DOCSLIB.ORG

Reducing Sludge Production and the Domination of Comamonadaceae by Reducing the Oxygen Supply in the Wastewater Treatment Procedure of a Food-Processing Factory

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Reducing Sludge Production and the Domination of Comamonadaceae by Reducing the Oxygen Supply in the Wastewater Treatment Procedure of a Food-Processing Factory 60632 (099) Biosci. Biotechnol. Biochem., 71, 60632-1–9, 2007 Reducing Sludge Production and the Domination of Comamonadaceae by Reducing the Oxygen Supply in the Wastewater Treatment Procedure of a Food-Processing Factory Tamiko SADAIE,1 Aya SADAIE,1 Masao TAKADA,2 Keiichi HAMANO,3 Junichi OHNISHI,4 y Niji OHTA,4 Kouji MATSUMOTO,4 and Yoshito SADAIE4; 1Clarus Environment Co., Ltd., Nishi Sinjuku 6-12-7, Shinjuku, Tokyo 160-0023, Japan 2Takada Co., Ltd., Miyoshi-cho 901-9, Iruma, Saitama 354-0041, Japan 3Taitec Co., Ltd., Koshigaya 2693-1, Saitama 343-0822, Japan 4Department of Molecular Biology, Faculty of Science, Saitama University, Saitama 338-8570, Japan Received November 8, 2006; Accepted December 19, 2006; Online Publication, March 7, 2007 [doi:10.1271/bbb.60632] Sludge production was reduced remarkably by re- limited oxygen supply requires sufficient degradation of ducingAdvance the dissolved oxygen supply to less than View 1 mg/‘ nutrients to maintain cellular activity.1,2) in the conventional wastewater treatment procedure In this communication, we report an improvement in of a food-processing factory that produced 180 m3 of the conventional large-scale activated sludge process wastewater of biochemical oxygen demand (BOD) of by lowering of the oxygen supply to less than 1 mg/‘, about 1,000 mg/‘ daily. DNA was extracted from the which resulted in a reduction in sludge production. Since sludge and subjected to PCR amplification. The PCR 80% of the total microorganisms detected by DAPI product was cloned into a plasmid and sequenced. (40-6-Diamidino-2-phenylindole) staining in activated Estimation of the resident bacterial distribution by sludge were hybridizable with bacterial DNA probes3) 16S rDNA sequences before and after improvement of and most bacteria are not culturable,4,5) we performed the system suggested a remarkable gradual change in a phylogenetic orProofs community structure analysis6) by the major bacterial population from Anaerolinaeceae comparing sequences of cloned 16S ribosomal RNA (15.6%) to Comamonadaceae (52.3%), members of genes (rDNA) of a bacterial population in the improved denitrifying bacteria of Proteobacteria. Although we sludge. With a low oxygen supply, the wastewater did not directly confirm the ability of denitrification of treatment system showed limited production of sludge. the resulting sludge, a change in the major final electron Community structure analysis suggested that nitrate- acceptors from oxygen to nitrate might explain the reducing Comamonadaceae became the dominant bac- reduction in sludge production in a conventional terial species. We suggest that sludge containing a large activated sludge process when the oxygen supply was fraction of the members of Comamonadaceae is capable limitted. of effecting a biological nutrient removal process with a reduced increase in cell mass when the oxygen supply is Key words: activated sludge; DO reduction; reduced limited. sludge production; community structure analysis Materials and Methods The conventional wastewater treatment process re- Activated sludge process. The improved wastewater quires a higher dissolved oxygen concentration of more treatment process of a food-processing factory consisted than 1 mg/‘ in the reactor to activate sludge. This of a first adjusting tank (capacity 200 t), a second reactor process inevitably produces excess sludge. A reduction tank (capacity 400 t), a third setting tank (capacity 70 t), in sludge production should lead to a reduction in the and a fourth sludge-digesting