Evidence of the Existence of Adenylyl Cyclase 10 (ADCY10) Ortholog
Total Page：16
File Type：pdf, Size：1020Kb
Journal of Reproduction and Development, Vol. 56, No. 2, 2010, 09-180N —Original Article— Evidence of the Existence of Adenylyl Cyclase 10 (ADCY10) Ortholog Proteins in the Heads and Connecting Pieces of Boar Spermatozoa Shunsuke TATE1)*, Kazumi NAKAMURA2)*, Chihiro SUZUKI3)*, Taichi NODA2), Jibak LEE1)# and Hiroshi HARAYAMA1–3) 1)Graduate School of Science and Technology, 2)Graduate School of Agricultural Science and 3)Faculty of Agriculture, Kobe University, Kobe 657-8501, Japan #Present: Chromosome Dynamics Laboratory, RIKEN Advanced Science Institute, Saitama 351-0198, Japan Abstract. The aim of this study is to provide evidence of the existence of the adenylyl cyclase 10 (ADCY10) ortholog proteins in boar spermatozoa. Experiments with RT-PCR techniques, nucleotide sequence analyses and Northern blot analyses revealed that boar testes exclusively express approximately 5.1-kbp RNA, the nucleotide sequence of which is highly similar to that of human ADCY10. Database analyses with CDART suggested that pig ADCY10 ortholog proteins conserve two catalytic domains of adenylyl cyclase. Western blot techniques and indirect immunofluorescence with a specific antiserum to pig recombinant ADCY10 ortholog proteins showed that 48-kDa and 70-kDa truncated forms of pig ADCY10 ortholog proteins are localized in the equatorial segments and connecting pieces of boar ejaculated spermatozoa. Finally, cell imaging techniques with fluo-3/AM indicated that incubation with sodium bicarbonate (an ADCY10 activator) can initiate the calcium influx in the boar sperm heads that is controlled via the cyclic AMP signaling cascades. These results are consistent with the suggestion that functional ADCY10 ortholog proteins exist in the heads of boar spermatozoa. This is the first direct evidence of the existence of ADCY10 proteins in the heads of mammalian spermatozoa. Key words: Bicarbonate, Calcium, Cyclic AMP, Pig, Sperm (J. Reprod. Dev. 56: 271–278, 2010) hile mammalian spermatozoa are transported through the spermatozoa is an adenylyl cyclase 10 (ADCY10, formerly called epididymis, they gradually acquire potentials to move pro- soluble adenylyl cyclase) that is distinguished from the other iso- gressively and fertilize oocytes. This process is termed sperm forms by G protein-independent activation and lack of a maturation [1]. In the terminal region of the epididymis (caudal membrane-binding domain. Binding of bicarbonate to ADCY10 epididymides), stored spermatozoa are temporally quieted by the obviously stimulates catalysis of adenosine 5’-triphosphates (ATP) influence of the acid-base status of the luminal fluid [2, 3] and to cyclic adenosine 3’,5’-monophosphate (cAMP) [22, 23], which interaction with membrane stabilizing factors [4, 5]. Immediately is an important second messenger that can activate the protein after ejaculation, spermatozoa initiate flagellar beating in response kinase A (PKA)-mediated signaling cascades [11, 24, 25] and to bicarbonate, which originates from the male accessory genital exchange protein directly activated by cAMP (Epac)-mediated sig- glands [6, 7]. In the female reproductive tract, a relatively higher naling cascades, leading to the expression of sperm fertilizing concentration of bicarbonate in the luminal fluid also promotes a ability [26–29]. Moreover, the PKA-mediated signaling cascades series of sperm changes that are required for the expression of fer- are also modulated by the protein phosphatase 1 [30, 31]. tilizing ability, including phospholipid changes in the plasma The ADCY10 of rodent spermatozoa is being investigated in membrane [8, 9], changes in surface glycoconjugates [10], several laboratories and is well characterized [22, 32–36]. For increases of phosphorylated proteins [11, 12], increases of intracel- instance, two controversial hypotheses have been suggested con- lular calcium [13, 14], activation of phospholipase A2 [15] and cerning the mechanisms for generation of the truncated form of polymerization and subsequent depolymerization of F-actin [16]. ADCY10 so far. In the primary report, it is considered that this These molecular changes enable the spermatozoa to undergo the cyclase is originally synthesized mainly in the testis as a 189-kDa acrosome reaction in the heads and hyperactivation in the flagella. precursor (full-length form) with two catalytic domains in the N- Extracellular bicarbonate enters spermatozoa through the terminal region and that it then changes to the 48-kDa truncated plasma membrane by the actions of carbonic anhydrase [3, 17, 18], form during the sperm maturational process. However, it has lately sodium-bicarbonate cotransporter [19] and bicarbonate/chloride been reported that both the full-length and