Integration of Cistromic and Transcriptomic Analyses Identifies Nphs2, Mafb, and Magi2 As Wilms' Tumor 1 Target Genes in Podoc

Home , ADARB1, ADCY10, Angiogenin, AP2B1, ARID1B, ARL6

BASIC RESEARCH www.jasn.org

Integration of Cistromic and Transcriptomic Analyses Identiﬁes Nphs2, Mafb,andMagi2 as Wilms’ Tumor 1 Target Genes in Podocyte Differentiation and Maintenance

Lihua Dong,* Stefan Pietsch,* Zenglai Tan,* Birgit Perner,* Ralph Sierig,* Dagmar Kruspe,* † ‡ † Marco Groth, Ralph Witzgall, Hermann-Josef Gröne,§ Matthias Platzer, and | Christoph Englert*

Departments of *Molecular Genetics and †Genome Analysis, Leibniz Institute for Age Research, Fritz Lipmann Institute, Jena, Germany; ‡Institute for Molecular and Cellular Anatomy, University of Regensburg, Regensburg, Germany; §Department of Cellular and Molecular Pathology, German Cancer Research Center, Heidelberg, Germany; and |Faculty of Biology and Pharmacy, Friedrich Schiller University of Jena, Jena, Germany

ABSTRACT The Wilms’ tumor suppressor gene 1 (WT1) encodes a zinc finger transcription factor. Mutation of WT1 in humans leads to Wilms’ tumor, a pediatric kidney tumor, or other kidney diseases, such as Denys–Drash and Frasier syndromes. We showed previously that inactivation of WT1 in podocytes of adult mice results in proteinuria, foot process effacement, and glomerulosclerosis. However, the WT1-dependent transcriptional network regulating podocyte development and maintenance in vivo remains unknown. Here, we performed chromatin immunoprecipitation followed by high-throughput sequencing with glomeruli from wild-type mice. Additionally,weperformedacDNAmicroarrayscreenonaninduciblepodocyte–specific WT1 knockout mouse model. By integration of cistromic and transcriptomic analyses, we identified the WT1 targetome in mature podocytes. To further analyze the function and targets of WT1 in podocyte maturation, we used an Nphs2-Cre model, in which WT1 is deleted during podocyte differentiation. These mice display anuria and kidney hemorrhage and die within 24 hours after birth. To address the evolutionary conservation of WT1 targets, we performed functional assays using zebrafish as a model and identified Nphs2, Mafb,andMagi2 as novel WT1 target genes required for podocyte development. Our data also show that both Mafb and Magi2 are required for normal development of the embryonic zebrafish kidney. Collectively, our work provides insights into the transcriptional networks controlled by WT1 and identifies novel WT1 target genes that mediate the function of WT1 in podocyte differentiation and maintenance.

J Am Soc Nephrol 26: 2118–2128, 2015. doi: 10.1681/ASN.2014080819

The essential function of the kidney is to filter blood glomeruli stages. Podocytes start to differentiate and and maintain fluid homeostasis in the body. The establish their intricate architecture, including foot podocyte, which surrounds blood capillaries with processes and slit diaphragms, from the capillary interdigitating foot processes in Bowman’s capsule, is an important component of the filtration apparatus. A specialized intercellular junction called the Received August 22, 2014. Accepted October 10, 2014. slit diaphragm is formed between neighboring foot Published online ahead of print. Publication date available at processes to prevent macromolecules from diffus- www.jasn.org. 1 ing into the urinary space. Podocytes arise from Correspondence: Prof. Christoph Englert, Molecular Genetics, Leibniz epithelial precursors during different stages of kid- Institute for Age Research, Fritz Lipmann Institute, Beutenbergstrasse 11, ney development, namely the renal vesicle, the 07745 Jena, Germany. Email: cenglert@fli-leibniz.de S-shaped body, the capillary loop, and the maturing Copyright © 2015 by the American Society of Nephrology

2118 ISSN : 1046-6673/2609-2118 JAmSocNephrol26: 2118–2128, 2015 www.jasn.org BASIC RESEARCH stage.2 Podocytes are terminally differentiated cells with limited peaks were identical in both ChIP-Seq experiments (Figure 1A); capability to proliferate, and podocyte injury or loss is a hallmark 69.3% of WT1 binding sites localized in the promoter and tran- of progressive kidney disease.3 Mutations in genes encoding po- scribed regions (Figure 1B). WT1 binding sites were significantly docyte differentiation markers, such as Nephrin, Podocin, and enriched in the proximity of transcription start site (TSS) and PLC«1, give rise to early onset proteinuria and kidney failure.4–6 promoter regions (within 1 kb from TSS [14.3%; P,0.001]) The Wilms’ tumorsuppressor1(WT1) was shown to be (Figure 1, C and D). However, 50% of the mapped WT1 peaks mutated in Wilms’ tumor, the most common solid pediatric areatleast50kbawayfromtheclosestTSS(SupplementalFigure1). kidney tumor.7–10 WT1 mutations are present in approxi- These results show that WT1 gene regulation works by both mately 20% of patients with sporadic Wilms’ tumor.11 Muta- proximal and distal regulatory elements. Next, we sought to tions in WT1 have also been shown to occur in several human identify WT1 binding motifs within the central 200 bp of the diseases, such as WAGR, Denys–Drash, and Frasier syndromes WT1-binding regions from the overlapping peaks using the which all show glomerular defects, suggesting that the gene MEME-ChIP algorithm (multiple EM for motif elicitation of has important roles in glomerular development and podocyte large DNA datasets) (P,0.001).22 We identified the core con- function.12–14 WT1 is expressed during different stages of the sensus sequence GGGAGG as the most highly conserved WT1 developing kidney. WT1 expression levels rise significantly as binding sequence in the two most enriched motifs (called kidney development proceeds, are highest at the capillary primary and secondary motifs) (Figure 1E). Interestingly, stage, and are restricted to podocytes in the adult.15 WT1 in- over 85% of peak fragments analyzed contained both primary activation in the mouse results in embryonic lethality along and secondary motifs, which tended to occur close to one with agenesis of kidneys and gonads.16 another (Figure 1F). WT1 encodes a transcription factor with an amino-terminal To identify potential WT1 target genes in podocytes, we proline- and glutamine-rich protein interaction domain and selected those genes that showed WT1 binding sites within four carboxy-terminal Krüppel-type (Cys2-His2) zinc fingers. their transcribed region, including sequences 3 kb upstream of WT1 comprises 10 exons and encodes at least 36 isoforms re- their annotated TSSs. With these criteria, we identified 1573 sulting from alternative splicing, usage of alternative translation protein-coding genes and 61 noncoding genes as potential WT1 start sites, and RNA editing.17 The most prominent alternative target genes (Supplemental Table 2). To interpret the biologic splicing occurs at two splice donor sites of exon 9, resulting in significance of WT1 binding sites in adult podocytes, we used the inclusion or exclusion of the three amino acids lysine, threonine, Cytoscape software, identifying the biologic processes and mo- and serine (KTS) between zinc fingers 3 and 4. The corresponding lecular functions enriched in our dataset (Figure 1G).23 The proteins are named WT1+KTS or WT12KTS, with the latter most highly enriched function related to actin filament organi- being considered as a bona fide transcription factor.18 In contrast, zation, indicating that WT1 regulates expression of cytoskeletal WT1+KTS isoforms preferentially bind RNA.19 To address the components in podocytes. Interestingly, one of highest ranking requirement of WT1 at different stages of kidney development clusters is glomerular development, which contains Myo1e, and maturation, we generated a conditional WT1 allele. Podocyte- Notch2, Plce1, Ptpro, etc. Thus, the functions of WT1 targets specificknockoutofWT1 in adult mice results in proteinuria, foot are consistent with the established role of WT1 in podocytes process effacement, and FSGS.20 However,themolecularroleof and thus, serve as an indicator for the quality of our dataset. WT1 in podocyte differentiation and maintenance is largely unknown. Here, we have identified the WT1 direct targetome in WT1 Maintains Podocytes Function as both an podocytes as well as WT1 target genes that are required for po- Activator and a Repressor docyte differentiation and homeostasis. To determine the functional consequence of WT1 activity in mature podocytes, we sought to integrate our WT1 target list with gene expression data. We used quadruple transgenic mice fl fl RESULTS (WT1 / ;Nphs2-rtTA;LC1), which allow us to delete WT1 in adult kidneys on doxycycline induction.20 To minimize sec- Genomic Characterization of WT1 Targets in Adult ondary or tertiary effects, we isolated glomeruli with a mag- Kidney netic bead perfusion method after 6 days of induction of WT1 To identify DNA-binding sites of WT1 across the genome deletion. At this time point, the respective knockout mice dis- of podocytes, we performed chromatin immunoprecipitation play slight proteinuria (Supplemental Figure 2). To identify followed by high-throughput sequencing (ChIP-Seq) from downstream genes of WT1 in podocytes, we performed an isolated mouse glomeruli. We performed two independent exon-array experiment on glomeruli on WT1 deletion. We ChIP-Seq experiments and obtained a minimum of 10 million observed 1753 differentially expressed genes after knockout reads per sample (Supplemental Table 1). Significantly en- of WT1 in adult podocytes by using a P value#0.05 as a cutoff riched WT1-occupied peaks were analyzed by the model- (Figure 2A, Supplemental Table 3). These genes were analyzed based analysis of ChIP-Seq algorithm.21 Overall, in the two for their molecular and cellular functions and involved KEGG experiments, we identified 4335 and 4956 significantly en- (Kyoto encyclopedia of genes and genomes) pathways using riched regions by the cutoff of P,0.001. Among those, 2257 the bioinformatic tool DAVID24 (Supplemental Table 4). The

J Am Soc Nephrol 26: 2118–2128, 2015 WT1 Target Genes in Podocytes 2119 BASIC RESEARCH www.jasn.org

analysis identified axon guidance, lysosome, and focal adhesion as the top three categories among the known affected biologic functions. Integrating our WT1 ChIP-Seq data with our microarray expression dataset, 192 genes were common to both gene lists. Although most of these genes were down- regulated in WT1 knockout glomeruli (148), there were also 44 genes that were upregulated. This indicates that WT1 acts as both an activator and a repressor of transcription (Figure 2B). The WT1 binding motif is identical in both instances, and the position of the WT1 binding region relative to the TSS of genes did not show a difference between activated and repressed genes (data not shown). To identify potential cofactors that could modulate the activating or repressive function of WT1, we masked the identified WT1 binding motifs to search for other consensus motifs that were overrepresented in its proximity. We identified enriched motifs for potential WT1 coactivators, including Sox5, Sox7, and some Fox proteins (e.g., FoxP1 and FoxP2) as potential corepressors (Supple- mental Figure 3).25 The intersection of the WT1 targetome that we identified here with genes reported to be specifically expressed in podocytes26 revealed that WT1 mostly activates podocyte-enriched genes and represses nonpodocyte-enriched genes (72% activation versus 16% repression) (Supplemental Figure 4). Because our data are derived from adult kidneys, they suggest a role for WT1 in defining and maintaining podocyte identity. Consistent with previous reports, we verified WT1 binding to the promoter of known transcriptional target genes of WT1, such as Nphs127,28 or Sulf1.29,30 Expression levels of both genes were significantly reduced in WT1 knockout mice (Supplemental Figure 5). Bioinformatic analysis of the common gene Figure 1. ChIP-Seq reveals WT1 binding to genes regulating podocyte function. (A) The list revealed the most affected pathways as Venn diagram depicts overlapping peaks of the significantly enriched genomic intervals of two regulation of cytoskeleton followed by focal biologic replicates of ChIP-Seq from the adult mouse kidney. (B) The genomic distribution of adhesion and tight junction (Figure 2C). Ex- fi the WT1 ChIP enrichment signal. Classi cation is on the basis of the following descriptions. amination of the WT1-deleted mouse podo- Promoter is within 3 kb upstream of TSS, and intergenic is between annotated genes (ex- cytes displayed widening and flattening of the cluding promoter regions). (C and D) The ChIP enrichment signal is highest near the TSS and footprocessesaswellasinterruptionoftheslit highly localized within 1 kb of TSSs. (E) Primary and secondary WT1 binding motifs identified 20 by MEME from the top 500 overlapping peaks. (F) The number of base pairs between primary diagram (Figure 2D). The glomerular base- and secondary motifs. (G) Gene ontology analysis of WT1 cistrome by defining the peaks ment membrane and its charge seemed un- localized to promoters or gene-transcribed regions. MEME, multiple Em for motif elicitation. affected by the podocyte-specific inactivation of WT1 as shown in electron microscopic

2120 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2118–2128, 2015 www.jasn.org BASIC RESEARCH

This led us to dissect the function of WT1 in maturing podocytes and their maintenance. We and others have shown the requirement of WT1 for podocyte homeostasis.20,30 However, the role of WT1 in podocyte maturation remains to be illustrated. Here, we used conditional podocyte–specific WT1 fl fl knockout mice (WT1 / ;Nphs2-Cre), in which Cre expression is driven by a fragment of the Nphs2 promoter. Nphs2 is expressed during podocyte maturation after the capil- fl fl lary loop stage.30 In WT1 / ;Nphs2-Cre mice, WT1 is detected at the capillary loop stage but not in mature glomeruli (Figure 3, A and B). Mutant mice were born at the expected Mendelian ratio but died within 24 hours after birth. Newborn animals suffered from anuria and kidney hemorrhage. Apart from this, the urogenital system displayed no gross abnormalities. On the histologic level, kid- fl fl neys of WT1 / ;Nphs2-Cre mice were characterized by a significant reduction in the number of mature glomeruli and proximal convoluted tubuli (Figure 3, C and D). Given the effect of podocyte-specific WT1 inactivation on functional kidney architecture, we addressed the question of structural defects regarding podocytes. Indeed, analysis using electron microscopy revealed structural changes in the form of abundant foot process effacement in knockout mice (Figure 3F, arrow). Detachment or loss of podocytes from the vascular tuft, which was detected in histologic analyses, could also be observed in ultrastructural studies Figure 2. WT1 maintains podocyte function as both an activator and a repressor. (A) The (Figure 3H, arrowheads). These data differential expression MA (log2[fold changes] to average intensity) plots between WT1 mutant and control glomeruli. (B) The Venn diagram depicts the overlapping genes of the show that WT1 regulates podocyte matu- WT1 cistrome and up- or downregulated genes in WT1 mutant mice. (C) KEGG pathway ration and that loss of WT1 in podocytes fi enrichment analysis of the WT1 targetome. Overrepresented KEGG pathways are shown in results in failure of the renal ltration the histogram. (D) Ultrastructural kidney analysis of WT1 mutant and control adult mice system. (age.8weeksold)treatedwithdoxycyclinefor6days. Podocytes (arrows) and endothelial cells (arrowheads) were abnormally distant from the glomerular basement membrane (G), WT1 Activates Expression of Nphs2, which was itself irregularly shaped in the mutant. Black dots indicate negative charges by Mafb, and Magi2 in Podocytes polyethylenimine staining. No obvious charge differences between the glomerular basement To characterize the genes that mediate the m membranes of mutant and control glomeruli are detectable. Scale bar, 0.5 m. KEGG, Kyoto function of WT1 in podocytes, we first encyclopedia of genes and genomes; MA, M (log ratios) and A (mean average) scale. sorted the genes by ChIP peaks localized in the promoter (#1500 bp from TSS) ac- analyses (Figure 2D). These morphologic changes of WT1 mutant cording to foldness of enrichment and only considered peaks podocytes are, thus, consistent with WT1-controlling genes that with an enrichment of $20-fold. Then, using our microarray are involved in pathways that regulate, for example, the cytoskel- analysis, only genes that were downregulated on WT1 knock- eton or cell-cell interaction as mentioned above. out (and therefore, normally activated by WT1) were used. Of those genes, we selected three for additional analysis; WT1 Is Required for Podocyte Maturation Nphs2, Mafb,andMagi2. WT1 binds to a consensus motif in Human patients with Denys–Drash and Frasier syndromes the promoter region of all of the three genes (Figure 4, A–C). exhibit glomerular defects caused by mutations in WT1.13,14 Mutation of NPHS2 in humans causes nephrotic syndrome.5

J Am Soc Nephrol 26: 2118–2128, 2015 WT1 Target Genes in Podocytes 2121 BASIC RESEARCH www.jasn.org

Mafb encodes a transcription factor that is expressed at the capillary loop stage and restricted to podocytes as shown in the GUDMAP database.31 Mafb has been shown to be required for podocyte development in mice.32,33 Magi2 is a component of the slit diaphragm complex and might have a function for the glomerular ﬁltration barrier.34 Indeed, Magi2 null mice display morphologic abnormalities of podocytes and anuria.35 Inactivation of WT1 resulted in loss of Podocin, Mafb, and Magi2 in podocytes (Figure 4, D–L).

Nphs2, mafba, and magi2 Are Conserved Functional Target Genes of WT1 in Zebrafish Toaddress the evolutionary conservation of WT1 targets in vivo, we turned to zebrafish, which have been frequently used to study podocyte formation during kidney development.36 Bioinformatic analysis identified single Nphs2 and Magi2 genes and two orthologs for Mafb in the zebrafish genome. Nphs2,37 mafba,38 and magi2 were found to be expressed in the glomerular region of the embryonic zebrafish kidney: the pronephros (Figure 5, A–C). Mafbb expression was not detectable in this region (Supplemental Figure 6). To determine whether regulation by WT1 was conserved, we examined nphs2, mafba,andmagi2 activity after wt1a and wt1b knockdown. Ex- pression levels of nphs2, mafba,andmagi2 were significantly reduced or absent in both morphants (Figure 5, D–I). This find- ing encouraged us to study the function of nphs2, mafba,andmagi2 by knockdown of the respective genes. The injection of

showing single glomerulus (GL) and convoluted proximal tubulus (PT) of normal ap- pearance. (G) High magnification identifies Figure 3. WT1 is required for podocyte differentiation. (A and B) Immunohistochemistry podocytes (P) with abundant foot processes of E18.5 kidney sections using an antibody against WT1 (red) shows disappearance of (arrows). (F) Section of a P0 WT1flox/flox;Nphs2-Cre WT1 signal in glomeruli of mutant mice (dotted lines) and the WT1flox/flox mouse as kidney depicting a glomerulus with one capillary a control. (C and D) Histologic analysis of sagittal kidney sections from newborn (P0) vessel deprived of surrounding podocytes (ar- control and WT1flox/flox;Nphs2-Cre mice stained with periodic acid–Schiff (PAS). In kid- row). Proteinaceous material (asterisks) was neys of mutant mice, the numbers of mature glomeruli and proximal convoluted tubuli found in Bowman’s space and neighboring were strongly reduced. Remaining glomeruli were smaller (arrow). The developmental tubuli. (H) High magnification of F reveals zone or outer renal cortex was without obvious pathologic findings. (E–H) Ultrastructural widespread foot process effacement (ar- kidney analysis from the inner cortex of newborn WT1flox/flox;Nphs2-Cre and control rowheads). Scale bar, 25 mminA,B,E,and mice. (E) Electron microscopy of a P0 WT1flox/+;Nphs2-Cre control kidney section F; 2 mminGandH.

