21 and CBL 26 during serial passages in B-

HXB2. CBL 4.0, CBL 4.1 and CBL 4.3 passages were terminated at 10-fold, 12-fold and

6.6-fold of their IC50 values respectively after more than 200 days in culture. CBL 4.0

and CBL 4.1 selected the A62V mutation during serial passages. These A62V containing

viruses were relatively more susceptible less susceptible to AZT. The IC50 values of

AZT increased from 4.2 – 10-fold above parental HIV-1B-HXB2, compared to 1.4 – 2.4-

fold against CBL 17r and CBL 21r respectively.

The selection of A62V in by CBL 4.0 and CBL 4.1 in the absence of other

obvious contributing mutations was particularly curious in our study, since in previous

studies, the A62V mutation has been noted to have limited impacts on drug resistance

evolution. A62V has also always been reported as part of a mutation complex (A62V,

V75I, F77L, F116Y, and Q151M) in patients treated with multiple nucleoside RTIs, 107

particularly in patients treated with a combinations of AZT and ddC or AZT and ddI182.

When this complex occurs, the Q151M change was the first and pivotal mutation to appear, followed by F116Y, F77L, V75I and A62V182. The effect of A62V in the

evolution of drug resistance has also been analyzed in recombinant clones. In

recombinant A62V clones only, the sensitivity of d4T was reduced 1.28-fold, ddI

increased 1.25-fold, while the susceptibility AZT, 3TC and ddC remained unchanged. In

recombinant clones containing the multidrug complex with or without the A62V mutation, 3TC was sensitive in the presence or absence of A62V, while AZT resistance

(100-fold) remained unchanged, resistance decreased against ddI and d4T, but increased

4-fold against ddC87. Therefore, the contribution of A62V is extremely limited in the

development of drug resistance. In fact, during the course of this research, we recognized

that the chemical structures of CBL 4.0, CBL 4.1 and CBL 4.3 were very similar to the

recently published chemical structure of an indolopyridone, a nucleotide competing

reverse transcriptase inhibitor (NcRTI-1), recently published by Tibotec, Belgium95.

Interesting, they also reported that A62V has been associated with a 10-fold increase in resistance to the NcRTI in the presence of thymidine analog associated mutations

(TAMs) M41L/D67N/K70R/T215Y and P133H94. This discovery supports our observations that CBL 4.0, CBL 4.1 and CBL 4.3 belong to a unique class of novel antiretroviral compounds.

CBL 17, CBL 21 and CBL 26 rapidly selected non-nucleoside RT inhibitor- associated mutations, this was not surprising as NNRTI-associated mutations have been known to occur early during the course of patient therapy8,9,13. L100I and Y181C selected 108

by CBL 17 and CBL 21 respectively, have been associated with intermediate-high level

resistance to NNRTIs56,162. The Y181 residue lies with other hydrophobic amino acids

(Y188, F227, W229, and Y232) in the NNRTI-binding pocket (NNRTI-bp) of that is

located near, but not overlapping the active site of HIV-1 RT85,108,168. The entrance of this

NNRTI-bp is ringed by the p66/p51 junction which consists of L100, K101, K103, V179,

and Y181 of p66 and E138 of p5185. This NNRTI-bp exists only in the presence of

NNRTIs, therefore be proposed that both CBL 17 and CBL 21 are NNRTIs that change

the conformation of the active site of HIV-1 RT. CBL 26 was particularly interesting,

obvious drug-resistance associated mutations were not found in several sequences

amplified from CBL 26r despite a >10-fold increase in IC50 and obvious resistance to known ARV drugs. CBL 26r was also associated with mutations in Tat, Vpu, Env and

Nef. Due to time limitations, we were only able to examine the contribution of a Vpu

mutation to CBL 26r by site directed mutagenesis and we found little evidence of its contribution to drug resistance.

In summary, six potent antiretroviral compounds were identified and characterized from small molecule library screening. Three of these compounds, CBL

4.0, CBL 4.1 and CBL 4.3 are nucleotide competing reverse transcriptase inhibitiors

(NcRTIs), a new class of reverse transcriptase inhibitiors. The remaining three

compounds; CBL 17, CBL 21 and CBL 26 are likely non-nucleoside reverse transcriptase

inhibitors (NNRTIs). However, CBL 26 could also be active against other HIV-1

target(s) that are yet to be identified. CHAPTER III

CELL-BASED SCREENING OF A SMALL MOLECULE LIBRARY TO IDENTIFY NEW ANTIRETROVIRAL COMPOUNDS PARTICULARLY HIV-1 CORECEPTOR ANTAGONISTS

INTRODUCTION

The goal of this project was to screen a 34,000 small molecule library for new antiretroviral compounds, specifically for antagonists of HIV-1 coreceptors (CCR5 and

CXCR4). HIV-1 is characterized by several genetic variations, one of which is the

variation in coreceptor usage during viral entry. The two main coreceptors used by HIV-1 are the chemokine receptors CCR5 and CXCR461. CCR5, the coreceptor for R5-using

viruses that are more common in the early stages of the HIV-1 infection, is preferred by

macrophage-tropic HIV-1 and HIV-2. CXCR4 is the coreceptor of the X4-using viruses

that are more virulent, it is associated with the later stages of infection and preferred by

T-lymphocyte-tropic viruses149,173. Although, this chapter describes the screening of a sub-library previously described in Chapter 2, the main difference between this project

109 110

and that previously described is the method utilized for screening these small molecule libraries. In Chapter 2, a fluorescent lentiviral vector was used to screen two sub- libraries; however this chapter describes the simultaneous screening of one these sub- libraries using two replicative-competent fluorescent viruses. The initial aim of this project was to assemble an efficient, automated cell-based protocol for rapidly screening small molecule libraries while using replicative-competent viruses and being able to distinguish between CCR5 and CXCR4 antagonists. Cell-based methods using fluorescence or scintillation-based biological assays have been shown to be amenable to automation143. Several HIV-1 drug discovery assays have reported the use of reporter genes inserted into a virus or a cell line. Compounds identified from these assays suppress the expression of the reporter gene. Cell-based high-throughput screening has increased the efficiency of assessing various drug targets with rapid turnover.

In HIV drug discovery, coreceptor antagonists would be difficult to screen with biochemical assays. In fact, since there are two coreceptors CCR5 and CXCR4, each compound would have to be screened twice, thus increasing the cost and labor of drug discovery. Therefore, in this study we have been able to circumvent this difficulty, by designing a single cell-based assay that uses both R5 and X4 reporter viruses to simultaneously screen a small molecule library. This study has also achieved the goals of small-molecule screening which are to develop credible, robust and reproducible protocols for the screening of a large number of structurally diverse compounds; identify

“hits” that could become leads, determine the efficacy, potency and toxicity of various hits. 111

MATERIALS AND METHODS

Small molecule library

The library screened in this project was purchased from Chembridge Corp. (San

Diego, CA) and access to the library was provided by the Small Molecule Screening core

(Cleveland Clinic, Lerner Research Institute). This chemical sub-library includes 34,000 structurally diverse chemicals chosen from a library of over 1 million compounds. The molecular weight of these compounds ranged from 150-500 while their verified purity by

NMR was greater than 95%. Each compound was made available for this screening in

5mg/ml (10-15mM) stock dissolved in DMSO. 80 compounds were frozen per 96-well plate at -80°C in the Small Molecule Screening core. For characterization, 1mg of each identified hit was purchased from Chembridge Corporation, re-suspended in DMSO and stored in 10mM aliquots at -80°C.

Marketed antiretroviral drugs

Known ARV drugs such as nucleoside reverse transcriptase inhibitors zidovudine and nevirapine were obtained from the NIH AIDS Research and Reference Reagent

Program. Other compounds obtained from the NIH reference program were enfuvirtide,

TAK779, AMD3100 and nelfinavir. L-870,810, an integrase inhibitor was obtained from

Merck research laboratories.

112

Cells

U87.CD4.CCR5 and U87.CD4.CXCR4 cell lines were used for the small

molecule library screening. Both cell lines stably express CD4 receptor and a chemokine receptor (CCR5 or CXCR4) and were obtained from the NIH reference program. U87MG

cells are glioma cells lines stably transduced with the MV7neo-T4 retroviral vector,

selected for G418 resistance and were maintained as described in Chapter 220. MT4 and

PBMC prepared and maintained as previously described in materials and methods in

Chapter 2.

Viruses

Figure 3.1: Genome of fluorescent viruses. Fluorescent genes EGFP or DsRed2 were inserted between HIV-1 env and nef genes. env: envelope; gag: LTR; Long terminal repeats; Nef: Negative factor; PR: Protease; Rev: Anti-repression transactivator protein; Tat: Transactivating regulatory protein; Vif: Virion infectivity factor; Vpu: Viral protein U; Vpr: Viral protein R.

Fluorescent viruses were obtained from Dr. Jan Weber. As previously described,

HIV-1 tagged with EGFP and DsRed2 are recombinant, replicative-competent viruses

202 that encode and express these fluorescent genes . HIV-1YU-2 is a R5- while HIV-1NL4.3 113

is an X4-using virus. As recently published by Dr. Weber, fluorescent genes were

inserted between the env and nef genes of these viruses without compromising the

202 integrity of the viral genome . HIV-1YU-2EGFP was amplified in U87.CD4.CCR5 while

HIV-1NL4.3DsRed2 was grown in MT4 cells. The tissue culture infective doses of these

viruses were determined in both U87.CD4.CCR5 and U87.CD4.CXCR4. Other viruses,

HIV-1B-HXB2, HIV-1C5 and HIV-1B-92US026, were obtained from NIH AIDS reference

program, amplified and stored as described in materials and methods section of Chapter

Verification of coreceptor usage

Figure 3.2: Verification of coreceptor usage of fluorescent viruses. Coreceptor usage of green and red viruses prior to use in screening the small molecule library was confirmed by fluorescent microscopy and reverse transcriptase assay after 5 days in culture.

HIV-1 coreceptor usage of HIV-1YU-2 and HIV-1NL4.3 fluorescent viruses was verified by reverse transcriptase assay and fluorescent microscopy. Briefly, 1x104 114

U87.CD4.CXCR4 and U87.CD4.CCR5 cells were separately seeded in 100μl of medium in 96-well flat-bottom plates and incubated overnight at 37°C in 5% CO2. 100μl of

various dilutions of each virus was added to separate cultures of U87.CD4.CXCR4 and

U87.CD4.CCR5. Cells were incubated with virus overnight and washed with 1x PBS to

remove non-adsorbed viral inoculum. 200μl of fresh U87 medium was added to the cells

and culture was maintained for 72 hours. HIV-1 replication was assessed by RT assay

and fluorescent microscopy using a Leica DMIRB inverted upright wide-field

fluorescence microscope (Heidelberg, Germany).

Plate design

Figure 3.3: Plate design of each 96-well flat bottom plates used to screen the 34,000 small molecules. No drug controls were analyzed in column 1 on each plate, while 10μl of AMD3100, TAK779, AZT and 0.01% DMSO were analyzed in column 12. Eighty compounds were analyzed per plate with a total of 10 plates analyzed per day.

115

Each 96-well flat-bottom was designed to screen 80 small molecules at a time,

using prong replicators. The experiments controls were tested in columns 1 and 12. No

drug controls were tested in column 1. In column 1, wells A and B contained cells only,

without virus and drugs. Cell mixture in wells C and D were infected with the R5-EGFP

virus. Wells E and F were infected with only the X4-DsRed2 virus. Both viruses were

analyzed at the same multiplicity of infection (MOI=0.01). For the known drug controls,

wells A and B in column 12 were treated with 10μM of AMD 3100. Cells in wells C and

D were treated with 10μM of TAK779, wells E and F were treated with 10μM of AZT

while 0.01% DMSO was added to cells in wells G and H in column 12.

Screening protocol

Figure 3.4: Protocol for screening small molecule library. Co-cultures of CCR5 and CXCR4 expressing cells infected with admixtures of green (R5-using) and red (X4- using) viruses in the presence of 5mg/ml of each compound for 5 days. Antiviral activity monitored by fluorescent microscopy.

116

A mixture of 2.5 x103 of U87.CD4.CXCR4 and U87.CD4.CCR5 cells (total of 5 x103 cells) in a total volume of 200μl were co-cultured in 96-well flat-bottom microtitre plates and incubated overnight in 5% CO2 at 37°C for 16 hours. Eighty test compounds and 3 known drug controls were added to each plate. Cells were incubated for 2 hours in the presence an absence of compounds. A mixture of DsRed2-tagged X4 and 4μl of

EGFP-tagged R5 viruses, volumes corresponding to a multiplicity of infection of 0.01 for each of the fluorescent viruses was added to each well and further incubated for 5 days.

Antiviral activity

On day 5, fluorescent microscopy (using both red and green filters) was performed to determine the antiviral activity of the test compound by their inhibition of viral replication. Antiviral activity was observed as the extinction of fluorescence and recorded for each well. An inhibitor of the CCR5-using virus such as TAK779, would selectively extinguish the green fluorescence while an inhibitor of CXCR4-using virus such as AMD3100, would selectively extinguish the red fluorescence produced from multiple replication of the DsRed2-tagged X4-using virus. Inhibition of both green and red viruses (as seen with AZT) would extinguish both green and red fluorescence.

117

Confirmation of antiviral activity

Figure 3.5: Drug susceptibility of R5-using virus (HIV-1C5) and X4-using virus (HIV-1B- HXB2) to hits. Following the library screening, each selected compound was retested at 8.5µM in separate cultures of U87.CD4.CCR5/HIV-1C5 virus and U87.CD4.CXCR4/HIV-1B-HXB2.

Compounds identified following the initial screening as inhibitors of either

CCR5-using virus, CXCR4-using virus or both viruses were re-assessed for antiviral

activity. For this assay, individual cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 cells were maintained in 96-well flat bottom plates. 7,500 of each cell line were seeded

into 200ul of appropriate culture medium in separate microtitre plates overnight in 5%

CO2 at 37°C. After 16 hours, 0.2μl (8.5μM) of these compounds was added in triplicates

in both U87.CD4.CCR5 and U87.CD4.CXCR4 cells for 2 hours. U87.CD4.CCR5 was

infected with HIV-1C5, a laboratory adapted C-subtype isolate, while U87.CD4.CXCR4 cells were infected with HIV-1B-HXB2, a laboratory adapted B-subtype. Both viruses were

tested singly at a multiplicity of 0.01. Cultures were maintained for 7 days. However, 118

10μl of viral culture supernatant was harvested on days 3, 5 and 7 and frozen at -80°C for

reverse transcriptase activity assay.

Cellular toxicity in U87.CD4.CCR5 and U87.CD4.CXCR4

Figure 3.6: Cellular toxicity of selected compounds analyzed in independent cultures of U87.CD4.CCR5, U87.CD4.CXCR4 and MT4.

Cellular proliferation in the presence of selected small molecules was determined

by seeding 7,500 of either U87.CD4.CCR5 or U87.CD4.CXCR4 in 200μl of U87.CD4

maintenance medium in 96-well flat bottom microtitre plates for 16 hours. Following

which 2μl (8.5μM) of compounds was added to each well. Cells were incubated for 5

days in the presence and absence of test compounds in 5%CO2 at 37°C. On day 5, culture

supernatant was removed and 100μl of MTT dissolved in PBS was added to each well.

Cells were incubated in the presence of MTT, after 4 hours, MTT solution was removed from cells and 50μl of 100% DMSO was added to each well. Cell-DMSO was incubated for 30 minutes. Absorbance was measured by the VICTOR V (PerkinElmer). 119

Cellular Toxicity of compounds in MT4 and PBMC

Cell viability by trypan blue exclusion and cellular proliferation by mean transit time (MTT) assay determined as previously described in Chapter 2.

Antiviral assays

Antiviral assays of compound treated MT4 and PBMCs were performed as previously described in Chapter 2. U87.CD4.CCR5 and U87.CD4.CXCR4 (1 x104 cells per well) in 96-well plates were incubated with serial dilutions of compounds for 2 hours.

Cells were infected with HIV-1 isolates at a multiplicity of infection (MOI) of 0.01.

Following an additional 2 hour incubation at 37°C in 5% CO2, infected cells were washed three times with 1x phosphate-buffered saline (PBS) and incubated in fresh medium containing the serial dilution of compounds. On day 5, new virus production was quantified from clarified cell-free supernatant by reverse transcriptase activity as previously described in Chapter 2.

Time-of-addition assay

2 x 105 MT4 cells were seeded into flat-bottom microtitre plates overnight. The cells were infected with HIV-1 NL4-3-fluc2 (a firefly luciferase expressing R5 virus) at a

MOI of 0.2 (volume 30μl) and incubated for 2 hours at 37°C with 5% CO2 the presence and absence of compounds. Cells were washed three times in 1x PBS to remove non- 120

adsorbed viral particles. 100x IC50 was added at time 0, 2, 4, 8, 12 and 24 hours post- infection into parallel wells using; AMD3100 and AZT as controls. Virus production was measured after 48 hours post infection by reverse transcriptase assay performed on viral culture supernatant and luciferase assay system (Promega) on lysed culture cells. Briefly, culture supernatant was removed from wells and cells were washed with 1x PBS. 20μl of diluted 1x lysis buffer (Promega) was added to each well, plates were shaken at a very low speed for 15 minutes on a platform shaker. 100μl of reconstituted luciferase reagent was added to each well. Plates were covered with aluminum foil, shaken for an additional

5 seconds and read in Victor V. A second reading of each plate was performed 5 minutes after the first.