truncated forms of exchanger [20, 21]. The intracellular acceptor for bicarbonate in ADCY10 are generated from the same Adcy10 gene in the testis by alternate splicing. In any case, the resultant truncated form consists Received: October 7, 2009 almost exclusively of two conserved catalytic domains. The spe- Accepted: December 20, 2009 Published online in J-STAGE: January 27, 2010 cific cyclase activity of the truncated form is approximately 20-fold ©2010 by the Society for Reproduction and Development higher than that of the full-length form. This cyclase is also stimu- Correspondence: H Harayama (e-mail: [email protected]) lated by direct binding with not only bicarbonate but also calcium. *S Tate, K Nakamura and C Suzuki contributed equally to this work. In mature spermatozoa, the ADCY10 is localized in the middle 272 TATE et al. Table 1. Primer sets designed to amplify pig adenylyl cyclase 10 (ADCY10) ortholog Primer Forward primers Reverse primers Expected Set # Sequential Sequential molecular size Nucleotide sequences No. Nucleotide sequences No. of PCR product 1 CTGACATGGCACTTCTGCTG 3– 22 CTCCTGGGTCTCAAACAATCC 587– 567 585 2 TGCCTTGAACATGAACCCTC 176– 195 GTAGGGGGCGGTTTTAAGA 853– 835 678 3 TCTTAAAACCGCCCCCTAC 835– 853 CTCATTAAGGCCCAAACACTG 1586– 1566 752 4 GTCAACATAGCTGCCAGGA 1416– 1434 GAACAGGTTATTCCAGGTCAC 2486– 2466 1071 5 TCTGCCTAGACCTCAGTGTCA 2305– 2325 GGTGCATGGCTTTCTTCTGG 3030– 3011 726 6 GCTGGAAAGCCAGGTGATTG 2924– 2943 ACCATCTGGCCCATGTTG 3622– 3605 699 7 CCTCTGGCTCACCACTTTCTG 3387– 3407 TTTGAACCACACGCCCTG 4004– 3987 618 8 TCCAGATCGTTAAGGCCTACC 3931– 3951 CCAGGAGCATTCCACTTTGGAA 4446– 4425 516 9 GAGCACATCTTCAGCAAGGC 4293– 4312 CCATGATGGGAGATTCAGGA 4928– 4909 636 10 GCGTCGACaCCCTCGAAGAGAAGAATCACAG 191– 212 CGCAAGCTTbAAATTTTAAGATGTCTCCTCC 473– 453 300 11 GGAATTCcACCTCCTGAGGCTGGCTTGC 925– 944 GGCAAGCTTbGGCATCCTGAATGGCTGAACC 1136– 1116 228 a The underlined sequence indicates the restriction site for SalI. b The underlined sequence indicates the restriction site for HindIII. c The underlined sequence indicates the restriction site for EcoRI. pieces and is involved in the systems of ATP synthesis. Moreover, ome.org/cgi-bin/web-primer). In addition, we designed the PCR it also plays a critical role in the regulation of cAMP-dependent primers with flanking restriction sites, and these were indicated as protein tyrosine phosphorylation and motility activation. Thus, set #10 (SalI and HindIII for the forward and reverse primers, male mice lacking ADCY10 are infertile, as their spermatozoa are respectively) and set #11 (EcoRI and HindIII for the forward and immotile. To our knowledge, however, only limited data are avail- reverse primers, respectively) in Table 1. The PCR products that able regarding ADCY10 ortholog proteins in spermatozoa from were amplified with the primer sets #10 and #11 were expected to other species of mammals, although existence of this cyclase is be partial cDNA fragments for the truncated form of pig ADCY10 postulated in the models of cAMP-signaling cascades leading to the ortholog. expression of sperm fertilizing ability [e.g., 21]. The aim of this Total RNAs were extracted from the testes, livers and kidneys of study was to provide evidence of the existence of functional three mature Meishan boars (1–3 years old) using ISOGEN RNA ADCY10 ortholog proteins in boar spermatozoa by reverse tran- extraction reagent (Nippon Gene, Tokyo, Japan), and then they scription (RT)-polymerase chain reaction (PCR), Northern were reverse-transcribed using a SuperScript First Strand Synthesis blotting, immunodetection and bioassay for the biological function System for RT-PCR (Invitrogen, Carlsbad, CA, USA). The of the ADCY10 ortholog proteins. obtained cDNAs were used as templates for PCR to amplify cDNA fragments of pig ADCY10 ortholog with PCR Master Mix Materials and Methods (Promega Corporation, Madison, WI, USA) and the above-men- tioned primer sets (Table 1). The PCR products were subjected to Animal use ethics statement electrophoresis in 1% agarose gel containing 100 ng/ml ethidium The Committee of Laboratory Animal Experiments of Kobe bromide (Wako Pure Chemical Industries, Osaka, Japan). University investigated our research plan and the feeding condi- We commissioned Hokkaido System Science (Sapporo, Japan) tions of our animals. We undertook the following experiments to do the cDNA sequence analyses of PCR products that were with the approval of this committee (document Nos.16-04-08 and amplified with primer sets #1–9 (http://www.hssnet.co.jp/). 19-5-11). Preparation of cRNA probes and Northern blot analysis Design of PCR primers, RT-PCR and sequence analysis The PCR products that were amplified with primer set #10 were To obtain a cDNA sequence of pig ortholog of ADCY10, the subcloned into the SalI/HindIII site of pSPT19 plasmids (Roche HTGS