2122 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2118–2128, 2015 www.jasn.org BASIC RESEARCH

Figure 4. WT1 binds to the promoters and activates expression of Nphs2, Mafb,andMagi2 in podocytes. (A–C) Binding of WT1 to the promoters of Nphs2, Mafb,andMagi2 as viewed in the University of California-Santa Cruz genome browser within the indicated genomic intervals. ChIP fragment sequences on DNA are shown in red and blue for the two independent WT1 ChIP-Seq datasets. Regions with overlaps are depicted in black. The peaks in the Nphs2, Mafb,andMagi2 loci are shown by yellow bars. Input control represents sequencing data of chromatin that were not subjected to immunoprecipitation. Conservation denotes placental mammal basewise conservation by Phastcons score. (D–L) Double immunostaining for WT1 and Podocin, Mafb, and Magi2 in glomeruli of (upper panel) WT1flox/flox or (lower panel) WT1flox/flox;Nphs2-Cre mice. Scale bar, 10 mm. antisense morpholinos against nphs2,37 mafba,andmagi2 re- knockdown zebrafish embryos, we extended our experiments sulted in severe pericardial edema (Figure 5, K–M), which is to the transgenic zebrafish line wt1b::GFP, which expresses similar to what is seen in wt1a/b morphants.39 To visualize GFP in the developing glomerulus and pronephric tubule.39 potential glomerular defects in nphs2, mafba,andmagi2 At 48 hours postfertilization, the nphs2, mafba,andmagi2

J Am Soc Nephrol 26: 2118–2128, 2015 WT1 Target Genes in Podocytes 2123 BASIC RESEARCH www.jasn.org

Figure 5. WT1 regulates nphs2, mafba,andmagi2 expression during pronephros development in zebrafish. (A–C) nphs2, mafba,and magi2 are expressed in glomeruli of zebrafish embryos (arrows). (D–I) nphs2, mafba,andmagi2 expressions are reduced in wt1a and wt1b morphants (arrows). (J–M) Knockdown of nphs2, mafba,ormagi2 results in pericardial edema (arrows). (N–U) Knockdown of nphs2, mafba,ormagi2 in zebrafish results in cyst formation as visualized using a transgenic wt1b::GFP.39 G, glomeruli; GFP, green fluorescent protein; MO, morpholino. morphants displayed significant pronephros defects, which DISCUSSION were visible as glomerular cysts (Figure 5, N–U). The strong effects observed after knockdown of nphs2, mafba,andmagi2 Several human glomerular diseases are caused by WT1 muta- in developing zebrafish embryos support the notion that, like tions, including missense mutation within exon 8 or 9 encoding Podocin, Mafb and Magi2 are regulators of pronephros develop- zinc fingers 2 or 3 in children with Denys–Drash syndrome or ment in zebrafish. Moreover, loss of expression of all three genes alterations of alternative splicing of WT1+KTS and WT12KTS in wt1a and wt1b morphants shows that Nphs2, Mafb, and Magi2 leading to Frasier syndrome. Both are characterized by nephrotic are conserved target genes of WT1 in podocytes. syndrome associated with glomerulosclerosis.13,14 The latter is

2124 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2118–2128, 2015 www.jasn.org BASIC RESEARCH the end point of a series of processes with podocyte damage or Mafb, a basic leucine zipper transcription factor, is essential loss as a common denominator.40 We and others had shown that for podocyte differentiation and foot process formation, deletion of WT1 in adult podocytes results in proteinuria, foot which was suggested by investigation of Mafb-deficient process effacement, and glomerulosclerosis.20,41 However, the mice.32,33 A recent study revealed that mutations causing al- WT1-dependent transcriptional network that governs podocyte terations in the amino-terminal transcriptional activation do- differentiation and maintenance remains to be deciphered. In main of MAFB cause multicentric carpotarsal osteolysis this study, we integrated the WT1 cistrome and transcriptome to (MCTO) characterized by aggressive osteolysis particularly provide insight into the complex role of WT1 in podocyte main- affecting the carpal and tarsal bones. Also, MCTO is frequently tenance. In addition, we analyzed the function of WT1 in podo- associated with progressive renal failure. The pathogenesis of cyte differentiation by using a podocyte-specificknockout MCTO might be attributed to MAFB dysfunction in osteoclasts mouse model. Experiments in zebrafish confirmed the role of and podocytes.50 Mafba, an ortholog in zebrafish, is expressed selected WT1 target genes in kidney development. during early stages of podocyte formation.38 In this work, Our ChIP-Seq data analysis revealed WT1 primary and we show that mafba is required for podocyte development secondary motifs to harbor a core GGGAGG sequence that in zebrafish. shows high similarity to previously published motifs that Magi2, encoding the membrane-associated guanylate ki- had been identified using ChIP on chip or restriction enzyme nase inverted 2, is upregulated on foot process differentiation assistant ChIP-Seq experiments on the developing mouse kid- and consistently expressed in adult podocytes.34,51 Magi2, to- ney at E18.5.42,43 The most striking difference is that we found gether with IQGAP1, CASK, spectrins, and a-actinin, is a two similar motifs close to each other in many peak fragments. component of the nephrin multiprotein complex.34 A recent This suggests that two or more WT1 molecules bind to the study has shown that deletion of the Magi2 gene in mice causes same promoter fragment or that WT1 binds as a dimer. In fact, neonatal lethality with podocyte morphologic abnormalities there is evidence that WT1 functions as a homodimer.44 Di- and anuria.35 We show here that magi2 is also expressed in merization is mediated by two distinct domains within the podocytes of zebrafish. Knockdown of magi2 in zebrafish re- N-terminal region.45 Our data also show that, in many cases, sults in glomerular defects and epicardial edema. In addition, binding sites for members of the Sox and Fox families can be WT1 targets include most genes responsible for hereditary found close to WT1 binding sites, showing that WT1 acts in podocyte diseases, such as NPHS1, LAMB2, LMX1b,and concert with other transcription factors. even WT1 itself (Supplemental Table 5). Visceral epithelial cells (podocytes) are derived from the cap In summary, our results show that WT1 is a crucial tran- mesenchyme, wherein WT1 is expressed at low levels. WT1 scription factor for podocyte maturation and maintenance. It expression increases in pretubular aggregates and is thought to fulfills its function by regulation of a number of key target genes, drive cells to undergo the mesenchymal-to-epithelial transi- including Nphs2, Mafb,andMagi2. Future work will have to tion by activating Wnt4.46 WT1 expression continues to in- identify the individual contributions of each target gene (e.g., crease along with development of podocyte progenitors and is by forcing its expression in WT1-negative podocytes in vivo). later restricted to adult podocytes.15 The integrity of podocytes and their interaction with the glomerular basement membrane are crucial for maintenance of the intact glomer- CONCISE METHODS ular filtration barrier. Alteration of the intercellular junctions and cytoskeletal structure of podocytes or their detachment Generation of the Mutant Mice fl fl from the membrane results in the development of albumin- The inducible podocyte–specific WT1 knockout mouse line (WT1 / ; uria.47 Interestingly, WT1 direct target genes in podocytes Nphs2-rtTA;LC1) was generated as described.20 To inactivate WT1, were enriched for regulation of actin cytoskeleton, focal ad- mice were fed with 2 mg/ml doxycycline in a 5% sucrose solution. The fl fl hesion, tight junction, and adherens junction, indicating that conditional podocyte–specific WT1 knockout mouse line (WT1 / ; WT1 is a central regulator of podocyte architecture. This is Nphs2-Cre) was generated by crossing WT1flox mice to the transgenic corroborated by the podocyte-specific WT1 knockout mouse Nphs2-Cre mice.52 All animal experiments were performed in accor- model that we used, where the loss of WT1 affected podocyte dance with institutional guidelines and ethical review committees. differentiation and led to kidney failure and death within 24 hours after birth. ChIP-Seq In this study, we focused on the characterization of the WT1 Briefly, glomeruli were isolated from 2- to 3-month-old C57BL/6 mice targets Nphs2, Mafb,andMagi2. Podocin is a key protein of the using the sieving method.53 Glomeruli were fixed with 1% formal- podocyte slit diaphragm protein complex, where it interacts dehyde for 15 minutes at 37°C, washed with 125 mM glycine, resus- with nephrin, NEPH1, and CD2AP.48,49 Mutations in the hu- pended in ChIP buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, man podocin gene NPHS2 cause a corticosteroid-resistant ne- 5 mM EDTA, 0.5% NP-40, 0.1% SDS, and 1.0% Triton X-100) con- phrotic syndrome owing to the disruption of filtration barrier taining protease inhibitors (Roche), and sonicated with the Bioruptor integrity.5 Podocin function is highly conserved between the for 30 minutes (30 seconds on and 30 seconds off). WT1 immuno- zebrafish pronephros and the mammalian metanephros.37 precipitation was performed as described54 using the C-19 antibody

J Am Soc Nephrol 26: 2118–2128, 2015 WT1 Target Genes in Podocytes 2125 BASIC RESEARCH www.jasn.org

(Santa Cruz Biotechnology). DNA was eluted with the Qiagen MinE- were applied. The following antibodies were used: a polyclonal rabbit lute PCR Purification Kit. Templates for ChIP-Seq analysis were pre- antipodocin antibody (diluted 1:100; Sigma-Aldrich), a monoclonal pared using the TruSeq ChIP Sample Prep Kit (Illumia) following the mouse anti-human WT1 antibody (diluted 1:100; Dako), a polyclonal manufacturer’s instructions. Sequencing was performed on an Illumina rabbit anti-Magi2 antibody (diluted 1:50; EMD Millipore), and the HiSeq2000 platform, and at least 10 million reads of 50-nucleotide polyclonal rabbit anti-Mafb antibody (diluted 1:50; Bethyl). After three single-end sequences were generated for each sample. The sequences washes, the sections were stained with an Alexa Fluor 594 goat anti- were mapped to the mouse genome (version mm10), allowing two base rabbit IgG antibody (diluted 1:500) or an Alexa 488-conjugated goat mismatches. Peak calling was carried out using model-based analysis of anti-mouse IgG antibody (diluted 1:500; Invitrogen) for 1 hour at room ChIP-Seq.55 Peaks were considered identical when they showed an over- temperature. The DNA was visualized using Hoechst staining before lap of at least 6 bp. WT1 binding motif was carried out using MEME.22 mounting slides with ProLong Gold Antifade Mountant (Life Tech- nology). Sections were analyzed with a Carl Zeiss Axio Imager Microarray ApoTome. Pictures were taken with a Carl Zeiss AxioCam MRm Two sets of six 2- to 3-month-old mice with each of the following digital camera. fl fl fl fl genotypes (WT1 ox/ ox;Nphs2-rtTA;LC-1 and WT1 ox/ ox;Nphs2- rtTA) were treated for 6 days with doxycycline in the drinking water. Zebrafish Maintenance Subsequently, glomeruli were extracted using magnetic bead perfusion.56 Zebrafish were maintained under standard conditions for zebrafish RNAwas isolated from the glomeruli using the RNeasy Mini Kit (Qiagen). husbandry.58 Embryos were raised at 28°C and staged according to The resulting RNA was then used to create the biotin-labeled library to morphologic criteria.59 be hybridized on GeneChips Exon 1.0 STmouse microarrays following the procedure described by the manufacturer (Affymetrix). The hybrid- Whole-Mount In Situ Hybridization ization data were analyzed using oneChannelGUI.57 The list of differ- The cDNA fragment, which was used for the riboprobe of zebrafish entially expressed genes was generated using an FDR#0.05. mafba, was amplified with primer pair 59-CCACGAGCGACAACC- CGTCCT-39 (forward) and 59-GTTCCCCCTGTCGCCTCTCTC-39 Transmission Electron Microscopy (reverse), giving rise to a 510-bp PCR product. The zebrafish magi2 Newborn (P0) mice were euthanized by decapitation, and kidneys cDNA fragment was amplified with primers 59-CCCCCGAAGAATG- were harvested, washed in 13 PBS, fixed in a freshly prepared solu- CAAGGAA-39 (forward) and 59-AAGAACAAACTGTGCCTCCTCT-39 tionof2%glutaraldehyde(Sigma-Aldrich)in13 PBS for 2 d at 4°C, (reverse), giving rise to a 1014-bp PCR product. The nphs2 probe was and conserved for 2–4din13 PBS-buffered 0.02% sodium azide used as previously described.39 Whole-mount in situ hybridization was (Merck GmbH) at 4°C. Adult mice were deeply anesthetized with performed as described.39 Embryos were hybridized with a digoxigenin- xylazine/ketamine and perfused with 40 ml freshly prepared 2% labeled riboprobe of nphs2, mafba,ormagi2. Anti-DIG AP and glutaraldehyde/13 PBS through the heart’s left ventricle. After iso- NBT/BCIP (Roche) were used to detect the probe. After color re- lation, kidneys were cut into small pieces of approximately 1 mm3 action, embryos were washed with methanol, equilibrated in clear- and postfixed in 2% glutaraldehyde/13 PBS for 3–4 d at 4°C. The ing solution (1/3 benzoyl-alcohol and 2/3 benzoyl-benzoate), and specimens were incubated with cacodylate-buffered 1% OsO4 for photographed using a stereomicroscope (SteREO Discovery V8; 2–3 hours before being embedded in Epon. Ultrathin sections were Zeiss). stainedwithuranylacetateandleadcitrateandthenvisualizedinatrans- mission electron microscope (Carl Zeiss EM 902) equipped with a cooled Zebrafish Experiments CCD digital camera (TRS Tröndle Restlichtverstärkersysteme). Antisense morpholino-oligonucleotides (GeneTools) were directed against the translational start site (mafba and magi2)orthesplicedonor Polyethylenimine Staining site of exon 3 (nphs2). As a control, a standard morpholino that is direct- Kidneys of euthanized adult mice were isolated, cut into 1-mm3 ing against a human b-globin intron mutation was used. Morpholinos pieces, stained with 0.5% polyethylenimine in 0.9% NaCl (pH 7.3) were diluted in water to a working concentration of 1 mM with 0.1% for 30 minutes, washed with three changes of 50 mM sodium caco- phenol red as a tracer. Dose-response experiments were carried out by dylate for 10 minutes each, fixed in 2% phosphotungstic acid/ injections of 0.1–0.5 nl into the yolk of one- or two-cell embryos using a 0.1% glutaraldehyde for 1 hour, washed with 50 mM sodium ca- manual manipulator (type M1; Saur). The following morpholino oligo- codylate buffer, treated for 2 hours with 1% OsO4 in 25 mM nucleotides were used in this study: nphs2, TGCGATTTAAAACGTG- sodium cacodylate for contrasting, dehydrated, and embedded TACCAGGGC; mafba, CGCTCATCGTGCCCCTGTTCTTCAG; magi2, in EPON 812. TTTTCTTCTTCAGGCTTTTGGACAT; and wt1a and wt1b as de- scribed39; 24, 48, and 72 hours postfertilization, injected embryos were Immunohistochemistry treated with 0.016% tricaine (Sigma) before being evaluated for morpho- E18.5 kidneys of WT1 mutant and control mice were fixed in 4% PFA, logic defects using the epifluorescence microscope Zeiss SteREO Discov- embedded in paraffin, and cut into 8-mm sections. The sections were ery V8. To determine the lowest morpholino concentration required to deparaffinized, subjected to antigen retrieval treatment, and blocked induce morphologic defects, injections with increasing morpholino dos- for 1 hour at room temperature in 5% normal donkey serum, 1% age were performed. Images were generated using the AxioVision soft- BSA, and 0.1% Triton X-100 in PBS before the primary antibodies ware (Carl Zeiss).

2126 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2118–2128, 2015 www.jasn.org BASIC RESEARCH

ACKNOWLEDGMENTS 11. Huff V: Wilms tumor genetics. Am J Med Genet 79: 260–267, 1998 12. Narahara K, Kikkawa K, Kimira S, Kimoto H, Ogata M, Kasai R, We thank Abinaya Nathan and Thomas Bates for critically reading Hamawaki M, Matsuoka K: Regional mapping of catalase and Wilms tumor— aniridia, genitourinary abnormalities, and mental retardation and improving this manuscript and Gundula Bergner for secretarial triad loci to the chromosome segment 11p1305——p1306. Hum assistance. We also thank Cornelia Luge for chromatin immuno- Genet 66: 181–185, 1984 precipitation followed by high-throughput sequencing library 13. Pelletier J, Bruening W, Kashtan CE, Mauer SM, Manivel JC, Striegel JE, preparation, Jenny Buchelt and Frank Kaufmann for maintenance Houghton DC, Junien C, Habib R, Fouser L, Fine RN, Silverman BL, ’ of the mouse colonies, and Sabrina Stötzer and Christina Ebert for Harber DA, Housman D: Germline mutations in the Wilms tumor suppressor gene are associated with abnormal urogenital development in zebrafish husbandry. We thank Maik Baldauf and Gabriele Günther Denys-Drash syndrome. Cell 67: 437–447, 1991 for technical support and many other members of our laboratory 14. Barbaux S, Niaudet P, Gubler MC, Grünfeld JP, Jaubert F, Kuttenn F, for their helpful discussions and contributions. Fékété CN, Souleyreau-Therville N, Thibaud E, Fellous M, McElreavey This work was supported by Deutsche Forschungsgemeinschaft K: Donor splice-site mutations in WT1 are responsible for Frasier syn- Grants SFB 699 (to R.W.) and EN280/8-1 (to C.E.). drome. Nat Genet 17: 467–470, 1997 15. Mundlos S, Pelletier J, Darveau A, Bachmann M, Winterpacht A, Zabel B: Nuclear localization of the protein encoded by the Wilms’ tumor gene WT1 in embryonic and adult tissues. Development 119: 1329– DISCLOSURES 1341, 1993 16. Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D, None. Jaenisch R: WT-1 is required for early kidney development. Cell 74: 679–691, 1993 17. Ozdemir DD, Hohenstein P: WT1 in the kidney—ataleinmouse REFERENCES models. Pediatr Nephrol 29: 687–693, 2014 18. Bickmore WA, Oghene K, Little MH, Seawright A, van Heyningen V, Hastie ND: Modulation of DNA binding specificity by alternative 1. Pavenstädt H, Kriz W, Kretzler M: Cell biology of the glomerular po- splicing of the Wilms tumor wt1 gene transcript. Science 257: 235–237, docyte. Physiol Rev 83: 253–307, 2003 1992 2. Dressler GR: The cellular basis of kidney development. Annu Rev Cell 19. Caricasole A, Duarte A, Larsson SH, Hastie ND, Little M, Holmes G, Dev Biol 22: 509–529, 2006 Todorov I, Ward A: RNA binding by the Wilms tumor suppressor zinc 3. Greka A, Mundel P: Cell biology and pathology of podocytes. Annu Rev finger proteins. Proc Natl Acad Sci U S A 93: 7562–7566, 1996 Physiol 74: 299–323, 2012 20. Gebeshuber CA, Kornauth C, Dong L, Sierig R, Seibler J, Reiss M, 4. Kestilä M, Lenkkeri U, Männikkö M, Lamerdin J, McCready P, Putaala H, Tauber S, Bilban M, Wang S, Kain R, Böhmig GA, Moeller MJ, Gröne Ruotsalainen V, Morita T, Nissinen M, Herva R, Kashtan CE, Peltonen L, HJ, Englert C, Martinez J, Kerjaschki D: Focal segmental glomerulo- Holmberg C, Olsen A, Tryggvason K: Positionally cloned gene for a sclerosis is induced by microRNA-193a and its downregulation of WT1. novel glomerular protein—nephrin—is mutated in congenital nephrotic Nat Med 19: 481–487, 2013 syndrome. Mol Cell 1: 575–582, 1998 21. Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, 5. Boute N, Gribouval O, Roselli S, Benessy F, Lee H, Fuchshuber A, Nusbaum C, Myers RM, Brown M, Li W, Liu XS: Model-based analysis of Dahan K, Gubler MC, Niaudet P, Antignac C: NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid- ChIP-Seq (MACS). Genome Biol 9: R137, 2008 resistant nephrotic syndrome. Nat Genet 24: 349–354, 2000 22. Machanick P, Bailey TL: MEME-ChIP: Motif analysis of large DNA da- – 6. Hinkes B, Wiggins RC, Gbadegesin R, Vlangos CN, Seelow D, Nürnberg tasets. Bioinformatics 27: 1696 1697, 2011 G, Garg P, Verma R, Chaib H, Hoskins BE, Ashraf S, Becker C, Hennies 23. Saito R, Smoot ME, Ono K, Ruscheinski J, Wang PL, Lotia S, Pico AR, HC, Goyal M, Wharram BL, Schachter AD, Mudumana S, Drummond I, Bader GD, Ideker T: A travel guide to Cytoscape plugins. Nat Methods – Kerjaschki D, Waldherr R, Dietrich A, Ozaltin F, Bakkaloglu A, Cleper R, 9: 1069 1076, 2012 Basel-Vanagaite L, Pohl M, Griebel M, Tsygin AN, Soylu A, Müller D, 24. Huang W, Sherman BT, Lempicki RA: Systematic and integrative anal- Sorli CS, Bunney TD, Katan M, Liu J, Attanasio M, O’toole JF, ysis of large gene lists using DAVID bioinformatics resources. Nat – Hasselbacher K, Mucha B, Otto EA, Airik R, Kispert A, Kelley GG, Smrcka Protoc 4: 44 57, 2009 AV, Gudermann T, Holzman LB, Nürnberg P, Hildebrandt F: Positional 25. Gupta S, Stamatoyannopoulos JA, Bailey TL, Noble WS: Quantifying cloning uncovers mutations in PLCE1 responsible for a nephrotic syn- similarity between motifs. Genome Biol 8: R24, 2007 drome variant that may be reversible. Nat Genet 38: 1397–1405, 2006 26. Boerries M, Grahammer F, Eiselein S, Buck M, Meyer C, Goedel M, 7. Call KM, Glaser T, Ito CY, Buckler AJ, Pelletier J, Haber DA, Rose EA, Bechtel W, Zschiedrich S, Pfeifer D, Laloë D, Arrondel C, Gonçalves S, Kral A, Yeger H, Lewis WH, Jones C, Housman DE: Isolation and char- Krüger M, Harvey SJ, Busch H, Dengjel J, Huber TB: Molecular acterization of a zinc finger polypeptide gene at the human chromo- fingerprinting of the podocyte reveals novel gene and protein some 11 Wilms’ tumor locus. Cell 60: 509–520, 1990 regulatory networks. Kidney Int 83: 1052–1064, 2013 8. Gessler M, Poustka A, Cavenee W, Neve RL, Orkin SH, Bruns GA: Ho- 27. Wagner N, Wagner KD, Xing Y, Scholz H, Schedl A: The major podocyte mozygous deletion in Wilms tumours of a zinc-finger gene identified by protein nephrin is transcriptionally activated by the Wilms’ tumor sup- chromosome jumping. Nature 343: 774–778, 1990 pressor WT1. J Am Soc Nephrol 15: 3044–3051, 2004 9. Haber DA, Buckler AJ, Glaser T, Call KM, Pelletier J, Sohn RL, Douglass 28. Guo G, Morrison DJ, Licht JD, Quaggin SE: WT1 activates a glomerular- EC, Housman DE: An internal deletion within an 11p13 zinc finger gene specific enhancer identified from the human nephrin gene. JAmSoc contributes to the development of Wilms’ tumor. Cell 61: 1257–1269, Nephrol 15: 2851–2856, 2004 1990 29. Schumacher VA, Schlötzer-Schrehardt U, Karumanchi SA, Shi X, Zaia J, 10. Rose EA, Glaser T, Jones C, Smith CL, Lewis WH, Call KM, Minden M, Jeruschke S, Zhang D, Pavenstädt H, Drenckhan A, Amann K, Ng C, Champagne E, Bonetta L, Yeger H, Housman DE: Complete physical Hartwig S, Ng KH, Ho J, Kreidberg JA, Taglienti M, Royer-Pokora B, Ai X: map of the WAGR region of 11p13 localizes a candidate Wilms’ tumor WT1-dependent sulfatase expression maintains the normal glomerular gene. Cell 60: 495–508, 1990 filtration barrier. J Am Soc Nephrol 22: 1286–1296, 2011