121

RESULTS

3.1 A novel assay to identify HIV-1 inhibitors especially HIV-1 coreceptor

antagonists

In this study, a novel HIV-1 high-throughput assay was designed to identify

potential HIV-1 inhibitors. This assay uses replication-competent viruses expressing

EGFP and DsRed2 fluorescent genes, to identify novel inhibitors of HIV-1 particularly,

HIV-1 coreceptor (CCR5 and CXCR4) antagonists from large compound libraries. Four

recombinant fluorescent viruses, two CCR5 (each expressing either EGFP or DsRed2)

and two CXCR4 viruses (expressing either EGFP or DsRed2) developed by Dr Jan

Weber. As previously described, fluorescent genes were inserted between the env and nef

202 genes of HIV-1YU-2 and HIV-1NL4.3 (Fig 3.7) . These viruses have been extensively

verified to be intact and able to undergo multiple rounds of replication by protein

immunoblotting and various viral fitness assays202.

3.2 Verification of coreceptor usage by R5- and X4-using EGFP and DsRed2

viruses

To suit the screening protocol, this system was optimized by testing various multiplicities of infection and combinations of R5 and X4-fluorescent gene expressing viruses. Two combinations, HIV-1YU-2EGFP versus HIV-1NL4.3DsRed2; HIV-1YU-

2DsRed2 versus HIV-1NL4.3EGFP were assessed in the absence of compounds (Fig 3.8). 122

Admixtures of U87.CD4.CCR5 and U87.CD4.CXCR4 cells were infected with various volumes of all four viruses, monitoring the expression of green and red proteins daily for

7 days by fluorescent microscopy. The best R5 and X4 combination observed with robust infection was determined to be HIV-1YU-2EGFP and HIV-1NL4.3DsRed2 after 5 days of infection (Fig 3.8).

Figure 3.7: Verification of coreceptor usage. The coreceptor usage of each virus was determined by infecting separate cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 cells for 5 days at a multiplicity of infection (MOI) of 0.01. HIV-1 reverse transcriptase assay was performed to determine the robustness of the replication of each virus in each cell line. CXCR4-using viruses, NL4.3EGFP and NL4.3DsRed2 replicated better in U87.CD4.CXCR4 cells, while CCR5-using viruses, YU-2EGFP and Yu-2DsRed2 replicated better in U87.CD.CCR5 cells. Results presented are mean ± SD from triplicate determinations

123

Green Filter Red Filter Merged Cells only, no virus

10µl X4-EGFP +R5-DsRed2

100µl X4-EGFP + R5-DsRed2

1µl R5-EGFP + X4-DsRed2

10µl R5-EGFP + X4-DsRed2

100µl R5-EGFP + X4-DsRed2

Figure 3.8: Admixtures of different multiplicities of HIV-1 fluorescent viruses were used to infect co-cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 cells. In panel A shows cell cocultures without infection. Panel B shows 10μl and 100μl of HIV-1YU-2DsRed2 and HIV-1NL4.3EGFP. Panel C shows 1μl, 10μl and 100μl admixtures of HIV-1YU-2EGFP and HIV-1NL4.3DsRed2. Pictures were taken at 10x magnification. 124

3.3 Effect of known antiretroviral drugs on fluorescent viruses

AZT NVP RANTES TAK-779

NFV L-870810 AMD-3100 T-20

Figure 3.9: The antiviral activity of known antiretroviral drugs was assessed against an admixture of HIV-1YU-2EGFP and HIV-1NL4.3DsRed2. In panel a, reverse transcriptase, integrase and protease inhibitors significantly inhibited both viruses. In panel b, RANTES and TAK-779 selectively inhibited the R5- HIV-1YU-2EGFP while AMD-3100 inhibited HIV-1NL4.3DsRed2. Both viruses were completely inhibited by viral entry inhibitor T20.

Specificity and reliability of the screening protocol was determined by testing the

effect of known antiretrovirals against our chosen combination of HIV-1YU-2EGFP and

HIV-1NL4.3DsRed2. Three concentrations (1μM, 10μM and 50μM) of AMD3100,

TAK779, enfuvirtide, zidovudine, nevirapine, L-870,810 and nelfinavir were analyzed in

equal co-cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 cells infected with R5-EGFP

and X4-DsRed2 viruses (pictures of 10µM treated wells shown in Fig 3.9). Their 125

antiretroviral activity was monitored daily by fluorescent microscopy for 5 days. On days

3 and 5, pictures of infected wells were taken and compared. Antiviral activity determined by fluorescent microscopy was more pronounced on day 5. We also

established that 10μM of each compound was the best concentration to analyze these

compounds. 10μM corresponds to approximately 100-200-fold of the IC50 of these known antiretroviral drugs.

3.4 Small molecule library screening

Figure 3.10: Results of the cell-based small library screening. 34,000 compounds were analyzed with red and green fluorescent viruses, 213 hits were selected for further evaluation. Following independent cultures in CCR5- and CXCR4-expressing cells, 10 compounds were selected for evaluation of their antiviral activity and cellular toxicity. Of these compounds, 4 were chosen for extensive characterization following HIV-1 reverse transcriptase and cellular proliferation assays.

The screening of a 34,000 small molecule library began after establishing the experimental protocol. As shown in Fig 3.3, eighty small molecules were analyzed per plate using AZT, AMD 3100 and TAK779 as known drug controls, as well as 0.01% 126

DMSO as solvent control. Ten plates were screened daily making a total of 800 molecules analyzed per day. Co-cultures of U87 glioma cell lines expressing the CD4 receptor and CCR5 or CXCR4 coreceptors were pre-treated with 10μM of small molecule compounds for 2 hours. These cells were then simultaneously infected with an

admixture of R5- and X4-using EGFP and DsRed2 expressing viruses respectively, at a

MOI of 0.01 each for 5 days. At this low multiplicity of infection, replication of each

virus is restricted to its permissive cell line. That is, replication of X4-DsRed2 virus

would occur only in CXCR4 cells, and R5-EGFP only in CCR5 cells. Previous

experiments during the course of this studies have shown that otherwise non-permissive

cells could be infected at very high multiplicities of infection90. This protocol also

allowed us to subjectively assess compound cellular toxicity by direct observation using

light microscopy. Only compounds determined to be relatively non-toxic with 95%

inhibition of X4, R5 or both viruses were selected for further characterization. The 95%

cutoff limit was determined after our analysis of the first 3,500 compounds. Following

the high-throughput screening of these compounds, 33 “hits” were identified to have

inhibited either of R5- or X4-using virus or both viruses. Retrospectively, all 33 “hits”

inhibited 95-100% of fluorescence in the high throughput screening.

A total 213 “hits” were identified (0.54% hit rate) from our high-throughput

screening of 34,000 small molecule compounds. From this initial screening, ten

compounds were identified; one compound inhibited the R5 virus; three compounds

inhibited the X4-DsRed2 virus, while six compounds significantly inhibited both R5 and

X4 viruses (Fig 3.12). A single concentration (~ 8.5µM) was analyzed for antiviral 127

activity separately against HIV-1C5 in U87.CD4.CCR5 and HIV-1B-HXB2 in

U87.CD4.CXCR4 and MT4. HIV-1 reverse transcriptase assay was used to assess effect of these compounds on multiple rounds of viral replication. We selected 10 compounds for further characterization following these assays. One compound inhibited the R5 virus; seven inhibited the X4 virus while two compounds inhibited both R5 and X4 viruses. The

IC50 values of the ten compounds selected from the verification of the antiviral activity of hits by RT assay was determined from various concentrations of these compounds in

U87.CD4.CCR5 and U87.CD4.CXCR4. The inhibitory concentrations of these compounds were correlated with their CC50 and four compounds were selected based on the significant anti-HIV-1 activity. Three of these compounds; Hits 2.0, 4.0 and 10.0 inhibited both X4 and R5 viruses, while Hit 3.0 inhibited more of X4-using than R5- using virus. Four compounds were identified to have significant anti-HIV-1 activity without associated cellular toxicity.

We selected four compounds: Hit 2.0, Hit 3.0, Hit 4.0 and Hit 10.0 for further characterization. The most interesting compound identified was Hit 3.0. As shown on

Table 2, the IC50 of this compound was 8.35-fold lower against X4-using viruses

compared to the 40.17μM against C5, an R5-using virus tested in U87.CD4.CCR5. Hit

4.0 had the lowest IC50 against both viruses, 0.12μM and 0.03μM in MT4 and PBMC respectively. Hit 10.0 was the second most potent with IC50 values 0.15μM and 4.25μM in MT4 and PBMC. Cellular toxicity was determined in stimulated primary mononuclear cells and MT4. In general, these compounds were relatively non-cytotoxic to all cells tested (Tables 1 and 2). 128

Table 1: Ten compounds were selected from the 213 small molecules identified from the library screening for evaluation of their antiviral activity in separate cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 cells infected with R5- and X4-using viruses respectively. Four compounds, Hits 2.0, 3.0, 4.0 and 10.0 were chosen for further characterization. The IC50 of Hits 2.0, 4.0 and 10.0 were less than 2µM against both R5- and X4-using viruses. Results presented are mean ± SD of triplicate determinations. Compounds marked as very weak: poor RT assay, probably due to compound toxicity.

Table 2: Cellular viability, cellular proliferation and antiviral activity of selected hits. Cellular toxicity (cell viability and cellular proliferation) of Hits 2.0, 3.0, 4.0 and 10.0 was correlated with their antiviral activity against primary and laboratory adapted HIV-1 isolates in PBMC and MT4 cells infected at a multiplicity of 0.01 respectively. These compounds were relatively non-cytotoxic with low IC50 concentrations. Results presented are mean ± SD of triplicate determinations.

129

Time-of-addition assay

Figure 3.11: Time of addition assay measured by luciferase chemiluminescence. MT4 cells were infected with HIV-1R5-fluc2, MOI 0.2. 100x IC50 of compounds were added at various time points. Inhibition by Hits 2.0 and 4.0 extended to 4 hours post infection similar to the profile observed with AZT. Hit 3.0 inhibited HIV-1 replication when added at the time of infection. Hit 10.0 prevented infection until 12 hours post infection.

Specific HIV-1 lifecycle event inhibited by the 4 hits identified from the small molecule screening was analyzed by the time of addition assay. As shown in Figure 6, the most significant finding we identified is that addition of Hit 10.0 could be delayed until

12 hours post infection. Infact, this time could be extended to 24 hours, since luciferase luminescence at 24 hours was less than 5-fold of the no drug control. Another significant finding was HIV-1 inhibition by 3.0 when added 2 hours pre- and post-infection. The 130

inhibition profile of Hit 2.0 was similar to that of Hit 4.0. Addition of Hit 2.0 and Hit 4.0 could be delayed until 4 hours following infection. As also shown in Figure 6, this pattern of inhibition was similar to the pattern of inhibition by AZT.

131

DISCUSSION

In this chapter, a novel HIV-1 replication assay was designed to identify viral entry inhibitors particularly antagonists of HIV-1 coreceptors, CCR5 and CXCR4. These viruses were initially constructed to quantify the replicative fitness of intact, drug- resistant HIV-1 isolates expressing two different fluorescent reporter genes harboring mutations202. Viruses utilized to screen this small molecule library are replicative competent R5-using recombinant viruses expressing enhanced green fluorescent (EGFP) and X4-using viruses expressing Discosoma sp. (DsRed2) proteins in a backbone of HIV-

1NL4-3. Fluorescent genes were inserted between the env and nef genes without

compromising viral infectivity with protein expression under the control of HIV-1

LTR202. As shown in the results, robust reporter gene expression was observed following

a 5 day infection with these viruses. We also able to demonstrate that appropriate reporter

signal was suppressed significantly by 100x the IC50 of known HIV-1 inhibitors that

target major HIV-1 lifecycle events such as viral entry (enfuvirtide, AMD 3100 and

TAK779); reverse transcription (zidovudine and nevirapine); integration (L-870,810) and

virion maturation (nelfinavir).

As expected, both R5-green and X4-red reporter signals were inhibited by the

viral fusion inhibitor enfuvirtide, reverse transcriptase inhibitors zidovudine and

nevirapine, integrase inhbitor L-870,810. In contrast, only the R5-green signal was

suppressed by TAK779, while the X4-red was totally inhibited by AMD 3100. A 132

significant induction of the green more than the red reporter signal was observed with

nelfinavir, a protease inhibitor and therefore a late event inhibitor in HIV-1 lifecycle. The

difference between the inductions of reporter signal by nelfinavir could be attributed to

the difference between the maturation times of EGFP and DsRed2. DsRed2 maturation measured by color intensity is slower than EGFP’s maturation time126,202. This same

protocol was adapted to screen a small molecule library.

This chapter has also described the utility of these fluorescent viruses in the cell-

based screening of a small molecule library for new anti-HIV-1 compounds. This system

is designed to identify broad inhibitors, of especially early HIV-1 lifecycle events such as

viral entry, reverse transcription and integration. Extensive research has been done to

identify HIV-1 reverse transcriptase and protease inhibitors. Currently, highly desirable

drug targets are viral entry (fusion inhibitors and coreceptor antagonists), integrase and

virion maturation and assembly inhibitors. However the main aim of this project was to

identify HIV-1 coreceptor antagonists. Therefore, R5-EGFP and X4-DsRed2 viruses

were simultaneously used to infect a co-culture of U87.CD4.CCR5 and

U87.CD4.CXCR4 cells; to screen a small molecule library and identify new

antiretroviral compounds, particularly viral entry inhibitors and antagonists of CCR5 and

CXCR4.

One problem previously associated with the discovery of HIV-1 coreceptor

antagonists is that most cell lines express the CXCR4 coreceptor and allow infection by

X4-using viruses; however, majority of early HIV-1 infections have been associated with

R5-using viruses. A natural choice of cell permissive to both X4 and R5 cells are 133

peripheral blood mononuclear cells (PBMC). The practical use of PBMC in drug

screening is limited by its labor intensive isolation seronegative donors and therefore, is ill-suited for automation. Another choice of cells would have been Ghost X4/R5 cells, however, the fluorescent background of these cells would be high as they express some base-line EGFP in the absence of HIV infection137. Therefore, our use of the admixture of

U87.CD4.CCR5 and U87.CD4.CXCR4 has eliminated these problems. These cells have

been stably transfected with either CCR5 or CXCR4 and used extensively for HIV

replication and antiviral assays particularly in the study of anti-HIV-1 vaccines154,180.

Furthermore have been established as highly sensitive and suitable for high-throughput assays180.

The aim of this project is to identify and characterize new lead compounds acting

as HIV-1 coreceptor antagonists as well as other HIV-1 inhibitors. Characterizing 213

compounds would have been too ambitious. Therefore, the antiviral activity of all hits

from the HTS was verified by re-analyzing the same concentration of hits tested in the

library screening using traditional HIV-1 reverse transcriptase assay. Ten compounds

were identified, seven of which inhibited the replication of B-HXB2, and one compound

inhibited R5 in U87.CD4.CCR5, while two compounds inhibited both viruses. The CC50 and IC50 values of these ten compounds were analyzed by trypan blue exclusion and

MTT in MT4, U87.CD4.CCR5, U87.CD4.CXCR4 and PBMC. Three of these

compounds Hits 2.0, 4.0 and 10.0 inhibited both R5 and X4 viruses at low

concentrations. However, Hit 3.0 selectively inhibited the X4 virus without antiviral

activity against the R5 virus. The IC50 against the X4 virus was 6-fold higher that 134

obtained against the R5 virus. Although the IC50 of Hit 3.0 against the X4-using virus B-

HXB2 was 4.81μM, which is relatively higher than the IC50 values of the other three

compounds against either both R5-using and X4-using viruses. However, this compound

is a successful hit that could be optimized into a drug discovery lead. A successful “hit”

identified following HTS has been described to have IC50 of ≤10μM and lead

98 optimization of the chemical structure is used to further reduce the IC50 to 1-10nM .

However, the most interesting observation from this project was the extended inhibitory effect of Hit 10.0 from the time of addition of assay. HIV-1 replication measured by luciferase expression was significantly reduced by Hit 10.0 when added 12 hours post infection. Also significant was the inhibition pattern observed with Hit 3.0. HIV-1 replication was inhibited when added 2 hours post infection. Hits 2.0 and 4.0 showed a similar pattern to AZT, with inhibition lasting 4 hours post infection.

The overall success rate of our library screening was ~0.01%, since we identified

4 compounds out of a 34,000 small molecule library. However, the initially higher hit rate of 0.56%, calculated following library screening with fluorescent viruses could be associated with limitations previously described with cell-based HTS. Cell-based HTS are associated with a high rate of false positives, due to compound toxicity, non-specific binding and activity and compound interference with the bioassays such as fluorescent compounds in a fluorescence-based biological assay164. Other limitations include

compound degradation, evaporation and low compound concentration in test plates,

inability to maintain plate reproducibility (cell and replicator problems), solvent

interference and subjective analysis of screening read-out system and results14. Some of 135

the limitations were encountered frequently in our screening; however the most

significant was that of assessing fluorescent compounds in a fluorescence-based

biological assay. We were able to overcome this limitation by using two subsequent

antiviral assays to confirm the antiretroviral activity of these compounds. The sensitivity

of this novel system was also confirmed by one of the compounds identified. Hit 4.0 was previously identified from the small molecule when it was screened for new antiretroviral compounds using a VSV-pseudotyped EGFP-tagged lentiviral expression vector. In

Chapter 2, Hit 4.0 was extensively characterized to be a reverse transcriptase inhibitor91.