tank (capacity 200 t) for amount of energy required for sludge treatment. Re- the treatment of sludge with lower dissolved oxygen for ducing the oxygen supply to less than 1 mg/‘ in the one week. Sedimented sludge in the first tank was also wastewater treatment system often results in a reduction digested in a fifth tank (capacity 50 t) and returned to the in sludge production, possibly because energy produc- fourth tank. A fraction of the supernatant and suspended tion by bacterial respiration and metabolism with a solids of the fourth sludge-digesting tank was returned y To whom correspondence should be addressed. Tel: +81-48-858-3399; Fax: +81-48-858-3384; E-mail: [email protected] 60632-2 T. SADAIE et al. to the first adjusting tank every week. After November MEGA3 version 3.1,11) run on a PC. Unambiguously 25, 2004, the operation of the second reactor tank was aligned parts are further analyzed to make a neigh- performed with a lower oxygen supply (DO < 1). bor-joining tree, which was visualized with the Tree- Before improvement, the second reactor tank was kept View program (http://taxonomy.zoology.gla.ac.uk/rod/ running with higher oxygen supply (DO > 1), and the treeview.html).12) The 34 reference sequences shown fourth tank was used as a reactor. Before improvement, in Fig. 2 are C. gracilis (AB109889), P. lanceolata the sedimented sludge of the first and third tanks was (AB021390), R. antarcticus (AY609198), R. tataoui- condensed in the fifth tank, followed by a drying nensis (AF144383), V. paradoxus (DQ241396), H. pal- process. leronii (AF019073), X. azovorans (AF285414), A. kon- jaci (AF137507), A. metamorphum (AY780904), Colony formation. Colonies of the sludge sample were A. psychrophilum (AF078755), D. acidovorans (AB23- formed after serial dilutions with distilled water on 1159), Diaphorobacter NA5 (DQ294626), C. terrigena Luria-Bertani broth7) agar after incubation at room (AB021418), C. denitrificans (AF233880), B. denitrifi- temperature (20 C) for 3 d. cans (D14320), A. hongkongensis (DQ489306), L. dis- cophora (Z18533), I. dechloratans (X72724), R. benzo- DNA extraction. DNA was extracted8) from the lyticum (AJ888903), B. brasilensis (AJ238360), P. api- sludge. It was obtained by precipitating the sample sta (AY268172), L. thiooxidans (AJ289885), S. albido- from the reactor at 3,000 RPM for 15 min. The sludge flavus (AY965999), O. formigenes (U49758), S. ster- sample was resuspended in TE buffer containing phenol coricanis (AJ566849), A. defragrans (AB195161), and glass beads (BZ-04, diameter 0.35–0.5 mm, AS N. halophila (AF272413), F. limneticum (Y17060), ONE, Osaka, Japan), and vortexed vigorously. DNA was T. chlorobenzoica (AF229887), A. anaerobius (Y147- extracted twice with phenol-chroloform-isoamylalchol 01), M. pratensis (AY298905), H. denitrificans (AY82- afterAdvance RNase1 treatment. View0184), N. flava (AJ239301), and E. coli (J01695). PCR and TA cloning. 16S rDNA was PCR amplified Nucleotide sequence accession numbers. The 16S with template sludge DNA, AmpliTaq DNA polymerase rDNA sequences of the 318 uncultured clones deter- (Applied Biosystems, Branchburg, NJ) and a primer mined in this study have been deposited under DDBJ pair, 50AGAGTTTGATCCTGGCTCAG30 (E. coli 16S accession nos AB286331 to AB286648. rDNA positions 8–27)/50AAGGAGGTGATCCAGCC- GCA30 (E. coli 16S rDNA positions 1541–1530). Prim- Results and Discussion ers were custom made (Espec Oligo Service, Tsukuba, Japan). Amplified DNA was cloned with plasmid pCRII- Improvement ofProofs activated sludge process TOPO (Invitrogen, Carlsbad, CA) and introduced into A conventional activated sludge and wastewater Escherichia coli strain DH5 -T1 by the procedures of treatment process was performed in a food-manufactur- the supplier. Apr transformant colonies were randomly ing factory which daily produced 180 m3 wastewater of selected and regrown on LB agar medium (1cm 1cm) biochemical oxygen demand (BOD) of about 1,000 containing antibiotics. Cells of the regrown colony were mg/‘. Dissolved oxygen (DO) of more than 1 mg/‘ was collected with toothpicks, and recombinant plasmids kept in the reactor tank before improvement. We were purified with a purification kit (ABI PRISMÔ reduced DO to less than 1 mg/‘ in the reactor tank Miniprep Kit, Applied Biosystems, Foster City, CA). and aerated the sedimented sludge in the fourth tank Cloned 16S rDNA was PCR amplified with plasmid with a lower oxygen supply, in which DO was also kept DNA and a primer pair, as described above. to less than 1 mg/‘ for one week. A fraction of super- natant and suspended solids of the fourth tank was DNA sequencing. DNA sequencing was performed returned to the first tank of the system to stabilize the with an ABI PRISM 3100 Genetic Analyzer after system. Although the DO value fluctuated, it was kept to sequencing reaction of the cloned segment by the Dye less than 1.0 (from 0.8 to 0.2) after improvement. terminator method as described by the supplier. Se- Before improvement, 10 tons of wet sedimented quencing was performed from both directions using the sludge was extracted every day, although careful same primer pair. Some of the sequencing reactions management of the whole system may have reduced were also performed by Hitachi HiTec Science Systems the production of sludge. No sludge was extracted for (Hitachi-Naka, Ibaraki, Japan). more than 8 months after improvement. We measured pH, suspended solids (SSs), mixed Bioinformatics. DNA sequences were subjected to the liquor suspended solids (MLSSs), chemical oxygen de- Classifier and Sequence Match programs of Ribosomal mand (COD), BOD, N-hexane-extractable fraction (N- Data Base Project II (http://rdp.come.msu.edu/).9) Co- hexane), nitrate, and sulfate in the system before im- mamonadaceae and Betaproteobacteria sequences were provement and 2 months after improvement (Table 1). aligned using ClustalX program version 1.83 (http:// Discharged water from the setting tank showed exten- bips.u-strasbg.fr/fr/Documentation/ClustalX/)10) and sively lowered values of COD and BOD as compared to Activated Sludge and Community Structure Analysis 60632-3 Table 1. Parameters of Activated Sludge Process with Lower Oxygen Content Adjusting Reactor Setting Sludge digesting tank tank tank tank pH 5.4(5.6) 7.2(7.6) 6.2(6.1) SS 680(217) 13(30.6) MLSS 11,000(10,100) 19,000(12,600) COD 680(303) 6,900(4,850) 18(35.1) 8,400(5,430) BOD 460(862) 2,000(1,260) 11(7.6) 1,300(1,670) N-hexan 260(98.6) <5(<5) Nitrate <0:2(0.8) <0:1(<0:2) <0:2(82.6) Sulfate <1(15.8) 25(24) 61(75.6) Data are from activated sludge system on January 20, 2005.
Load more

Recommended publications
  • Microbial Community Response to Heavy and Light Crude Oil in the Great Lakes
    Microbial Community Response to Heavy and Light Crude Oil in the Great Lakes Stephen Techtmann 10/24/19 Microbial Sensors Techtmann Lab @ MTU Investigating the applications of environmental microbial communities Hydraulic Fracturing Related Antibiotic Resistance Oil Bioremediation Techtmann Lab @ MTU Overview • Background on oil biodegradation • Microbial response to light and heavy crude oil in the Great Lakes • Machine learning for prediction of contamination in the Great Lakes. Oil Spills Deepwater Horizon Enbridge Line 6B Deepwater Horizon Oil Spill • 4,1000,000 bbl of oil released • Light Sweet Crude oil released • April 20, 2010 • 1101.7 miles of shoreline oiled Atlas and Hazen 2011 Enbridge Line 6B Spill – Marshall MI • 20,082 bbl of oil released • Diluted Bitumen • July 26, 2010 • 70 miles of shoreline oiled https://www.mlive.com/news/kalamazoo/2010/07/state_of_emergency_declared_as.html Oil Transmissions Pipelines in the Great Lakes Region Line 5: • 645 miles from Superior WI to Sarnia Ontario • 540,000 barrels per day • Light crude and natural gas liquids (NGLs) Crude oil Oil types and API Gravity Microbes and Biotechnology (Bioremediation) Low cost input Microbe High value output Decreased Cost Contaminant Increased Efficiency Carbon dioxide or non- toxic daughter products Carbon dioxide Microbial Biomass Petroleum Microbe Daughter Products Water Microbial Ecology and Biotechnology Low cost input Microbe High value output Decreased Cost/Increased Efficiency Complex input Input A Microbe Microbe Output A Input B Microbe Output