J Am Soc Nephrol 26: 2118–2128, 2015 WT1 Target Genes in Podocytes 2127 BASIC RESEARCH www.jasn.org

30. Ratelade J, Arrondel C, Hamard G, Garbay S, Harvey S, Biebuyck N, 45. Holmes G, Boterashvili S, English M, Wainwright B, Licht J, Little M: Two Schulz H, Hastie N, Pontoglio M, Gubler MC, Antignac C, Heidet L: A N-terminal self-association domains are required for the dominant murine model of Denys-Drash syndrome reveals novel transcriptional negative transcriptional activity of WT1 Denys-Drash mutant proteins. targets of WT1 in podocytes. Hum Mol Genet 19: 1–15, 2010 Biochem Biophys Res Commun 233: 723–728, 1997 31. Davies JA, Little MH, Aronow B, Armstrong J, Brennan J, Lloyd-MacGilp S, 46. Essafi A, Webb A, Berry RL, Slight J, Burn SF, Spraggon L, Velecela V, Armit C, Harding S, Piu X, Roochun Y, Haggarty B, Houghton D, Davidson Martinez-Estrada OM, Wiltshire JH, Roberts SG, Brownstein D, Davies D, Baldock R: Access and use of the GUDMAP database of genitourinary JA, Hastie ND, Hohenstein P: A wt1-controlled chromatin switching development. Methods Mol Biol 886: 185–201, 2012 mechanism underpins tissue-specific wnt4 activation and repression. 32. Sadl V, Jin F, Yu J, Cui S, Holmyard D, Quaggin S, Barsh G, Cordes S: The Dev Cell 21: 559–574, 2011 mouse Kreisler (Krml1/MafB) segmentation gene is required for differen- 47. Brinkkoetter PT, Ising C, Benzing T: The role of the podocyte in albumin tiation of glomerular visceral epithelial cells. Dev Biol 249: 16–29, 2002 filtration. Nat Rev Nephrol 9: 328–336, 2013 33. Moriguchi T, Hamada M, Morito N, Terunuma T, Hasegawa K, Zhang C, 48. Schwarz K, Simons M, Reiser J, Saleem MA, Faul C, Kriz W, Shaw AS, Yokomizo T, Esaki R, Kuroda E, Yoh K, Kudo T, Nagata M, Greaves DR, Holzman LB, Mundel P: Podocin, a raft-associated component of the Engel JD, Yamamoto M, Takahashi S: MafB is essential for renal de- glomerular slit diaphragm, interacts with CD2AP and nephrin. JClin velopment and F4/80 expression in macrophages. Mol Cell Biol 26: Invest 108: 1621–1629, 2001 5715–5727, 2006 49. Sellin L, Huber TB, Gerke P, Quack I, Pavenstadt H, Walz G: NEPH1 34. Lehtonen S, Ryan JJ, Kudlicka K, Iino N, Zhou H, Farquhar MG: Cell defines a novel family of podocin interacting proteins. FASEB J 17: junction-associated proteins IQGAP1, MAGI-2, CASK, spectrins, and 115–117, 2003 alpha-actinin are components of the nephrin multiprotein complex. 50. Zankl A, Duncan EL, Leo PJ, Clark GR, Glazov EA, Addor MC, Herlin T, Proc Natl Acad Sci U S A 102: 9814–9819, 2005 Kim CA, Leheup BP, McGill J, McTaggart S, Mittas S, Mitchell AL, 35. Ihara K, Asanuma K, Fukuda T, Ohwada S, Yoshida M, Nishimori K: Mortier GR, Robertson SP, Schroeder M, Terhal P, Brown MA: Multi- MAGI-2 is critical for the formation and maintenance of the glomerular centric carpotarsal osteolysis is caused by mutations clustering in the filtration barrier in mouse kidney. Am J Pathol 184: 2699–2708, 2014 amino-terminal transcriptional activation domain of MAFB. Am J Hum 36. Kroeger PT Jr., Wingert RA: Using zebrafish to study podocyte genesis Genet 90: 494–501, 2012 during kidney development and regeneration. Genesis 52: 771–792, 2014 51. Ihara KI, Nishimura T, Fukuda T, Ookura T, Nishimori K: Generation of 37. Kramer-Zucker AG, Wiessner S, Jensen AM, Drummond IA: Organi- Venus reporter knock-in mice revealed MAGI-2 expression patterns in zation of the pronephric filtration apparatus in zebrafish requires adult mice. Gene Expr Patterns 12: 95–101, 2012 Nephrin, Podocin and the FERM domain protein Mosaic eyes. Dev Biol 52. Moeller MJ, Sanden SK, Soofi A, Wiggins RC, Holzman LB: Podocyte- 285: 316–329, 2005 specific expression of cre recombinase in transgenic mice. Genesis 35: 38. O’Brien LL, Grimaldi M, Kostun Z, Wingert RA, Selleck R, Davidson AJ: 39–42, 2003 WT1a, Foxc1a, and the Notch mediator Rbpj physically interact and regulate 53. Akis N, Madaio MP: Isolation, culture, and characterization of endo- the formation of podocytes in zebrafish. Dev Biol 358: 318–330, 2011 thelial cells from mouse glomeruli. Kidney Int 65: 2223–2227, 2004 39. Perner B, Englert C, Bollig F: The Wilms tumor genes wt1a and wt1b 54. Heliot C, Cereghini S: Analysis of in vivo transcription factor recruitment control different steps during formation of the zebrafish pronephros. by chromatin immunoprecipitation of mouse embryonic kidney. Dev Biol 309: 87–96, 2007 Methods Mol Biol 886: 275–291, 2012 40. Mondini A, Messa P, Rastaldi MP: The sclerosing glomerulus in mice and 55. Feng J, Liu T, Qin B, Zhang Y, Liu XS: Identifying ChIP-seq enrichment man: Novel insights. Curr Opin Nephrol Hypertens 23: 239–244, 2014 using MACS. Nat Protoc 7: 1728–1740, 2012 41. Chau YY, Brownstein D, Mjoseng H, Lee WC, Buza-Vidas N, Nerlov C, 56. Takemoto M, Asker N, Gerhardt H, Lundkvist A, Johansson BR, Saito Y, Jacobsen SE, Perry P, Berry R, Thornburn A, Sexton D, Morton N, Betsholtz C: A new method for large scale isolation of kidney glomeruli Hohenstein P, Freyer E, Samuel K, van’t Hof R, Hastie N: Acute multiple from mice. Am J Pathol 161: 799–805, 2002 organ failure in adult mice deleted for the developmental regulator 57. Sanges R, Cordero F, Calogero RA: oneChannelGUI: A graphical in- WT1. PLoS Genet 7: e1002404, 2011 terface to Bioconductor tools, designed for life scientists who are not 42. Motamedi FJ, Badro DA, Clarkson M, Lecca MR, Bradford ST, Buske FA, familiar with R language. Bioinformatics 23: 3406–3408, 2007 Saar K, Hübner N, Brändli AW, Schedl A: WT1 controls antagonistic 58. Westerfield M: The Zebrafish Book. A Guide for the Laboratory Use of FGF and BMP-pSMAD pathways in early renal progenitors. Nat Com- Zebrafish (Danio rerio), 3rd Edition Eugene, OR, University of Oregon mun 5: 4444, 2014 Press,385 (Book) 1995. 43. Hartwig S, Ho J, Pandey P, Macisaac K, Taglienti M, Xiang M, Alterovitz 59. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF: Stages of G, Ramoni M, Fraenkel E, Kreidberg JA: Genomic characterization of embryonic development of the zebrafish. Dev Dyn 203: 253–310, 1995 Wilms ’ tumor suppressor 1 targets in nephron progenitor cells during kidney development. Development 137: 1189–1203, 2010 44. Moffett P, Bruening W, Nakagama H, Bardeesy N, Housman D, Housman DE, Pelletier J: Antagonism of WT1 activity by protein self- This article contains supplemental material online at http://jasn.asnjournals. association. Proc Natl Acad Sci U S A 92: 11105–11109, 1995 org/lookup/suppl/doi:10.1681/ASN.2014080819/-/DCSupplemental.

2128 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2118–2128, 2015

Supplemental data

Figure S1 ChIP-Seq analysis defines in vivo binding sites for Wt1 in the mouse genome (version mm10) relative to distance of transcriptional start sites. Mapping of the overlapping peaks from two independent ChIP-Seq experiments indicate that Wt1 works through both proximal and distal regulatory elements.

Figure S2. Coomassie staining of SDS-PAGE gel with urine samples from inducible Wt1 podocyte-specific knock out mice. Mouse T846 with strong proteinuria served as a positive control. The first six mice showing slight proteinuria were used for the microarray experiment.

A B

Figure S3 Neighboring motifs of Wt1 consensus sites in Wt1 up-regulated and down-regulated genes. (A) Neighboring motif of Wt1 consensus sites in Wt1 up-regulated genes indicating Sox 5 and Sox7 family binding motif. (B) Neighboring motif of Wt1 consensus sites in Wt1 down-regulated genes indicating Fox family binding motif (FoxP1, FoxP2, Foxj3, Foxj1, FoxK1 and Foxa2). 1

Figure S4. Venn diagram analysis of Wt1 up-regulated and Wt1 down-regulated genes along with podocytes enriched genes. The podocyte enriched gene list is from published data (fold change ≥ 2 compared to the rest of mouse glomeruli). 2

1.2 Nphs1 1

0.8 0.6

Nphs1 0.4 0.2 0 Control Wt1 mutant

B 1.2 Sulf1

Sulf1 0.8 0.6 0.4 0.2

0 Control Wt1 mutant

Figure S5 Wt1 positively regulates Nphs1 and Sulf1 in podocytes. (A, B) ChIP-Seq analysis on adult glomeruli identified Wt1 binding sites close to the transcription start sites of Nphs1 and Sulf1. Binding of Wt1 as viewed in the UCSC browser within the indicated genomic intervals (mm10 coordinates). ChIP product sequences on DNA are shown in red and blue for the two independent Wt1 ChIP-Seq data sets. The regions with overlaps are depicted in dark color. The peaks in the Nphs1 and Sulf1 loci are shown by a yellow line. Input control represents sequencing data of chromatin that were not subjected to immunoprecipitation. Conservation denotes placental mammal basewise conservation by Phastcons score. (C, D) Quantitative reverse transcription PCR shows the down-regulation of Nphs1 and Sulf1 after knock down of Wt1 in adult podocytes

Figure S6. In situ hybridization of mafbb expression in zebrafish at 48 hpf. The mafbb signal is not detectable in the glomerular region.

Table 1. Overview of obtained and uniquely mapped reads from two independent ChIP-Seq experiments

sample Σ reads (millions) uniquely mapped reads (Bowtie1)

1st Wt1 ChIP-Seq 14.8 37%

1st Input control 21.6 42%

2nd Wt1 ChIP-Seq 57.4 37%

2nd Input control 66.8 30%

Table 2 Summary of Wt1 ChIP-Seq peaks in genome indicating regulated genes. See excel file 1

Table 3 Differentially expressed gene list upon microarray analysis of wild type and mutant glomeruli. See excel file 2

Table 4. Functional annotation of microarray data by DAVID

Term Count % PValue mmu04360:Axon guidance 32 1.785714 1.12E-05 mmu04142:Lysosome 30 1.674107 1.18E-05 mmu04510:Focal adhesion 41 2.287946 3.64E-05 mmu00480:Glutathione metabolism 15 0.837054 7.59E-04 mmu04810:Regulation of actin cytoskeleton 38 2.120536 0.002188 mmu04530:Tight junction 26 1.450893 0.003673 mmu00190:Oxidative phosphorylation 25 1.395089 0.004559 mmu00230:Purine metabolism 28 1.5625 0.007371 mmu00531:Glycosaminoglycan degradation 8 0.446429 0.007861

mmu00020:Citrate cycle (TCA cycle) 9 0.502232 0.013273 mmu04110:Cell cycle 23 1.283482 0.014815 mmu05222:Small cell lung cancer 17 0.948661 0.015628 mmu05212:Pancreatic cancer 15 0.837054 0.017522 mmu00511:Other glycan degradation 6 0.334821 0.021407 mmu00240:Pyrimidine metabolism 18 1.004464 0.022929 mmu04310:Wnt signaling pathway 25 1.395089 0.023721 mmu04340:Hedgehog signaling pathway 12 0.669643 0.024131 mmu00100:Steroid biosynthesis 6 0.334821 0.027748 mmu00520:Amino sugar and nucleotide sugar metabolism 10 0.558036 0.038478 mmu05010:Alzheimer's disease 28 1.5625 0.044132 mmu04670:Leukocyte transendothelial migration 20 1.116071 0.044433 mmu05016:Huntington's disease 28 1.5625 0.046787 mmu04120:Ubiquitin mediated proteolysis 22 1.227679 0.049049 mmu00604:Glycosphingolipid biosynthesis 5 0.279018 0.066388 mmu00970:Aminoacyl-tRNA biosynthesis 9 0.502232 0.070914 mmu04144:Endocytosis 29 1.618304 0.082863 mmu04114:Oocyte meiosis 18 1.004464 0.098234

Table 5 List of genes mutation of which affects podocyte structure and function in human patients.3 Those genes that were identified in this work as Wt1 targets either by ChIP-Seq or microarray are indicated.

Protein Gene Associated diseases ChIP-Seq Microarray

WT1 WT1 Denys-Drash syndrome (DDS) Frasier’s × syndrome (FS) Nephrin NPHS1 Congenital nephrotic syndrome of the × × Finnish type (CNF) Podocin NPHS2 Corticosteroid-resistant nephrotic × × syndrome (SRNS) PLCε1 PLCE1 Inherited nephrotic syndrome ×

α-Actinin-4 ACTN4 Focal segmental glomerulosclerosis × × (FSGS) INF2 INF2 FSGS × ×

CD2AP CD2AP Sporadic FSGS

Synaptopodin SYNPO Sporadic FSGS ×

Myosin 1E MYO1E Childhood FSGS ×

LMX1B LMX1B Nail-patella syndrome × ×

Laminin β2 LAMB2 Pierson’s syndrome Occasionally oligosymptomatic disease TRPC6 TRPC6 FSGS

MYH9 MYH9 Epstein syndrome Fechtner syndrome × ×

Apolipoprotein APOL1 Sporadic FSGS L-1 Glypican 5 GPC5 Acquired nephrotic syndrome

1. Gupta, S, Stamatoyannopoulos, JA, Bailey, TL, Noble, WS: Quantifying similarity between motifs. Genome biology, 8: R24, 2007. 2. Boerries, M, Grahammer, F, Eiselein, S, Buck, M, Meyer, C, Goedel, M, Bechtel, W, Zschiedrich, S, Pfeifer, D, Laloe, D, Arrondel, C, Goncalves, S, Kruger, M, Harvey, SJ, Busch, H, Dengjel, J, Huber, TB: Molecular fingerprinting of the podocyte reveals novel gene and protein regulatory networks. Kidney international, 83: 1052-1064, 2013. 3. Greka, A, Mundel, P: Cell biology and pathology of podocytes. Annual review of physiology, 74: 299- 323, 2012.