Also, this compound has been identified as a nucleotide-competing reverse transcriptase inhibitor (NcRTI), a new class of reverse transcriptase inhibitors94,95.

Although the typical small-molecule library screened by HTS has > 100,000

compounds with molecular weight 100-500 and the traditional method of drug discovery

is the target driven (oriented) drug discovery, this process involves the identification of

compounds/drugs against a specific protein target, it was a laborious linear process where

modulators of an identified protein target are synthesized, characterized and developed.

Diversity driven (oriented) drug discovery is used to simultaneously identify various

protein targets and their small molecule regulators174. We have described a diversity-

driven drug discovery system, which also allowed the efficient and effective screening of large libraries of small molecules within a short period of time and the identification of multiple drug targets. Further research will be done to fully characterize the mechanism

of action of these compounds. Characterization of the hits and leads derived from a library screening include target validation. The therapeutic value and relevance of each 136

target is evaluated using biology-based assays to determine the effect of the “hits” on

target. A dose-dependent response by the target must be observed during target validation. CHAPTER IV

KST201 AND KST301: ANALOGUES OF RESVERATROL AS NOVEL ANTIRETROVIRAL COMPOUNDS

INTRODUCTION

Resveratrol (3,4′,5-trihydroxyl-trans-stilbene), is a naturally occurring phytoalexin, found in grapes, peanuts, cranberries and red wine19,77,201. In grapes,

Resveratrol is produced as an antimicrobial agent in response to fungal attack by Botrytis cinerea3. Resveratrol has been extensively characterized to be an anticancer, antiinflammatory, antioxidative, antiplatelet aggregation, antiviral and cardioprotective compound18,19,53,77,80,139. It has also been shown to have moderate anti-HIV-1 activity against clinical and select drug-resistant HIV-1 isolates80. A previous study has described the synergistic inhibition of HIV-1 replication in mitogen stimulated peripheral blood mononuclear cells (PBMC) and monocytes derived macrophages (MDM) when 10μM of

Resveratrol was combined with nucleoside reverse transcriptase inhibitors (RTIs)80.

137 138

Resveratrol has been shown to synergistically lower 2- to 6-fold, the IC90 of AZT,

ddI and ddC80. It also showed similar enhancement of the antiviral activity of ddI against ddI-resistant viruses at a concentration 10-fold less than hydroxyurea (HU), without the toxicity of HU80. Studies have also shown that Resveratrol was relatively non-cytotoxic

to cells with CC50 values ≥30μM, as determined by trypan blue exclusion and MTT

assay80. Although, human metabolites of Resveratrol (Resveratrol glucoronides) were

less cytotoxic than Resveratrol, they did not exhibit synergistic effects when combined

with RTIs200. However, since Resveratrol is widely available and relatively non-toxic, it has the potential of being a good candidate for additional drug development in the quest to discover affordable antiretroviral drugs. Based on these reports, two derivatives of

Resveratrol, KST 201 and KST 301 were analyzed for cellular toxicity and anti-HIV activity against clinical isolates and drug-resistant HIV in stimulated primary human cells

(PBMC) and transformed cells.

139

MATERIALS AND METHODS

Compounds

KST 201 (MW; 210) and KST 301 (MW; 226) were synthesized and obtained from the laboratory of Dr. Tsai, department of Chemistry, Kent State University, Kent,

OH. Resveratrol (C14H12O3, MW; 228.2) was purchased from Sigma. KST 201, KST 301

and Resveratrol were dissolved in 200-proof, absolute Ethanol (Sigma), filtered through a

0.22μm filter, aliquots of 1mMol stock were stored at -20°C. KST 201 and KST 301 were

protected from photo-degradation by preparing compounds in the dark and covering with aluminum foil. 200-proof Ethanol was used a solvent control in cellular toxicity and antiviral activity assays.

Marketed antiretroviral drugs

Known antiretroviral (ARV) drugs such as nucleoside reverse transcriptase inhibitor (zidovudine) and 118-D-24, an integrase inhibitor were obtained from the NIH

AIDS Research and Reference Reagent Program (ARRRP).

Cells

T-lymphoid, indicator and coreceptor expressing cell lines used in this research

were obtained from the NIH AIDS reagent research and reference program. Human T- lymphoblastoid cell lines MT4, MT2, C8166 and primary mononuclear cells, PBMC were prepared and maintained as described in Chapter 2. Indicator cells, Ghost X4/R5 140

were maintained in DMEM, 10% FBS, 100U of penicillin/mL and 100μg of

streptomycin/mL supplemented with 500ug/ml of G418, 100ug/ml hygromycin and

1ug/ml puromycin137. U87.CD4.CCR5 and U87.CD4.CXCR4 are glioma cell lines

previously described the materials and methods section of Chapter 2.

Viruses

All HIV-1 and HIV-2 isolates were obtained from the NIH AIDS reagent &

research reference program. HIV-1B-92BR003 (R5) was amplified in Ghost X4/R5 and

U87.CD4.CCR5. 50% tissue culture infective dose (TCID50) and HIV-1 coreceptor

verification of B-92BR003 was determined in Ghost X4/R5 and U87.CD4.CCR5 at 24,

48, 72 and 120 hours post infection. Other viruses: HIV-1B-HXB2, HIV-1B-92US026, HIV-

1N119 (catalog # 1392) and HIV-1NL-4.3DsRed2 were grown in MT4. HIV-1C5 and HIV-1Y-

U2EGFP (a fluorescent recombinant virus) were amplified in U87.CD4.CCR5; while HIV-

2CBL-20 and RT-5 (a multidrug reverse transcriptase resistant HIV-1 recombinant clone) were amplified in C8166. Viral culture, storage and determination of TCID50 were performed as described in Chapter 2.

Cellular toxicity

Cellular toxicity was determined by the assessment of;

1. Cell viability

Trypan blue exclusion

Cytotoxicity by Lactate dehydrogenase detection 141

2. Cellular proliferation by the indirect 3-(4,5-dimethylthiazol-2-yl)-2,5-

diphenyltetrazolium bromide (MTT) colorimetric assay method

Trypan blue exclusion method

PBMCs and MT4 cells were plated at a density of 40,000 and 30,000 cells per

well respectively and incubated with serial dilutions of KST 201, KST 301 and

Resveratrol. Cellular toxicity determined as previously described in Chapter 2.

Cytotoxicity by lactate dehydrogenase inhibition

Cell viability is determined by colorimetric of measurement of LDH released

from non-viable, damaged cells. In this reaction, LDH reduces NAD to NADH+ followed by the transfer of the H/H+ to INT forming formazan, a tetrazolium salt by Diaphorase (a catalyst). LDH detection was purchased from Roche. Briefly, 25,000 MT4 and 30,000

PBMC were incubated with various concentrations of compounds for 5 days at 37°C with

5% CO2. 100µl/well of LDH reaction kit mixture was incubated with 100µl of clarified

culture supernatant for 30 minutes. Absorbance was measured at 500nm using Victor V,

a microtitre plate reader.

Cellular proliferation by MTT colorimetric assay

25,000 MT4 and 30,000 PBMC previously treated with various concentrations of

compounds for 5 days were centrifuged at 20°C using 1500 rpm for 5 minutes. However,

12,500 Ghost X4/R5 seeded into 96-well flat-bottom plates in 100μl of medium were 142

incubated for 16 hours at 37°C with 5% CO2. MTT assay performed as described in

Chapter 2.

Antiviral assays in indicator Ghost X4/R5

Initially, the antiretroviral activity of KST 201, 301 and Resveratrol was assessed

in EGFP indicator Ghost X4/R5 cells. Briefly, 12,500 Ghost X4/R5 cells were seeded for

16 hours in 96-well flat-bottom plates. Various concentrations of compounds were

incubated with cells for 2 hours before infection with 25μl of B-92BR003 (at a multiplicity of infection 0.02). Following a 2 hour infection, unadsorbed viral inoculum was washed out three times with 1x PBS. Cells were replenished with fresh medium and appropriate concentrations of compounds and were further incubated for 48 hours. 10μl of viral culture supernatant was harvested for reverse transcriptase assay (as described below) at 24, 48, 72, 96, 120 and 144 hours post infection. Assay was terminated by discarding culture supernatant and replacing with 100 μl of 1x PBS. Antiviral activity was determined by fluorescent microscopy with a Leica DMIRB inverted upright wide- field fluorescence microscope (Heidelberg, Germany) and measuring EGFP expression using Victor V,a multiscanner spectrophotometric 96-well plate autoreader

(PerkinElmer). 50% inhibitory concentration (IC50) was calculated for each compound

using SigmaPlot software (SPSS Inc.).

143

T-lymphoid cell lines and primary mononuclear cells

IL-2 and PHA stimulated PBMC (1x105 per well) and MT4 cells (9x104 per well) in 96-well plates were incubated with serial dilutions of compounds for 16 hours (Fig.4).

HIV-1 was added at a multiplicity of infection (MOI) of 0.01IU/cell and 0.02IU/cell respectively, as previously described in Chapter 2.

HIV-1 reverse transcriptase inhibition assay

RT assay performed as previously described in Chapter 2.

Effect of Hits on HIV-1 Coreceptors, CCR5 and CXCR4

As previously described, 2,500 U87.CD4.CCR5 and 2,500 U87.CD4.CXCR4 cells were seeded in 96-well flat-bottom plates for 16 hours. Cells were further incubated for 2 hours in the presence and absence of various concentrations of compounds at 37°C in 5%CO2. An admixture of DsRed2-tagged X4 and EGFP-tagged R5 viruses, 10μl of

DsRed2 and 4μl of EGFP corresponding to a multiplicity of infection (MOI) of 0.01

IU/cell for each of the fluorescent viruses was added to each well and further incubated for 5 days. Infection was monitored with a Leica DMIRB inverted upright wide-field fluorescence microscope (Heidelberg, Germany)92.

144

RESULTS

Figure 4.1 Structure of Resveratrol

4.1 Cellular toxicity in Ghost X4/R5

KST 201, KST 301 and Resveratrol were relatively non-cytotoxic to Ghost X4/R5

following 48 and 144 hours incubation with cells. Although only three concentrations of

these compounds were analyzed, we observed that the 50% cytotoxic concentrations

(CC50) of these compounds were higher than 10μM, the maximum concentration

analyzed in this assay (Fig 4.2). These compounds were relatively non-cytotoxic to both

MT4 and PBMC (Table 4.1). By trypan blue exclusion, relative viability was higher than

50% in all wells of treated with these compounds in MT4. However in PBMC, viability

was significantly reduced in the presence of 10μM Resveratrol. C50 by cell viability could

not be calculated as only 3 dilutions of each compound was analyzed, instead of a

minimum of 4 dilution points required for calculating CC50 using the SigmaPlot software.

KST 201, KST 301 and Resveratrol were relatively non-cytotoxic to both MT4

and PBMC by the lactate dehydrogenase cytotoxicity method. The CC50 of these 145

compounds were above 50μM, the maximum concentration evaluated in this assay (Table

4.1). Cytotoxicity, determined by effect of compounds on cellular proliferation in MT4

and PBMC by the MTT method, showed the CC50 of all three compounds were above the

maximum concentration (50μM) in PBMC. However in MT4, CC50 of all compounds

ranged between 10μM and 40μM (Table 4.1).

Figure 4.2: Cellular toxicity of KST 201, KST 301 and Resveratrol determined by MTT method. Results are mean ± SD calculated from triplicate determinations.

146

Table 4.1: Antiviral activity and cellular toxicity of Resveratrol, KST 201 and KST 301. CC50 determined as the concentration of compound toxic to 50% of cell culture population. IC50 defined as the concentration inhibitory to 50% of viral reverse transcriptase, relative to the no drug, virus only control for each virus. Results are mean ± SD calculated from triplicate determinations.

4.2 HIV susceptibility to Resveratrol and its analogues

The preliminary antiviral activity of KST 201, KST 301 and Resveratrol was assessed in indicator Ghost X4/R5 (Fig 4.3). Inhibition of EGFP expression was significant in KST 201 and Resveratrol treated wells at 5μM and 10μM. KST 301 only

inhibited HIV-1 replication at 10μM. Three dilutions (1%, 2.5% and 5%) of absolute

ethanol were analyzed as solvent controls. None of these dilutions significantly inhibited

HIV-1 replication when compared to KST 201, KST 301 and Resveratrol. EGFP

expression observed by microscopy was measured 48 and 144 hours post infection. As

shown in Fig 4.4, at 48 hours post infection, the pattern of KST 201 inhibition was very

similar to that of Resveratrol as demonstrated by fluorescent microscopy. At 144 hours

post infection, none of these compounds significantly inhibited HIV-1 replication. 147

The antiviral activity of KST 201, KST 301 and Resveratrol was primarily determined against B-HXB2 and B-92US026 in MT4 and PBMC respectively. KST 201 had the lowest IC50 values; 0.64μM ± 0.08 and 5μM ± 1.198 against B-HXB2 and B-

92US026 respectively. Remarkably, the IC50 of KST 301 was very similar to that of

Resveratrol against both B-HXB2 and B-92US026. The drug susceptibility of two HIV-1 laboratory adapted viruses (B-92BR003 and C5); nevirapine resistant virus, N119; multidrug resistant HIV-1 isolate, RT5 and a HIV-2CBL-20 (Table 4.2). Resveratrol and KST

301 were relatively inactive against all the isolates analyzed. The most significant finding was that KST 201 was relatively sensitive to reverse transcriptase inhibitors resistant

HIV-1; N119 and RT5. The IC50 of KST 201 was less than 10μM against both viruses.

Also, HIV-2 was most sensitive to KST 201 with an IC50 of 2μM (Table 4.2).

148

Figure 4.3: Subjective analysis of the antiviral activity by EGFP expression in Ghost X4/R5. Increasing concentration of KST 201, KST 301 and Resveratrol were incubated with HIV-1B-92BR003 at a multiplicity of infection (MOI) of 0.01 for 48 hours post infection. Inhibition of viral replication measured as the expression of EGFP by infected cells. Various concentrations of ethanol were also analyzed, as test compounds were dissolved in Ethanol. KST 201 and Resveratrol inhibited viral replication significantly at 5µM. Pictures were taken at 10x magnitude. Picture of KST 301 at 1µM was unavailable.

149

Figure 4.4 Inhibition of HIV-1 replication measured by EGFP expression. EGFP fluorescence measured 48 and 144 hours post infection. Results presented are mean of duplicate determination.

Table 4.2 IC50 of Resveratrol, KST 201 and KST 301 against HIV-2, primary and drug resistant HIV-1 isolates. IC50 defined as the concentration inhibitory to 50% of viral reverse transcriptase, relative to the no drug, virus only control for each virus. Results are mean ± SD calculated from triplicate determinations.

150

4.3 Effect of KST 201, KST 301 and Resveratrol on HIV-1 coreceptors

Figure 4.5: Inhibition of HIV-1 coreceptors by KST 201, KST 301 and Resveratrol. Co- cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 were infected with a mixture of HIV- 1NL4.3DsRed2 (X4-using) and HIV-1YU-2EGFP (R5-using) in the presence of 10µM of each compound for 5 days. No differential inhibition of either virus was observed. Pictures were taken at 10x magnification.

The effect of KST 201, KST 301 and Resveratrol on both CCR5-using and

CXCR4-using viruses was analyzed using two HIV-1 strains tagged with fluorescent

genes.10μM of all compounds was tested in a co-culture of X4-using HIV-1NL4.3DsRed2

and R5-using HIV-1YU-2EGFP in U87.CD4.CCR5 and U87.CD4.CXCR4. As shown in

Fig 4.5, none of these compounds inhibited the replication of either or both viruses at

10μM.

151

DISCUSSION

In this section we have analyzed the antiviral activity of KST 201 and KST 301,

two derivatives of Resveratrol, a naturally occurring compound. Previous studies have

identified Resveratrol to have modest anti-HIV-1 activity and significant synergistic

inhibition of HIV-1 replication when used in combination with nucleoside HIV-1 reverse

transcriptase inhibitors. The CC50 and IC50 of Resveratrol was identified to be >30μM and >10μM in previous studies. However, in this study, the CC50 of Resveratrol ranged from 5μM to > 50μM depending on the sensitivity of the cytotoxicity assay and the type of cell used in the assay. The antiviral activity of Resveratrol was also dependent on the cell line and viral isolate used in the experiment. The most significant difference between

CC50 and IC50 of these compounds was the selectivity indices of for KST 201; 15-fold in

MT4 and 2-fold in PBMC. The selectivity indices of Resveratrol and KST 301 ranged

from 1- to 3.2-fold. Apart from the susceptibility of B-HXB2 to KST 201 in MT4, the

narrow therapeutic indices of these compounds limits the use of the compounds as lead

compounds in the development of new antiretroviral drugs. Compound cellular toxicity

was assessed by trypan blue exclusion, LDH cytotoxicity assessment and MTT assay. Of

these methods, the least consistent was the LDH cytotoxicity assessment. Cellular

toxicity was lower than observed by trypan blue exclusion and MTT method.

