Schwann Cell Reprogramming and Lung Cancer Progression: a Meta-Analysis of Transcriptome Data
Total Page:16
File Type:pdf, Size:1020Kb
 
											Load more
										Recommended publications
									
								- 
												  (12) Patent Application Publication (10) Pub. No.: US 2016/0237501 A1 SHARP Et AlUS 2016O23750 1A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0237501 A1 SHARP et al. (43) Pub. Date: Aug. 18, 2016 (54) BIOMARKERS FOR DIAGNOSIS OF Related U.S. Application Data TRANSIENT SCHEMICATTACKS (62) Division of application No. 13/182,630, filed on Jul. (71) Applicant: The Regents of the University of 14, 2011, now abandoned. California, Oakland, CA (US) (60) Provisional application No. 61/364.334, filed on Jul. 14, 2010. (72) Inventors: Frank SHARP, Davis, CA (US); Xinhua ZHAN. Vacaville, CA (US); Publication Classification Glen C. JICKLING, Sacramento, CA (US): S. Claiborne JOHNSTON, San (51) Int. Cl. Francisco, CA (US) CI2O I/68 (2006.01) (52) U.S. Cl. (73) Assignee: The Regents of the University of CPC ........ CI2O 1688 (2013.0); CI2O 2600/158 California, Oakland, CA (US) (2013.01); C12O 2600/1 18 (2013.01) (57) ABSTRACT (21) Appl. No.: 15/043,577 The present invention provides methods and compositions for diagnosing and predicting the risk and cause of transient (22) Filed: Feb. 14, 2016 ischemic attacks (TIA). Patent Application Publication Aug. 18, 2016 Sheet 1 of 4 US 2016/0237SO1 A1 Standardized intensity s sis: iagnosis Controls xIA Figure IA-B Patent Application Publication Aug. 18, 2016 Sheet 2 of 4 US 2016/0237SO1 A1 & TA Cross-validated Probabilities (Thresholds 0.89) * Controls Controls TA ----------------------------------------------------------------------------------------------------------------------------------------- ... 0.9 O.8 O O 20 Subjects30 40 SO 50 Figure 2 Patent Application Publication Aug. 18, 2016 Sheet 3 of 4 US 2016/0237SO1 A1 Cross-validated Probabilities (Threshold=3.97) & TIA1 & A2 TIA1 T1A2 .
- 
												  Seq2pathway Vignetteseq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
- 
												  Characterization of Genomic Copy Number Variation in Mus Musculus Associated with the Germline of Inbred and Wild Mouse Populations, Normal Development, and CancerWestern University Scholarship@Western Electronic Thesis and Dissertation Repository 4-18-2019 2:00 PM Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer Maja Milojevic The University of Western Ontario Supervisor Hill, Kathleen A. The University of Western Ontario Graduate Program in Biology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Maja Milojevic 2019 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Genetics and Genomics Commons Recommended Citation Milojevic, Maja, "Characterization of genomic copy number variation in Mus musculus associated with the germline of inbred and wild mouse populations, normal development, and cancer" (2019). Electronic Thesis and Dissertation Repository. 6146. https://ir.lib.uwo.ca/etd/6146 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract Mus musculus is a human commensal species and an important model of human development and disease with a need for approaches to determine the contribution of copy number variants (CNVs) to genetic variation in laboratory and wild mice, and arising with normal mouse development and disease. Here, the Mouse Diversity Genotyping array (MDGA)-approach to CNV detection is developed to characterize CNV differences between laboratory and wild mice, between multiple normal tissues of the same mouse, and between primary mammary gland tumours and metastatic lung tissue.
- 
												![AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] Product Data](https://docslib.b-cdn.net/cover/9949/ak3l1-ak4-mouse-monoclonal-antibody-clone-id-oti3a9-product-data-239949.webp)  AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] Product DataOriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA503371 AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] Product data: Product Type: Primary Antibodies Clone Name: OTI3A9 Applications: FC, WB Recommended Dilution: WB 1:2000, FLOW 1:100 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG2b Clonality: Monoclonal Immunogen: Full length human recombinant protein of human AK4(NP_037542) produced in HEK293T cell. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 25.1 kDa Gene Name: adenylate kinase 4 Database Link: NP_037542 Entrez Gene 11639 MouseEntrez Gene 29223 RatEntrez Gene 205 Human P27144 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 3 AK3L1 (AK4) Mouse Monoclonal Antibody [Clone ID: OTI3A9] – TA503371 Background: This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates.