Excel 1:Summary of Wt1 ChIP-Seq peaks in genome indicating regulated genes peak Chrom Start End peak score genes MACS_peak_104 chr1 73424896 73425420 166.8 Tnp1 (-409259), Tns1 (+699289) MACS_peak_107 chr1 74249326 74249802 162.28 Gpbar1 (-29036), Arpc2 (+13014) MACS_peak_109 chr1 74386418 74387312 194.52 Ctdsp1 (-4744) MACS_peak_110 chr1 75384424 75385117 133.55 Gmppa (-51172), Speg (+9474) MACS_peak_111 chr1 75387005 75387628 119.99 Gmppa (-48626), Speg (+12020) MACS_peak_113 chr1 76070680 76071302 79.87 Slc4a3 (+524725) MACS_peak_12 chr1 13372406 13373223 121.22 Prdm14 (-245652), Ncoa2 (+1268) MACS_peak_121 chr1 82291021 82291765 66.87 Irs1 (+46) MACS_peak_122 chr1 82603387 82603742 66.82 Mff (-121353), Col4a3 (+16644) MACS_peak_127 chr1 84619163 84619677 110.77 Pid1 (-334775), Dner (+76801) MACS_peak_128 chr1 85758219 85758774 236.17 Cab39 (-34950), A630001G21Rik (-21891) MACS_peak_13 chr1 13373984 13374578 72.68 Ncoa2 (-198) MACS_peak_130 chr1 86472126 86472724 71.14 Ptma (-54311), 1700019O17Rik (+46096) MACS_peak_134 chr1 88738625 88739396 83.34 Sh3bp4 (-331451), Arl4c (-36820) MACS_peak_135 chr1 88975991 88976744 99.52 Arl4c (-274177), Sh3bp4 (-94094) MACS_peak_137 chr1 89555123 89555841 185.59 Agap1 (+100671), Gbx2 (+375694) MACS_peak_138 chr1 89575672 89576063 93.36 Agap1 (+121057), Gbx2 (+355308) MACS_peak_139 chr1 89690905 89691666 78.62 Agap1 (+236475), Gbx2 (+239890) MACS_peak_14 chr1 13738208 13738825 89.58 Xkr9 (+69746), Eya1 (+571682) MACS_peak_140 chr1 90440873 90441728 189.13 Cops8 (-162124), Cxcr7 (+237298) MACS_peak_141 chr1 90442655 90443330 85.06 Cops8 (-160432), Cxcr7 (+238990) MACS_peak_142 chr1 90470732 90471552 232.8 Cops8 (-132283), Cxcr7 (+267139) MACS_peak_143 chr1 90506540 90507344 54.66 Cops8 (-96483), Cxcr7 (+302939) MACS_peak_144 chr1 91052803 91053346 107.49 Lrrfip1 (-369) MACS_peak_145 chr1 91456524 91456923 60 Hes6 (-43502), Per2 (+2604) MACS_peak_146 chr1 92687055 92687559 98.13 Gpc1 (-144379), Otos (-38466) MACS_peak_147 chr1 93176396 93176955 75.5 Sned1 (-59221), 2310007B03Rik (-15728) MACS_peak_15 chr1 13775260 13776036 93.81 Xkr9 (+106877), Eya1 (+534551) MACS_peak_16 chr1 14309840 14310749 60.45 Eya1 (-96) MACS_peak_161 chr1 106719055 106719746 71.57 Bcl2 (-5111), Kdsr (+40341) MACS_peak_162 chr1 106759460 106760044 83.05 Kdsr (-10) MACS_peak_173 chr1 119626824 119627236 100.36 Epb4.1l5 (+21970), Tmem185b (+100863) MACS_peak_174 chr1 120557132 120557827 122.87 Marco (-52396), En1 (-45007) MACS_peak_177 chr1 121327587 121328277 60.06 Insig2 (+4648), En1 (+725445) MACS_peak_178 chr1 121540398 121540864 83.79 Htr5b (-12166), Ddx18 (+27349) MACS_peak_183 chr1 125458473 125458963 171.57 Slc35f5 (-102298), Actr3 (-23228) MACS_peak_186 chr1 127306332 127306799 521.86 Mgat5 (+101580), Tmem163 (+371455) MACS_peak_188 chr1 127348552 127349233 114 Mgat5 (+143907), Tmem163 (+329128) MACS_peak_189 chr1 130455212 130455542 55.19 Daf2 (-32378), Cd55 (+7363) MACS_peak_19 chr1 19899215 19899928 287.29 Tcfap2b (+687518), Pkhd1 (+718485) MACS_peak_191 chr1 131486528 131487469 308.21 Ikbke (-207436), Srgap2 (+40362) MACS_peak_194 chr1 132335419 132335939 143.77 Nuak2 (+19554), Tmcc2 (+55602) MACS_peak_196 chr1 132417432 132417979 57.83 Dstyk (+253) MACS_peak_197 chr1 132477087 132477747 50.77 Rbbp5 (+50) MACS_peak_199 chr1 133222633 133223178 129.07 Plekha6 (-23191), Ppp1r15b (+91740) MACS_peak_200 chr1 133695993 133696556 56.74 Lax1 (-6259), Atp2b4 (+57474) MACS_peak_202 chr1 133800906 133801401 52.49 Atp2b4 (-47405), Optc (+106019) MACS_peak_206 chr1 138937686 138938298 160.3 2310009B15Rik (-81138), Dennd1b (-25717) MACS_peak_21 chr1 21052675 21053109 120.99 Tram2 (+26333), Efhc1 (+101266) MACS_peak_215 chr1 143503568 143504227 135.33 B3galt2 (-136799) MACS_peak_229 chr1 151571133 151571566 109.64 Fam129a (-23) MACS_peak_230 chr1 152089939 152090506 83.89 1700025G04Rik (+97) MACS_peak_233 chr1 152766320 152766812 212.5 Arpc5 (+24) MACS_peak_234 chr1 152809894 152810247 63.51 Ncf2 (+2814), Smg7 (+92575) MACS_peak_236 chr1 156309080 156309713 185.98 Nphs2 (-1338) MACS_peak_237 chr1 157143335 157143701 137.5 2810025M15Rik (-268834), 1700057K13Rik (-34873) MACS_peak_239 chr1 158347670 158348139 163.49 Fam5b (+8355), Sec16b (+821735) MACS_peak_24 chr1 23263840 23265026 439.64 4933415F23Rik (-162180), Ogfrl1 (+118742) MACS_peak_240 chr1 158732640 158733652 91.91 Pappa2 (+224292), Astn1 (+370806) MACS_peak_244 chr1 162590057 162590797 51.4 Myoc (-48723), Vamp4 (+19599) MACS_peak_245 chr1 164252835 164253556 145.11 4930455F23Rik (-22402), Slc19a2 (+4141) MACS_peak_248 chr1 165535881 165536593 152.87 Adcy10 (+51054), Mpzl1 (+98304) MACS_peak_249 chr1 165707656 165708938 69.2 Rcsd1 (-203) MACS_peak_250 chr1 165709865 165710337 218.28 Rcsd1 (-2007) MACS_peak_252 chr1 165837116 165838298 112.82 Cd247 (+49026), Pou2f1 (+164927) MACS_peak_252 chr1 165837116 165838298 112.82 Cd247 (+49026), Pou2f1 (+164927) MACS_peak_253 chr1 166000410 166001502 84.71 Pou2f1 (+1678), Cd247 (+212275) MACS_peak_254 chr1 166282531 166283110 230.74 Tada1 (-96346), Ildr2 (+28682) MACS_peak_256 chr1 166316732 166317701 59.6 Tada1 (-61950), Ildr2 (+63078) MACS_peak_258 chr1 167052978 167053530 222.58 Fam78b (+51837), Uck2 (+231873) MACS_peak_260 chr1 167182315 167182887 148.15 Uck2 (+102526), Fam78b (+181184) MACS_peak_261 chr1 167249318 167249707 125.96 Uck2 (+35614), Fam78b (+248096) MACS_peak_267 chr1 170489339 170490036 154.66 Nos1ap (+100161), 1700015E13Rik (+180827) MACS_peak_268 chr1 170499603 170500269 96.25 Nos1ap (+89913), 1700015E13Rik (+191075) MACS_peak_269 chr1 171222272 171222851 70 Apoa2 (-2492), Tomm40l (-48) MACS_peak_270 chr1 171251499 171252391 107.23 Ndufs2 (-4833), Adamts4 (+1523) MACS_peak_271 chr1 171379120 171379853 63.09 Arhgap30 (-9473), Pvrl4 (+9314) MACS_peak_272 chr1 172436722 172437382 730.35 Slamf9 (-38308), Pigm (+60521) MACS_peak_275 chr1 176064725 176065305 64.51 B020018G12Rik (-85899), Pld5 (+210297) MACS_peak_276 chr1 176092036 176092460 240.95 B020018G12Rik (-113132), Pld5 (+183064) MACS_peak_278 chr1 179546271 179546971 52.41 Tfb2m (-354), Cnst (+92) MACS_peak_279 chr1 180266379 180266863 160.3 Itpkb (-63855), Psen2 (-10321) MACS_peak_281 chr1 180768021 180768589 84.46 Acbd3 (+42262), H3f3a (+45298) MACS_peak_282 chr1 181010604 181011322 171.3 Ephx1 (+6532), Tmem63a (+68445) MACS_peak_283 chr1 182191709 182192325 131.5 Vmn1r1 (-33919), Degs1 (+90742) MACS_peak_284 chr1 182460526 182461220 89.71 Trp53bp2 (+51706), Capn2 (+56610) MACS_peak_285 chr1 182509420 182509950 59.04 Capn2 (+7798), Trp53bp2 (+100518) MACS_peak_286 chr1 182511000 182511620 89.68 Capn2 (+6173), Trp53bp2 (+102143) MACS_peak_288 chr1 183116270 183116750 89.58 MACS_peak_289 chr1 184137476 184137924 64.56 Dusp10 (+103239), Hlx (+594793) MACS_peak_291 chr1 184827148 184827514 60.81 Mosc1 (-16018), Mosc2 (+18516) MACS_peak_292 chr1 185287129 185287528 70.11 Iars2 (+42072), Rab3gap2 (+83161) MACS_peak_293 chr1 185481727 185482538 88.71 Slc30a10 (+27285), Lyplal1 (+635177) MACS_peak_294 chr1 185574680 185575264 64.22 Slc30a10 (+120124), Lyplal1 (+542338) MACS_peak_296 chr1 189727603 189728524 141.41 Ptpn14 (-204) MACS_peak_297 chr1 189750142 189750791 84.67 Ptpn14 (+22199), Smyd2 (+171821) MACS_peak_299 chr1 189792519 189792911 139.4 Ptpn14 (+64447), Smyd2 (+129573) MACS_peak_300 chr1 189861024 189861408 52.01 Smyd2 (+61072), Ptpn14 (+132948) MACS_peak_302 chr1 189879749 189880337 118.28 Smyd2 (+42245), Ptpn14 (+151775) MACS_peak_303 chr1 189883369 189883782 79.11 Smyd2 (+38712), Ptpn14 (+155308) MACS_peak_304 chr1 191464926 191465721 94.63 Ppp2r5a (-68283), Dtl (+110210) MACS_peak_306 chr1 194795160 194795962 164.07 Cd34 (-143260), Plxna2 (+175732) MACS_peak_39 chr1 36352385 36352856 71.14 4632411B12Rik (+16560), Arid5a (+44888) MACS_peak_40 chr1 36424914 36425508 54.71 4632411B12Rik (-56030), Lman2l (+20028) MACS_peak_41 chr1 36445193 36445495 127.52 Lman2l (-105) MACS_peak_45 chr1 37600641 37601440 206.88 Mgat4a (-64637), 2010300C02Rik (+118770) MACS_peak_46 chr1 38368455 38368991 119.11 Rev1 (-239061), Aff3 (+296232) MACS_peak_48 chr1 39186526 39187255 98.63 Npas2 (-7381), Pdcl3 (+199077) MACS_peak_49 chr1 39192546 39193169 327.55 Npas2 (-1414) MACS_peak_52 chr1 43067159 43068081 88.71 Tgfbrap1 (+31002), Gpr45 (+114748) MACS_peak_53 chr1 43320790 43321721 95.04 Nck2 (-124495), Rpl29 (+132135) MACS_peak_54 chr1 43362847 43363765 111.68 Nck2 (-82445), Rpl29 (+174185) MACS_peak_55 chr1 43444929 43445810 146.01 Nck2 (-381) MACS_peak_69 chr1 52597291 52598253 278.61 Nab1 (-97324), Tmem194b (-32933) MACS_peak_71 chr1 52800458 52800888 68.23 Mfsd6 (-73355), Inpp1 (+17015) MACS_peak_72 chr1 54867207 54867712 134.48 Pgap1 (-309778), Ankrd44 (+58927) MACS_peak_73 chr1 55087850 55088360 169.01 Hspd1 (-173), Hspe1 (-43) MACS_peak_75 chr1 56168459 56169211 50.15 Hsfy2 (+468616), Plcl1 (+762889) MACS_peak_78 chr1 58284430 58285069 78.52 Bzw1 (-108386), Aox3l1 (+6424) MACS_peak_79 chr1 58422936 58423348 61.73 Clk1 (+946) MACS_peak_8 chr1 12697929 12698389 77.62 Sulf1 (-20386) MACS_peak_81 chr1 59318829 59319499 159.86 Fzd7 (-162983), Cdk15 (+62257) MACS_peak_84 chr1 59762115 59762803 403.48 Bmpr2 (-2178) MACS_peak_85 chr1 60410019 60410550 51.74 Abi2 (+666) MACS_peak_86 chr1 61321621 61322198 51.81 Pard3b (-306644), Icos (+343996) MACS_peak_87 chr1 61406955 61407536 69.84 Pard3b (-221308), Icos (+429332) MACS_peak_89 chr1 61641588 61642457 114.11 Pard3b (+3199) MACS_peak_9 chr1 12717914 12718953 166.08 Sulf1 (-111) MACS_peak_90 chr1 62860495 62861536 298.13 Nrp2 (+157699), Ino80d (+253251) MACS_peak_92 chr1 62887342 62887980 52.03 Nrp2 (+184344), Ino80d (+226606) MACS_peak_93 chr1 63533985 63534731 100.22 Adam23 (+88454), Dytn (+152569) MACS_peak_95 chr1 63978448 63979171 79.58 Klf7 (+142579), Fastkd2 (+248185) MACS_peak_307 chr10 3633667 3634595 99.52 Plekhg1 (-238535), Iyd (+93853) MACS_peak_309 chr10 3755893 3756590 87.81 Plekhg1 (-116425), Iyd (+215963) MACS_peak_312 chr10 4429529 4430072 58.11 1700052N19Rik (-2804), Rmnd1 (+2551) MACS_peak_314 chr10 5179489 5180477 798.93 Syne1 (+14723), Esr1 (+567938) MACS_peak_317 chr10 5823835 5824597 214.09 Mtrf1l (-274) MACS_peak_318 chr10 8752445 8752930 54.37 Ust (-233863), Sash1 (+133382) MACS_peak_319 chr10 9647458 9648496 174.78 Sash1 (-761907), Samd5 (+27231) MACS_peak_325 chr10 12867879 12868459 55.61 Utrn (-6434), Stx11 (+96098) MACS_peak_327 chr10 12911914 12912540 60.68 Utrn (-50492), Stx11 (+52040) MACS_peak_328 chr10 13107004 13107769 123.34 Plagl1 (+16599), Fam164b (+70636) MACS_peak_329 chr10 13964292 13964926 86.01 Hivep2 (-1770) MACS_peak_330 chr10 17299514 17300030 168.86 Cited2 (-423456) MACS_peak_331 chr10 18069983 18070681 55.87 Reps1 (+14392), Ect2l (+140558) MACS_peak_332 chr10 19122194 19122604 134.08 Olig3 (-234140), Tnfaip3 (-110436) MACS_peak_334 chr10 19699025 19699652 71.14 Il20ra (-13248), Il22ra2 (+77311) MACS_peak_335 chr10 19987714 19988258 57.33 Mtap7 (-160934), Map3k5 (+53460) MACS_peak_336 chr10 22674440 22675133 55.52 Slc2a12 (+29776), Tbpl1 (+56660) MACS_peak_337 chr10 22868203 22868804 193.69 Tcf21 (-48376), Eya4 (+481399) MACS_peak_338 chr10 22875082 22875690 184.85 Tcf21 (-55258), Eya4 (+474517) MACS_peak_340 chr10 24364789 24365283 57.67 Ctgf (-230406), Moxd1 (+141519) MACS_peak_341 chr10 24590930 24591695 102.68 Ctgf (-4129) MACS_peak_342 chr10 26465292 26465873 103.46 Arhgap18 (-306929), L3mbtl3 (-90398) MACS_peak_344 chr10 26772195 26773508 124.06 Arhgap18 (+340) MACS_peak_356 chr10 39185226 39185742 78.33 Fyn (-184315), Wisp3 (-21690) MACS_peak_357 chr10 39377001 39377923 52.98 Traf3ip2 (-235472), Fyn (+7663) MACS_peak_358 chr10 39378035 39379132 227.07 Traf3ip2 (-234350), Fyn (+8785) MACS_peak_360 chr10 39459745 39460401 76.54 Traf3ip2 (-152861), Fyn (+90274) MACS_peak_361 chr10 39487294 39487982 65.95 Traf3ip2 (-125296), Fyn (+117839) MACS_peak_362 chr10 39495212 39495623 61.73 Traf3ip2 (-117516), Fyn (+125619) MACS_peak_363 chr10 39557606 39558432 120.41 Traf3ip2 (-54915), Fyn (+188220) MACS_peak_365 chr10 40348876 40349740 147.83 Cdk19 (0) MACS_peak_368 chr10 42274083 42274703 141.99 Armc2 (-256011), Foxo3 (+2349) MACS_peak_372 chr10 49131116 49132362 74.94 Grik2 (+657015) MACS_peak_378 chr10 52417191 52417618 57.62 Nus1 (-142) MACS_peak_379 chr10 53410827 53411409 73.63 Asf1a (-185843), Gm9766 (-31267) MACS_peak_380 chr10 54076117 54076666 75.13 Man1a (-596) MACS_peak_384 chr10 56474945 56475481 176.97 Gja1 (+97913) MACS_peak_385 chr10 59194831 59195577 75.23 Sept10 (+26643), Sh3rf3 (+381845) MACS_peak_386 chr10 59241132 59241719 55.15 P4ha1 (-81870), Ankrd57 (+19504) MACS_peak_387 chr10 59322804 59323640 86.51 P4ha1 (-74) MACS_peak_388 chr10 59537258 59537943 195.71 Oit3 (-95822), Ccdc109a (+79091) MACS_peak_389 chr10 59879261 59880116 64.21 Dnajb12 (+98) MACS_peak_390 chr10 59978625 59979426 62.93 Ddit4 (-27256), Anapc16 (+24086) MACS_peak_392 chr10 61782954 61783751 67.6 H2afy2 (+511) MACS_peak_394 chr10 62210618 62211242 629.56 Tspan15 (+20288), Neurog3 (+77840) MACS_peak_395 chr10 62340003 62340778 115.16 Hk1 (+39517), Tacr2 (+87953) MACS_peak_396 chr10 63157014 63157451 66.52 Mypn (+46719), Atoh7 (+57077) MACS_peak_397 chr10 63541629 63542216 332.1 Ctnna3 (+111825), Lrrtm3 (+548332) MACS_peak_403 chr10 68136194 68136879 57.57 Arid5b (+142189), Rtkn2 (+156939) MACS_peak_404 chr10 69812564 69813257 229.23 Ccdc6 (-284210), Ank3 (+279203) MACS_peak_405 chr10 70301153 70301849 122.76 Fam13c (-139409), Slc16a9 (+56225) MACS_peak_406 chr10 70494485 70494922 56.81 Fam13c (+53794), Phyhipl (+104587) MACS_peak_413 chr10 75587818 75588740 164.02 Ggt5 (-1102) MACS_peak_414 chr10 76501119 76501638 81.11 Ybey (-32265), Lss (-30248) MACS_peak_416 chr10 77583863 77584438 159.25 Sumo3 (-22083), Pttg1ip (+2384) MACS_peak_417 chr10 78352389 78352719 81.62 Agpat3 (-854) MACS_peak_419 chr10 79766830 79767252 67.89 Rnf126 (-120) MACS_peak_420 chr10 79840597 79841664 310.11 Ptbp1 (-13474), 9130017N09Rik (+20110) MACS_peak_421 chr10 79854049 79854703 77.35 Ptbp1 (-229) MACS_peak_423 chr10 80115190 80115958 69.41 Stk11 (-962) MACS_peak_424 chr10 80149473 80150260 94.94 Cirbp (-17974), Midn (+1577) MACS_peak_425 chr10 80150867 80151486 80.01 Cirbp (-16664), Midn (+2887) MACS_peak_426 chr10 80151650 80152742 318.17 Cirbp (-15645), Midn (+3906) MACS_peak_427 chr10 80159599 80160420 101.6 Cirbp (-7831), Midn (+11720) MACS_peak_428 chr10 80160654 80162106 477.31 Cirbp (-6461), Midn (+13090) MACS_peak_429 chr10 80577059 80577717 67.98 Klf16 (-92) MACS_peak_430 chr10 80622019 80622636 99.9 Csnk1g2 (-7328), Scamp4 (+19448) MACS_peak_431 chr10 80887262 80887815 66.53 Tmprss9 (+7723), Timm13 (+13430) MACS_peak_432 chr10 81137590 81137920 71.01 Zbtb7a (+1484), Pias4 (+29965) MACS_peak_433 chr10 81167561 81168221 105.89 Pias4 (-171) MACS_peak_434 chr10 81329378 81329874 71.17 Tbxa2r (+895) MACS_peak_435 chr10 81350263 81350964 154.18 Hmg20b (-187) MACS_peak_436 chr10 81401879 81402574 54.35 2210404O07Rik (+9163), Nfic (+24946) MACS_peak_437 chr10 81430172 81430726 57.35 Nfic (-3276) MACS_peak_438 chr10 81435375 81435806 98.69 Nfic (-8418), Celf5 (+47118) MACS_peak_439 chr10 81560989 81561432 65.99 Tle2 (-14321), Aes (+1651) MACS_peak_440 chr10 81596561 81597552 154.81 Tle6 (+3843), Tle2 (+21525) MACS_peak_442 chr10 83291788 83292417 108.33 Slc41a2 (+45714), Chst11 (+306606) MACS_peak_443 chr10 83301749 83302399 51.78 Slc41a2 (+35743), Chst11 (+316577) MACS_peak_445 chr10 84713373 84713740 114.82 Rfx4 (-42491), Polr3b (+91120) MACS_peak_446 chr10 84976615 84977322 121.65 Ric8b (+59353), Fhl4 (+125526) MACS_peak_447 chr10 86114293 86114967 336.84 Timp3 (-185782), Fbxo7 (+92701) MACS_peak_450 chr10 86340045 86340607 54.73 Timp3 (+39914), Syn3 (+158570) MACS_peak_452 chr10 90576275 90576894 134.32 Apaf1 (+506158), Anks1b (+703076) MACS_peak_453 chr10 90637511 90637867 62.71 Apaf1 (+445054), Anks1b (+764180) MACS_peak_457 chr10 94409755 94410424 160.3 Tmcc3 (-104767), Ndufa12 (+211081) MACS_peak_460 chr10 94514540 94515069 50.22 Tmcc3 (-52) MACS_peak_461 chr10 95235986 95236738 88.56 Plxnc1 (-291784), Cradd (+87735) MACS_peak_462 chr10 95262317 95263082 107.11 Plxnc1 (-318122), Cradd (+61397) MACS_peak_470 chr10 99203685 99204236 114.96 Dusp6 (-59270), Galnt4 (+95826) MACS_peak_479 chr10 105574277 105574734 91.31 Tmtc2 (-27) MACS_peak_485 chr10 111419592 111420332 149.48 Nap1l1 (-53230), Bbs10 (+121283) MACS_peak_489 chr10 113161288 113161993 82.98 Atxn7l3b (-232615) MACS_peak_494 chr10 117005858 117006579 100.36 Lrrc10 (-39122), Best3 (+19905) MACS_peak_495 chr10 117223997 117224827 95.79 Yeats4 (+95) MACS_peak_497 chr10 117905584 117906523 67.35 Mdm1 (-235733), Rap1b (-60080) MACS_peak_498 chr10 119065359 119066006 73.47 Dyrk2 (-196780), Cand1 (+174372) MACS_peak_499 chr10 119670688 119671146 62.32 Cand1 (-430862), Grip1 (-148595) MACS_peak_501 chr10 121873111 121873673 124.33 BC048403 (+133455), Srgap1 (+173801) MACS_peak_503 chr10 121955647 121956273 1060.95 Srgap1 (+91233), BC048403 (+216023) MACS_peak_506 chr10 126845197 126845970 178.46 Xrcc6bp1 (+55787), Lrig3 (+879365) MACS_peak_507 chr10 126971947 126972463 110.54 Xrcc6bp1 (-70834), Ctdsp2 (-6512) MACS_peak_508 chr10 126978058 126979048 181.72 Ctdsp2 (-164) MACS_peak_510 chr10 127289169 127289468 81.62 Ddit3 (-1474), Mbd6 (-548) MACS_peak_511 chr10 127290181 127290812 151.75 Mbd6 (-1726), Ddit3 (-296) MACS_peak_512 chr10 127600035 127600620 88.98 Nxph4 (-65769), Lrp1 (+20820) MACS_peak_513 chr10 127661822 127662736 122.45 BC029853 (-1561) MACS_peak_514 chr10 127665800 127669478 639.63 Nab2 (-936) MACS_peak_514 chr10 127665800 127669478 639.63 Nab2 (-936) MACS_peak_514 chr10 127665800 127669478 639.63 Nab2 (-936) MACS_peak_515 chr10 127766563 127767016 479.98 Gpr182 (-14992), Rdh9 (-9615) MACS_peak_517 chr10 128092635 128093606 120.67 Baz2a (+661) MACS_peak_518 chr10 128133799 128134512 121.05 Baz2a (+41696), Rbms2 (+42412) MACS_peak_520 chr10 128302948 128303796 85.87 Pan2 (+37) MACS_peak_521 chr10 128525839 128526318 103.96 Esyt1 (-220) MACS_peak_522 chr10 128583715 128583994 55.62 Pa2g4 (-17921), Erbb3 (+5646) MACS_peak_523 chr10 128626635 128626992 146.38 Rps26 (-308) MACS_peak_529 chr11 3535432 3536094 149.48 Smtn (+3529), Selm (+21061) MACS_peak_530 chr11 3573080 3573539 165.16 Morc2a (-76184), Smtn (-34018) MACS_peak_531 chr11 4294707 4295359 348 Lif (+37465), Hormad2 (+146049) MACS_peak_532 chr11 5183985 5184797 72.9 Emid1 (-32169), kremen (+54111) MACS_peak_537 chr11 5444649 5445087 56.73 Znrf3 (-21) MACS_peak_538 chr11 5892340 5892765 88.47 Pold2 (-14297), Myl7 (+6229) MACS_peak_540 chr11 6999301 6999830 109.05 Adcy1 (-63923), Ramp3 (+341033) MACS_peak_541 chr11 7129703 7130348 97.29 Igfbp1 (-67761), Adcy1 (+66537) MACS_peak_544 chr11 8467900 8468763 53.81 Tns3 (+196203) MACS_peak_546 chr11 8493893 8494488 115.54 Tns3 (+170344) MACS_peak_547 chr11 8494906 8495452 140.22 Tns3 (+169356) MACS_peak_548 chr11 8496498 8497058 118.28 Tns3 (+167757) MACS_peak_555 chr11 18745764 18746346 129.56 Etaa1 (-792180), Gm16140 (-263073) MACS_peak_558 chr11 19925226 19925850 70.41 Spred2 (+1096), Actr2 (+187413) MACS_peak_559 chr11 20038776 20039125 152.22 Actr2 (+74000), Spred2 (+114509) MACS_peak_561 chr11 23067719 23068263 75.64 Xpo1 (-188050), Fam161a (+54604) MACS_peak_567 chr11 32383931 32384224 127.52 Ubtd2 (-71294), Sh3pxd2b (+36267) MACS_peak_569 chr11 33791435 33791761 127.52 Gabrp (-212641), Kcnip1 (+51987) MACS_peak_572 chr11 35142733 35143467 217.09 Pank3 (-626395), Slit3 (+21644) MACS_peak_576 chr11 40691850 40692718 79.58 Mat2b (+398) MACS_peak_583 chr11 44232681 44233220 58.4 Adra1b (-396619), Il12b (-167112) MACS_peak_585 chr11 50177036 50177780 205.02 3010026O09Rik (+2557), Sqstm1 (+33382) MACS_peak_587 chr11 50210097 50210717 176.14 Sqstm1 (+383) MACS_peak_589 chr11 51851964 51852868 133.06 Phf15 (+5065), Sar1b (+88753) MACS_peak_590 chr11 52361335 52361998 67.63 Vdac1 (+552) MACS_peak_594 chr11 53350339 53351057 91.04 Aff4 (-69) MACS_peak_595 chr11 53761332 53762219 108.52 Irf1 (-8238), Il5 (+40982) MACS_peak_596 chr11 53763392 53764523 226.37 Irf1 (-6056), Il5 (+43164) MACS_peak_597 chr11 54115773 54116585 59.4 P4ha2 (+15255), Csf2 (+133720) MACS_peak_599 chr11 55414070 55414676 139.1 Fat2 (-102116), Sparc (+5707) MACS_peak_601 chr11 57525171 57525684 79.53 Galnt10 (-120014), Mfap3 (+6763) MACS_peak_602 chr11 57671751 57672294 140.62 Sap30l (-129614), Galnt10 (+26581) MACS_peak_603 chr11 57677149 57677789 107.83 Sap30l (-124168), Galnt10 (+32027) MACS_peak_605 chr11 57773612 57774336 90.55 Sap30l (-27663), Galnt10 (+128532) MACS_peak_606 chr11 57786354 57787013 293.34 Sap30l (-14953), Galnt10 (+141242) MACS_peak_607 chr11 57983407 57983982 125.33 Hand1 (-151548), Larp1 (-25369) MACS_peak_608 chr11 58009707 58010361 86.77 Larp1 (+970) MACS_peak_611 chr11 59786466 59786988 50.67 Pld6 (+930) MACS_peak_612 chr11 60189568 60190004 76.74 Srebf1 (+30818), Rai1 (+49704) MACS_peak_613 chr11 60537057 60537669 110.66 Alkbh5 (-320) MACS_peak_617 chr11 62921078 62921722 78.13 Cdrt4 (-29793), Fam18b (+41910) MACS_peak_618 chr11 63287654 63288268 238.22 Pmp22 (+156451), Hs3st3b1 (+634323) MACS_peak_619 chr11 63775464 63775935 102.38 Hs3st3b1 (+146584), Pmp22 (+644190) MACS_peak_620 chr11 63785250 63786028 198.95 Hs3st3b1 (+136645), Pmp22 (+654129) MACS_peak_621 chr11 63889724 63890748 244.88 Hs3st3b1 (+32048), Pmp22 (+758726) MACS_peak_623 chr11 64511311 64512088 118.64 Elac2 (-467335), Hs3st3a1 (+76368) MACS_peak_626 chr11 64711649 64712176 78.84 Elac2 (-267122), Hs3st3a1 (+276581) MACS_peak_627 chr11 65141804 65142819 193.57 Arhgap44 (+20649), Elac2 (+163277) MACS_peak_628 chr11 65386680 65387210 62.01 Myocd (-116956), Map2k4 (+401352) MACS_peak_629 chr11 65723847 65724781 126.42 Myocd (-454325), Map2k4 (+63983) MACS_peak_630 chr11 67514982 67515849 75.59 Gas7 (-17582), Myh13 (+188313) MACS_peak_633 chr11 67628417 67628926 122.43 Rcvrn (-66654), Gas7 (+95674) MACS_peak_634 chr11 67648620 67649283 115.79 Rcvrn (-46374), Gas7 (+115954) MACS_peak_635 chr11 67649534 67650534 205.94 Rcvrn (-45292), Gas7 (+117036) MACS_peak_637 chr11 69086949 69087685 551.83 Vamp2 (-1211) MACS_peak_638 chr11 69096598 69097422 205.55 Per1 (-3148) MACS_peak_639 chr11 69168100 69168731 151.75 Alox12b (+11344), Alox8 (+29423) MACS_peak_640 chr11 69411012 69411815 59.02 Tmem88 (-13180), Kdm6b (+2259) MACS_peak_641 chr11 69415133 69415662 59.11 Kdm6b (-1725) MACS_peak_642 chr11 69417142 69418011 107.16 Kdm6b (-3904) MACS_peak_643 chr11 69418679 69419490 152.43 Kdm6b (-5412), Dnahc2 (+130023) MACS_peak_644 chr11 69503824 69504278 106.97 Kdm6b (-90378), Dnahc2 (+45057) MACS_peak_645 chr11 69671050 69671849 67.48 Eif4a1 (+973) MACS_peak_647 chr11 69995112 69996003 175.45 Phf23 (-213) MACS_peak_648 chr11 70432111 70432690 89.18 Arrb2 (-252) MACS_peak_649 chr11 70561974 70563033 199.33 Mink1 (-377) MACS_peak_650 chr11 70563248 70564190 212.86 Mink1 (+838) MACS_peak_651 chr11 70608674 70609352 179.58 Chrne (+10181), Mink1 (+46132) MACS_peak_655 chr11 72608281 72608777 71.17 Ankfy1 (-81473), Ube2g1 (+1268) MACS_peak_657 chr11 74638531 74638854 81.62 1300001I01Rik (-10802), E130309D14Rik (+19088) MACS_peak_658 chr11 74830130 74830509 115.57 Mnt (-604) MACS_peak_659 chr11 74830741 74831306 137.74 Mnt (+100) MACS_peak_663 chr11 75733077 75733627 117.46 Ywhae (+465) MACS_peak_665 chr11 76447708 76448420 186.41 Timm22 (+40897), Abr (+61355) MACS_peak_666 chr11 76449573 76450307 128.47 Timm22 (+42773), Abr (+59479) MACS_peak_667 chr11 76467476 76467953 53.77 Abr (+41704), Timm22 (+60548) MACS_peak_669 chr11 77802162 77802996 193.05 Myo18a (+25314), Pipox (+91293) MACS_peak_670 chr11 77847534 77848031 52.35 Pipox (+46089), Myo18a (+70518) MACS_peak_671 chr11 77984351 77985178 71.04 Dhrs13 (-47548), Phf12 (+1949) MACS_peak_672 chr11 78245713 78246243 68.33 Supt6h (-275), Sdf2 (+232) MACS_peak_673 chr11 78600130 78600885 132.84 Tmem97 (-49773), Nlk (+96917) MACS_peak_674 chr11 78827494 78828050 150.33 Nos2 (-93087), 1810012P15Rik (+1177) MACS_peak_675 chr11 78829378 78830122 62.42 Nos2 (-91109), 1810012P15Rik (+3155) MACS_peak_676 chr11 79063554 79063983 157.89 Lgals9 (-78845), Ksr1 (+82585) MACS_peak_677 chr11 79065519 79066161 52.54 Lgals9 (-80916), Ksr1 (+80514) MACS_peak_678 chr11 79107758 79108205 71.32 Lgals9 (-123058), Ksr1 (+38372) MACS_peak_680 chr11 79719026 79719617 63.72 Rab11fip4 (+128110), Utp6 (+243065) MACS_peak_681 chr11 80294920 80295663 205.16 Rhbdl3 (-5620), Rhot1 (+86237) MACS_peak_682 chr11 80300547 80301157 62.4 Rhbdl3 (-60) MACS_peak_683 chr11 80532655 80533492 110.01 Cdk5r1 (+56028), Myo1d (+246951) MACS_peak_684 chr11 80682724 80683388 274.75 Myo1d (+96969), Cdk5r1 (+206010) MACS_peak_686 chr11 81185410 81185971 138.25 Accn1 (-32788), 1700071K01Rik (+387848) MACS_peak_687 chr11 84394781 84395430 138.51 Aatf (+118395), Acaca (+199668) MACS_peak_688 chr11 85233513 85234214 76.18 Appbp2 (+1256), 1700125H20Rik (+62768) MACS_peak_689 chr11 85310741 85311441 62.57 Ppm1d (-163) MACS_peak_691 chr11 86962048 86962686 172.42 Dhx40 (-154707), Ypel2 (+31395) MACS_peak_693 chr11 88404763 88405382 60.82 1700106J16Rik (+111030), Msi2 (+361006) MACS_peak_694 chr11 88463873 88464366 57.33 1700106J16Rik (+170077), Msi2 (+301959) MACS_peak_695 chr11 88470221 88471102 185.98 1700106J16Rik (+176619), Msi2 (+295417) MACS_peak_696 chr11 88645058 88645702 94.25 Msi2 (+72887), 1700106J16Rik (+399149) MACS_peak_697 chr11 89900815 89901945 450.01 Ankfn1 (-362825), Pctp (+101514) MACS_peak_704 chr11 94231603 94232560 454.83 Wfikkn2 (+10497), Tob1 (+20628) MACS_peak_705 chr11 94496870 94497267 52.54 Spata20 (-11759), Epn3 (+2905) MACS_peak_706 chr11 94497818 94498714 123.99 Spata20 (-12956), Epn3 (+1708) MACS_peak_707 chr11 94989568 94990066 98.63 Ppp1r9b (-1395) MACS_peak_708 chr11 94992745 94993634 175.66 Samd14 (-16689), Ppp1r9b (+1978) MACS_peak_709 chr11 95034673 95035469 73.18 Pdk2 (+6300), Samd14 (+25192) MACS_peak_710 chr11 95037253 95037819 160.53 Pdk2 (+3835), Samd14 (+27657) MACS_peak_711 chr11 95071000 95071892 78.64 Pdk2 (-30075), Itga3 (+5268) MACS_peak_712 chr11 95075133 95075695 234.82 Pdk2 (-34043), Itga3 (+1300) MACS_peak_713 chr11 95309450 95310018 148.69 Myst2 (+512) MACS_peak_714 chr11 95343055 95343908 81.16 Slc35b1 (-41440), Fam117a (+6464) MACS_peak_715 chr11 95369977 95370794 487.01 Slc35b1 (-14536), Fam117a (+33368) MACS_peak_716 chr11 95493944 95494755 525.1 Nxph3 (+20215), Spop (+80267) MACS_peak_717 chr11 95504158 95504954 370 Nxph3 (+10009), Spop (+90473) MACS_peak_718 chr11 95513453 95513936 72.31 Nxph3 (+870) MACS_peak_720 chr11 96075612 96076262 108.33 Atp5g1 (-243) MACS_peak_721 chr11 96823854 96824695 94.89 Nfe2l1 (+5693), Cbx1 (+35139) MACS_peak_722 chr11 96977325 96978021 135.46 Sp2 (+15) MACS_peak_723 chr11 96994943 96995903 109.36 Sp6 (-18146), Sp2 (-17735) MACS_peak_724 chr11 96997108 96997835 207.46 Sp2 (-19784), Sp6 (-16097) MACS_peak_725 chr11 97025493 97026139 51.56 Scrn2 (-4136) MACS_peak_726 chr11 97032040 97032478 97.85 Scrn2 (+2307), Lrrc46 (+9110) MACS_peak_727 chr11 97302258 97302640 52.77 Npepps (-21873), Mrpl45 (-13267) MACS_peak_728 chr11 97437684 97438402 307.58 Arhgap23 (-12117), Socs7 (+75492) MACS_peak_729 chr11 97441416 97442222 196.62 Arhgap23 (-8341), Socs7 (+79268) MACS_peak_730 chr11 97449851 97451134 314.52 Arhgap23 (+333) MACS_peak_731 chr11 97669101 97669776 85.06 Cisd3 (-16513), Mllt6 (+6027) MACS_peak_733 chr11 97799302 97799827 68.74 Lasp1 (-107) MACS_peak_734 chr11 97813405 97814121 197.84 Lasp1 (+14091), Fbxo47 (+70391) MACS_peak_736 chr11 98412208 98412840 91.47 Erbb2 (+40) MACS_peak_737 chr11 98588061 98588798 105.47 Ormdl3 (-1185) MACS_peak_739 chr11 98708873 98709853 230.3 Csf3 (+8050), Med24 (+20072) MACS_peak_740 chr11 98750446 98751557 204.23 Thra (+9129), Nr1d1 (+24240) MACS_peak_741 chr11 98765527 98766287 325.17 Nr1d1 (+9335), Thra (+24034) MACS_peak_742 chr11 98773554 98774176 64.71 Nr1d1 (+1377), Thra (+31992) MACS_peak_745 chr11 98783230 98783917 66.01 Msl1 (-12195), Nr1d1 (-8332) MACS_peak_746 chr11 98788857 98789189 71.01 Nr1d1 (-13781), Msl1 (-6746) MACS_peak_747 chr11 98950792 98951830 121.81 Rara (-9160), Cdc6 (+43422) MACS_peak_748 chr11 98959407 98959985 64.99 Rara (-775) MACS_peak_751 chr11 100395174 100395846 125.26 Hap1 (-39369), Jup (+2229) MACS_peak_752 chr11 100396943 100397618 58.19 Jup (+458) MACS_peak_754 chr11 100968924 100969797 71.38 Stat3 (-29850), Ptrf (+1256) MACS_peak_757 chr11 101056677 101057294 106.48 Naglu (-13108), Atp6v0a1 (+47531) MACS_peak_758 chr11 101060148 101060847 143.55 Naglu (-9596), Atp6v0a1 (+51043) MACS_peak_761 chr11 101173186 101174125 224.36 Cntnap1 (-2461), Plekhh3 (-2354) MACS_peak_762 chr11 101189577 101190348 211.55 Cntnap1 (+13846), Ezh1 (+36487) MACS_peak_763 chr11 101259224 101259894 157.99 Wnk4 (-1008) MACS_peak_764 chr11 101604439 101604868 77.45 Rdm1 (-23295), Tmem106a (+22412) MACS_peak_765 chr11 101687156 101688017 379.33 Dhx8 (-45369), Arl4d (+22046) MACS_peak_766 chr11 101700306 101700801 277.83 Dhx8 (-32402), Arl4d (+35013) MACS_peak_767 chr11 101772264 101772871 111.18 Etv4 (+12742), Dhx8 (+39612) MACS_peak_768 chr11 101997777 101998544 378.9 1700006E09Rik (+11105), Mpp3 (+28794) MACS_peak_769 chr11 102027222 102027966 88.98 Mpp3 (-639) MACS_peak_772 chr11 102407329 102408048 55.6 Slc25a39 (-172) MACS_peak_773 chr11 102555892 102556519 77.67 Gpatch8 (-48) MACS_peak_774 chr11 102606580 102607371 60.82 Gm1564 (-58612), Fzd2 (+2545) MACS_peak_776 chr11 103097095 103097714 70.78 Acbd4 (-4283), Plcd3 (+4253) MACS_peak_777 chr11 103142331 103142885 75.92 Fmnl1 (-28530), Hexim2 (+9269) MACS_peak_778 chr11 103158423 103159107 169.9 Fmnl1 (-12373), Hexim2 (+25426) MACS_peak_780 