The effect ethanol on the antiviral activity and cytotoxicity of KST 201, KST 301

and Resveratrol were also analyzed. Since these compounds were dissolved in absolute

ethanol and the final volume of Ethanol per well ranged from 0.001μl to 10μl. One of the

aims of this project was to identify the effect of ethanol in the presence of KST 201, KST 152

301 and Resveratrol on host cells. One of the conclusions of this research is that the effect of ethanol varies with cell type, with MT4 viability and proliferation reduced in the presence of ethanol, unlike PBMC. However, it could also be inferred that the antiviral activity of these compounds was not significantly potentiated by ethanol. Since only KST

201 exerted some antiviral activity against several HIV-1 and-2 isolates. No difference was observed between the inhibition of R5-using and X4-using viruses as demonstrated with HIV-1 tagged with fluorescent genes. Also, the relatively inactivity of KST 301 and

Resveratrol against drug resistant viruses and HIV-2 limits their use in the treatment of

HAART-resistant HIV-1 infections.

CHAPTER V

DIVALENT METAL ION CHELATING SMALL MOLECULES AS NOVEL HIV INTEGRASE INHIBITORS

INTRODUCTION

HIV integrase is very attractive target for new antiretroviral compounds due to its uniqueness to the virus and its absence in its human host. There are three enzyme HIV gene products. Currently, drugs approved for patient use target two of these enzymes; reverse transcriptase and protease. Integrase is the third enzyme, thus an important antiretroviral target. The aim of this project was to determine the antiviral activity of 48 rationally designed compounds, particularly to confirm the anti-HIV integrase of these compounds in both biochemical and cell-based assays, therefore validating the protocol of synthesis of these compounds. We extensively characterized BFX 1001-BFX 1008, determined their cellular toxicity, antiviral activity and selected for resistant HIV-1 strains. We also determined the activity of these compounds against several primary and

153 154

drug-resistant HIV-1 and-2 strains. However, due to time constraints, we could not

extensively analyze the antiviral activity of several compounds in this series. Their

preliminary antiviral activity was determined by the expression of luciferase activity. The

possible target of HIV-1 inhibition was assessed by in vitro selection of resistant strains

for the BFX 1001 – BFX 1006. The effect of these 6 compounds on purified HIV-1

integrase as analyzed by Bioveris high-throughput screening and gel-based

electrophoresis in Mg2+ and Mn2+ was previously determined by our collaborators prior to the start of our study. Overall, we compared the antiretroviral activity of BFX

compounds to those of known integrase inhibitors: 118-D-24, Control A and Control B.

Cell-based assays were performed in the HIV laboratory at the Cleveland Clinic

Foundation, but in vitro HIV-1 integrase assays were performed at the laboratory of

Molecular Pharmacology at the NIH, Bethesda, MD.

155

MATERIALS AND METHODS

Compounds

Forty-eight (48) divalent metal ion chelating small molecules were designed and

synthesized by Bioflexis LLC, Cleveland, OH. Compounds were obtained in 1mM and

5mM stock concentrations dissolved in DMSO. Aliquots of 50μl were stored at -80°C.

Marketed antiretroviral compounds

Nucleoside/nucleotide and non-nucleoside reverse transcriptase inhibitors

[zidovudine (AZT); [Entry inhibitors, enfuvirtide (T-20), TAK 779 and AMD 3100]; and

Protease inhibitors [saquinavir (SQV) and nelfinavir (NFV)] were obtained from NIH

AIDS reagents and filtered before use in assays. L-870,810, an integrase inhibitor was

obtained from Merck research laboratories.

Cells

Human T-lymphoblastoid cell lines MT4, MT2 and C8166 were used because of

fast duplication times, high susceptibility to HIV infection and strong cytopathic effects

observed especially in MT-2 and C8166 cells. Peripheral blood mononuclear cells

(PBMC) used for both cytotoxicity and antiviral assays were isolated from HIV- seronegative donors using Ficoll-Hypaque and gradient centrifugation of heparin-treated venous blood. PBMC were mitogen- stimulated with 2 µg/ml of phytohemagglutinin

(PHA; Gibco BRL), in the presence of 1 ng/ml interleukin-2 (IL-2, Gibco, BRL) for 72 156

hours at 37°C prior to antiviral and cytotoxicity assays. All cells were maintained in

RPMI 1640 / 2 mM L-glutamine medium (Cellgro; Mediatech, Herndon, VA) supplemented with 10% fetal bovine serum (Cellgro), 10mM HEPES buffer (N-2- hydroxyethylpiperazine-N-2-ethanesulfonic acid; Sigma), 100U of penicillin/mL and

100μg of streptomycin/mL (Gibco). U87.CD4.CCR5 and U87.CD4.CXCR4 cells were maintained in DMEM medium, 15% FBS, 100U of penicillin/mL and 100μg of streptomycin/mL, puromycin and geneticin.

Plasmids and viruses

All HIV-1 and HIV-2 isolates were obtained from the NIH AIDS reagent & research reference program and were prepared as previously described in Chapter 2.

Antiviral activity

Antiviral activity of BFX compounds was determined as previously described in Chapter

Cellular toxicity

Cellular toxicity was determined by the assessment of:

Cell viability by trypan blue exclusion method

Cell viability was performed as described in Chapter 2.

Cellular proliferation by MTT colorimetric assay

MTT assay was performed as described in Chapter 2. 157

Effect of hits on HIV-1 coreceptors, CCR5 and CXCR4

As previously described, 2,500 U87.CD4.CCR5 and 2,500 U87.CD4.CXCR4

cells were seeded in 96-well. After 16 hours, cells were further incubated for 2 hours in

the presence and absence of various concentrations of compounds at 37°C in 5%CO2. An admixture of DsRed2-tagged X4 and EGFP-tagged R5 viruses, 10μl of DsRed2 and 4μl of EGFP corresponding to a multiplicity of infection (MOI) of 0.01 IU/cell for each of the fluorescent viruses was added to each well and further incubated for 5 days. Infection was monitored with a Leica DMIRB inverted upright wide-field fluorescence microscope

(Heidelberg, Germany)92.

In vitro HIV-1 integrase inhibition assays

The inhibitory activity of compounds on HIV-1 integrase was analyzed by;

1. Bioveris high-throughput assay to determine compound effect on HIV-1 strand

transfer reaction was performed as described in Chapter 2.

2. Electrophoresis to assess 3′-end processing and strand transfer reactions was

performed as described in Chapter 2.

PCR-based single cycle assay

MT4 cells (2.5 x 105 cells per well) were incubated with compound overnight at

37°C in 5% CO2. Cells were infected with HIV-1HXB2 at MOI of 0.01 IU/cell for 2 hours

in the presence and absence of compounds. Three washing steps with 1x PBS were

carried out and cells were re-incubated with initial concentrations of compounds at 0, 2, 158

4, 8, 12 and 24 hours. Cells were harvested 24 hours post-infection. Total genomic DNA

was extracted from lysed cells with QIAmp DNA blood kit (Qiagen). Cellular DNA was

confirmed by amplification with a pair of β-actin primers. Relative production of virus

was quantified with oligonucleotide primer pairs as previously described28. PCR products

were amplified with the following primer pairs;

- Products of proviral integration: LTR-1 (CACACAAGGCTACTTCCCTGA; 59-76)

and AU3-1; (CCCAGTACAGGCAAAAAGCAGCTGC; 432-456)

- Early reverse transcription: R-U5 forward (GGCTAACTAGGGAACCCACTG; 496-

516) and R-U5 reverse; (CTGCTAGAGATTTTCCACACTGAC; 612-635)

- Late reverse transcription: R-U5 forward (GGCTAACTAGGGAACCCACTG; 496-

516) and Gag reverse; (GCGTCGAGAGAGCTCCTCTGGT; 692-692)

- 2-LTR circles: forward (AACTAGGGAACCCACTGCTTAAG; 500→522) and reverse

(TCCACAGATCAAGGATATCTTGTC; 28-51)

In vitro selection for drug resistant variants

As previously described in Chapter 2, C8166 cells were infected with HIV-1HXB2

(MOI of 0.01) in 48-well plates. Compounds were added to infected cells starting at a

th sub-inhibitory concentration of equal to 1/128 of IC50. Cultures were maintained and

scored microscopically on HIV-1 induced cytopathic effects (CPE) by syncytia formation and reverse transcriptase (RT) activity every 4 to 6 days. RT and CPE activity were observed, cell-free culture supernatant was used to infect fresh C8166 cells in the 159

presence of equal or higher concentration of the compound. When no virus CPE and RT

activity is observed, the infected culture is maintained in the presence of the same

concentration of the compound. Compound concentration was gradually increased to 20-

60–fold of the IC50. Drug susceptibility assays using virus generated from serial passages

and wild-type parental virus were performed to determine IC50 value.

HP4149 (CATGGGTACCAGCACACAAAGG; 4150–4171) and PCRC

(CCCAAATGCCAGTCTCTTTCTCCTG; 5261-5285)

INT-F (GTACCAGCACACAAAGGAATTGGAGG; 5170-5143) and INT-R

(AGTGATGTCTATAAAACCATCCCCTAGC; 4155-4180)

160

RESULTS

5.1 Antiviral activity of BFX 1001-1008

Only BFX 1005 and BFX 1006 exerted significant antiviral activity against B-

HXB2 and B-92US06. The IC50 of these compounds are summarized below (Table 5.1).

The antiviral activity of BFX 1001, BFX 1002, BFX 1003 and BFX 1004 was observed at concentrations ≥ 10μM. No significant anti-HIV-1 activity was observed in the presence of BFX 1007 and 1008, particularly against B-92US026.

5.2 Cellular toxicity

BFX 1001 - BFX 1008 were relatively non-cytotoxic to MT4 and PBMC at

10μM. However, BFX 1005 and 1006 were highly cytotoxic to MT4 at concentrations ≥

1μM. Cellular viability was also less than 50% in PBMC in the presence of these two compounds. However, out of these eight compounds, BFX 1005 and 1006 were most toxic to MT4 cells.

161

Table 5.1: Cellular toxicity and antiviral activity of BFX 1001 – BFX 1008. CC50 calculated from relative cellular viability calculated from trypan blue exclusion assays and relative cellular proliferation determined by the MTT method in primary blood mononuclear cells (PBMC) and a T-lymphoid cell line (MT4). IC50 calculated from reverse transcriptase assay from viral culture supernatant from C8166, MT4 and PBMC. Compounds were relatively inactive against primary and laboratory adapted viruses except for BFX 1005 and BFX 1006. However, the activity of these compounds was secondary to their cellular toxicity. The selectivity indices (SI), CC50:IC50 of these compounds = 1. CC50 is the concentration toxic to 50% of cells relative to the no drug, no virus control. IC50 defined as the concentration inhibitory to 50% of viral reverse transcriptase, relative to the no drug, virus only control for each virus. Results are mean calculated from triplicate determinations.

162

5.3 Effect of BFX compounds on other HIV-1 isolates

BFX 1001 – BFX 1003 were ineffective against R5-using HIV-1 strains such as

B-93US003 and C5. However, these compounds inhibited the replication of nevirapine

resistant HIV-1 (N119) at IC50 values of 26 -39µM. The most significant finding was that

BFX 1004 was active against both R5 viruses analyzed in this experiment with IC50 values less than 2µM. As expected, BFX 1012 and BFX 1025 inhibited the replication of all HIV-1 strains assessed in this experiment. The IC50 values of the compounds are

summarized below.

Table 5.2: Drug susceptibility of two CCR5-using viruses (B-93US003 and C5) and a nevirapine resistant virus to BFX 1001 – BFX 1004. IC50 values of BFX 1001 – BFX 1004 were higher than 50µM, the maximum concentration analyzed in this study. However, BFX 1004 was highly active against both CCR5-using viruses tested in is panel. BFX 1012 and BFX 1025 were tested in this panel as known integrase inhibitors which were highly active both R5- and X4-using, primary and drug-resistant viruses. IC50 defined as the concentration inhibitory to 50% of viral reverse transcriptase, relative to the no drug, virus only control for each virus. Results are mean ± SD calculated from triplicate determinations.

163

5.4 Pre versus post viral integration inhibition

As shown in Fig 5.3, in this assay, an EGFP-tagged virus was used to divide HIV-

1 lifecycle into; pre- and post-viral integration steps as previously reported40. 10μM and

50μM BFX 1001 – BFX 1010 cells were infected with HIV-1NL4.3EGFP using 118-D-24

(an in vitro HIV-1 integrase inhibitor) and AZT as known drug controls. No significant inhibition of HIV-1 replication determined by EGFP expression was observed at 10μM.

However, only BFX 1007 inhibited HIV-1 replication at 50μM.

164

Figure 5.1: Pre vs. post viral integration inhibition. An EGFP expressing virus was used to broadly divide the lifecycle of HIV-1 into pre- and post-integration events. Pre- integration inhibitors like 118-D-24 and AZT significantly inhibited replication at 50µM. Inhibition observed in BFX 1005 and BFX 1006 was secondary to cellular toxicity.

165

5.5 Effects of compounds on HIV-1 coreceptors

Figure 5.2: Inhibition of HIV-1 coreceptors by BFX 1001-BFX 1004. Co-cultures of U87.CD4.CCR5 and U87.CD4.CXCR4 were infected with a mixture of HIV-1NL4.3DsRed2 (X4-using) and HIV-1YU-2EGFP (R5-using) in the presence of 10µM of each compound for 5 days. Known integrase inhibitors such as BFX 1012 and BFX 1025 were tested in parallel as drug controls. No differential inhibition of either virus was observed. Pictures were taken at 10x magnification.

The effect of BFX 1001 – BFX 1004 on both CCR5-using and CXCR4-using

viruses was analyzed using two HIV-1 strains tagged with fluorescent genes (Fig 5.2).

10μM of each compound was tested in a co-culture of X4-using HIV-1NL4.3DsRed2 and

R5-using HIV-1YU-2EGFP in U87.CD4.CCR5 and U87.CD4.CXCR4 using BFX 1012

and BFX 1025 (known HIV-1 integrase inhibitors) as drug controls. As shown in Fig. 7, none of the BFX 1001-1004 inhibited the replication of either or both viruses at 10μM.

166

5.6 Single cycle assays by PCR

Figure 5.3: PCR-based single cycle assays. Specific primer pairs were used to amplify the products of integration, early and late reverse transcription from the total cellular DNA isolated from 100x IC50 treated, HIV infected cells. BFX 1012, a known diketo acid inhibitor of HIV integrase increased the accumulation of 2-LTR circles; however, none of our compounds of interest significantly increased the accumulation of 2-LTR circles. BFX 1001-BFX 1004 increased the accumulation of early and late products of reverse transcription. -: no visible band: +: Faint band; ++: moderate size band and +++: wide band

A PCR-based assay was used to identify the HIV-1 lifecycle event targeted by

BFX 1001, BFX 1002, BFX 1003 and BFX 1004 using BFX 1012 (a known integrase

inhibitor) and AZT (a nucleoside reverse transcriptase inhibitor) as controls. In this assay,

PCR primer pairs were used to identify early products of reverse transcription (Early RT), late products of reverse transcription (Late RT) and products of inhibition of HIV-1 integration (2-LTR circles). BFX 1001-BFX 1004 did not inhibit HIV-1 reverse 167

transcription (Fign 5.1). Unlike AZT-treated cells, strong product bands were identified

from the DNA of infected cells treated with these compounds. 2-LTR circles were

identified from compound treated wells, however, these bands were not as consistent or as strong as products identified from BFX 1012 treated cells.

5.7 In vitro selection of resistant HIV-1 strains

Figure 5.4: Passages of HIV-1B-HXB2 in increasing concentration of BFX compounds in C8166 cells infected with HIV-1B-HXB2.

A total of 19 serial passages of B-HXB2 in increasing compound concentrations

of BFX 1001 - BFX 1006 were performed in C8166 cells (Fig 5.4). Viral replication was

monitored by HIV-1 reverse transcriptase activity and cytopathic effects. BFX 1005 and

BFX 1006 were found to be cytotoxic to C8166 cells at high , however, 118-D-24 and 168

BFX 1012 were toxic to only to B-HXB2 at high concentrations. Increased concentrations of BFX 1001-BFX 1004 did not inhibit HIV-1 replication (Fig 5.4).

Therefore, the drug susceptibility of clarified culture supernatant harvested from BFX

1001-BFX 1004 was determined (data not shown). In parallel, the drug susceptibility of

B-HXB2 was also determined (data not shown). As shown below, there was no

remarkable difference in the drug susceptibility of wild type B-HXB2 and resistant BFX

viruses to BFX 1001-BFX 1004. No inhibition was observed until 10μM for BFX 1003

and 50μM for BFX 1001, BFX 1002 and BFX 1003. We were also unable to identify no

nucleotide and/or amino acid change(s) from the sequences of integrase genes amplified

from the DNA of BFX treated infected C8166 cells during passage.