- 
												  Supplementary InformationSupplementary Information This text file includes: Supplementary Methods Supplementary Figure 1-13, 15-30 Supplementary Table 1-8, 16, 20-21, 23, 25-37, 40-41 1 1. Samples, DNA extraction and genome sequencing 1.1 Ethical statements and sample storage The ethical statements of collecting and processing tissue samples for each species are listed as follows: Myotis myotis: All procedures were carried out in accordance with the ethical guidelines and permits (AREC-13-38-Teeling) delivered by the University College Dublin and the Préfet du Morbihan, awarded to Emma Teeling and Sébastien Puechmaille respectively. A single M. myotis individual was humanely sacrificed given that she had lethal injuries, and dissected. Rhinolophus ferrumequinum: All the procedures were conducted under the license (Natural England 2016-25216-SCI-SCI) issued to Gareth Jones. The individual bat died unexpectedly and suddenly during sampling and was dissected immediately. Pipistrellus kuhlii: The sampling procedure was carried out following all the applicable national guidelines for the care and use of animals. Sampling was done in accordance with all the relevant wildlife legislation and approved by the Ministry of Environment (Ministero della Tutela del Territorio e del Mare, Aut.Prot. N˚: 13040, 26/03/2014). Molossus molossus: All sampling methods were approved by the Ministerio de Ambiente de Panamá (SE/A-29-18) and by the Institutional Animal Care and Use Committee of the Smithsonian Tropical Research Institute (2017-0815-2020). Phyllostomus discolor: P. discolor bats originated from a breeding colony in the Department Biology II of the Ludwig-Maximilians-University in Munich. Approval to keep and breed the bats was issued by the Munich district veterinary office.
- 
												  A Single-Cell Transcriptomic Landscape of Primate Arterial AgingARTICLE https://doi.org/10.1038/s41467-020-15997-0 OPEN A single-cell transcriptomic landscape of primate arterial aging Weiqi Zhang 1,2,3,4,5,13, Shu Zhang6,7,13, Pengze Yan3,8,13, Jie Ren7,9,13, Moshi Song3,5,8, Jingyi Li2,3,8, Jinghui Lei4, Huize Pan2,3, Si Wang3,5,8, Xibo Ma3,10, Shuai Ma2,3,8, Hongyu Li2,3, Fei Sun2,3, Haifeng Wan3,5,11, ✉ ✉ ✉ Wei Li 3,5,11, Piu Chan4, Qi Zhou3,5,11, Guang-Hui Liu 2,3,4,5,8 , Fuchou Tang 6,7,9,12 & Jing Qu 3,5,11 Our understanding of how aging affects the cellular and molecular components of the vas- 1234567890():,; culature and contributes to cardiovascular diseases is still limited. Here we report a single-cell transcriptomic survey of aortas and coronary arteries in young and old cynomolgus monkeys. Our data define the molecular signatures of specialized arteries and identify eight markers discriminating aortic and coronary vasculatures. Gene network analyses characterize tran- scriptional landmarks that regulate vascular senility and position FOXO3A, a longevity- associated transcription factor, as a master regulator gene that is downregulated in six subtypes of monkey vascular cells during aging. Targeted inactivation of FOXO3A in human vascular endothelial cells recapitulates the major phenotypic defects observed in aged monkey arteries, verifying FOXO3A loss as a key driver for arterial endothelial aging. Our study provides a critical resource for understanding the principles underlying primate arterial aging and contributes important clues to future treatment of age-associated vascular disorders. 1 CAS Key Laboratory of Genomic and Precision Medicine, Beijing Institute of Genomics, Chinese Academy of Sciences, Beijing 100101, China.