    [Show full text]
  • Monophyletic Group of Unclassified -Proteobacteria Dominates in Mixed
    Monophyletic group of unclassified γ-Proteobacteria dominates in mixed culture biofilm of high-performing oxygen reducing biocathode Michael Rothballer, Matthieu Picot, Tina Sieper, Jan B. A. Arends, Michael Schmid, Anton Hartmann, Nico Boon, Cees J. N. Buisman, Frédéric Barrière, David P. B. T. B. Strik To cite this version: Michael Rothballer, Matthieu Picot, Tina Sieper, Jan B. A. Arends, Michael Schmid, et al.. Monophyletic group of unclassified γ-Proteobacteria dominates in mixed culture biofilm of high- performing oxygen reducing biocathode. Bioelectrochemistry, Elsevier, 2015, 106 (Part A), pp.167-176. 10.1016/j.bioelechem.2015.04.004. hal-01151357 HAL Id: hal-01151357 https://hal-univ-rennes1.archives-ouvertes.fr/hal-01151357 Submitted on 14 Sep 2015 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ACCEPTED MANUSCRIPT A monophyletic group of unclassified γ -Proteobacteria dominates in a mixed culture biofilm of high-performing oxygen reducing biocathode Michael Rothballer a#, Matthieu Picot b#, Tina Sieper a, Jan B. A. Arends c, Michael Schmid a, Anton Hartmann a, Nico Boon c, Cees Buisman d, Frédéric Barrière b, David P. B. T. B. Strik d* a Helmholtz Zentrum München - German Research Center for Environmental Health, Department of Environmental Sciences, Research Unit Microbe –Plant Interactions, Ingolstädter Landstrasse 1, 85764 Neuherberg, Germany b Université de Rennes 1, CNRS UMR no.
    [Show full text]
  • Brachymonas Denitrificans Gen. Nov., Sp. Nov., An
    J. Gen. App!. Microbiol., 41, 99-117 (1995) BRACHYMONAS DENITRIFICANS GEN. NOV., SP. NOV., AN AEROBIC CHEMOORGANOTROPHIC BACTERIUM WHICH CONTAINS RHODOQUINONES, AND EVOLUTIONARY RELATIONSHIPS OF RHODOQUINONE PRODUCERS TO BACTERIAL SPECIES WITH VARIOUS QUINONE CLASSES AKIRA HIRAISHI,* YONG KOOK SHIN,' AND JUNTA SUGIYAMA' Laboratory of Environmental Biotechnology, Konishi Co., Ltd., Sumida-ku, Tokyo 130, Japan 'Institute of Molecular and Cellular Biosciences, The University of Tokyo, Bunkyo-ku, Tokyo 113, Japan (Received October 18, 1994; Accepted January 13, 1995) The new strains of aerobic chemoorganotrophic rhodoquinone-containing bacteria previously isolated from activated sludge were studied from taxonomic and phylogenetic viewpoints. These strains were Gram- negative, nonmotile coccobacilli, had a strictly respiratory type of metab- olism with oxygen or nitrate as the terminal acceptor, produced catalase and oxidase, and contained both ubiquinone-8 and rhodoquinone-8 as major quinones. DNA-DNA reassociation studies revealed that the new strains were highly related to each other at hybridization levels of more than 74%, suggesting the genetic coherency of the isolates as a single species. The 16S rRNA gene from one of the isolates, strain AS-P1, was amplified in vitro and sequenced directly. Sequence comparisons and a distance matrix tree analysis revealed that strain AS-P 1 was most closely related to Comamonas testosteroni, a representative of the beta subclass of the Proteobacteria, but the level of sequence similarity between the two appeared to be low enough to warrant different generic allocations. The strains were differentiated from related organisms by a number of pheno- typic and chemotaxonomic properties. Thus, we conclude that the isolates should be placed in a new genus and species of the beta subclass of the Proteobacteria, for which we propose the name Brachymonas denitrificans.