169

5.8 Restriction analysis of the DNA of acutely infected cells

Figure 5.5 Southern analysis of the effect of BFX 1001- BFX 1004 on the DNA of acutely infected cells. 100x of the IC50 of each compound was incubated with a GFP- tagged lentiviral vector. Accumulation of viral 2-LTR circles in cellular DNA indicates inhibition of integration as demonstrated by known integrase inhibitors such as D118 and BFX 1012. None of these compounds increased 2-LTR circles in infected cells. Southern analysis performed by Anna Khodyakova of the laboratory of Dr. Andre Gudkov, Department of Molecular Genetics, Cleveland Clinic Foundation.

Restriction analysis of the DNA of BFX 1001-BFX 1004 treated HeLa cells infected with an EGFP-tagged lentiviral vector showed that compared to known integrase inhibitors such as 118-D-24 and BFX 1012, none of these compounds significantly inhibit the integration reaction as demonstrated by the reduction in the accumulation of 2- 170

LTR circles (Fig 5.5). In addition, there is an obvious reduction in linear 3′-LTR and 5′-

LTR products in cells treated with BFX 1001 – BFX 1004. In general, the profiles of

BFX 1001, BFX 1002, BFX 1003 and BFX 1004 are very similar to the profiles of novel reverse transcriptase inhibitors (CBL 21 and CBL 26) previously described in Chapter 2 as novel HIV-1 reverse transcriptase inhibitors.

5.9 Other BFX compounds

Other compounds were analyzed by the inhibition of luciferase expression by infecting

TZM-bl cells with HIV-1 expressing the luciferase gene. The antiviral activity of 10μM of BFX 1009, 1010, 1012, 1013, 1014, 1016, 1018, 1023, 1024, 1025, 1026, 1027, 1028 and 1029 was assessed by luciferase chemiluminescence from B-HXB2 infected TZM-bl

(Fig 5.6a). Only the drug controls, BFX 1012 and BFX 1025 inhibited less than 50% of the luminescence of the no drug, virus infected wells. Therefore, none of these compounds were suitable for further characterization. Also, the antiviral activity of a batch of compounds consisting of some of the compounds previously analyzed at a single concentration (10µM) was repeated by luciferase chemiluminescence in the presence of various concentration of each compound. These compounds were BFX 1012, BFX 1025,

BFX 1026, BFX 1028, BFX 1030, BFX 1031, BFX 1033, BFX 1040, BFX 1041, BFX

1042 and 1043 (Fig 5.6b). Again, only the drug controls; BFX 1012 and BFX 1025 significantly inhibited HIV-1 replication. 171

a. 60000

50000

40000

30000 Series1

20000

10000

Chemiluminescence Chemiluminescence 0

9 3 4 6 4 5 6 7 8 9 10 12 1 1 1 18 23 2 2 2 2 2 2 e itiv Pos

Figures 5.6a and b: Inhibition of HIV-1 replication by BFX compounds. Several BFX compounds were analyzed in this study by measuring luciferase chemiluminescence following the infection of U87.CD4.CCR5 cells for 48 hours. None of these compounds significantly inhibited viral replication in infected cells.

172

5.10 Inhibition of HIV-1 integrase

Select BFX compounds were analyzed by high-throughput assay and gel-

electrophoresis in Mg2+ and Mn2+. The Bioveris high-throughput assay was used to

determine the effect of compounds on the strand transfer reactions of HIV-1 integration.

While, both the strand transfer and 3’-end processing reactions were analyzed by the gel- based assays.

High-throughput assay (Mg2+)

As expected, BFX 1012, BFX 1025 and BFX 1028 had significant anti-HIV-1 integrase activity, particularly inhibiting the strand transfer reaction of HIV-1 integration.

However, of the other compounds analyzed, the most potent compound was BFX 1023 with an IC50 of 26μM (Fig 5.8). The IC50 values of the compounds are summarized

below; BFX 1012 was the most potent inhibitor of the strand transfer reaction of HIV-1 integration with an IC50 of 2.9nM. BFX 1025 and BFX 1028 were similarly potent (Table

5.2).

173

Figure 5.7: Inhibition of HIV-1 strand transfer reaction of known diketo acid derivatives BFX 1012, BFX 1025 and BFX 1028 determined by the high-throughput method. Increasing drug concentrations were incubated with streptavidin-labeled donor DNA and biotinylated target DNA for 1 hour in the presence of purified HIV-1 integrase.

Table 5.3: High-throughput analysis of IC50 of known diketo acid (DKA) derivatives determined in the presence of Mg2+. IC50 defined as the concentration of compound that extinguished 50% of the streptavidin-biotin signal. Results are mean ± SD from multiple determinations (n).

174

DISCUSSION

HIV-1 integrase catalyzes the introduction of viral DNA into host chromosome

and therefore begins the existence of viral reservoirs of kinetically stable, replication

competent proviral DNA sanctuaries that persists despite treatment21,171. These reservoirs

contribute to the presence of a large genetically diverse population of wild-type and drug-

resistant HIV-1 variants in infected individuals62. They are very difficult to eradicate,

making treatment extremely difficult and cure of HIV-1 infection out of reach. Thus,

HIV-1 integrase inhibitors would be critical in the management of HIV-1 infection.

Inhibition of HIV-1 viral DNA integration is assessed by the following criteria; i) inhibition of viral replication within 4-24 hours post infection, ii) inhibition in the presence of Mg2+ or Mn2+, iii) reduction of the overall product of integration and iv)

accumulation of 2-LTR circles. In our study, PCR amplification of the products of

integration following single cycle assays to determine the inhibition of integration within

4-6 hours of infection was largely unsuccessful. The results observed were inconsistent

and unreproducible. Inhibition of HIV-1 integrase in the presence of Mg2+ and Mn2+ was the most useful method for the identification of new HIV-1 integrase inhibitors, with the high-throughput screening method being the most sensitive in our hands. However, we do not have regular access to this machine (results reported in this study were generated during a two-week training at the laboratory of Dr. Yves Pommier, laboratory of

Molecular Pharmacology, National Institutes of Health, Bethesda, MD). Therefore, to 175

readily assess the inhibition of HIV-1 integration, accumulation of 2-LTR circles evaluated by PCR proved to be the most useful method for this purpose.

LTR circles are found in addition to linear DNA in HIV infected cells. Two forms of circular DNA have been described in infected cells, 1- and 2-LTR circles. These

circular forms of DNA are not substrates for the integration reaction. 1-LTR circles are

generated during reverse transcription or by ligation of the LTR ends of the 2-LTR

circles190. 2-LTR circles are intermediate products of the inhibition of HIV-1 integration and overall inhibition of the replication lifecycle152. Generation of 2-LTR circles occurs

after the transfer of the pre-integration complex (PIC) into the nucleus from the

cytoplasm. 2-LTR circles are formed by the ligation of the ends of the viral DNA by host

cell DNA end-joining apparatus which are non-homologous to HIV-1 integrase26. In the presence of an integrase inhibitor, the number of 2-LTR circles accumulates significantly but more slowly than unintegrated linear viral DNA. Accumulation of 2-LTR circles reaches the maximal level after 24 hours post infection. Accumulated 2-LTR circles can be quantified using specific oligonucleotide sequences designed to PCR amplify DNA across junctions of circular DNA26.

In this section, we have used all these four methods to identify potential HIV-1

integrase inhibitors. Although we were not able to identify potent, new HIV-1 integrase

inhibitors in this project, we have been able to validate the protocol of compound

synthesis by correctly identifying and characterizing known integrase inhibitors, such as

the diketo acid derivatives (BFX 1012, BFX 1025 and BFX 1028) using methods

mentioned above. SUMMARY AND PERSPECTIVES

It has been estimated that there are less than 500 known drug targets currently

used in therapy. Forty-five percent of these targets are receptors, 28% are enzymes, 11%

are hormones and factors55. In HIV/AIDS therapy, two of the FDA-approved drug classes

target HIV enzymes (reverse transcriptase and protease), while the third class targets an

envelope fusion protein (gp41). NRTIs were originally synthesized as a cancer cell

poison84, NNRTIs were synthesized based on target modeling and PIs were discovered by

target driven high-throughput screening and rational drug design50,172. Fusion inhibitors

were discovered by target driven, rational drug designing following a database search for

compounds that dock in the hydrophobic cavity formed in gp41204,205. Currently there is

no cure for HIV/AIDS, but combination therapy is used to manage HIV infection.

Combination therapy is also known as highly active antiretroviral therapy (HAART).

HAART has been credited with improving overall patient quality of life. However; each drug class has been associated with various degrees of drug resistance and troubling reports of multi-class drug-resistant HIV-1 isolates identified from HAART experienced patients51,121. Therefore, there is still an urgent need to identify more potent compounds

and drug classes. New classes of antiretroviral drugs such as antagonists of HIV-1

coreceptors, nucleotide competing reverse transcriptase, integrase and virion maturation

176 177

inhibitors are currently at various stages on drug development. The overall goals of the

projects discussed in this dissertation were to identify new antiretroviral compounds and

also to design efficient drug screening protocols for characterizing the mechanism(s) of

antiretroviral action of these compounds.In this dissertation, the two methods of drug discovery were utilized used to identify new antiretroviral compounds. These were the diversity- and target-driven discovery methods. Both methods are described in the

General Introduction section (Chapter 2). In Chapters 3 and 4, cell-based assays were

used to screen small molecule drug libraries in the diversity-driven drug discovery

method. Seven new reverse transcriptase inhibitors, one CXCR4 coreceptor antagonist

and a compound of yet to be determined mechanism of action were identified and

characterized. In Chapters 4 and 5, target driven drug discovery method was used to

design two analogues of Resveratrol and potential inhibitors of HIV-1 integrase. We were

unable to show the structures of these compounds in this dissertation, due to patent

application concerns; however, we hope to include these structures in the publications

listed in the preface.

Using the diversity method, a total of 74,000 compounds were analyzed in cell-

based bioassays. This method was highly efficient, as we were able to simultaneously

assess cellular toxicity and antiviral activity of compounds using the bioassays. In

contrast, in the target-driven method, each newly designed potential HIV-1 integrase

inhibitor was repeatedly analyzed in different assays. This process was labor intensive, expensive and time consuming as the antiviral activity of each new compound was correlated with its cellular toxicity in separate assays. Another advantage of the diversity- 178

based drug discovery method is the broad range of the mechanism(s) of inhibition of compounds identified using bioassays that assess a broad range of HIV-1 targets. These compounds potentially target HIV-1 reverse transcriptase and coreceptors. The therapeutic value and relevance of each target was evaluated using specifically designed biology-based assays to determine the effect of these hits on the host cell. Target range was extremely limited for rationally designed metal ion chelators of HIV-1 integrase, as we were unable to identify novel and highly active inhibitors from the 48 compounds analyzed in chapter 5. However, a significant advantage is that we were able to characterize known integrase inhibitors using our protocols and assays. Therefore, as these controls were synthesized using the same protocol as the 48 compounds analyzed, we have been able to validate the process of synthesis of these rationally designed metal ion chelators of HIV-1 integrase.

A major disadvantage of the diversity-driven method is the large of number of potential inhibitors (hits) identified from each drug library screening. 34 initial hits were identified from the high-throughput lentiviral screening in Chapter 3, while 213 compounds were identified following the cell-based, fluorescent method described in

Chapter 4. Another common disadvantage associated is that hits are not always suitable for further development into candidate drugs. However, during the course of our study, three additional compounds were identified from the lead optimization of CBL 4.0. The structure of these compounds is similar to the structure of indolopyridone-1 (INDOPY-1), a first in class nucleotide competing RT inhibitor93. 179

During the course of this study, we have been able to achieve the goals of a successful small library drug screening project. These goals were to develop credible, robust and reproducible protocols for the screening of a large number of structurally diversed compounds, identify hits that could be optimized into leads, determine the efficacy, potency and toxicity of these compounds. Previous studies have described a

98 successful hit to have IC50 ≤ 10μM . In this project, we were identify several, new compounds with IC50 values less than 1µM. We have also achieved hit rates comparable

to 0.1% (determined by previous publications)98. However, we were unable to:

1. Validate the HIV-1 target of inhibition of CBL 26, as an interesting compound that

could be targeting multiple processes in HIV-1 lifecycle.

2. Extensively characterize the mechanism of action and specificity of the 3 new

compounds (Hit 2.0, Hit 3.0 and Hit 10.0) identified from the small molecule library

screening using fluorescent viruses in Chapter 4.

3. Determine the marketability of these compounds through different stages of clinical

studies and their potential as clinical antiretroviral agents.

Overall, we have been able to answer the research questions presented in the

specific aims and objectives of these projects at the beginning of this graduate study by

designing new protocols and enhancing existing methods to identify and characterize

novel antiretroviral compounds.

REFERENCES

1. 1981. Kaposi's sarcoma and Pneumocystis pneumonia among homosexual men-- New York City and California. MMWR Morb. Mortal Wkly Rep. 30:305-308.

2. 1981. Pneumocystis pneumonia--Los Angeles. MMWR Morb. Mortal Wkly Rep. 30:250-252.

3. Adrian, M., P. Jeandet, J. Veneau, L. A. Weston, and R. Bessis. 1997. Biological activity of Resveratrol, a stilbenic compound from grapevines, against Botrytis cinerea, the causal agent for gray mold. Journal of Chemical Ecology 23:1689-1702.

4. Aiken, C. 2006. Viral and cellular factors that regulate HIV-1 uncoating. Curr Opin HIV/AIDS 1:194-199.

5. Allaway, G. P., K. L. Davis-Bruno, G. A. Beaudry, E. B. Garcia, E. L. Wong, A. M. Ryder, K. W. Hasel, M. C. Gauduin, R. A. Koup, J. S. McDougal, and . 1995. Expression and characterization of CD4-IgG2, a novel heterotetramer that neutralizes primary HIV type 1 isolates. AIDS Res Hum Retroviruses. 11:533- 539.

6. Allaway, G. P., F. Li, R. Goila-Gaur, K. Salzwedel, N. R. Kilgore, M. Reddick, C. Matallana, A. Castillo, D. Zoumplis, D. E. Martin, J. M. Orenstein, G. P. Allaway, E. O. Freed, and C. T. Wild. - Development of Bevirimat (PA-457): first-in-class HIV maturation inhibitor- PA-457: a potent HIV inhibitor that disrupts core condensation by targeting a late step in Gag processing.-Retrovirology.

7. Amara, A., S. L. Gall, O. Schwartz, J. Salamero, M. Montes, P. Loetscher, M. Baggiolini, J. L. Virelizier, and F. Arenzana-Seisdedos. 1997. HIV coreceptor downregulation as antiviral principle: SDF-1alpha-dependent internalization of the chemokine receptor CXCR4 contributes to inhibition of HIV replication. J Exp. Med. 186:139-146.

8. Andries, K., H. Azijn, T. Thielemans, D. Ludovici, M. Kukla, J. Heeres, P. Janssen, B. De Corte, J. Vingerhoets, R. Pauwels, and M. P. De Bethune.

180 181

2004. TMC125, a novel next-generation nonnucleoside reverse transcriptase inhibitor active against nonnucleoside reverse transcriptase inhibitor-resistant human immunodeficiency virus type 1. Antimicrob Agents Chemother. 48:4680- 4686.

9. Antinori, A., M. Zaccarelli, A. Cingolani, F. Forbici, M. G. Rizzo, M. P. Trotta, S. Di Giambenedetto, P. Narciso, A. Ammassari, E. Girardi, A. De Luca, and C. F. Perno. 2002. Cross-resistance among nonnucleoside reverse transcriptase inhibitors limits recycling efavirenz after nevirapine failure. AIDS Res Hum Retroviruses. 18:835-838.

10. Arroyo, M. A., M. Hoelscher, W. Sateren, E. Samky, L. Maboko, O. Hoffmann, G. Kijak, M. Robb, D. L. Birx, and F. E. McCutchan. 2005. HIV-1 diversity and prevalence differ between urban and rural areas in the Mbeya region of Tanzania. AIDS. 19:1517-1524.

11. Arthur, L. O., J. W. Bess, Jr., R. C. Sowder, R. E. Benveniste, D. L. Mann, J. C. Chermann, and L. E. Henderson. 1992. Cellular proteins bound to immunodeficiency viruses: implications for pathogenesis and vaccines. Science. 258:1935-1938.

12. Arya, S. K. and R. C. Gallo. 1986. Three novel genes of human T-lymphotropic virus type III: immune reactivity of their products with sera from acquired immune deficiency syndrome patients. Proc. Natl. Acad. Sci. U. S. A. 83:2209- 2213.

13. Bacheler, L., S. Jeffrey, G. Hanna, R. D'Aquila, L. Wallace, K. Logue, B. Cordova, K. Hertogs, B. Larder, R. Buckery, D. Baker, K. Gallagher, H. Scarnati, R. Tritch, and C. Rizzo. 2001. Genotypic correlates of phenotypic resistance to efavirenz in virus isolates from patients failing nonnucleoside reverse transcriptase inhibitor therapy. J Virol. 75:4999-5008.