- 
												  B4GALT2 Rabbit PabLeader in Biomolecular Solutions for Life Science B4GALT2 Rabbit pAb Catalog No.: A17573 Basic Information Background Catalog No. This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They A17573 encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to Observed MW similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in 42kDa the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs Calculated MW the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: Category beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in Primary antibody glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding Applications two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011] WB,IHC Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 8704 O60909 IHC 1:100 - 1:200 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 155-271 of human B4GALT2 (NP_085076.2). Synonyms B4Gal-T2;B4Gal-T3;beta4Gal-T2;B4GALT2 Contact Product Information 400-999-6126 Source Isotype Purification Rabbit IgG Affinity purification [email protected] www.abclonal.com.cn Storage Store at -20℃.
- 
												  5' Untranslated Region Elements Show High Abundance and GreatInternational Journal of Molecular Sciences Article 0 5 Untranslated Region Elements Show High Abundance and Great Variability in Homologous ABCA Subfamily Genes Pavel Dvorak 1,2,* , Viktor Hlavac 2,3 and Pavel Soucek 2,3 1 Department of Biology, Faculty of Medicine in Pilsen, Charles University, 32300 Pilsen, Czech Republic 2 Biomedical Center, Faculty of Medicine in Pilsen, Charles University, 32300 Pilsen, Czech Republic; [email protected] (V.H.); [email protected] (P.S.) 3 Toxicogenomics Unit, National Institute of Public Health, 100 42 Prague, Czech Republic * Correspondence: [email protected]; Tel.: +420-377593263 Received: 7 October 2020; Accepted: 20 November 2020; Published: 23 November 2020 Abstract: The 12 members of the ABCA subfamily in humans are known for their ability to transport cholesterol and its derivatives, vitamins, and xenobiotics across biomembranes. Several ABCA genes are causatively linked to inborn diseases, and the role in cancer progression and metastasis is studied intensively. The regulation of translation initiation is implicated as the major mechanism in the processes of post-transcriptional modifications determining final protein levels. In the current bioinformatics study, we mapped the features of the 50 untranslated regions (50UTR) known to have the potential to regulate translation, such as the length of 50UTRs, upstream ATG codons, upstream open-reading frames, introns, RNA G-quadruplex-forming sequences, stem loops, and Kozak consensus motifs, in the DNA sequences of all members of the subfamily. Subsequently, the conservation of the features, correlations among them, ribosome profiling data as well as protein levels in normal human tissues were examined. The 50UTRs of ABCA genes contain above-average numbers of upstream ATGs, open-reading frames and introns, as well as conserved ones, and these elements probably play important biological roles in this subfamily, unlike RG4s.
- 
												  Molecular Structure of a Novel Cholesterol-Responsive a Subclass ABC Transporter, ABCA9View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by University of Regensburg Publication Server BBRC Biochemical and Biophysical Research Communications 295 (2002) 408–416 www.academicpress.com Molecular structure of a novel cholesterol-responsive A subclass ABC transporter, ABCA9 Armin Piehler,1 Wolfgang E. Kaminski,1 Juurgen€ J. Wenzel, Thomas Langmann, and Gerd Schmitz* Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, Franz-Josef-Strauß-Allee 11, D-93042, Regensburg, Germany Received 25 May 2002 Abstract We recently identified a novel ABC A subclass transporter, ABCA6, in human macrophages. Here, we report the molecular cloning of an additional ABC A subfamily transporter from macrophages denoted ABCA9. The identified coding sequence is 4.9 kb in size and codes for a 1624 amino acid protein product. In accordance with the proposed nomenclature, the novel transporter was designated ABCA9. The putative full-length ABC transporter polypeptide consists of two transmembrane domains and two nu- cleotide binding folds and thus conforms to the group of full-size ABC transporters. We identified alternative ABCA9 mRNA variants in human macrophages that predict the existence of three truncated forms of the novel transporter. Among the human ABC A subfamily transporters, ABCA9 exhibits the highest amino acid sequence homology with ABCA8 (72%) and ABCA6 (60%), respectively. The striking amino acid sequence similarity between these transporter molecules supports the notion that they represent an evolutionary more recently emerged subgroup within the family of ABC A transporters, which we refer to as ‘‘ABCA6-like transporters.’’ ABCA9 mRNA is ubiquitously expressed with the highest mRNA levels in heart, brain, and fetal tissues.