chr11 103884708 103885119 58.49 Nsf (+69142), Wnt3 (+110739) MACS_peak_781 chr11 103937419 103937908 148.26 Nsf (+16392), Wnt3 (+163489) MACS_peak_783 chr11 104213421 104213939 179.9 Mapt (-17756), 4933407P14Rik (+27353) MACS_peak_784 chr11 104230391 104230879 92.24 Mapt (-801) MACS_peak_787 chr11 105292307 105293419 449.81 Mrc2 (+217) MACS_peak_789 chr11 107355136 107356080 117.27 Nol11 (-166227), Pitpnc1 (+115112) MACS_peak_790 chr11 107651109 107652017 67.95 Cacng1 (+64913), Helz (+103603) MACS_peak_791 chr11 107652156 107653102 86.38 Cacng1 (+63847), Helz (+104669) MACS_peak_791 chr11 107652156 107653102 86.38 Cacng1 (+63847), Helz (+104669) MACS_peak_795 chr11 113165304 113165910 132.68 Sox9 (+383397), Slc39a11 (+400208) MACS_peak_796 chr11 113245460 113246193 89.84 Slc39a11 (+319988), Sox9 (+463617) MACS_peak_797 chr11 114043459 114043931 54.13 Cdc42ep4 (-292535), Sdk2 (+22256) MACS_peak_798 chr11 114044208 114044714 60.82 Cdc42ep4 (-293301), Sdk2 (+21490) MACS_peak_800 chr11 115162772 115163413 60.33 Slc9a3r1 (-248) MACS_peak_801 chr11 115173770 115174171 80.4 Slc9a3r1 (+10630), Nat9 (+13345) MACS_peak_802 chr11 115904978 115905532 85.73 2210020M01Rik (+5116), Recql5 (+27751) MACS_peak_807 chr11 116621153 116621704 86.01 Rhbdf2 (+2823), Aanat (+25368) MACS_peak_808 chr11 117098096 117098591 183.81 Sec14l1 (-16828), Mgat5b (+179481) MACS_peak_810 chr11 117120317 117121532 100.8 Sept9 (-78736), Sec14l1 (+5753) MACS_peak_811 chr11 117135410 117136045 197.54 Sept9 (-63933), Sec14l1 (+20556) MACS_peak_812 chr11 117410154 117410648 52.56 Tnrc6c (-243888), Sept9 (+210740) MACS_peak_814 chr11 117779713 117780292 103.66 Tmc8 (-2655), Tmc6 (+680) MACS_peak_816 chr11 117963200 117963745 187.69 Tha1 (-89947), Socs3 (+5893) MACS_peak_817 chr11 117969159 117969881 98.63 Socs3 (-154) MACS_peak_818 chr11 118326627 118328060 339.92 Usp36 (-37100), BC100451 (+15190) MACS_peak_819 chr11 118421454 118422005 861.76 Cant1 (-2678) MACS_peak_821 chr11 118430077 118430638 85.1 C1qtnf1 (-13176), Cant1 (-11306) MACS_peak_822 chr11 118433372 118433948 240.41 Cant1 (-14608), C1qtnf1 (-9874) MACS_peak_823 chr11 119040692 119041234 129.45 Cbx8 (-50) MACS_peak_824 chr11 119086267 119086857 72.99 Cbx4 (-325) MACS_peak_826 chr11 119683068 119683608 129.7 Chmp6 (-230472), Rptor (+80343) MACS_peak_827 chr11 119794568 119795298 81.91 Chmp6 (-118877), Rptor (+191938) MACS_peak_828 chr11 119833082 119833635 51.39 Chmp6 (-80451), Rptor (+230364) MACS_peak_829 chr11 120252508 120253332 183.24 Bahcc1 (+19973), Actg1 (+95564) MACS_peak_832 chr11 120498784 120499528 182.93 Gcgr (-31571), Slc25a10 (+7319) MACS_peak_833 chr11 120518028 120518390 60.81 Gcgr (-12518), Slc25a10 (+26372) MACS_peak_834 chr11 120572692 120573238 107.16 P4hb (-29) MACS_peak_835 chr11 120950769 120951299 59.04 Slc16a3 (+2550), Csnk1d (+40299) MACS_peak_837 chr11 121794368 121794985 76.57 Ptchd3 (-35541), Metrnl (+92250) MACS_peak_1000 chr12 112086692 112087346 116.71 BC048943 (-106164), Aspg (-19664) MACS_peak_1003 chr12 112576329 112577083 339.33 Tmem179 (-65546), Inf2 (-12078) MACS_peak_1004 chr12 112645148 112645666 50.94 Siva1 (+579) MACS_peak_1005 chr12 112950407 112951000 63.58 Btbd6 (-25859), Nudt14 (-8586) MACS_peak_1006 chr12 113000748 113001237 102.81 Brf1 (-372) MACS_peak_1009 chr12 118301747 118302496 218.99 Sp4 (-682) MACS_peak_1010 chr12 119238530 119239313 60.71 Itgb8 (-646) MACS_peak_838 chr12 3309857 3310414 109.89 Rab10 (-167) MACS_peak_851 chr12 15698262 15699636 683.64 Trib2 (+117836) MACS_peak_852 chr12 15703975 15704929 232.5 Trib2 (+112333) MACS_peak_853 chr12 15721552 15722243 89.94 Trib2 (+94887) MACS_peak_857 chr12 17575654 17576476 66.1 Hpcal1 (-114749), Odc1 (+31192) MACS_peak_858 chr12 17733043 17733772 80.91 5730507C01Rik (-781102), Hpcal1 (+42594) MACS_peak_859 chr12 21134135 21134540 90.78 Asap2 (+22582), Itgb1bp1 (+151899) MACS_peak_860 chr12 21163730 21164138 70.47 Asap2 (+52178), Itgb1bp1 (+122303) MACS_peak_861 chr12 21316322 21316815 71.43 Iah1 (+177) MACS_peak_862 chr12 24592912 24593587 174.17 Klf11 (-58121), Grhl1 (+20963) MACS_peak_864 chr12 29015192 29016017 162.14 Myt1l (-512779), Tssc1 (+263777) MACS_peak_865 chr12 29175675 29176129 65.03 Myt1l (-352482), Tssc1 (+424074) MACS_peak_867 chr12 30561434 30562034 138.87 Sntg2 (-188359), Tmem18 (-22709) MACS_peak_869 chr12 31949201 31949769 77.85 Gpr22 (-235559), Hbp1 (+1050) MACS_peak_872 chr12 32616053 32616696 128.7 Nampt (-203960), 2010109K11Rik (+237586) MACS_peak_873 chr12 32621745 32622415 331.45 Nampt (-198255), 2010109K11Rik (+243291) MACS_peak_876 chr12 32778521 32780488 78.9 Nampt (-40830), 2010109K11Rik (+400716) MACS_peak_877 chr12 33303248 33303841 72.76 Efcab10 (-91309), Atxn7l1 (+1030) MACS_peak_878 chr12 33717463 33718273 81.58 Ferd3l (-210557), Twistnb (+288244) MACS_peak_883 chr12 40471945 40472447 61.13 Immp2l (-551894), Dock4 (+26143) MACS_peak_894 chr12 48969147 48970057 61.5 Foxg1 (-413405) MACS_peak_897 chr12 52504843 52505506 88.56 Arhgap5 (-10904), Nubpl (+407429) MACS_peak_899 chr12 54984544 54985451 91.16 Cfl2 (-122121), Baz1a (+1338) MACS_peak_900 chr12 55443171 55443841 57.67 Psma6 (+44681), Nfkbia (+49141) MACS_peak_901 chr12 55446452 55447139 81.43 Nfkbia (+45851), Psma6 (+47971) MACS_peak_902 chr12 57607347 57607963 71 Sstr1 (-604149), 4921506M07Rik (+43540) MACS_peak_905 chr12 59411406 59411947 86.95 Fbxo33 (-192194) MACS_peak_917 chr12 69403758 69404561 142.83 Arf6 (+32010), Gm71 (+178868) MACS_peak_918 chr12 69442268 69442819 491.13 Arf6 (+70394), Gm71 (+140484) MACS_peak_919 chr12 69458143 69458829 162.28 Arf6 (+86336), Gm71 (+124542) MACS_peak_920 chr12 69494574 69495096 217.09 Gm71 (+88193), Arf6 (+122685) MACS_peak_921 chr12 69502085 69502773 123.59 Gm71 (+80599), Arf6 (+130279) MACS_peak_923 chr12 69582612 69583322 81.47 Gm71 (+61) MACS_peak_924 chr12 70111403 70111984 55.54 Nin (-8840), Pygl (+115989) MACS_peak_925 chr12 70227452 70227911 55.1 Pygl (+1) MACS_peak_932 chr12 78748548 78749187 90.36 Mpp5 (-79) MACS_peak_933 chr12 78983991 78984352 103.93 Tmem229b (-694) MACS_peak_934 chr12 79661251 79661883 209.66 Rad51l1 (+364285), Zfp36l1 (+451446) MACS_peak_935 chr12 79755696 79756098 53.07 Zfp36l1 (+357116), Rad51l1 (+458615) MACS_peak_936 chr12 79856306 79856834 50.28 Zfp36l1 (+256443), Rad51l1 (+559288) MACS_peak_938 chr12 79944717 79945199 57.36 Zfp36l1 (+168055), Rad51l1 (+647676) MACS_peak_940 chr12 79975746 79976431 171.3 Zfp36l1 (+136924), Rad51l1 (+678807) MACS_peak_941 chr12 79993880 79994540 159.26 Zfp36l1 (+118803), Rad51l1 (+696928) MACS_peak_942 chr12 80083658 80084620 50.4 Zfp36l1 (+28874), Rad51l1 (+786857) MACS_peak_943 chr12 80112971 80113605 98.3 Zfp36l1 (-275) MACS_peak_944 chr12 80123475 80123982 80.08 Zfp36l1 (-10716), Actn1 (+136642) MACS_peak_945 chr12 80260227 80260807 218.85 Actn1 (-146) MACS_peak_947 chr12 83950480 83950967 81.98 2410016O06Rik (+116) MACS_peak_948 chr12 85289202 85290021 131.01 Fam164c (+1021), Nek9 (+49750) MACS_peak_949 chr12 85454947 85455748 137.95 Tmed10 (-80631), Fos (-18553) MACS_peak_950 chr12 85473228 85473760 68.02 Fos (-407) MACS_peak_951 chr12 85485841 85486644 112.67 Jdp2 (-113173), Fos (+12342) MACS_peak_953 chr12 86690880 86691679 113.02 Vash1 (+12580), Angel1 (+35180) MACS_peak_954 chr12 86793896 86794313 159.98 Gm6772 (+59736), 6430527G18Rik (+90709) MACS_peak_955 chr12 86800715 86801776 220.45 Gm6772 (+66877), 6430527G18Rik (+83568) MACS_peak_956 chr12 86824923 86825358 98.21 6430527G18Rik (+59673), Gm6772 (+90772) MACS_peak_959 chr12 87093276 87093747 52.54 Ngb (+9027), Tmem63c (+66948) MACS_peak_961 chr12 87373976 87374482 90.38 Sptlc2 (+14001), Ahsa1 (+107501) MACS_peak_967 chr12 94282586 94283506 51.35 MACS_peak_969 chr12 95694800 95695613 67.8 Flrt2 (+2981), 1700019M22Rik (+352015) MACS_peak_970 chr12 95746795 95747784 122.41 Flrt2 (+55064), 1700019M22Rik (+299932) MACS_peak_971 chr12 97612531 97613057 103.97 Galc (+646543) MACS_peak_972 chr12 98106442 98106872 77.35 Galc (+152680) MACS_peak_975 chr12 99391515 99392394 103.75 3300002A11Rik (+45557), Foxn3 (+58119) MACS_peak_977 chr12 100724915 100725561 113.08 Rps6ka5 (-210) MACS_peak_981 chr12 102875944 102876499 151.45 Btbd7 (+2184), Ubr7 (+118247) MACS_peak_983 chr12 104985750 104986344 72.68 Clmn (-120971), 4831426I19Rik (+12630) MACS_peak_984 chr12 105009656 105010396 128.61 Glrx5 (-22663), 4831426I19Rik (-11349) MACS_peak_985 chr12 105784131 105784564 57.13 Papola (-354) MACS_peak_987 chr12 108223214 108223942 140.32 Ccnk (+43840), Ccdc85c (+51839) MACS_peak_988 chr12 108835639 108836111 104.79 Slc25a29 (+1) MACS_peak_989 chr12 111089200 111089663 140.29 Traf3 (-77116), Rcor1 (+49634) MACS_peak_990 chr12 111430388 111431386 296.82 Tnfaip2 (-11774), 1200009I06Rik (+13457) MACS_peak_991 chr12 111446372 111446791 58.28 Tnfaip2 (+3921), Gm266 (+39241) MACS_peak_992 chr12 111486179 111487398 150.64 Gm266 (-966) MACS_peak_994 chr12 111516798 111517160 177.91 Gm266 (-31156), Eif5 (-21122) MACS_peak_995 chr12 111681934 111682396 117.2 Trmt61a (+4060), Bag5 (+31091) MACS_peak_996 chr12 111816433 111816993 149.78 Xrcc3 (-2872), Zfyve21 (+2443) MACS_peak_1018 chr13 13954343 13955024 94.11 B3galnt2 (+10) MACS_peak_1023 chr13 20050115 20050854 295.85 Gpr141 (-226228), Elmo1 (-134869) MACS_peak_1024 chr13 20052476 20053375 191.66 Gpr141 (-228669), Elmo1 (-132428) MACS_peak_1025 chr13 20108845 20109360 79.34 Gpr141 (-284846), Elmo1 (-76251) MACS_peak_1026 chr13 25069695 25070565 57.06 Dcdc2a (+14126), Nrsn1 (+199866) MACS_peak_1027 chr13 25098247 25099250 143.79 Dcdc2a (+42745), Nrsn1 (+171247) MACS_peak_1031 chr13 28757480 28758422 553.06 Sox4 (+195731), Prl5a1 (+615467) MACS_peak_1032 chr13 29954715 29955130 68.55 Cdkal1 (-99335), E2f3 (+31140) MACS_peak_1033 chr13 29957674 29958327 294.55 Cdkal1 (-102413), E2f3 (+28062) MACS_peak_1035 chr13 32518377 32519381 355.12 Gmds (-180335), Mylk4 (+262900) MACS_peak_1038 chr13 32924327 32925329 93.66 Serpinb6b (-40685), Serpinb1c (-26688) MACS_peak_1039 chr13 33018729 33019180 75.27 Serpinb9b (-8459), Serpinb9 (+14414) MACS_peak_1042 chr13 37440673 37441467 73.32 Rreb1 (-447801), Ly86 (+95725) MACS_peak_1045 chr13 37531708 37532371 217.2 Rreb1 (-356831), Ly86 (+186695) MACS_peak_1046 chr13 37826664 37827129 63.58 Rreb1 (-61974), Ly86 (+481552) MACS_peak_1047 chr13 38528068 38528579 51.4 Txndc5 (+136) MACS_peak_1051 chr13 41249582 41250167 64.15 BC024659 (+31) MACS_peak_1052 chr13 41267608 41268241 60.18 BC024659 (+18081), Nedd9 (+91076) MACS_peak_1053 chr13 41457303 41458043 358.42 Tmem170b (-148543), Nedd9 (-98672) MACS_peak_1054 chr13 41689590 41690093 170.14 Gm5082 (+40399), 9530008L14Rik (+157646) MACS_peak_1055 chr13 41705514 41706067 57.42 Gm5082 (+56348), 9530008L14Rik (+141697) MACS_peak_1057 chr13 42050991 42051726 81.11 Hivep1 (-662) MACS_peak_1059 chr13 42241945 42242516 195.64 Edn1 (-59039), Hivep1 (+190210) MACS_peak_1060 chr13 44073013 44073589 101.76 Jarid2 (-657602), Cd83 (+288194) MACS_peak_1061 chr13 44228288 44229197 173.45 Jarid2 (-502160), Cd83 (+443636) MACS_peak_1062 chr13 44232081 44233099 182.76 Jarid2 (-498313), Cd83 (+447483) MACS_peak_1063 chr13 44413051 44413782 98.29 Jarid2 (-317486), Cd83 (+628310) MACS_peak_1064 chr13 44506996 44507740 228.54 Jarid2 (-223535), Cd83 (+722261) MACS_peak_1065 chr13 44658041 44658678 107.23 Jarid2 (-72543), Cd83 (+873253) MACS_peak_1066 chr13 44733827 44734363 58.61 Jarid2 (+3192), Dtnbp1 (+268001) MACS_peak_1067 chr13 44839681 44840959 148.09 Jarid2 (+109417), Dtnbp1 (+161776) MACS_peak_1070 chr13 44939606 44940036 98.81 Dtnbp1 (+62275), Jarid2 (+208918) MACS_peak_1071 chr13 47104890 47105565 52.96 Dek (+993) MACS_peak_1072 chr13 47122314 47123154 73.4 Rnf144b (+14) MACS_peak_1074 chr13 48227692 48228204 69.81 Id4 (-33479) MACS_peak_1076 chr13 48545626 48546494 58.88 Zfp169 (-32650), Ptpdc1 (+79513) MACS_peak_1077 chr13 48552183 48552841 218 Zfp169 (-39102), Ptpdc1 (+73061) MACS_peak_1078 chr13 51250850 51251440 92.39 S1pr3 (-157473), Nxnl2 (+80120) MACS_peak_1080 chr13 54211937 54212513 93.72 Cplx2 (-165119), Hrh2 (+20096) MACS_peak_1082 chr13 54611362 54611842 62.86 Cltb (-330) MACS_peak_1083 chr13 55168878 55169467 229.8 Nsd1 (-40609), Fgfr4 (+16355) MACS_peak_1084 chr13 55444603 55445295 93.18 Grk6 (-385) MACS_peak_1085 chr13 56088468 56089029 75.34 Pitx1 (-257324), H2afy (+46801) MACS_peak_1086 chr13 58035445 58036081 222.31 Spock1 (-127431), Klhl3 (+66665) MACS_peak_1088 chr13 59646379 59646870 124.75 Golm1 (+29159), Naa35 (+61292) MACS_peak_1089 chr13 59704630 59705084 52.03 4921517D22Rik (-10756), Fam75d3 (+1340) MACS_peak_1090 chr13 59834651 59835600 129.08 Zcchc6 (-11979), Gas1 (+342409) MACS_peak_1093 chr13 60177178 60178206 150.96 Gas1 (-157) MACS_peak_1094 chr13 60267127 60268067 149.43 Dapk1 (-334350), Gas1 (-90062) MACS_peak_1097 chr13 60470789 60471286 71.14 Gas1 (-293503), Dapk1 (-130909) MACS_peak_1098 chr13 63256749 63257206 196.51 Fancc (+174767), 2010111I01Rik (+241992) MACS_peak_1099 chr13 63486764 63487193 113.12 Fancc (-55234), Ptch1 (+78541) MACS_peak_1100 chr13 63564725 63565213 210.48 Ptch1 (+551) MACS_peak_1102 chr13 67864860 67866009 186.25 BC048507 (+2098), Mtrr (+754626) MACS_peak_1105 chr13 70277719 70278094 62.98 BC018507 (+359727), Med10 (+468025) MACS_peak_1108 chr13 73970885 73971528 139.22 Tppp (-38212), Zdhhc11 (+7345) MACS_peak_1116 chr13 81131211 81131737 68.66 Arrdc3 (+247790), Gpr98 (+501670) MACS_peak_1118 chr13 81710805 81711550 88.9 Mblac2 (-239), Polr3g (-165) MACS_peak_1122 chr13 84347666 84348664 157.1 Ccnh (-841312), Tmem161b (+125869) MACS_peak_1127 chr13 91371011 91371632 113.54 Atg10 (-147335), Ssbp2 (-89775) MACS_peak_1129 chr13 93137940 93138544 71.91 Cmya5 (+6482), Mtx3 (+293455) MACS_peak_1130 chr13 93303285 93304034 160.5 Homer1 (-835) MACS_peak_1131 chr13 94264006 94264429 322.91 Scamp1 (+21063), Lhfpl2 (+206422) MACS_peak_1132 chr13 95779347 95780075 116.94 F2rl2 (+82791), Iqgap2 (+112211) MACS_peak_1136 chr13 98015785 98016620 129.49 Rgnef (+189962), Enc1 (+775098) MACS_peak_1137 chr13 98358659 98359178 74.5 Foxd1 (+4674), Tmem174 (+278491) MACS_peak_1138 chr13 98365634 98366656 124.18 Foxd1 (+11900), Tmem174 (+271265) MACS_peak_1139 chr13 98392960 98394026 171.31 Foxd1 (+39248), Tmem174 (+243917) MACS_peak_1140 chr13 98533967 98534884 54.21 Tmem174 (+102984), Foxd1 (+180181) MACS_peak_1141 chr13 98594785 98595470 66.15 Tmem174 (+42282), Foxd1 (+240883) MACS_peak_1143 chr13 99124660 99125383 185.9 1700024P04Rik (-140457), Zfp366 (-59801) MACS_peak_1145 chr13 99516370 99516830 84.69 Mtap1b (+2) MACS_peak_1146 chr13 102748972 102749729 151.32 Cd180 (+55793), Mast4 (+585141) MACS_peak_1147 chr13 102756451 102757233 325.94 Cd180 (+63284), Mast4 (+577650) MACS_peak_1148 chr13 102764228 102765050 133.02 Cd180 (+71081), Mast4 (+569853) MACS_peak_1151 chr13 104540713 104541189 53.84 Adamts6 (+253078), Cwc27 (+276002) MACS_peak_1157 chr13 107890014 107890539 58.9 Zswim6 (-213) MACS_peak_1158 chr13 107890553 107890991 181.5 Zswim6 (-708) MACS_peak_1162 chr13 109651991 109652619 53.32 Rab3c (+627912), Pde4d (+998203) MACS_peak_1164 chr13 112037872 112038295 88.06 Ankrd55 (-250367), Map3k1 (-229101) MACS_peak_1167 chr13 112927255 112927881 85.85 Dhx29 (-225), Skiv2l2 (-188) MACS_peak_1168 chr13 113180309 113180766 117.86 Gzmk (+359) MACS_peak_1170 chr13 113621888 113622421 98.01 Snx18 (-3591) MACS_peak_1171 chr13 114821469 114822442 172.04 Mocs2 (+3719), Itga2 (+110085) MACS_peak_1176 chr13 119409260 119409699 56.65 Nnt (-342) MACS_peak_1177 chr13 119689705 119690342 113.02 MACS_peak_1178 chr14 8164514 8164850 72.41 Pdhb (+8310), Pxk (+66469) MACS_peak_1181 chr14 13399458 13400105 118.09 Sntn (-271094), Synpr (+115002) MACS_peak_1182 chr14 14012336 14012719 81.62 Atxn7 (+37) MACS_peak_1186 chr14 20165331 20165975 128.31 1810063B07Rik (-82481), Kcnk5 (+16129) MACS_peak_1187 chr14 21500221 21500671 55.79 Myst4 (+592) MACS_peak_1188 chr14 21822773 21823368 123.1 Vdac2 (-8490), Samd8 (+72540) MACS_peak_1189 chr14 21987650 21988336 83.47 Comtd1 (-139083), Zfp503 (+1608) MACS_peak_1190 chr14 22161358 22161939 138.87 1700112E06Rik (+141937) MACS_peak_1191 chr14 22745708 22746702 189.03 1700112E06Rik (+726493) MACS_peak_1193 chr14 22757668 22758091 195.55 1700112E06Rik (+738168) MACS_peak_1194 chr14 24205135 24205844 153.23 Kcnma1 (-201285), Dlg5 (+40430) MACS_peak_1195 chr14 24222177 24223032 158.22 Kcnma1 (-218400), Dlg5 (+23315) MACS_peak_1196 chr14 24245647 24246274 60.61 Dlg5 (-41) MACS_peak_1197 chr14 24822935 24823566 437.14 Zmiz1 (-636041), Rps24 (+332834) MACS_peak_1198 chr14 25457462 25458228 201.96 Zmiz1 (-1447) MACS_peak_1200 chr14 26579804 26580416 89.67 Fam116a (+560) MACS_peak_1201 chr14 31223803 31224183 71.01 Sema3g (+6120), Phf7 (+27225) MACS_peak_1202 chr14 31226774 31227667 551.49 Sema3g (+9348), Phf7 (+23997) MACS_peak_1203 chr14 31229346 31230023 191.3 Sema3g (+11812), Phf7 (+21533) MACS_peak_1204 chr14 31336662 31337070 57.08 Capn7 (+142) MACS_peak_1205 chr14 31830476 31830937 62.57 Ankrd28 (-292) MACS_peak_1206 chr14 31831029 31831955 62.86 Ankrd28 (-1077) MACS_peak_1207 chr14 32950697 32951275 54.35 Lrrc18 (-40396), E130203B14Rik (+94230) MACS_peak_1211 chr14 35842775 35843345 56.27 4930474N05Rik (-251905), 4930596D02Rik (-31082) MACS_peak_1215 chr14 36942357 36943019 91.1 Fam190b (-1424) MACS_peak_1221 chr14 45218965 45219786 86.56 Gpr137c (-341), Txndc16 (+175) MACS_peak_1222 chr14 45463385 45464095 106.5 Gnpnat1 (-74944), Fermt2 (+66325) MACS_peak_1223 chr14 45506655 45507591 68.53 Gnpnat1 (-118327), Fermt2 (+22942) MACS_peak_1227 chr14 46902146 46902595 66.39 Samd4 (+19406), Gch1 (+287031) MACS_peak_1228 chr14 46999424 47000232 84.24 Samd4 (+116863), Gch1 (+189574) MACS_peak_1229 chr14 47405867 47406393 50.41 Dlgap5 (+12277), Lgals3 (+32270) MACS_peak_1231 chr14 47823031 47823765 99.25 Peli2 (-297471), Ktn1 (+159642) MACS_peak_1232 chr14 47839540 47840127 55.15 Peli2 (-281035), Ktn1 (+176078) MACS_peak_1233 chr14 47857084 47857808 53.84 Peli2 (-263423), Ktn1 (+193690) MACS_peak_1237 chr14 50807424 50807884 106.23 Parp2 (-292) MACS_peak_1238 chr14 52143066 52143951 96.71 Rpgrip1 (+32606), Supt16h (+53730) MACS_peak_1239 chr14 54575540 54576033 61.83 Haus4 (-21426), Jub (+1629) MACS_peak_1240 chr14 54577314 54578169 108.29 Jub (-326) MACS_peak_1241 chr14 54897299 54897867 326.77 Pabpn1 (+3440), Slc22a17 (+15549) MACS_peak_1244 chr14 55014497 55015077 124.83 Ngdn (-667) MACS_peak_1245 chr14 55585002 55585603 101.46 Psme2 (+5718), Psme1 (+6809) MACS_peak_1246 chr14 56667769 56668805 170.64 Mphosph8 (+39) MACS_peak_1247 chr14 57737002 57737496 168.57 Xpo4 (-72293), Lats2 (+8874) MACS_peak_1248 chr14 57744201 57744935 66.52 Xpo4 (-79612), Lats2 (+1555) MACS_peak_1255 chr14 61648673 61649183 56.15 Kcnrg (+41446), Dleu7 (+644051) MACS_peak_1256 chr14 61681067 61681761 92.25 Kcnrg (+73932), Dleu7 (+611565) MACS_peak_1257 chr14 61769797 61770356 185.41 Kcnrg (+162595), Dleu7 (+522902) MACS_peak_1259 chr14 63163820 63164657 104.3 Fdft1 (+14252), Ctsb (+41774) MACS_peak_1260 chr14 65097788 65098313 50.48 Extl3 (+55) MACS_peak_1261 chr14 65098863 65099263 163.07 Extl3 (-957) MACS_peak_1263 chr14 65343690 65344168 126.48 Zfp395 (-14747), Fbxo16 (+77228) MACS_peak_1266 chr14 66868370 66869189 100.81 Dpysl2 (-180), Gm5464 (-70) MACS_peak_1267 chr14 67008786 67009401 120.86 Bnip3l (-217) MACS_peak_1268 chr14 67866435 67866849 60.4 Dock5 (+66930), Gnrh1 (+121413) MACS_peak_1269 chr14 67877759 67878520 176.56 Dock5 (+55432), Gnrh1 (+132911) MACS_peak_1270 chr14 69997343 69997862 99.48 Egr3 (-79842), Pebp4 (+157183) MACS_peak_1271 chr14 70074700 70075904 145.97 Egr3 (-2143) MACS_peak_1272 chr14 70170358 70171176 183.97 9930012K11Rik (-11265), Pdlim2 (+6905) MACS_peak_1273 chr14 70206400 70207102 71.72 Sorbs3 (+920) MACS_peak_1274 chr14 70583679 70584042 139.73 Nudt18 (+6014), Fam160b2 (+15974) MACS_peak_1276 chr14 73452951 73453624 57.35 Itm2b (-68017), Med4 (-56761) MACS_peak_1278 chr14 74731970 74732533 53.57 Esd (-93) MACS_peak_1279 chr14 74863015 74863386 103.62 Lrch1 (+84676), Esd (+130856) MACS_peak_1280 chr14 74882478 74883579 184.59 Lrch1 (+64848), Esd (+150684) MACS_peak_1281 chr14 74910157 74910802 172.62 Lrch1 (+37397), Esd (+178135) MACS_peak_1282 chr14 74925734 74926371 185.39 Lrch1 (+21824), Esd (+193708) MACS_peak_1283 chr14 74946427 74947119 65.68 Lrch1 (+1104), Esd (+214428) MACS_peak_1284 chr14 74947461 74948243 77.17 Lrch1 (+25) MACS_peak_1285 chr14 75284070 75284727 64.87 Zc3h13 (+26) MACS_peak_1287 chr14 75845018 75845521 61.05 Tpt1 (+14) MACS_peak_1288 chr14 76505681 76506268 107.18 Serp2 (+50712), Tsc22d1 (+90154) MACS_peak_1289 chr14 76569360 76569863 125.28 Serp2 (-12925), 9030625A04Rik (+467005) MACS_peak_1291 chr14 76764039 76764888 548.9 Serp2 (-207777), 9030625A04Rik (+272153) MACS_peak_1292 chr14 76912361 76913026 81.11 Serp2 (-356007), 9030625A04Rik (+123923) MACS_peak_1293 chr14 76927370 76928086 95.93 Serp2 (-371041), 9030625A04Rik (+108889) MACS_peak_1295 chr14 78645520 78646079 114.04 Akap11 (-108940), Dgkh (+79289) MACS_peak_1308 chr14 87254930 87255869 95.22 Tdrd3 (-161183), Diap3 (-114286) MACS_peak_1327 chr14 97791685 97792449 71.66 Dach1 (+377476) MACS_peak_1331 chr14 101608806 101609364 75.32 Tbc1d4 (+106) MACS_peak_1334 chr14 103099355 103099974 151.78 Fbxl3 (-156) MACS_peak_1335 chr14 103471069 103471610 75.94 Mycbp2 (-124540), Scel (-42001) MACS_peak_1336 chr14 103474627 103475332 125.33 Mycbp2 (-128180), Scel (-38361) MACS_peak_1337 chr14 103485472 103486122 137.5 Mycbp2 (-138997), Scel (-27544) MACS_peak_1359 chr14 120336438 120336874 58.41 Rap2a (-141805), Mbnl2 (+60987) MACS_peak_1360 chr14 120477220 120477866 71.6 Rap2a (-918) MACS_peak_1361 chr14 120477964 120478327 88.57 Rap2a (-315) MACS_peak_1362 chr14 122564097 122564744 182.49 Pcca (+30093), A2ld1 (+348744) MACS_peak_1367 chr15 3995749 3996351 50.93 AW549877 (-298) MACS_peak_1368 chr15 4027186 4027881 164.83 Plcxd3 (-347957), Oxct1 (+1106) MACS_peak_1369 chr15 4790153 4790687 105.91 Heatr7b2 (-108317), C6 (+63210) MACS_peak_1370 chr15 4796695 4797291 89.18 Heatr7b2 (-101744), C6 (+69783) MACS_peak_1372 chr15 5343710 5344390 167.44 Ptger4 (-100219) MACS_peak_1375 chr15 6909652 6910125 189.59 Lifr (-230653), Osmr (-35576) MACS_peak_1378 chr15 10691443 10691758 103.93 Ttc23l (-132933), Rai14 (+23030) MACS_peak_1379 chr15 10714483 10715402 94.27 Rai14 (-312) MACS_peak_1380 chr15 11160887 11161230 54.08 Adamts12 (+96269), Tars (+238599) MACS_peak_1383 chr15 12117355 12118291 176.98 Zfr (-28) MACS_peak_1409 chr15 25509909 25510530 96.5 Myo10 (-112330), Basp1 (-96456) MACS_peak_1412 chr15 27884494 27885037 76.86 Fam105a (-203268), Trio (+141082) MACS_peak_1418 chr15 31322674 31323159 148.86 Ankrd33b (+44842), Dap (+98532) MACS_peak_1419 chr15 31381810 31382703 71.37 Ankrd33b (-14498), Ropn1l (+71432) MACS_peak_1420 chr15 31392625 31393144 297.26 Ankrd33b (-25126), Ropn1l (+60804) MACS_peak_1421 chr15 32042096 32042812 72.85 Tas2r119 (-134835), Fam173b (+440338) MACS_peak_1424 chr15 32778592 32778994 69.81 Sdc2 (-141930), Sema5a (+533980) MACS_peak_1426 chr15 35371251 35371920 76.22 Vps13b (+40) MACS_peak_1428 chr15 36531927 36532333 90.66 Ankrd46 (-35339), Snx31 (+23442) MACS_peak_1430 chr15 37136776 37137311 67.93 Zfp706 (-129642), Grhl2 (-95992) MACS_peak_1431 chr15 37433252 37433762 88.04 Grhl2 (+200471), Ncald (+358493) MACS_peak_1432 chr15 37568791 37569321 57.33 Ncald (+222944), Grhl2 (+336020) MACS_peak_1434 chr15 37779420 37779807 60.81 Ncald (+12386), Grhl2 (+546578) MACS_peak_1435 chr15 38299341 38299865 58.97 Klf10 (+1104), Odf1 (+80400) MACS_peak_1436 chr15 38300879 38301584 101.76 Klf10 (-525) MACS_peak_1437 chr15 38384162 38385304 180.55 Klf10 (-84026), Azin1 (+134533) MACS_peak_1438 chr15 38470439 38470884 108.1 Klf10 (-169955), Azin1 (+48604) MACS_peak_1457 chr15 51798573 51799521 143.98 Trps1 (-909006), Eif3h (+66414) MACS_peak_1459 chr15 53322641 53323279 96.86 Ext1 (+23223), Med30 (+610515) MACS_peak_1460 chr15 53347019 53347849 100.89 Ext1 (-1251) MACS_peak_1461 chr15 53826503 53827272 86.89 Ext1 (-480705), Samd12 (+75548) MACS_peak_1463 chr15 53896511 53897323 306.39 Ext1 (-550734), Samd12 (+5519) MACS_peak_1467 chr15 57793221 57794246 244.9 Derl1 (+98684), Zhx2 (+99067) MACS_peak_1468 chr15 59003833 59004254 71.32 Ndufb9 (+70234), Mtss1 (+77982) MACS_peak_1475 chr15 67176597 67177228 92.37 St3gal1 (-31) MACS_peak_1477 chr15 67303684 67304281 78.64 St3gal1 (-127101), Zfat (+954873) MACS_peak_1478 chr15 67361026 67361813 133.33 St3gal1 (-184538), Zfat (+897436) MACS_peak_1481 chr15 68363279 68363628 74.4 Khdrbs3 (-563834), Zfat (-104598) MACS_peak_1487 chr15 72687046 72687853 106.6 Kcnk9 (-141171), Trappc9 (+373754) MACS_peak_1490 chr15 75705345 75706098 127.3 Rhpn1 (+1434), Mafa (+42200) MACS_peak_1491 chr15 75856798 75857327 142.52 Zc3h3 (-15155), Gsdmd (-5276) MACS_peak_1492 chr15 76091565 76091947 71.01 Nrbp2 (-1743) MACS_peak_1493 chr15 76206733 76207247 51.2 Plec (-669) MACS_peak_1494 chr15 76207279 76207884 111.39 Plec (-1261) MACS_peak_1495 chr15 76208111 76208772 99.52 Plec (-2121) MACS_peak_1496 chr15 76457028 76457597 104.7 Scx (-125) MACS_peak_1498 chr15 77037539 77038206 136.44 Apol6 (-7403), 1110038F14Rik (+89329) MACS_peak_1499 chr15 77306749 77307292 140.62 Rbfox2 (+32) MACS_peak_1500 chr15 77784204 77784841 67.76 Apol8 (-29294), Myh9 (+57592) MACS_peak_1501 chr15 77792040 77792658 153.43 Apol8 (-37120), Myh9 (+49766) MACS_peak_1503 chr15 77842151 77842940 85.6 Myh9 (-431) MACS_peak_1504 chr15 77882626 77883290 147.66 Myh9 (-40843), Txn2 (+46036) MACS_peak_1505 chr15 78405856 78406461 62.74 Mpst (-553), Tst (-300) MACS_peak_1506 chr15 78416804 78417533 99.67 Kctd17 (-11459), Mpst (+10457) MACS_peak_1507 chr15 78792140 78792962 183.48 Mfng (-19106), Card10 (+10491) MACS_peak_1508 chr15 78796244 78797119 199.04 Mfng (-23237), Card10 (+6360) MACS_peak_1509 chr15 78803325 78804364 245.12 Card10 (-803) MACS_peak_1510 chr15 79391540 79392119 283.63 Tmem184b (+11473), Maff (+44152) MACS_peak_1512 chr15 79742512 79742999 159.41 Sun2 (-226) MACS_peak_1513 chr15 80014710 80015265 127.83 Pdgfb (-180) MACS_peak_1514 chr15 81190671 81191269 167.62 Mkl1 (-85951), Mchr1 (-44529) MACS_peak_1516 chr15 81802431 81803022 72.92 Tef (+54) MACS_peak_1517 chr15 81804523 81805159 59.97 Tef (+2168), Tob2 (+53485) MACS_peak_1518 chr15 81836357 81836804 75.66 Tob2 (+21745), Tef (+33908) MACS_peak_1519 chr15 82932883 82933548 151.29 Tcf20 (-21082), Nfam1 (+89922) MACS_peak_1521 chr15 83471563 83472214 106.76 Pacsin2 (-7283), Ttll1 (+39018) MACS_peak_1522 chr15 84300945 84301431 160.72 Parvg (-24931), Parvb (+69145) MACS_peak_1523 chr15 84313748 84314330 55.48 Parvg (-12080), Parvb (+81996) MACS_peak_1525 chr15 84681460 84682047 55.15 Prr5 (+756) MACS_peak_1526 chr15 84696184 84696478 81.62 Arhgap8 (-23721), Prr5 (+15333) MACS_peak_1527 chr15 85675868 85676402 83.34 Wnt7b (-98065), Ppara (-59429) MACS_peak_1529 chr15 86078796 86079219 110.96 Gramd4 (+21301), Cerk (+107133) MACS_peak_1530 chr15 86089875 86090607 182.49 Gramd4 (+32534), Cerk (+95900) MACS_peak_1531 chr15 86188792 86189605 194.57 Cerk (-3058) MACS_peak_1532 chr15 86219402 86219919 99.7 Tbc1d22a (+5202) MACS_peak_1533 chr15 88863811 88864319 157.29 Pim3 (+1871), Ttll8 (+90353) MACS_peak_1534 chr15 89180346 89180858 60.37 Plxnb2 (-6752), Fam116b (+15873) MACS_peak_1536 chr15 95209103 95209640 450.57 Nell2 (+319334), Tmem117 (+580187) MACS_peak_1537 chr15 95217006 95217687 277.83 Nell2 (+311359), Tmem117 (+588162) MACS_peak_1542 chr15 97677765 97678671 142.82 Amigo2 (-430931), Rpap3 (+27604) MACS_peak_1543 chr15 97695593 97696293 103.71 Amigo2 (-448656), Rpap3 (+9879) MACS_peak_1544 chr15 97762609 97763321 64.4 Endou (-31560), Rapgef3 (+4701) MACS_peak_1545 chr15 97778621 97779367 125.33 Rapgef3 (-11328), Slc48a1 (-5371) MACS_peak_1546 chr15 97781914 97782572 106.08 Slc48a1 (-2122) MACS_peak_1547 chr15 97832022 97832895 177.47 Hdac7 (-788) MACS_peak_1549 chr15 97927079 97927733 51.65 Tmem106c (-36873), Vdr (-19110) MACS_peak_1551 chr15 98762129 98763011 220.53 Arf3 (+548) MACS_peak_1552 chr15 98793290 98793676 139.73 Wnt1 (+3626), Ddn (+14442) MACS_peak_1553 chr15 98809400 98810066 72.11 Ddn (-1808) MACS_peak_1554 chr15 98812606 98813518 143.45 Ddn (-5137), Prkag1 (+18446) MACS_peak_1555 chr15 98832151 98832760 53.75 Prkag1 (-948) MACS_peak_1557 chr15 99093379 99093959 124.83 C1ql4 (-5941), Dnajc22 (-5815) MACS_peak_1558 chr15 99221510 99222237 107.23 Kcnh3 (-3102) MACS_peak_1559 chr15 99457666 99458328 50.65 Nckap5l (-249) MACS_peak_1560 chr15 99772386 99772921 58.68 Lass5 (-139) MACS_peak_1561 chr15 99787104 99787830 241.35 Lass5 (-14952), Lima1 (+87989) MACS_peak_1564 chr15 101173636 101174051 58.62 Acvr1b (-281) MACS_peak_1565 chr15 101293775 101294596 66.16 9430023L20Rik (+9885), Krt80 (+75939) MACS_peak_1567 chr15 101827378 101827686 92.6 Krt2 (-9363), Krt1 (+23254) MACS_peak_1568 chr15 102100046 102100702 206.26 Tenc1 (-2614) MACS_peak_1569 chr15 102100710 102101581 126.19 Tenc1 (-1842) MACS_peak_1570 chr15 102101807 102102234 170.8 Tenc1 (-967) MACS_peak_1571 chr15 102102512 102103061 86.2 Tenc1 (-201) MACS_peak_1572 chr15 102103259 102103920 76.82 Tenc1 (+602) MACS_peak_1573 chr15 102104041 102104531 62.06 Tenc1 (+1298), Spryd3 (+31929) MACS_peak_1574 chr15 102106298 102106780 237.94 Tenc1 (+3551), Spryd3 (+29676) MACS_peak_1575 chr15 102247523 102248369 90.5 Itgb7 (-16011), Rarg (+9537) MACS_peak_1576 chr15 102406528 102407197 98.63 Sp1 (+547) MACS_peak_1577 chr15 102516666 102517189 50.61 Tarbp2 (-1318), Map3k12 (+76) MACS_peak_1579 chr15 102746649 102747321 67.02 Hoxc13 (-174146), Calcoco1 (-24807) MACS_peak_1580 chr15 102976956 102978017 