14. Bajorath, J. 2002. Integration of virtual and high-throughput screening. Nat Rev Drug Discov. 1:882-894.

15. Balzarini, J., P. Herdewijn, and E. De Clercq. 1989. Differential patterns of intracellular metabolism of 2',3'-didehydro-2',3'-dideoxythymidine and 3'-azido- 2',3'-dideoxythymidine, two potent anti-human immunodeficiency virus compounds. J Biol Chem. 264:6127-6133.

16. Barre-Sinoussi, F., J. C. Chermann, F. Rey, M. T. Nugeyre, S. Chamaret, J. Gruest, C. Dauguet, C. Axler-Blin, F. Vezinet-Brun, C. Rouzioux, W. Rozenbaum, and L. Montagnier. 1983. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science. 20;220:868-871. 182

17. Barre-Sinoussi, F. 2003. The early years of HIV research: integrating clinical and basic research. Nat Med 9:844-846.

18. Bertelli, A. A., F. Ferrara, G. Diana, A. Fulgenzi, M. Corsi, W. Ponti, M. E. Ferrero, and A. Bertelli. 1999. Resveratrol, a natural stilbene in grapes and wine, enhances intraphagocytosis in human promonocytes: a co-factor in antiinflammatory and anticancer chemopreventive activity. Int J Tissue React. 21:93-104.

19. Bertelli, A. A., L. Giovannini, D. Giannessi, M. Migliori, W. Bernini, M. Fregoni, and A. Bertelli. 1995. Antiplatelet activity of synthetic and natural resveratrol in red wine. Int J Tissue React. 17:1-3.

20. Bjorndal, A., H. Deng, M. Jansson, J. R. Fiore, C. Colognesi, A. Karlsson, J. Albert, G. Scarlatti, D. R. Littman, and E. M. Fenyo. 1997. Coreceptor usage of primary human immunodeficiency virus type 1 isolates varies according to biological phenotype. J Virol. 71:7478-7487.

21. Blankson, J. N., D. Persaud, and R. F. Siliciano. 2002. The challenge of viral reservoirs in HIV-1 infection. Annu Rev Med. 53:557-93.:557-593.

22. Boretto, J., S. Longhi, J. M. Navarro, B. Selmi, J. Sire, and B. Canard. 2001. An integrated system to study multiply substituted human immunodeficiency virus type 1 reverse transcriptase. Anal. Biochem. 292:139-147.

23. Braaten, D. and J. Luban. 2001. Cyclophilin A regulates HIV-1 infectivity, as demonstrated by gene targeting in human T cells. EMBO J. 20:1300-1309.

24. Bukrinskaya, A. G. 2004. HIV-1 assembly and maturation. Arch. Virol. 149:1067-1082.

25. Bushman, F. D., T. Fujiwara, and R. Craigie. 1990. Retroviral DNA integration directed by HIV integration protein in vitro. Science. 249:1555-1558.

26. Butler, S. L., E. P. Johnson, and F. D. Bushman. - Human immunodeficiency virus cDNA metabolism: notable stability of two-long terminal repeat circles.-47.

27. Chan, D. C., D. Fass, J. M. Berger, and P. S. Kim. 1997. Core structure of gp41 from the HIV envelope glycoprotein. Cell. 89:263-273.

28. Chang, T. L., J. Vargas, Jr., A. DelPortillo, and M. E. Klotman. 2005. Dual role of alpha-defensin-1 in anti-HIV-1 innate immunity. J. Clin. Invest. 115:765- 773. 183

29. Charneau, P., A. M. Borman, C. Quillent, D. Guetard, S. Chamaret, J. Cohen, G. Remy, L. Montagnier, and F. Clavel. 1994. Isolation and envelope sequence of a highly divergent HIV-1 isolate: definition of a new HIV-1 group. Virology. 205:247-253.

30. Chertova, E., J. J. Bess, Jr., B. J. Crise, R. C. Sowder II, T. M. Schaden, J. M. Hilburn, J. A. Hoxie, R. E. Benveniste, J. D. Lifson, L. E. Henderson, and L. O. Arthur. 2002. Envelope glycoprotein incorporation, not shedding of surface envelope glycoprotein (gp120/SU), Is the primary determinant of SU content of purified human immunodeficiency virus type 1 and simian immunodeficiency virus. J Virol. 76:5315-5325.

31. Clavel, F., F. Brun-Vezinet, D. Guetard, S. Chamaret, A. Laurent, C. Rouzioux, M. Rey, C. Katlama, F. Rey, J. L. Champelinaud, and . 1986. [LAV type II: a second retrovirus associated with AIDS in West Africa]. C R Acad Sci III. 302:485-488.

32. Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo, and P. Lusso. 1995. Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-suppressive factors produced by CD8+ T cells. Science. 270:1811- 1815.

33. Coffin, J., A. Haase, J. A. Levy, L. Montagnier, S. Oroszlan, N. Teich, H. Temin, K. Toyoshima, H. Varmus, P. Vogt, and . 1986. What to call the AIDS virus? Nature. 321:10.

34. Coffin, J., S. H. Hughes, and H. E. Varmus. 1997. Retroviruses. Cold Spring Harbor Laboratory Press.

35. Congreve, M., R. Carr, C. Murray, and H. Jhoti. 2003. A 'rule of three' for fragment-based lead discovery? Drug Discov Today. 8:876-877.

36. Connor, R. I., K. E. Sheridan, D. Ceradini, S. Choe, and N. R. Landau. 1997. Change in coreceptor use coreceptor use correlates with disease progression in HIV-1--infected individuals. J Exp. Med. 185:621-628.

37. Cooper, D., Hicks, C., Cahn, P., and et, al. 24-Week RESIST Study Analyses: the Efficacy of Tipranavir/Ritonavir Is Superior to Lopinavir/Ritonavir, and the TPV/r Treatment Response is Enhanced by Inclusion of Genotypically Active Antiretrovirals in the Optimized Background Regimen. 12th Conference on Retroviruses and Opportunistic Infections Poster 560. 2005.

38. Craig, J. C., I. B. Duncan, D. Hockley, C. Grief, N. A. Roberts, and J. S. Mills. 1991. Antiviral properties of Ro 31-8959, an inhibitor of human immunodeficiency virus (HIV) proteinase. Antiviral Res. 16:295-305. 184

39. Crump, M. P., J. H. Gong, P. Loetscher, K. Rajarathnam, A. Amara, F. Arenzana-Seisdedos, J. L. Virelizier, M. Baggiolini, B. D. Sykes, and I. Clark-Lewis. 1997. Solution structure and basis for functional activity of stromal cell-derived factor-1; dissociation of CXCR4 activation from binding and inhibition of HIV-1. EMBO J. 16:6996-7007.

40. Daelemans, D., C. Pannecouque, G. N. Pavlakis, O. Tabarrini, and E. De Clercq. 2005. A novel and efficient approach to discriminate between pre- and post-transcription HIV inhibitors. Mol Pharmacol. 67:1574-1580.

41. Dalgleish, A. G., P. C. Beverley, P. R. Clapham, D. H. Crawford, M. F. Greaves, and R. A. Weiss. 1984. The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus. Nature. 312:763-767.

42. Darlix, J. L., C. Gabus, M. T. Nugeyre, F. Clavel, and F. Barre-Sinoussi. 1990. Cis elements and trans-acting factors involved in the RNA dimerization of the human immunodeficiency virus HIV-1. J Mol Biol. 216:689-699.

43. Das, K., A. D. Clark, Jr., P. J. Lewi, J. Heeres, M. R. De Jonge, L. M. Koymans, H. M. Vinkers, F. Daeyaert, D. W. Ludovici, M. J. Kukla, B. De Corte, R. W. Kavash, C. Y. Ho, H. Ye, M. A. Lichtenstein, K. Andries, R. Pauwels, M. P. De Bethune, P. L. Boyer, P. Clark, S. H. Hughes, P. A. Janssen, and E. Arnold. 2004. Roles of conformational and positional adaptability in structure-based design of TMC125-R165335 (etravirine) and related non-nucleoside reverse transcriptase inhibitors that are highly potent and effective against wild-type and drug-resistant HIV-1 variants. J Med Chem. 47:2550-2560.

44. De Bethune, M. P., K. Andries, H. Azijn, J. Guillmont, J. Heeres, J. Vingerhoets, P. Lewl, E. Lee, P. Timmerman, and P. Williams. 2005. TMC278, a new potent NNRTI, with an increased barrier to resistance and favourable pharmacokinetic profile. 12th Conference on Retroviruses and Opportunistic Infections Poster 556.

45. De Clercq, E. 2001. Antiretroviral therapy. ASM Press.

46. De Clercq, E. 2003. Potential of acyclic nucleoside phosphonates in the treatment of DNA virus and retrovirus infections. Expert Rev Anti Infect Ther. 1:21-43.

47. De Clercq, E. 2005. New approaches toward anti-HIV chemotherapy. J Med Chem. 48:1297-1313.

48. De Leys, R., B. Vanderborght, M. Vanden Haesevelde, L. Heyndrickx, A. van Geel, C. Wauters, R. Bernaerts, E. Saman, P. Nijs, B. Willems, and . 1990. 185

Isolation and partial characterization of an unusual human immunodeficiency retrovirus from two persons of west-central African origin. J Virol. 64:1207-1216.

49. De Meyer, S., H. Azijn, D. Surleraux, D. Jochmans, A. Tahri, R. Pauwels, P. Wigerinck, and M. P. De Bethune. 2005. TMC114, a novel human immunodeficiency virus type 1 protease inhibitor active against protease inhibitor-resistant viruses, including a broad range of clinical isolates. Antimicrob Agents Chemother. 49:2314-2321.

50. Debouck, C. 1992. The HIV-1 protease as a therapeutic target for AIDS. AIDS Res Hum Retroviruses. 8:153-164.

51. Deeks, S. G. 2003. Treatment of antiretroviral-drug-resistant HIV-1 infection. Lancet. 362:2002-2011.

52. Dixon, S. L. and H. O. Villar. 1998. Bioactive diversity and screening library selection via affinity fingerprinting. J Chem Inf. Comput. Sci. 38:1192-1203.

53. Dorrie, J., H. Gerauer, Y. Wachter, and S. J. Zunino. 2001. Resveratrol induces extensive apoptosis by depolarizing mitochondrial membranes and activating caspase-9 in acute lymphoblastic leukemia cells. Cancer Res. 61:4731- 4739.

54. Drach, J. C. and C. Shipman, Jr. 1977. The selective inhibition of viral DNA synthesis by chemotherapeutic agents: an indicator of clinical usefulness? Ann N Y. Acad Sci. 284:396-409.:396-409.

55. Drews, J. 2000. Drug discovery: a historical perspective. Science. 287:1960- 1964.

56. Dueweke, T. J., T. Pushkarskaya, S. M. Poppe, S. M. Swaney, J. Q. Zhao, I. S. Chen, M. Stevenson, and W. G. Tarpley. 1993. A mutation in reverse transcriptase of bis(heteroaryl)piperazine-resistant human immunodeficiency virus type 1 that confers increased sensitivity to other nonnucleoside inhibitors. Proc Natl Acad Sci U S A. 90:4713-4717.

57. Dupnik, K. M., M. J. Gonzales, and R. W. Shafer. 2001. Most multidrug- resistant HIV-1 reverse transcriptase clones in plasma encode functional reverse transciptase enzymes. Antiviral Therapy 6:42.

58. Earl, P. L., R. W. Doms, and B. Moss. 1990. Oligomeric structure of the human immunodeficiency virus type 1 envelope glycoprotein. Proc Natl Acad Sci U S A. 87:648-652. 186

59. Erlanson, D. A., R. S. McDowell, and T. O'Brien. 2004. Fragment-based drug discovery. J Med Chem. 47:3463-3482.

60. Feng, S. and E. C. Holland. 1988. HIV-1 tat trans-activation requires the loop sequence within tar. Nature. 334:165-167.

61. Feng, Y., C. C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272:872-877.

62. Finzi, D., M. Hermankova, T. Pierson, L. M. Carruth, C. Buck, R. E. Chaisson, T. C. Quinn, K. Chadwick, J. Margolick, R. Brookmeyer, J. Gallant, M. Markowitz, D. D. Ho, D. D. Richman, and R. F. Siliciano. 1997. Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy. Science. 278:1295-1300.

63. Fischer, H. E. and J. M. Reuben. 1993. Human Immunodeficiency Virus Type 2: Implications for Blood Donors. Current Issues in Transfusion Medicine 2.

64. Fischer, U., J. Huber, W. C. Boelens, I. W. Mattaj, and R. Luhrmann. 1995. The HIV-1 Rev activation domain is a nuclear export signal that accesses an export pathway used by specific cellular RNAs. Cell. 82:475-483.

65. Flint, S. J., L. W. Enquist, L. W. Enquist, and A. M. Skalka. 2003. Principles of Virology: Molecular Biology, Pathogenesis, and Control of Animal Viruses, 2nd Edition. ASM Press.

66. Follenzi, A., L. E. Ailles, S. Bakovic, M. Geuna, and L. Naldini. 2000. Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV-1 pol sequences. Nat Genet. 25:217-222.

67. Food and Drug Administation. http://www.fda.gov/oashi/aids/virals.html.

68. Franchini, G., C. Gurgo, H. G. Guo, R. C. Gallo, E. Collalti, K. A. Fargnoli, L. F. Hall, F. Wong-Staal, and M. S. Reitz, Jr. 1987. Sequence of simian immunodeficiency virus and its relationship to the human immunodeficiency viruses. Nature. 328:539-543.

69. Freshney, R. I. Culture of animal cells: A manual of basic techniques. Wiley-Liss 3rd Edition. 1994.

70. Fujiwara, T., A. Sato, M. el Farrash, S. Miki, K. Abe, Y. Isaka, M. Kodama, Y. Wu, L. B. Chen, H. Harada, H. Sugimoto, M. Hatanaka, and Y. Hinuma. 1998. S-1153 inhibits replication of known drug-resistant strains of human immunodeficiency virus type 1. Antimicrob Agents Chemother. 42:1340-1345. 187

71. Goff, S., P. Traktman, and D. Baltimore. 1981. Isolation and properties of Moloney murine leukemia virus mutants: use of a rapid assay for release of virion reverse transcriptase 231. J Virol. 38:239-248.

72. Gottlieb, M. S., R. Schroff, H. M. Schanker, J. D. Weisman, P. T. Fan, R. A. Wolf, and A. Saxon. 1981. Pneumocystis carinii pneumonia and mucosal candidiasis in previously healthy homosexual men: evidence of a new acquired cellular immunodeficiency. N Engl J Med. 305:1425-1431.

73. Grinsztejn, B., Arasteh, K., Clotet, B., and et, al. TMC114/ritonavir is well tolerated in 3-class-experienced patients: week 24 primary analysis of POWER 1 (TMC114-C213). 3rd International AIDS Society Conference on HIV Pathogenesis and Treatment Program and abstracts of the 3rd International AIDS Society Conference on HIV Pathogenesis and Treatment. Rio de Janeiro. Abstract WePeLB6.2C01. 2005.

74. Grossman, Z., V. Istomin, D. Averbuch, M. Lorber, K. Risenberg, I. Levi, M. Chowers, M. Burke, Y. N. Bar, and J. M. Schapiro. 2004. Genetic variation at NNRTI resistance-associated positions in patients infected with HIV-1 subtype C. AIDS. 18:909-915.

75. Gulick, R. M., A. Meibohm, D. Havlir, J. J. Eron, A. Mosley, J. A. Chodakewitz, R. Isaacs, C. Gonzalez, D. McMahon, D. D. Richman, M. Robertson, and J. W. Mellors. 2003. Six-year follow-up of HIV-1-infected adults in a clinical trial of antiretroviral therapy with indinavir, zidovudine, and lamivudine. AIDS. 17:2345-2349.

76. Gulick, R. M., J. W. Mellors, D. Havlir, J. J. Eron, C. Gonzalez, D. McMahon, D. D. Richman, F. T. Valentine, L. Jonas, A. Meibohm, E. A. Emini, and J. A. Chodakewitz. 1997. Treatment with indinavir, zidovudine, and lamivudine in adults with human immunodeficiency virus infection and prior antiretroviral therapy. N Engl J Med. 337:734-739.

77. Hain, R., H. J. Reif, E. Krause, R. Langebartels, H. Kindl, B. Vornam, W. Wiese, E. Schmelzer, P. H. Schreier, R. H. Stocker, and . 1993. Disease resistance results from foreign phytoalexin expression in a novel plant. Nature. 361:153-156.

78. Hammer, S. M., K. E. Squires, M. D. Hughes, J. M. Grimes, L. M. Demeter, J. S. Currier, J. J. Eron, Jr., J. E. Feinberg, H. H. Balfour, Jr., L. R. Deyton, J. A. Chodakewitz, and M. A. Fischl. 1997. A controlled trial of two nucleoside analogues plus indinavir in persons with human immunodeficiency virus infection 188

and CD4 cell counts of 200 per cubic millimeter or less. AIDS Clinical Trials Group 320 Study Team. N Engl J Med. 337:725-733.

79. Hart, G. J., D. C. Orr, C. R. Penn, H. T. Figueiredo, N. M. Gray, R. E. Boehme, and J. M. Cameron. 1992. Effects of (-)-2'-deoxy-3'-thiacytidine (3TC) 5'-triphosphate on human immunodeficiency virus reverse transcriptase and mammalian DNA polymerases alpha, beta, and gamma. Antimicrob Agents Chemother. 36:1688-1694.