- 
												  B4GALT3 (B4GALT2) (NM 030587) Human Tagged ORF Clone Product DataOriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC233988 B4GALT3 (B4GALT2) (NM_030587) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: B4GALT3 (B4GALT2) (NM_030587) Human Tagged ORF Clone Tag: Myc-DDK Symbol: B4GALT2 Synonyms: B4Gal-T2; B4Gal-T3; beta4Gal-T2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC233988 representing NM_030587 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTGTGGAAGTCCAGGAGCAGTGGCCTTGTTTGCCAGCAGCCGGATGCCCGGGCCCACTGGGCGGGC CAGTGGCCGCCTGCGGGATGAGCAGACTGCTGGGGGGGACGCTGGAGCGCGTCTGCAAGGCTGTGCTCCT TCTCTGCCTGCTGCACTTCCTCGTGGCCGTCATCCTCTACTTTGACGTCTACGCCCAGCACCTGGCCTTC TTCAGCCGCTTCAGTGCCCGAGGCCCTGCCCATGCCCTCCACCCAGCTGCTAGCAGCAGCAGCAGCAGCA GCAACTGCTCCCGGCCCAACGCCACCGCCTCTAGCTCCGGGCTCCCTGAGGTCCCCAGTGCCCTGCCCGG TCCCACGGCTCCCACGCTGCCACCCTGTCCTGACTCGCCACCTGGTCTTGTGGGCAGACTGCTGATCGAG TTCACCTCACCCATGCCCCTGGAGCGGGTGCAGAGGGAGAACCCAGGCGTGCTCATGGGCGGCCGATACA CACCGCCCGACTGCACCCCAGCCCAGACGGTGGCGGTCATCATCCCCTTTAGACACCGGGAACACCACCT GCGCTACTGGCTCCACTATCTACACCCCATCTTGAGGCGGCAGCGGCTGCGCTACGGCGTCTATGTCATC AACCAGCATGGTGAGGACACCTTCAACCGGGCCAAGCTGCTTAACGTGGGCTTCCTAGAGGCGCTGAAGG AGGATGCCGCCTATGACTGCTTCATCTTCAGCGATGTGGACCTGGTCCCCATGGATGACCGCAACCTATA CCGCTGCGGCGACCAACCCCGCCACTTTGCCATTGCCATGGACAAGTTTGGCTTCCGGCTTCCCTATGCT
- 
												  Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR GeneHodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
- 
												  Single-Cell Analysis of Crohn's Disease Lesions IdentifiesbioRxiv preprint doi: https://doi.org/10.1101/503102; this version posted December 20, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell analysis of Crohn’s disease lesions identifies a pathogenic cellular module associated with resistance to anti-TNF therapy JC Martin1,2,3, G Boschetti1,2,3, C Chang1,2,3, R Ungaro4, M Giri5, LS Chuang5, S Nayar5, A Greenstein6, M. Dubinsky7, L Walker1,2,5,8, A Leader1,2,3, JS Fine9, CE Whitehurst9, L Mbow9, S Kugathasan10, L.A. Denson11, J.Hyams12, JR Friedman13, P Desai13, HM Ko14, I Laface1,2,8, Guray Akturk1,2,8, EE Schadt15,16, S Gnjatic1,2,8, A Rahman1,2,5,8, , M Merad1,2,3,8,17,18*, JH Cho5,17,*, E Kenigsberg1,15,16,17* 1 Precision Immunology Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA. 2 Tisch Cancer Institute, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA. 3 Department of Oncological Sciences, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA. 4 The Dr. Henry D. Janowitz Division of Gastroenterology, Icahn School of Medicine at Mount Sinai, New York City, NY 10029, USA. 5 Charles Bronfman Institute for Personalized Medicine, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA. 6 Department of Colorectal Surgery, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA 7 Department of Pediatrics, Susan and Leonard Feinstein IBD Clinical Center, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.