    [Show full text]
  • Bioelectrochemistry 106 (2015) 167–176
    Bioelectrochemistry 106 (2015) 167–176 Contents lists available at ScienceDirect Bioelectrochemistry journal homepage: www.elsevier.com/locate/bioelechem Monophyletic group of unclassified γ-Proteobacteria dominates in mixed culture biofilm of high-performing oxygen reducing biocathode Michael Rothballer a,1,MatthieuPicotb,1, Tina Sieper a, Jan B.A. Arends c, Michael Schmid a, Anton Hartmann a, Nico Boon c,CeesJ.N.Buismand, Frédéric Barrière b, David P.B.T.B. Strik d,⁎ a Helmholtz Zentrum München-German Research Center for Environmental Health, Department of Environmental Sciences, Research Unit Microbe–Plant Interactions, Ingolstädter Landstrasse 1, 85764 Neuherberg, Germany b Université de Rennes 1, CNRS UMR no. 6226, Institut des Sciences Chimiques de Rennes, Équipe MaCSE, Avenue Général Leclerc, 35042 Rennes Cedex, France c Ghent University, Faculty of Bioscience Engineering, Laboratory of Microbial Ecology and Technology (LabMET), Coupure Links 653, BE-9000 Gent, Belgium d Wageningen University, Sub-department of Environmental Technology, Bornse Weilanden 9, 6708 WG Wageningen, The Netherlands article info abstract Article history: Several mixed microbial communities have been reported to show robust bioelectrocatalysis of oxygen reduction Received 17 December 2014 over time at applicable operation conditions. However, clarification of electron transfer mechanism(s) and iden- Received in revised form 1 April 2015 tification of essential micro-organisms have not been realised. Therefore, the objective of this study was to shape Accepted 5 April 2015 oxygen reducing biocathodes with different microbial communities by means of surface modification using the Available online 8 April 2015 electrochemical reduction of two different diazonium salts in order to discuss the relation of microbial composi- fi Keywords: tion and performance.
    [Show full text]
  • Phylogenomics Provides New Insights Into Gains and Losses of Selenoproteins Among Archaeplastida
    Supplementary Materials: Phylogenomics provides new insights into gains and losses of selenoproteins among Archaeplastida Hongping Liang1,2,3#, Tong Wei2,3,4#, Yan Xu1,2,3#, Linzhou Li2,3,6, Sunil Kumar Sahu2,3,4, Hongli Wang1,2,3, Haoyuan Li1,2, Xian Fu2,3, Gengyun Zhang2,4, Michael Melkonian7, Xin Liu2,3,4, Sibo Wang2,4,5*,Huan Liu2,4,5* 1 BGI Education Center, University of Chinese Academy of Sciences, Beijing, China. 2 BGI-Shenzhen, Beishan Industrial Zone, Yantian District, Shenzhen 518083, China. 3 China National Gene Bank, Institute of New Agricultural Resources, BGI-Shenzhen, Jinsha Road, Shenzhen 518120, China. 4 State Key Laboratory of Agricultural Genomics, BGI-Shenzhen, Shenzhen 518083, China. 5 Department of Biology, University of Copenhagen, Copenhagen, Denmark. 6 School of Biology and Biological Engineering, South China University of Technology, 510006, China. 7 Botanical Institute, Cologne Biocenter, University of Cologne, Cologne D-50674, Germany. #these authors contributed equally to this work * Correspondence: *[email protected] Supplementary Figure S1: Completeness of genome assemblies and Stop codon statistics. The genome quality was assessed by the BUSCO program. The number of single, multiple, missing and fragmented genes are shown in the middle histogram. The stop codon usage of genes is shown on the right histograms. The species that lost the Sec machinery are marked with an asterisk in the tree. Each group was colored in different background in the left column. Group Species Numbers Stop Codon Arabidopsis thaliana
    [Show full text]
  • Bakterien Der Ameisengattung Pseudomyrmex