80. Heredia, A., C. Davis, and R. Redfield. 2000. Synergistic inhibition of HIV-1 in activated and resting peripheral blood mononuclear cells, monocyte-derived macrophages, and selected drug-resistant isolates with nucleoside analogues combined with a natural product, resveratrol. J Acquir. Immune. Defic. Syndr. 25:246-255.

81. Hirsch, V. M., R. A. Olmsted, M. Murphey-Corb, R. H. Purcell, and P. R. Johnson. 1989. An African primate lentivirus (SIVsm) closely related to HIV-2. Nature. 339:389-392.

82. Hitti, J., L. M. Frenkel, A. M. Stek, S. A. Nachman, D. Baker, A. Gonzalez- Garcia, A. Provisor, E. M. Thorpe, M. E. Paul, M. Foca, J. Gandia, S. Huang, L. J. Wei, L. M. Stevens, D. H. Watts, and J. McNamara. 2004. Maternal toxicity with continuous nevirapine in pregnancy: results from PACTG 1022. J Acquir. Immune. Defic. Syndr. 36:772-776.

83. Holtgrave, D. R. 2005. Causes of the decline in AIDS deaths, United States, 1995-2002: prevention, treatment or both? Int J STD AIDS. 16:777-781.

84. Horwitz, J. P. 1989. Design of some nucleic acid antimetabolites: expectations and reality. Invest New Drugs. 7:51-57.

85. Hsiou, Y., J. Ding, K. Das, A. D. Clark, Jr., S. H. Hughes, and E. Arnold. 1996. Structure of unliganded HIV-1 reverse transcriptase at 2.7 A resolution: implications of conformational changes for polymerization and inhibition mechanisms. Structure. 4:853-860.

86. Isel, C., C. Ehresmann, G. Keith, B. Ehresmann, and R. Marquet. 1995. Initiation of reverse transcription of HIV-1: secondary structure of the HIV-1 RNA/tRNA(3Lys) (template/primer). J Mol Biol. 247:236-250.

87. Iversen, A. K., R. W. Shafer, K. Wehrly, M. A. Winters, J. I. Mullins, B. Chesebro, and T. C. Merigan. 1996. Multidrug-resistant human immunodeficiency virus type 1 strains resulting from combination antiretroviral therapy. J Virol. 70:1086-1090. 189

88. Jacobo-Molina, A., J. Ding, R. G. Nanni, A. D. Clark, Jr., X. Lu, C. Tantillo, R. L. Williams, G. Kamer, A. L. Ferris, P. Clark, and . 1993. Crystal structure of human immunodeficiency virus type 1 reverse transcriptase complexed with double-stranded DNA at 3.0 A resolution shows bent DNA. Proc Natl Acad Sci U S A. 90:6320-6324.

89. Jaffe, H. 2004. Public health. Whatever happened to the U.S. AIDS epidemic? Science. 305:1243-1244.

90. Jegede, O. 2007. Unpublished data. Unpublished data.

91. Jegede, O., A. Khodyakova, M. Chernov, L. Menendez-Arias, A. Gudkov, and M. E. Quinones-Mateu. 2007. Identification and Characterization of New HIV-1 Reverse Transcriptase Inhibitors. Not yet published.

92. Jegede, O., J. Weber, M. L. M. Marotta, A. Prokvolit, and M. E. Quiñones- Mateu. 2007. Cell-based Screening of Small Molecule Library to Identify HIV-1 Entry Inhibitors. Yet to be published data.

93. Jochmans, D., Kesteleyn, B., Marchand, B., and et, al. Identification and Biochemical Characterization of a New Class of HIV Inhibitors: Nucleotide- competing Reverse Transcriptase Inhibitors. 12th Conference on Retroviruses and Opportunistic Infections Oral Abstract 156. 2005.

94. Jochmans, D., M. Van Ginderen, I. De Baere, P. Dehertogh, S. Hallenberger, and K. Hertogs. 2006. The in vitro resistance profile of NcRTI-1 is complementary with the resistance profile of tenofovir and zidovudine. 15th International HIV Drug Resistance Workshop Antivir Ther. 11:S21 (abstract no.16).

95. Jochmans, D., B. Van Schoubroeck, T. Ivens, P. Dehertogh, B. Kesteleyn, and K. Hertogs. 2005. ATP enhances the inhibitory effect of NcRTIs (Nucleotide-competing RT inhibitors). 14th International HIV Drug Resistance Workshop Antivir Ther. 10, Suppl 1:S93 (abstract no.83).

96. Johnson, A. A., C. Marchand, and Y. Pommier. 2004. HIV-1 integrase inhibitors: a decade of research and two drugs in clinical trial. Curr Top. Med Chem. 4:1059-1077.

97. Jonckheere, H., J. Anne, and E. De Clercq. 2000. The HIV-1 reverse transcription (RT) process as target for RT inhibitors. Med Res Rev. 20:129-154.

98. Jorgensen, W. L. 2004. The many roles of computation in drug discovery. Science. 303:1813-1818. 190

99. Kao, S. Y., A. F. Calman, P. A. Luciw, and B. M. Peterlin. 1987. Anti- termination of transcription within the long terminal repeat of HIV-1 by tat gene product. Nature. 330:489-493.

100. Kijak, G. H. and F. E. McCutchan. 2005. HIV diversity, molecular epidemiology, and the role of recombination. Curr Infect Dis Rep. 7:480-488.

101. Klatzmann, D., F. Barre-Sinoussi, M. T. Nugeyre, C. Danquet, E. Vilmer, C. Griscelli, F. Brun-Veziret, C. Rouzioux, J. C. Gluckman, J. C. Chermann, and . 1984. Selective tropism of lymphadenopathy associated virus (LAV) for helper-inducer T lymphocytes. Science. 225:59-63.

102. Klatzmann, D., E. Champagne, S. Chamaret, J. Gruest, D. Guetard, T. Hercend, J. C. Gluckman, and L. Montagnier. 1984. T-lymphocyte T4 molecule behaves as the receptor for human retrovirus LAV. Nature. %20-1985 Jan 2;312:767-768.

103. Kohlstaedt, L. A., J. Wang, J. M. Friedman, P. A. Rice, and T. A. Steitz. 1992. Crystal structure at 3.5 A resolution of HIV-1 reverse transcriptase complexed with an inhibitor. Science. 256:1783-1790.

104. Konvalinka, J., J. Litera, J. Weber, J. Vondrasek, M. Hradilek, M. Soucek, I. Pichova, P. Majer, P. Strop, J. Sedlacek, A. M. Heuser, H. Kottler, and H. G. Krausslich. 1997. Configurations of diastereomeric hydroxyethylene isosteres strongly affect biological activities of a series of specific inhibitors of human- immunodeficiency-virus proteinase. Eur J Biochem. 250:559-566.

105. Korber, B., M. Muldoon, J. Theiler, F. Gao, R. Gupta, A. Lapedes, B. H. Hahn, S. Wolinsky, and T. Bhattacharya. 2000. Timing the ancestor of the HIV-1 pandemic strains. Science. 288:1789-1796.

106. Kovacs, J. A. and H. Masur. 2000. Prophylaxis against opportunistic infections in patients with human immunodeficiency virus infection. N Engl J Med. 342:1416-1429.

107. Lalezari, J. P., K. Henry, M. O'Hearn, J. S. Montaner, P. J. Piliero, B. Trottier, S. Walmsley, C. Cohen, D. R. Kuritzkes, J. J. Eron, Jr., J. Chung, R. DeMasi, L. Donatacci, C. Drobnes, J. Delehanty, and M. Salgo. 2003. Enfuvirtide, an HIV-1 fusion inhibitor, for drug-resistant HIV infection in North and South America. N. Engl. J. Med. 348:2175-2185.

108. Larder, B. A. 1992. 3'-Azido-3'-deoxythymidine resistance suppressed by a mutation conferring human immunodeficiency virus type 1 resistance to nonnucleoside reverse transcriptase inhibitors. Antimicrob Agents Chemother. 36:2664-2669. 191

109. Lazzarin, A., B. Clotet, D. Cooper, J. Reynes, K. Arasteh, M. Nelson, C. Katlama, H. J. Stellbrink, J. F. Delfraissy, J. Lange, L. Huson, R. DeMasi, C. Wat, J. Delehanty, C. Drobnes, and M. Salgo. 2003. Efficacy of enfuvirtide in patients infected with drug-resistant HIV-1 in Europe and Australia. N. Engl. J. Med. 348:2186-2195.

110. Le Grice, S. F., T. Naas, B. Wohlgensinger, and O. Schatz. 1991. Subunit- selective mutagenesis indicates minimal polymerase activity in heterodimer- associated p51 HIV-1 reverse transcriptase. EMBO J. 10:3905-3911.

111. Ledergerber, B., M. Egger, V. Erard, R. Weber, B. Hirschel, H. Furrer, M. Battegay, P. Vernazza, E. Bernasconi, M. Opravil, D. Kaufmann, P. Sudre, P. Francioli, and A. Telenti. 1999. AIDS-related opportunistic illnesses occurring after initiation of potent antiretroviral therapy: the Swiss HIV Cohort Study. JAMA. 282:2220-2226.

112. Lederman, M. M., E. Connick, A. Landay, D. R. Kuritzkes, J. Spritzler, M. St Clair, B. L. Kotzin, L. Fox, M. H. Chiozzi, J. M. Leonard, F. Rousseau, M. Wade, J. D. Roe, A. Martinez, and H. Kessler. 1998. Immunologic responses associated with 12 weeks of combination antiretroviral therapy consisting of zidovudine, lamivudine, and ritonavir: results of AIDS Clinical Trials Group Protocol 315. J Infect Dis. 178:70-79.

113. Lemey, P., O. G. Pybus, B. Wang, N. K. Saksena, M. Salemi, and A. M. Vandamme. 2003. Tracing the origin and history of the HIV-2 epidemic. Proc Natl Acad Sci U S A. 100:6588-6592.

114. Levy, J. A. 1998. HIV and the pathogenesis of AIDS. American Society for Microbiology Second Edition.

115. Levy, J. A., A. D. Hoffman, S. M. Kramer, J. A. Landis, J. M. Shimabukuro, and L. S. Oshiro. 1984. Isolation of lymphocytopathic retroviruses from San Francisco patients with AIDS. Science. 225:840-842.

116. Lewis, W. and M. C. Dalakas. 1995. Mitochondrial toxicity of antiviral drugs. Nat Med. 1:417-422.

117. Li, F., R. Goila-Gaur, K. Salzwedel, N. R. Kilgore, M. Reddick, C. Matallana, A. Castillo, D. Zoumplis, D. E. Martin, J. M. Orenstein, G. P. Allaway, E. O. Freed, and C. T. Wild. 2003. - PA-457: a potent HIV inhibitor that disrupts core condensation by targeting a late step in Gag processing. Proc Natl Acad Sci U S A. 100:13555-13560.

118. Li, F., R. Goila-Gaur, K. Salzwedel, N. R. Kilgore, M. Reddick, C. Matallana, A. Castillo, D. Zoumplis, D. E. Martin, J. M. Orenstein, G. P. Allaway, E. O. 192

Freed, and C. T. Wild. 2003. PA-457: a potent HIV inhibitor that disrupts core condensation by targeting a late step in Gag processing. Proc Natl Acad Sci U S A. 100:13555-13560.

119. Lin, P. F., W. Blair, T. Wang, T. Spicer, Q. Guo, N. Zhou, Y. F. Gong, H. G. Wang, R. Rose, G. Yamanaka, B. Robinson, C. B. Li, R. Fridell, C. Deminie, G. Demers, Z. Yang, L. Zadjura, N. Meanwell, and R. Colonno. 2003. A small molecule HIV-1 inhibitor that targets the HIV-1 envelope and inhibits CD4 receptor binding. Proc. Natl. Acad. Sci. U. S. A. 100:11013-11018.

120. Lipinski, C. A., F. Lombardo, B. W. Dominy, and P. J. Feeney. 2001. Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv Drug Deliv Rev. 46:3-26.

121. Little, S. J., S. Holte, J. P. Routy, E. S. Daar, M. Markowitz, A. C. Collier, R. A. Koup, J. W. Mellors, E. Connick, B. Conway, M. Kilby, L. Wang, J. M. Whitcomb, N. S. Hellmann, and D. D. Richman. 2002. Antiretroviral-drug resistance among patients recently infected with HIV. N. Engl. J. Med. 347:385- 394.

122. Locas, C., S. Ching, and S. Damment. 2004. Safety profile of SPD754 in cynomolgus monkeys treated for 52 weeks. 11th Conference on Retroviruses and Opportunistic Infections Abstract 527.

123. MacCoss, M. and T. A. Baillie. 2004. Organic chemistry in drug discovery. Science. 303:1810-1813.

124. Mangeat, B., P. Turelli, G. Caron, M. Friedli, L. Perrin, and D. Trono. 2003. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424:99-103.

125. Mariani, R., D. Chen, B. Schrofelbauer, F. Navarro, R. Konig, B. Bollman, C. Munk, H. Nymark-McMahon, and N. R. Landau. 2003. Species-specific exclusion of APOBEC3G from HIV-1 virions by Vif. Cell. 114:21-31.

126. Maruyama, M., T. Nishio, T. Yoshida, C. Ishida, K. Ishida, Y. Watanabe, M. Nishikawa, and Y. Takakura. 2004. Simultaneous detection of DsRed2-tagged and EGFP-tagged human beta-interferons in the same single cells. J Cell Biochem. 93:497-502.

127. Masur, H., M. A. Michelis, J. B. Greene, I. Onorato, R. A. Stouwe, R. S. Holzman, G. Wormser, L. Brettman, M. Lange, H. W. Murray, and S. Cunningham-Rundles. 1981. An outbreak of community-acquired Pneumocystis 193

carinii pneumonia: initial manifestation of cellular immune dysfunction. N Engl J Med. 305:1431-1438.

128. Matamoros, T., J. Deval, C. Guerreiro, L. Mulard, B. Canard, and L. Menendez-Arias. 2005. Suppression of multidrug-resistant HIV-1 reverse transcriptase primer unblocking activity by alpha-phosphate-modified thymidine analogues. J Mol Biol. 349:451-463.

129. Matthews, T., M. Salgo, M. Greenberg, J. Chung, R. DeMasi, and D. Bolognesi. 2004. Enfuvirtide: the first therapy to inhibit the entry of HIV-1 into host CD4 lymphocytes. Nat Rev Drug Discov. 3:215-225.

130. McCutchan, F. E. 2006. Global epidemiology of HIV. J Med Virol. 78 Suppl 1:S7-S12.:S7-S12.

131. Melikyan, G. B., R. M. Markosyan, H. Hemmati, M. K. Delmedico, D. M. Lambert, and F. S. Cohen. 2000. Evidence that the transition of HIV-1 gp41 into a six-helix bundle, not the bundle configuration, induces membrane fusion. J Cell Biol. 151:413-423.

132. Meloni, S. T., B. Kim, J. L. Sankale, D. J. Hamel, S. Tovanabutra, S. Mboup, F. E. McCutchan, and P. J. Kanki. 2004. Distinct human immunodeficiency virus type 1 subtype A virus circulating in West Africa: sub-subtype A3. J Virol. 78:12438-12445.

133. Mitchell, T. and M. Cherry. 2005. Fragments-based drug design. Innovations in Pharmaceutical Technology 16.

134. Mocroft, A., B. Ledergerber, C. Katlama, O. Kirk, P. Reiss, M. A. d'Arminio, B. Knysz, M. Dietrich, A. N. Phillips, and J. D. Lundgren. 2003. Decline in the AIDS and death rates in the EuroSIDA study: an observational study. Lancet. 362:22-29.

135. Mocroft, A., S. Vella, T. L. Benfield, A. Chiesi, V. Miller, P. Gargalianos, M. A. d'Arminio, I. Yust, J. N. Bruun, A. N. Phillips, and J. D. Lundgren. 1998. Changing patterns of mortality across Europe in patients infected with HIV-1. EuroSIDA Study Group. Lancet. 352:1725-1730.

136. Morales-Ramirez, J. O., Teppler, H., Kovacs, C., and et, al. Antiretroviral Effect of MK-0518, a Novel HIV-1 Integrase Inhibitor, in ART-Naive HIV-infected Patients. 10th European AIDS Conference.Dublin, Ireland. Abstract LBPS1/6. 2005.

137. Morner, A., A. Bjorndal, J. Albert, V. N. Kewalramani, D. R. Littman, R. Inoue, R. Thorstensson, E. M. Fenyo, and E. Bjorling. 1999. Primary human 194

immunodeficiency virus type 2 (HIV-2) isolates, like HIV-1 isolates, frequently use CCR5 but show promiscuity in coreceptor usage. J Virol. 73:2343-2349.

138. Nabel, G. and D. Baltimore. 1987. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature. 326:711-713.

139. Nakagawa, H., Y. Kiyozuka, Y. Uemura, H. Senzaki, N. Shikata, K. Hioki, and A. Tsubura. 2001. Resveratrol inhibits human breast cancer cell growth and may mitigate the effect of linoleic acid, a potent breast cancer cell stimulator. J Cancer Res Clin Oncol. 127:258-264.

140. Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma, and D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 272:263-267.

141. Navia, M. A., P. M. Fitzgerald, B. M. McKeever, C. T. Leu, J. C. Heimbach, W. K. Herber, I. S. Sigal, P. L. Darke, and J. P. Springer. 1989. Three- dimensional structure of aspartyl protease from human immunodeficiency virus HIV-1. Nature. 337:615-620.

142. Nisole, S. and A. Saib. 2004. Early steps of retrovirus replicative cycle. Retrovirology. 1:9.

143. Oprea, T. I. 2002. Current trends in lead discovery: are we looking for the appropriate properties? J Comput. Aided Mol Des. 16:325-334.

144. Oprea, T. I. 2002. Virtual screening in lead discovery: a viewpoint. Molecules 7:51-62.

145. Ozel, M., G. Pauli, and H. R. Gelderblom. 1988. The organization of the envelope projections on the surface of HIV. Arch. Virol. 100:255-266.

146. Palella, F. J., Jr., K. M. Delaney, A. C. Moorman, M. O. Loveless, J. Fuhrer, G. A. Satten, D. J. Aschman, and S. D. Holmberg. 1998. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. HIV Outpatient Study Investigators. N Engl J Med. 338:853-860.

147. Parkin, N. T., S. Gupta, C. Chappey, and C. J. Petropoulos. 2006. The K101P and K103R/V179D mutations in human immunodeficiency virus type 1 reverse transcriptase confer resistance to nonnucleoside reverse transcriptase inhibitors. Antimicrob Agents Chemother. 50:351-354.

148. Pauwels, R., J. Balzarini, M. Baba, R. Snoeck, D. Schols, P. Herdewijn, J. Desmyter, and E. De Clercq. 1988. Rapid and automated tetrazolium-based 195

colorimetric assay for the detection of anti-HIV compounds. J. Virol. Methods. 20:309-321.

149. Penn, M. L., J. C. Grivel, B. Schramm, M. A. Goldsmith, and L. Margolis. 1999. CXCR4 utilization is sufficient to trigger CD4+ T cell depletion in HIV-1- infected human lymphoid tissue. Proc Natl Acad Sci U S A. 96:663-668.

150. Perelson, A. S., A. U. Neumann, M. Markowitz, J. M. Leonard, and D. D. Ho. 1996. HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science. 271:1582-1586.

151. Philpott, S. M. 2003. HIV-1 coreceptor usage, transmission, and disease progression. Curr HIV. Res. 1:217-227.

152. Pommier, Y., A. A. Johnson, and C. Marchand. 2005. Integrase inhibitors to treat HIV/AIDS. Nat Rev Drug Discov. 4:236-248.

153. Popovic, M., M. G. Sarngadharan, E. Read, and R. C. Gallo. 1984. Detection, isolation, and continuous production of cytopathic retroviruses (HTLV-III) from patients with AIDS and pre-AIDS. Science. 224:497-500.

154. Princen, K., S. Hatse, K. Vermeire, E. De Clercq, and D. Schols. 2004. Establishment of a novel CCR5 and CXCR4 expressing CD4+ cell line which is highly sensitive to HIV and suitable for high-throughput evaluation of CCR5 and CXCR4 antagonists. Retrovirology 1.

155. Proudfoot, N. 1991. Poly(A) signals. Cell. 64:671-674.

156. Puglisi, J. D., R. Tan, B. J. Calnan, A. D. Frankel, and J. R. Williamson. 1992. Conformation of the TAR RNA-arginine complex by NMR spectroscopy. Science. 257:76-80.

157. Quinones-Mateu, M. E., S. C. Ball, A. J. Marozsan, V. S. Torre, J. L. Albright, G. Vanham, G. G. van Der, R. L. Colebunders, and E. J. Arts. 2000. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J Virol. 74:9222-9233.

158. Quinones-Mateu, M. E., V. Soriano, E. Domingo, and L. Menendez-Arias. 1997. Characterization of the reverse transcriptase of a human immunodeficiency virus type 1 group O isolate. Virology. 236:364-373. 196

159. Rana, T. M. and K. T. Jeang. 1999. Biochemical and functional interactions between HIV-1 Tat protein and TAR RNA. Arch. Biochem. Biophys. 365:175- 185.

160. Ratner, L., W. Haseltine, R. Patarca, K. J. Livak, B. Starcich, S. F. Josephs, E. R. Doran, J. A. Rafalski, E. A. Whitehorn, K. Baumeister, and . 1985. Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature. 313:277- 284.

161. Rees, D. C., M. Congreve, C. W. Murray, and R. Carr. 2004. Fragment-based lead discovery. Nat Rev Drug Discov. 3:660-672.

162. Richman, D., C. K. Shih, I. Lowy, J. Rose, P. Prodanovich, S. Goff, and J. Griffin. 1991. Human immunodeficiency virus type 1 mutants resistant to nonnucleoside inhibitors of reverse transcriptase arise in tissue culture. Proc Natl Acad Sci U S A. 88:11241-11245.

163. Richman, D. D. 2001. HIV chemotherapy. Nature. 410:995-1001.

164. Rishton, G. M. 1997. Reactive compounds and in vitro false positives in HTS. Drug Discov Today 2:49-58.

165. Robbins, K. E., P. Lemey, O. G. Pybus, H. W. Jaffe, A. S. Youngpairoj, T. M. Brown, M. Salemi, A. M. Vandamme, and M. L. Kalish. 2003. U.S. Human immunodeficiency virus type 1 epidemic: date of origin, population history, and characterization of early strains. J Virol. 77:6359-6366.

166. Roberts, N. A., J. A. Martin, D. Kinchington, A. V. Broadhurst, J. C. Craig, I. B. Duncan, S. A. Galpin, B. K. Handa, J. Kay, A. Krohn, and . 1990. Rational design of peptide-based HIV proteinase inhibitors. Science. 248:358- 361.

167. Robertson, D. L., J. P. Anderson, J. A. Bradac, J. K. Carr, B. Foley, R. K. Funkhouser, F. Gao, B. H. Hahn, M. L. Kalish, C. Kuiken, G. H. Learn, T. Leitner, F. McCutchan, S. Osmanov, M. Peeters, D. Pieniazek, M. Salminen, P. M. Sharp, S. Wolinsky, and B. Korber. 2000. HIV-1 nomenclature proposal. Science. 288:55-56.

168. Rodgers, D. W., S. J. Gamblin, B. A. Harris, S. Ray, J. S. Culp, B. Hellmig, D. J. Woolf, C. Debouck, and S. C. Harrison. 1995. The structure of unliganded reverse transcriptase from the human immunodeficiency virus type 1. Proc Natl Acad Sci U S A. 92:1222-1226. 197

169. Rosen, C. A., J. G. Sodroski, and W. A. Haseltine. 1985. The location of cis- acting regulatory sequences in the human T cell lymphotropic virus type III (HTLV-III/LAV) long terminal repeat. Cell. 41:813-823.

170. Sakalian, M., C. P. McMurtrey, F. J. Deeg, C. W. Maloy, F. Li, C. T. Wild, and K. Salzwedel. - 3-O-(3',3'-dimethysuccinyl) betulinic acid inhibits maturation of the human immunodeficiency virus type 1 Gag precursor assembled in vitro.-22.

171. Saksena, N. K. and S. J. Potter. 2003. Reservoirs of HIV-1 in vivo: implications for antiretroviral therapy. AIDS Rev. 5:3-18.

172. Sarubbi, E., M. L. Nolli, F. Andronico, S. Stella, G. Saddler, E. Selva, A. Siccardi, and M. Denaro. 1991. A high throughput assay for inhibitors of HIV-1 protease. Screening of microbial metabolites. FEBS Lett. 279:265-269.

173. Scarlatti, G., E. Tresoldi, A. Bjorndal, R. Fredriksson, C. Colognesi, H. K. Deng, M. S. Malnati, A. Plebani, A. G. Siccardi, D. R. Littman, E. M. Fenyo, and P. Lusso. 1997. In vivo evolution of HIV-1 co-receptor usage and sensitivity to chemokine-mediated suppression. Nat Med. 3:1259-1265.

174. Schreiber, S. L. 2000. Target-oriented and diversity-oriented organic synthesis in drug discovery. Science. 287:1964-1969.

175. Schwartlander, B., J. Stover, N. Walker, L. Bollinger, J. P. Gutierrez, W. McGreevey, M. Opuni, S. Forsythe, L. Kumaranayake, C. Watts, and S. Bertozzi. 2001. AIDS. Resource needs for HIV/AIDS. Science. 292:2434-2436.

176. Schwartz, S., B. K. Felber, D. M. Benko, E. M. Fenyo, and G. N. Pavlakis. 1990. Cloning and functional analysis of multiply spliced mRNA species of human immunodeficiency virus type 1. J. Virol. 64:2519-2529.

177. Sharp, P. A. and R. A. Marciniak. 1989. HIV TAR: an RNA enhancer? Cell. %20;59:229-230.

178. Sheehy, A. M., N. C. Gaddis, and M. H. Malim. 2003. The antiretroviral enzyme APOBEC3G is degraded by the proteasome in response to HIV-1 Vif. Nat Med. 9:1404-1407.

179. Shehu-Xhilaga, M., G. Tachedjian, S. M. Crowe, and K. Kedzierska. 2005. Antiretroviral compounds: mechanisms underlying failure of HAART to eradicate HIV-1. Curr Med Chem. 12:1705-1719. 198

180. Shi, Y., J. Albert, G. Francis, H. Holmes, and E. M. Fenyo. 2002. A new cell line-based neutralization assay for primary HIV type 1 isolates. AIDS Res Hum Retroviruses. 18:957-967.

181. Shin, G. C., Taddeo, B., Haseltine, W. A., and Farnet, C. M. Genetic analysis of the human immunodeficiency virus type 1 integrase protein. J Virol. 68[3], 1633- 1642. 1994.

182. Shirasaka, T., M. F. Kavlick, T. Ueno, W. Y. Gao, E. Kojima, M. L. Alcaide, S. Chokekijchai, B. M. Roy, E. Arnold, R. Yarchoan, and . 1995. Emergence of human immunodeficiency virus type 1 variants with resistance to multiple dideoxynucleosides in patients receiving therapy with dideoxynucleosides. Proc Natl Acad Sci U S A. 92:2398-2402.

183. Simmons, G., P. R. Clapham, L. Picard, R. E. Offord, M. M. Rosenkilde, T. W. Schwartz, R. Buser, T. N. Wells, and A. E. Proudfoot. 1997. Potent inhibition of HIV-1 infectivity in macrophages and lymphocytes by a novel CCR5 antagonist. Science. 276:276-279.

184. Simon, F., P. Mauclere, P. Roques, I. Loussert-Ajaka, M. C. Muller-Trutwin, S. Saragosti, M. C. Georges-Courbot, F. Barre-Sinoussi, and F. Brun- Vezinet. 1998. Identification of a new human immunodeficiency virus type 1 distinct from group M and group O. Nat Med. 4:1032-1037.

185. Sluis-Cremer, N., N. A. Temiz, and I. Bahar. 2004. Conformational changes in HIV-1 reverse transcriptase induced by nonnucleoside reverse transcriptase inhibitor binding. Curr HIV Res. 2:323-332.

186. Spence, R. A., W. M. Kati, K. S. Anderson, and K. A. Johnson. 1995. Mechanism of inhibition of HIV-1 reverse transcriptase by nonnucleoside inhibitors. Science. 267:988-993.

187. Starcich, B., L. Ratner, S. F. Josephs, T. Okamoto, R. C. Gallo, and F. Wong- Staal. 1985. Characterization of long terminal repeat sequences of HTLV-III. Science. 227:538-540.

188. Stebbing, J. and G. Moyle. 2003. The clades of HIV: their origins and clinical significance. AIDS Rev. 5:205-213.

189. Stowring, L., A. T. Haase, and H. P. Charman. 1979. Serological definition of the lentivirus group of retroviruses. J Virol. 29:523-528.

190. Svarovskaia, E. S., R. Barr, X. Zhang, G. C. Pais, C. Marchand, Y. Pommier, T. R. Burke, Jr., and V. K. Pathak. - Azido-containing diketo acid derivatives 199

inhibit human immunodeficiency virus type 1 integrase in vivo and influence the frequency of deletions at two-long-terminal-repeat-circle junctions.-22.

191. Tang, J. W. and D. Pillay. 2004. Transmission of HIV-1 drug resistance. J. Clin. Virol. 30:1-10.

192. Tantillo, C., J. Ding, A. Jacobo-Molina, R. G. Nanni, P. L. Boyer, S. H. Hughes, R. Pauwels, K. Andries, P. A. Janssen, and E. Arnold. 1994. Locations of anti-AIDS drug binding sites and resistance mutations in the three- dimensional structure of HIV-1 reverse transcriptase. Implications for mechanisms of drug inhibition and resistance. J Mol Biol. 243:369-387.

193. Teague, S. J., A. M. Davis, P. D. Leeson, and T. Oprea. 1999. The Design of Leadlike Combinatorial Libraries. Angew. Chem Int Ed Engl. 38:3743-3748.

194. Thomson, M. M., L. Perez-Alvarez, and R. Najera. 2002. Molecular epidemiology of HIV-1 genetic forms and its significance for vaccine development and therapy. Lancet Infect Dis. 2:461-471.

195. Turpin, J. A. 2003. The next generation of HIV/AIDS drugs: novel and developmental antiHIV drugs and targets. Expert Rev Anti Infect Ther. 1:97-128.

196. UNAIDS. 2005. AIDS epidemic update: December 2005. UNAIDS.

197. UNAIDS. 2006. 2006 report on the global AIDS epidemic: Executive Summary / UNAIDS. " A UNAIDS 10th Anniversary Special Edition".

198. Varmus, H. and Brown, P. "Retroviruses." In Mobile DNA, edited by Douglas Berg and Martha Howe. 53-108. 1989. American Society for Microbiology Press.

199. Wain-Hobson, S., P. Sonigo, O. Danos, S. Cole, and M. Alizon. 1985. Nucleotide sequence of the AIDS virus, LAV. Cell. 40:9-17.

200. Wang, L. X., A. Heredia, H. Song, Z. Zhang, B. Yu, C. Davis, and R. Redfield. 2004. Resveratrol glucuronides as the metabolites of resveratrol in humans: characterization, synthesis, and anti-HIV activity. J Pharm. Sci. 93:2448- 2457.

201. Wang, Y., F. Catana, Y. Yang, R. Roderick, and R. B. van Breemen. 2002. An LC-MS method for analyzing total resveratrol in grape juice, cranberry juice, and in wine. J Agric. Food Chem. 50:431-435. 200

202. Weber, J., J. Weberova, M. Carobene, M. Mirza, J. Martinez-Picado, P. Kazanjian, and M. E. Quinones-Mateu. 2006. Use of a novel assay based on intact recombinant viruses expressing green (EGFP) or red (DsRed2) fluorescent proteins to examine the contribution of pol and env genes to overall HIV-1 replicative fitness. J Virol Methods. 136:102-117.

203. Weissenhorn, W., A. Dessen, S. C. Harrison, J. J. Skehel, and D. C. Wiley. 1997. Atomic structure of the ectodomain from HIV-1 gp41. Nature. 387:426- 430.

204. Wild, C., T. Greenwell, and T. Matthews. 1993. A synthetic peptide from HIV- 1 gp41 is a potent inhibitor of virus-mediated cell-cell fusion. AIDS Res. Hum. Retroviruses. 9:1051-1053.

205. Wild, C. T., D. C. Shugars, T. K. Greenwell, C. B. McDanal, and T. J. Matthews. 1994. Peptides corresponding to a predictive alpha-helical domain of human immunodeficiency virus type 1 gp41 are potent inhibitors of virus infection. Proc. Natl. Acad. Sci. U. S. A. 91:9770-9774.

206. Wilkin, T., Haubrich, R., Steinhart, C. R., and et, al. TMC114/r superior to standard of care in 3-class-experienced patients: 24-wks primary analysis of the Power 2 study (C202). 45th Interscience Conference on Antimicrobial Agents and Chemotherapy Program and abstracts of the 45th Interscience Conference on Antimicrobial Agents and Chemotherapy. Washington, DC. Abstract H-413. 2005.

207. Witvrouw, M., C. Pannecouque, K. Van Laethem, J. Desmyter, E. De Clercq, and A. M. Vandamme. 1999. Activity of non-nucleoside reverse transcriptase inhibitors against HIV-2 and SIV. AIDS. 13:1477-1483.

208. Wyatt, R. and J. Sodroski. 1998. The HIV-1 envelope glycoproteins: fusogens, antigens, and immunogens. Science. 280:1884-1888.

209. Young, F. E. 1988. The role of the FDA in the effort against AIDS. Public Health Rep. 103:242-245.

210. Zhou, J., C. H. Chen, and C. Aiken. 2004. The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3',3'-dimethylsuccinyl}-betulinic acid. J Virol. 78:922-929.

211. Zhu, T., B. T. Korber, A. J. Nahmias, E. Hooper, P. M. Sharp, and D. D. Ho. 1998. An African HIV-1 sequence from 1959 and implications for the origin of the epidemic. Nature. 391:594-597.