60632 (099) Biosci. Biotechnol. Biochem., 71, 60632-1–9, 2007 Reducing Sludge Production and the Domination of Comamonadaceae by Reducing the Oxygen Supply in the Wastewater Treatment Procedure of a Food-Processing Factory Tamiko SADAIE,1 Aya SADAIE,1 Masao TAKADA,2 Keiichi HAMANO,3 Junichi OHNISHI,4 y Niji OHTA,4 Kouji MATSUMOTO,4 and Yoshito SADAIE4; 1Clarus Environment Co., Ltd., Nishi Sinjuku 6-12-7, Shinjuku, Tokyo 160-0023, Japan 2Takada Co., Ltd., Miyoshi-cho 901-9, Iruma, Saitama 354-0041, Japan 3Taitec Co., Ltd., Koshigaya 2693-1, Saitama 343-0822, Japan 4Department of Molecular Biology, Faculty of Science, Saitama University, Saitama 338-8570, Japan Received November 8, 2006; Accepted December 19, 2006; Online Publication, March 7, 2007 [doi:10.1271/bbb.60632] Sludge production was reduced remarkably by re- limited oxygen supply requires sufficient degradation of ducingAdvance the dissolved oxygen supply to less than View 1 mg/‘ nutrients to maintain cellular activity.1,2) in the conventional wastewater treatment procedure In this communication, we report an improvement in of a food-processing factory that produced 180 m3 of the conventional large-scale activated sludge process wastewater of biochemical oxygen demand (BOD) of by lowering of the oxygen supply to less than 1 mg/‘, about 1,000 mg/‘ daily. DNA was extracted from the which resulted in a reduction in sludge production. Since sludge and subjected to PCR amplification. The PCR 80% of the total microorganisms detected by DAPI product was cloned into a plasmid and sequenced. (40-6-Diamidino-2-phenylindole) staining in activated Estimation of the resident bacterial distribution by sludge were hybridizable with bacterial DNA probes3) 16S rDNA sequences before and after improvement of and most bacteria are not culturable,4,5) we performed the system suggested a remarkable gradual change in a phylogenetic orProofs community structure analysis6) by the major bacterial population from Anaerolinaeceae comparing sequences of cloned 16S ribosomal RNA (15.6%) to Comamonadaceae (52.3%), members of genes (rDNA) of a bacterial population in the improved denitrifying bacteria of Proteobacteria. Although we sludge. With a low oxygen supply, the wastewater did not directly confirm the ability of denitrification of treatment system showed limited production of sludge. the resulting sludge, a change in the major final electron Community structure analysis suggested that nitrate- acceptors from oxygen to nitrate might explain the reducing Comamonadaceae became the dominant bac- reduction in sludge production in a conventional terial species. We suggest that sludge containing a large activated sludge process when the oxygen supply was fraction of the members of Comamonadaceae is capable limitted. of effecting a biological nutrient removal process with a reduced increase in cell mass when the oxygen supply is Key words: activated sludge; DO reduction; reduced limited. sludge production; community structure analysis Materials and Methods The conventional wastewater treatment process re- Activated sludge process. The improved wastewater quires a higher dissolved oxygen concentration of more treatment process of a food-processing factory consisted than 1 mg/‘ in the reactor to activate sludge. This of a first adjusting tank (capacity 200 t), a second reactor process inevitably produces excess sludge. A reduction tank (capacity 400 t), a third setting tank (capacity 70 t), in sludge production should lead to a reduction in the and a fourth sludge-digesting tank (capacity 200 t) for amount of energy required for sludge treatment. Re- the treatment of sludge with lower dissolved oxygen for ducing the oxygen supply to less than 1 mg/‘ in the one week. Sedimented sludge in the first tank was also wastewater treatment system often results in a reduction digested in a fifth tank (capacity 50 t) and returned to the in sludge production, possibly because energy produc- fourth tank. A fraction of the supernatant and suspended tion by bacterial respiration and metabolism with a solids of the fourth sludge-digesting tank was returned y To whom correspondence should be addressed. Tel: +81-48-858-3399; Fax: +81-48-858-3384; E-mail: [email protected] 60632-2 T. SADAIE et al. to the first adjusting tank every week. After November MEGA3 version 3.1,11) run on a PC. Unambiguously 25, 2004, the operation of the second reactor tank was aligned parts are further analyzed to make a neigh- performed with a lower oxygen supply (DO < 1). bor-joining tree, which was visualized with the Tree- Before improvement, the second reactor tank was kept View program (http://taxonomy.zoology.gla.ac.uk/rod/ running with higher oxygen supply (DO > 1), and the treeview.html).12) The 34 reference sequences shown fourth tank was used as a reactor. Before improvement, in Fig. 2 are C. gracilis (AB109889), P. lanceolata the sedimented sludge of the first and third tanks was (AB021390), R. antarcticus (AY609198), R. tataoui- condensed in the fifth tank, followed by a drying nensis (AF144383), V. paradoxus (DQ241396), H. pal- process. leronii (AF019073), X. azovorans (AF285414), A. kon- jaci (AF137507), A. metamorphum (AY780904), Colony formation. Colonies of the sludge sample were A. psychrophilum (AF078755), D. acidovorans (AB23- formed after serial dilutions with distilled water on 1159), Diaphorobacter NA5 (DQ294626), C. terrigena Luria-Bertani broth7) agar after incubation at room (AB021418), C. denitrificans (AF233880), B. denitrifi- temperature (20 C) for 3 d. cans (D14320), A. hongkongensis (DQ489306), L. dis- cophora (Z18533), I. dechloratans (X72724), R. benzo- DNA extraction. DNA was extracted8) from the lyticum (AJ888903), B. brasilensis (AJ238360), P. api- sludge. It was obtained by precipitating the sample sta (AY268172), L. thiooxidans (AJ289885), S. albido- from the reactor at 3,000 RPM for 15 min. The sludge flavus (AY965999), O. formigenes (U49758), S. ster- sample was resuspended in TE buffer containing phenol coricanis (AJ566849), A. defragrans (AB195161), and glass beads (BZ-04, diameter 0.35–0.5 mm, AS N. halophila (AF272413), F. limneticum (Y17060), ONE, Osaka, Japan), and vortexed vigorously. DNA was T. chlorobenzoica (AF229887), A. anaerobius (Y147- extracted twice with phenol-chroloform-isoamylalchol 01), M. pratensis (AY298905), H. denitrificans (AY82- afterAdvance RNase1 treatment. View0184), N. flava (AJ239301), and E. coli (J01695). PCR and TA cloning. 16S rDNA was PCR amplified Nucleotide sequence accession numbers. The 16S with template sludge DNA, AmpliTaq DNA polymerase rDNA sequences of the 318 uncultured clones deter- (Applied Biosystems, Branchburg, NJ) and a primer mined in this study have been deposited under DDBJ pair, 50AGAGTTTGATCCTGGCTCAG30 (E. coli 16S accession nos AB286331 to AB286648. rDNA positions 8–27)/50AAGGAGGTGATCCAGCC- GCA30 (E. coli 16S rDNA positions 1541–1530). Prim- Results and Discussion ers were custom made (Espec Oligo Service, Tsukuba, Japan). Amplified DNA was cloned with plasmid pCRII- Improvement ofProofs activated sludge process TOPO (Invitrogen, Carlsbad, CA) and introduced into A conventional activated sludge and wastewater Escherichia coli strain DH5 -T1 by the procedures of treatment process was performed in a food-manufactur- the supplier. Apr transformant colonies were randomly ing factory which daily produced 180 m3 wastewater of selected and regrown on LB agar medium (1cm 1cm) biochemical oxygen demand (BOD) of about 1,000 containing antibiotics. Cells of the regrown colony were mg/‘. Dissolved oxygen (DO) of more than 1 mg/‘ was collected with toothpicks, and recombinant plasmids kept in the reactor tank before improvement. We were purified with a purification kit (ABI PRISMÔ reduced DO to less than 1 mg/‘ in the reactor tank Miniprep Kit, Applied Biosystems, Foster City, CA). and aerated the sedimented sludge in the fourth tank Cloned 16S rDNA was PCR amplified with plasmid with a lower oxygen supply, in which DO was also kept DNA and a primer pair, as described above. to less than 1 mg/‘ for one week. A fraction of super- natant and suspended solids of the fourth tank was DNA sequencing. DNA sequencing was performed returned to the first tank of the system to stabilize the with an ABI PRISM 3100 Genetic Analyzer after system. Although the DO value fluctuated, it was kept to sequencing reaction of the cloned segment by the Dye less than 1.0 (from 0.8 to 0.2) after improvement. terminator method as described by the supplier. Se- Before improvement, 10 tons of wet sedimented quencing was performed from both directions using the sludge was extracted every day, although careful same primer pair. Some of the sequencing reactions management of the whole system may have reduced were also performed by Hitachi HiTec Science Systems the production of sludge. No sludge was extracted for (Hitachi-Naka, Ibaraki, Japan). more than 8 months after improvement. We measured pH, suspended solids (SSs), mixed Bioinformatics. DNA sequences were subjected to the liquor suspended solids (MLSSs), chemical oxygen de- Classifier and Sequence Match programs of Ribosomal mand (COD), BOD, N-hexane-extractable fraction (N- Data Base Project II (http://rdp.come.msu.edu/).9) Co- hexane), nitrate, and sulfate in the system before im- mamonadaceae and Betaproteobacteria sequences were provement and 2 months after improvement (Table 1). aligned using ClustalX program version 1.83 (http:// Discharged water from the setting tank showed exten- bips.u-strasbg.fr/fr/Documentation/ClustalX/)10) and sively lowered values of COD and BOD as compared to Activated Sludge and Community Structure Analysis 60632-3 Table 1. Parameters of Activated Sludge Process with Lower Oxygen Content Adjusting Reactor Setting Sludge digesting tank tank tank tank pH 5.4(5.6) 7.2(7.6) 6.2(6.1) SS 680(217) 13(30.6) MLSS 11,000(10,100) 19,000(12,600) COD 680(303) 6,900(4,850) 18(35.1) 8,400(5,430) BOD 460(862) 2,000(1,260) 11(7.6) 1,300(1,670) N-hexan 260(98.6) <5(<5) Nitrate <0:2(0.8) <0:1(<0:2) <0:2(82.6) Sulfate <1(15.8) 25(24) 61(75.6) Data are from activated sludge system on January 20, 2005.