    Diversität und Funktionen der mit der Ameisengattung Pseudomyrmex (Lund, 1831) assoziierten Bakterien Inaugural-Dissertation zur Erlangung des Doktorgrades Dr. rer. nat. des Fachbereichs Biologie und Geografie an der Universität Duisburg-Essen vorgelegt von Sascha Eilmus aus Leverkusen März 2009 Die der vorliegenden Arbeit zugrunde liegenden Experimente wurden in der Abteilung für Allgemeine Botanik der Universität Duisburg-Essen und an einer anderen gleichwertigen Einrichtung durchgeführt. 1. Gutachter: Prof. Dr. Martin Heil 2. Gutachter: Prof. Dr. Peter Bayer 3. Gutachter: Prof. Dr. Hynek Burda Vorsitzender des Prüfungsausschusses: Prof. Dr. Daniel Hoffmann Tag der mündlichen Prüfung: 21. Juli 2009 Ein Gelehrter in seinem Laboratorium ist nicht nur ein Techniker; er steht auch vor den Naturgesetzen wie ein Kind vor der Märchenwelt. Marie Curie Zusammenfassung Zusammenfassung Der Ameisengattung Pseudomyrmex gehören zahlreiche Baum bewohnende Arten an, die z. T. unabhängig voneinander enge Mutualismen mit verschiedenen myrmekophytischen Pflanzen eingegangen sind. Dabei verteidigen die Ameisen ihre Wirtspflanze gegen Fraßfeinde. Wie war es möglich, dass sich innerhalb dieser Gruppe so oft Generalisten mit breitem Nahrungsspektrum zu z. T. hoch spezialisierten Pflanzenameisen mit rein pflanzlicher Ernährungsweise entwickeln konnten? Oftmals liegt der Schlüssel zum Verständnis spezialisierter phytophager Insekten in ihrem Mutualismus mit Mikroorganismen, die ihnen helfen, ihre Nahrung zu verdauen und diese durch Syntheseleistungen mit essentiellen
    [Show full text]
  • Culture-Independent Characterization of Doc-Transforming
    CULTURE-INDEPENDENT CHARACTERIZATION OF DOC-TRANSFORMING BACTERIOPLANKTON IN COASTAL SEAWATER by XIAOZHEN MOU (Under the Direction of Robert E. Hodson) ABSTRACT Bacterially-mediated transformation of aromatic monomers and organic osmolytes, two important components of the dissolved organic (DOC) pool in coastal seawater, is significant in the biogeochemical cycling of essential elements including carbon, sulfur and nitrogen. A study of bacterioplankton responding to the addition of 20 μM dimethylsulfoniopropionate (DMSP), a sulfur-containing organic osmolyte, suggested that a subset of the bacterial community could degrade DMSP. Cells developing high nucleic acid content in the presence of DMSP included members of α-Proteobacteria (mainly in the Roseobacter clade), β-Proteobacteria and γ- Proteobacteria, and a lower number of Actinobacteria and Bacteroidetes. The relative importance of DMSP-active taxa varied seasonally. Another study tested whether aromatic monomers and organic osmolytes are transformed by specialist bacterial taxa. The taxonomy of coastal bacterioplankton responding to the addition of 100 nM organic osmolyte [DMSP or glycine betaine (GlyB)] or aromatic monomer [para-hydroxybenzoic acid (pHBA) or vanillic acid (VanA)] was determined using incorporation of bromodeoxyuridine (BrdU) to track actively growing cells. 16S rDNA clones of active bacterioplankton indicated that both types of DOC were transformed by bacterial assemblages composed of the same major taxa, including Actinobacteria, Bacteroidetes, α-Proteobacteria (mainly members of the Roseobacter clade), β- Proteobacteria, and γ-Proteobacteria (mainly members of Altermonadaceae, Chromatiaceae, Oceanospirillaceae and Pseudomonadaceae). The relative abundance of each taxon differed, however. Members of the OM60/241 and OM185, SAR11, SAR86 and SAR116 bacterioplankton groups in the active cell group indicated the ability to transport and metabolize these compounds by these ubiquitous but poorly described environmental clusters.
    [Show full text]
  • S1. the Genomes of the Order Burkholderiales (Taxid:80840) in The
    S1. The genomes of the order Burkholderiales (taxid:80840) in the NCBI Genome List (http://www.ncbi.nlm.nih.gov/genome/browse/) 05-09-2014 N Organism/Name Kingdom Group SubGroup Size (Mb) Chr Plasmids Assemblies 1. Burkholderiales bacterium JGI 0001003-L21 Bacteria Proteobacteria Betaproteobacteria 0,070281 - - 1 2. Comamonadaceae bacterium JGI 0001003-E14 Bacteria Proteobacteria Betaproteobacteria 0,113075 - - 1 3. Candidatus Zinderia insecticola Bacteria Proteobacteria Betaproteobacteria 0,208564 1 - 1 4. Comamonadaceae bacterium JGI 0001013-A16 Bacteria Proteobacteria Betaproteobacteria 0,295955 - - 1 5. Oxalobacteraceae bacterium JGI 0001004-J12 Bacteria Proteobacteria Betaproteobacteria 0,301938 - - 1 6. Oxalobacteraceae bacterium JGI 0001002-K6 Bacteria Proteobacteria Betaproteobacteria 0,368093 - - 1 7. Burkholderiales bacterium JGI 0001003-J08 Bacteria Proteobacteria Betaproteobacteria 0,394907 - - 1 8. Burkholderiales bacterium JGI 0001002-H06 Bacteria Proteobacteria Betaproteobacteria 0,415398 - - 1 9. Pelomonas Bacteria Proteobacteria Betaproteobacteria 0,507844 - - 2 10. Leptothrix ochracea Bacteria Proteobacteria Betaproteobacteria 0,510792 - - 1 11. Oxalobacteraceae bacterium JGI 0001012-C15 Bacteria Proteobacteria Betaproteobacteria 0,640975 - - 1 12. Burkholderiales bacterium JGI 0001003-A5 Bacteria Proteobacteria Betaproteobacteria 0,686115 - - 1 13. Oxalobacteraceae bacterium JGI 001010-B17 Bacteria Proteobacteria Betaproteobacteria 0,825556 - - 1 14. Rhizobacter Bacteria Proteobacteria Betaproteobacteria 1,05799 - -
    [Show full text]
  • Activity and Community Composition of Denitrifying Bacteria in Poly(3-Hydroxybutyrate-Co-3-Hydroxyvalerate)-Using Solid-Phase Denitrification Processes
    Microbes Environ. Vol. 22, No. 1, 20–31, 2007 http://wwwsoc.nii.ac.jp/jsme2/ Activity and Community Composition of Denitrifying Bacteria in Poly(3-hydroxybutyrate-co-3-hydroxyvalerate)-Using Solid-phase Denitrification Processes SHAMS TABREZ KHAN1, YOKO HORIBA1, NAOTO TAKAHASHI1 and AKIRA HIRAISHI1* 1 Department of Ecological Engineering, Toyohashi University of Technology, Toyohashi 441–8580, Japan (Received September 4, 2006—Accepted November 13, 2006) Two laboratory-scale solid-phase denitrification (SPD) reactors, designated reactors A and B, for nitrogen removal were constructed by acclimating activated sludge with pellets and flakes of poly(3-hydoxybutyrate-co-3- hydroxyvalerate) (PHBV) as the sole added substrate under denitrifying conditions, respectively. The average − −1 −1 denitrification rate in both reactors was 60 mg NO3 -N g (dry wt) h under steady-state conditions, whereas −1 −1 washed sludge taken from the reactors showed an average denitrification rate of 20 mg NO3-N g (dry wt) h with fresh PHBV as the sole substrate. The difference in the denitrification rate between the two might be due to the bioavailability of intermediate metabolites as the substrate for denitrification, because acetate and 3-hydroxy- butyrate were detected in the reactors. Most of the predominant denitrifiers isolated quantitatively by the plate- counting method using non-selective agar medium were unable to degrade PHBV and were identified as mem- bers of genera of the class Betaproteobacteria by studying 16S rRNA gene sequence information. nirS and nosZ gene clone library-based analyses of the microbial community from SPD reactor A showed that most of the nirS and nosZ clones proved to be derived from members of the family Comamonadaceae and other phylogenetic groups of the Betaproteobacteria.
    [Show full text]