102.13 Hoxc9 (+455) MACS_peak_1581 chr15 102998997 102999648 54.41 Hoxc6 (-10239), Hoxc8 (+8784) MACS_peak_1582 chr15 103060058 103060537 91.67 Hoxc4 (+26331), Smug1 (+103139) MACS_peak_1583 chr15 103060805 103061587 148.96 Hoxc4 (+27229), Smug1 (+102241) MACS_peak_1584 chr15 103115144 103115862 174.26 Smug1 (+47934), Hoxc4 (+81536) MACS_peak_1585 chr15 103305038 103305459 122.84 Gpr84 (+5189), Copz1 (+32331) MACS_peak_1586 chr16 3872189 3872546 152.22 Zfp597 (+6) MACS_peak_1588 chr16 4641980 4642604 247.18 Vasn (+2347), Coro7 (+37428) MACS_peak_1589 chr16 4658500 4659614 132.88 Vasn (+19112), Coro7 (+20663) MACS_peak_1590 chr16 5997097 5997872 77.65 Fam86 (-741529) MACS_peak_1592 chr16 10785627 10786117 52.84 Socs1 (-336) MACS_peak_1594 chr16 10992882 10993290 113.01 Litaf (+35) MACS_peak_1595 chr16 11526933 11527386 118.39 Gm9961 (-374204), Snx29 (+121512) MACS_peak_1597 chr16 14182220 14182796 74.11 Nde1 (+19233), Myh11 (+108900) MACS_peak_1603 chr16 17863156 17863580 57.86 Car15 (-25182), Dgcr2 (+28360) MACS_peak_1605 chr16 18776637 18777130 113.28 Cldn5 (+37) MACS_peak_1606 chr16 18781733 18782347 427.51 Cldn5 (+5193), Cdc45 (+29932) MACS_peak_1608 chr16 20702563 20702886 125.96 Fam131a (+7668), Clcn2 (+14252) MACS_peak_1609 chr16 20716064 20716768 92.18 Polr2h (-1410), Clcn2 (+561) MACS_peak_1612 chr16 23239484 23240244 147.41 Rtp1 (-189269), BC106179 (-14534) MACS_peak_1613 chr16 23240396 23241131 206.3 Rtp1 (-188369), BC106179 (-15434) MACS_peak_1614 chr16 23256505 23257150 107.34 Rtp1 (-172305), BC106179 (-31498) MACS_peak_1615 chr16 23266180 23266550 82.48 Rtp1 (-162768), BC106179 (-41035) MACS_peak_1616 chr16 23358538 23359298 126.61 BC106179 (-133588), Rtp1 (-70215) MACS_peak_1617 chr16 23401262 23401893 75 BC106179 (-176248), Rtp1 (-27555) MACS_peak_1619 chr16 25468565 25469086 69.12 Trp63 (-214939), Tprg (+182009) MACS_peak_1620 chr16 26049095 26050120 156.12 Leprel1 (+56176), Trp63 (+365843) MACS_peak_1621 chr16 26116062 26116823 81.11 Leprel1 (-10659), Cldn1 (+255396) MACS_peak_1624 chr16 30034008 30034629 146.61 Hes1 (-31038), Opa1 (+454985) MACS_peak_1625 chr16 30063896 30064534 173.59 Hes1 (-1142) MACS_peak_1627 chr16 30083375 30084023 87.27 Hes1 (+18342), Cpn2 (+183833) MACS_peak_1629 chr16 30187680 30188380 112.66 Cpn2 (+79502), Hes1 (+122673) MACS_peak_1630 chr16 30215779 30216163 55.72 Cpn2 (+51561), Hes1 (+150614) MACS_peak_1633 chr16 30821465 30822127 72.07 Fam43a (+222073), AI480653 (+259636) MACS_peak_1634 chr16 32877580 32878022 113.46 Fyttd1 (+17) MACS_peak_1635 chr16 33178720 33179302 80 Osbpl11 (-6060), Lmln (+116490) MACS_peak_1636 chr16 33449277 33449835 64.97 Slc12a8 (-68773), Zfp148 (+68781) MACS_peak_1637 chr16 33832396 33833359 137.78 Itgb5 (+3213), Umps (+134125) MACS_peak_1638 chr16 33871805 33872599 123.34 Itgb5 (+42537), Umps (+94801) MACS_peak_1639 chr16 33891567 33892522 76.78 Itgb5 (+62380), Umps (+74958) MACS_peak_1640 chr16 33917934 33918278 127.52 Umps (+48897), Itgb5 (+88441) MACS_peak_1641 chr16 33926551 33926960 61.73 Umps (+40247), Itgb5 (+97091) MACS_peak_1644 chr16 33941308 33941829 54.35 Umps (+25434), Itgb5 (+111904) MACS_peak_1646 chr16 34941700 34942413 232.06 Ptplb (-80364), Mylk (+157107) MACS_peak_1647 chr16 34942896 34943377 82.16 Ptplb (-79284), Mylk (+158187) MACS_peak_1648 chr16 34958608 34959033 62.95 Ptplb (-63600), Mylk (+173871) MACS_peak_1649 chr16 34959290 34959700 124.46 Ptplb (-62926), Mylk (+174545) MACS_peak_1650 chr16 35031110 35031706 54.35 Adcy5 (-124228), Ptplb (+8987) MACS_peak_1651 chr16 35178295 35179039 108.1 Adcy5 (+23031), Sec22a (+185251) MACS_peak_1652 chr16 35199679 35200059 81.62 Adcy5 (+44233), Sec22a (+164049) MACS_peak_1655 chr16 36640007 36640576 89.65 Casr (-78158), Cd86 (+25785) MACS_peak_1656 chr16 37869693 37870375 71.14 Gpr156 (-46462), Lrrc58 (+1634) MACS_peak_1657 chr16 37881003 37881630 90.62 Gpr156 (-35179), Lrrc58 (+12917) MACS_peak_1666 chr16 43547334 43548483 169.37 Tigit (+116275), Zbtb20 (+300625) MACS_peak_1671 chr16 45893435 45894062 136.11 Phldb2 (-49371), Plcxd2 (+116664) MACS_peak_1672 chr16 46010325 46010917 82.37 Plcxd2 (-208) MACS_peak_1673 chr16 48303979 48304455 53.84 Dppa2 (-6057), Dppa4 (+20482) MACS_peak_1675 chr16 49698822 49699242 125.91 Ift57 (-262) MACS_peak_1676 chr16 50783651 50784194 56.82 Ccdc54 (-192769) MACS_peak_1677 chr16 50785892 50787002 368.72 Ccdc54 (-195293) MACS_peak_1679 chr16 51999933 52000794 76.42 Cblb (-31185) MACS_peak_1686 chr16 58421937 58422417 51.88 Dcbld2 (+13642), St3gal6 (+101135) MACS_peak_1687 chr16 58514681 58515330 80.87 St3gal6 (+8306), Dcbld2 (+106471) MACS_peak_1688 chr16 58523427 58523892 122.81 St3gal6 (-348) MACS_peak_1690 chr16 59638910 59639872 56.31 Arl6 (-52) MACS_peak_1714 chr16 73646965 73647876 116.06 Robo2 (+763491), Robo1 (+984272) MACS_peak_1716 chr16 73958291 73958967 50.07 Robo2 (+452283) MACS_peak_1718 chr16 76369717 76370574 66.48 Samsn1 (-460880), Nrip1 (+2903) MACS_peak_1720 chr16 78213774 78214259 91.32 Cxadr (-87674) MACS_peak_1732 chr16 87454687 87455137 96.44 Usp16 (-73) MACS_peak_1736 chr16 90407895 90408401 60.82 Hunk (+21751), 2610039C10Rik (+319223) MACS_peak_1737 chr16 91728352 91729383 78.77 Itsn1 (-503), Cryzl1 (-66) MACS_peak_1738 chr16 92183587 92184276 118.28 Kcne2 (-108457), Mrps6 (+125610) MACS_peak_1739 chr16 92458304 92458704 81.28 Kcne1 (-99036), Rcan1 (+7642) MACS_peak_1740 chr16 92631985 92632847 168.02 Clic6 (+134269), Runx1 (+193650) MACS_peak_1742 chr16 94536939 94537436 52.35 Dyrk1a (-33018), Dscr3 (-10559) MACS_peak_1743 chr16 95701990 95702722 80.69 Ets2 (-51) MACS_peak_1744 chr16 96757514 96758145 88.72 Itgb2l (-314216), Dscam (+412905) MACS_peak_1747 chr17 4907883 4908466 55.41 Arid1b (-86899) MACS_peak_1749 chr17 5940838 5941176 71.01 Synj2 (-273) MACS_peak_1750 chr17 6816153 6816669 51.07 Ezr (-33631), Rsph3b (+131945) MACS_peak_1751 chr17 6852454 6853232 144.42 Ezr (-70063), Rsph3b (+95513) MACS_peak_1752 chr17 8507933 8508706 69.09 Pde10a (-293425), T (+73897) MACS_peak_1753 chr17 8524593 8525447 99.03 Pde10a (-276725), T (+90597) MACS_peak_1755 chr17 10319699 10320749 78.14 Qk (-863) MACS_peak_1756 chr17 10581797 10582503 140.68 Qk (-262790), Pacrg (+258041) MACS_peak_1757 chr17 10677182 10677595 51.44 Qk (-358029), Pacrg (+162802) MACS_peak_1758 chr17 11513719 11514513 261.49 Agpat4 (-605168), Park2 (+673732) MACS_peak_1760 chr17 12169322 12169825 461.86 Agpat4 (+50290), Map3k4 (+149086) MACS_peak_1761 chr17 12292804 12293245 86.7 Map3k4 (+25635), Agpat4 (+173741) MACS_peak_1762 chr17 12327630 12328348 242.73 Plg (-50620), Map3k4 (-9329) MACS_peak_1764 chr17 17826563 17827006 97.26 Ncrna00085 (-4190) MACS_peak_1768 chr17 21488715 21489118 101.79 Zfp53 (-71) MACS_peak_1772 chr17 24638719 24639786 263.96 Nthl1 (+6571), Slc9a3r2 (+11052) MACS_peak_1773 chr17 24643980 24644777 123.06 Slc9a3r2 (+5926), Nthl1 (+11697) MACS_peak_1774 chr17 24649507 24650225 174.26 Slc9a3r2 (+439) MACS_peak_1775 chr17 24761112 24761625 180.74 4930528F23Rik (-43013), Hs3st6 (+8366) MACS_peak_1777 chr17 24960652 24961204 85.92 Hn1l (-305) MACS_peak_1780 chr17 25555873 25556806 73.1 Sstr5 (-59052), Sox8 (+14346) MACS_peak_1781 chr17 25813329 25813825 183.64 Wdr24 (-10050), Fbxl16 (+4492) MACS_peak_1782 chr17 26397342 26397839 234.76 Neurl1b (-17374), Luc7l (+144681) MACS_peak_1783 chr17 26916651 26917175 109.62 Kifc5b (-178) MACS_peak_1784 chr17 27057016 27057458 56.41 Itpr3 (-67) MACS_peak_1785 chr17 27058566 27059231 345.05 Itpr3 (+1595), 2900010M23Rik (+74992) MACS_peak_1786 chr17 27194214 27194899 201.87 Ip6k3 (-26793), Lemd2 (+9881) MACS_peak_1787 chr17 27199866 27200423 197.98 Ip6k3 (-32381), Lemd2 (+4293) MACS_peak_1789 chr17 28013212 28013866 77.35 Tcp11 (+67045), Anks1 (+104199) MACS_peak_1790 chr17 28018063 28018815 148.3 Tcp11 (+62145), Anks1 (+109099) MACS_peak_1791 chr17 28515385 28516202 121.22 Fkbp5 (-29682), 4930511I11Rik (-15067) MACS_peak_1793 chr17 28523032 28523560 215.68 Fkbp5 (-37184), 4930511I11Rik (-7565) MACS_peak_1794 chr17 28800891 28801260 60.81 Brpf3 (-50) MACS_peak_1795 chr17 29302238 29302602 231.86 Pi16 (-16462), BC004004 (+33632) MACS_peak_1796 chr17 29341938 29342586 128.07 Mtch1 (+5642), Pi16 (+23380) MACS_peak_1799 chr17 30471514 30471887 74.17 Btbd9 (+104586), Zfand3 (+466614) MACS_peak_1800 chr17 30609323 30609683 60.81 Btbd9 (-33216), Glo1 (+3156) MACS_peak_1803 chr17 33757061 33757835 100.55 March2 (-38778), Rab11b (+3038) MACS_peak_1804 chr17 33890701 33891206 122.94 Kifc1 (-321) MACS_peak_1805 chr17 34120175 34120766 54.9 Brd2 (+1276), H2-Oa (+28092) MACS_peak_1806 chr17 34120858 34121824 266.35 Brd2 (+406) MACS_peak_1807 chr17 34121939 34122409 54.28 Brd2 (-427) MACS_peak_1807 chr17 34121939 34122409 54.28 Brd2 (-427) MACS_peak_1808 chr17 34591122 34592580 303.8 Pbx2 (-620) MACS_peak_1809 chr17 34603386 34603992 53.95 Rnf5 (-128) MACS_peak_1811 chr17 35549478 35550181 164.98 Cdsn (-2298) MACS_peak_1812 chr17 35700398 35701210 93.01 Gtf2h4 (-27122), Ddr1 (+1240) MACS_peak_1813 chr17 35720441 35720928 71.96 Ier3 (-101028), Ddr1 (-18641) MACS_peak_1815 chr17 36023400 36024413 376.87 H2-T24 (-3347) MACS_peak_1824 chr17 42358112 42359019 124.35 3110082D06Rik (+42619), Opn5 (+252747) MACS_peak_1825 chr17 42916797 42917216 58.28 Tnfrsf21 (-99548), Cd2ap (-40583) MACS_peak_1826 chr17 44216856 44217537 182.61 Supt3h (-559974), Clic5 (+28625) MACS_peak_1828 chr17 44238780 44240077 849.59 Supt3h (-537742), Clic5 (+50857) MACS_peak_1829 chr17 44604318 44604880 71.14 Supt3h (-172572), Clic5 (+416027) MACS_peak_1830 chr17 45572425 45573105 104.02 Hsp90ab1 (+496) MACS_peak_1831 chr17 45573749 45574533 95.17 Hsp90ab1 (-880) MACS_peak_1832 chr17 45596527 45597119 63.65 Slc29a1 (-921) MACS_peak_1833 chr17 45805625 45806258 197.85 1600014C23Rik (-72098), Vegfa (+226435) MACS_peak_1834 chr17 45886550 45887192 69.1 1600014C23Rik (-153027), Vegfa (+145506) MACS_peak_1835 chr17 46040490 46041220 83.34 Mrps18a (-70149), Vegfa (-8478) MACS_peak_1836 chr17 46049529 46050300 320.88 Mrps18a (-61089), Vegfa (-17538) MACS_peak_1837 chr17 46051861 46052700 103.79 Mrps18a (-58723), Vegfa (-19904) MACS_peak_1838 chr17 46265964 46266854 403.06 Gm88 (+12244), Tjap1 (+16604) MACS_peak_1839 chr17 46282347 46283306 157.9 Tjap1 (+186) MACS_peak_1840 chr17 46383312 46383895 64.3 Zfp318 (-162) MACS_peak_1841 chr17 46552806 46553612 155.04 Cul9 (-6821), Srf (+2953) MACS_peak_1842 chr17 46610045 46610692 59.94 Srf (-54207), Ptk7 (+19135) MACS_peak_1843 chr17 46619149 46619954 149.88 Srf (-63390), Ptk7 (+9952) MACS_peak_1844 chr17 46629633 46630441 196.36 Ptk7 (-533) MACS_peak_1845 chr17 46843049 46843499 91.59 Tbcc (-47347), BC032203 (-11861) MACS_peak_1846 chr17 46864478 46865095 237.65 BC032203 (-33374), Tbcc (-25834) MACS_peak_1847 chr17 46889556 46890719 112.29 Tbcc (-483) MACS_peak_1849 chr17 49432255 49432757 90.79 Mocs1 (+4142), Daam2 (+131831) MACS_peak_1850 chr17 49472046 49472560 60.22 Mocs1 (+43939), Daam2 (+92034) MACS_peak_1851 chr17 49472622 49473054 133.05 Mocs1 (+44474), Daam2 (+91499) MACS_peak_1852 chr17 49477297 49477856 399.78 Mocs1 (+49213), Daam2 (+86760) MACS_peak_1854 chr17 49545480 49545951 91.59 Daam2 (+18621), Mocs1 (+117352) MACS_peak_1855 chr17 49563164 49564064 104.73 Daam2 (+723) MACS_peak_1857 chr17 53478992 53479753 50.85 Rab5a (+139) MACS_peak_1865 chr17 62882690 62883215 69.55 Efna5 (-1636) MACS_peak_1867 chr17 65957327 65957842 51.13 Twsg1 (-6398), Ankrd12 (+119461) MACS_peak_1868 chr17 66123388 66124120 80.69 Ddx11 (+234) MACS_peak_1869 chr17 66411745 66412369 70.41 1110012J17Rik (+37693), Ddx11 (+288537) MACS_peak_1870 chr17 66419259 66419790 153.87 1110012J17Rik (+30225), Ddx11 (+296005) MACS_peak_1872 chr17 66469945 66470419 63.35 1110012J17Rik (-20432), Rab12 (+49488) MACS_peak_1873 chr17 66480164 66480837 65.54 1110012J17Rik (-30751), Rab12 (+39169) MACS_peak_1874 chr17 67928236 67928963 461.38 Arhgap28 (+75508), Lama1 (+231335) MACS_peak_1875 chr17 67931126 67931824 298.59 Arhgap28 (+72633), Lama1 (+234210) MACS_peak_1876 chr17 67988831 67989581 137.95 Arhgap28 (+14902), Lama1 (+291941) MACS_peak_1877 chr17 67995694 67996753 168.4 Arhgap28 (+7884), Lama1 (+298959) MACS_peak_1878 chr17 68022579 68023281 112.44 L3mbtl4 (-250867), Arhgap28 (-18822) MACS_peak_1879 chr17 70596403 70596942 76.44 Dlgap1 (+171877), Tgif1 (+254537) MACS_peak_1881 chr17 71002328 71003252 73.4 2900073G15Rik (-257) MACS_peak_1882 chr17 71125291 71125952 152.08 Lpin2 (-79032), Myom1 (+106065) MACS_peak_1883 chr17 71168332 71169410 196.39 Lpin2 (-35783), Myom1 (+149314) MACS_peak_1884 chr17 72503549 72503978 57.45 Alk (+100543), Clip4 (+721817) MACS_peak_1886 chr17 74527829 74528661 57.45 Birc6 (-50) MACS_peak_1887 chr17 74866503 74867370 171.93 Ltbp1 (-138592), Ttc27 (+149187) MACS_peak_1892 chr17 79715526 79716248 136.16 Cyp1b1 (-846) MACS_peak_1896 chr17 80706573 80707261 248.63 Cdkl4 (-143083), Map4k3 (+21176) MACS_peak_1898 chr17 83181602 83182134 58.9 Pkdcc (-33415) MACS_peak_1899 chr17 83197070 83197973 143.11 Pkdcc (-17761) MACS_peak_1900 chr17 83275874 83276458 105.66 Eml4 (-74765), Pkdcc (+60883) MACS_peak_1901 chr17 83938568 83939329 168.9 Haao (-92159), Zfp36l2 (+248998) MACS_peak_1902 chr17 84503825 84504505 100.04 Thada (-37957), Plekhh2 (-7730) MACS_peak_1903 chr17 84510263 84510828 65.62 Plekhh2 (-1349) MACS_peak_1904 chr17 84935606 84936122 132.82 Lrpprc (-145078), Ppm1b (-22137) MACS_peak_1905 chr17 86203850 86204488 69.39 Epas1 (-549695), Prkce (+36384) MACS_peak_1906 chr17 86236748 86237471 90.63 Epas1 (-516754), Prkce (+69325) MACS_peak_1908 chr17 86379319 86380129 174.17 Epas1 (-374140), Prkce (+211939) MACS_peak_1909 chr17 86444741 86445294 66.53 Epas1 (-308846), Prkce (+277233) MACS_peak_1910 chr17 86769818 86770351 92.14 1700090G07Rik (-147263), Epas1 (+16221) MACS_peak_1912 chr17 87185664 87186116 75.18 Socs5 (+78211), Mcfd2 (+80057) MACS_peak_1914 chr17 87367412 87367891 71.32 1700011E24Rik (+60089), Ttc7 (+84766) MACS_peak_1916 chr17 87386828 87387385 74.81 1700011E24Rik (+40634), Ttc7 (+104221) MACS_peak_1918 chr17 87473709 87474473 68.08 Epcam (-161888), Calm2 (-27156) MACS_peak_1919 chr17 88065849 88066565 55.77 Fbxo11 (-922) MACS_peak_1920 chr17 88259075 88259466 164.75 Foxn2 (-181441), Gm4832 (+133759) MACS_peak_1921 chr17 88260810 88261285 113.31 Foxn2 (-179664), Gm4832 (+135536) MACS_peak_1922 chr17 88326466 88327187 173.88 Foxn2 (-113885), Gm4832 (+201315) MACS_peak_1929 chr18 4353286 4353849 56.95 Map3k8 (-615) MACS_peak_1930 chr18 5063201 5063907 62.06 Svil (+16965), Zfp438 (+270885) MACS_peak_1932 chr18 9818336 9819081 70.9 Thoc1 (-139471), Colec12 (+111061) MACS_peak_1933 chr18 10029562 10030138 74.11 Usp14 (+299) MACS_peak_1937 chr18 11967161 11967617 178.18 Cables1 (+128115), 6030446N20Rik (+154064) MACS_peak_1938 chr18 11973738 11974130 102.21 Cables1 (+134660), 6030446N20Rik (+147519) MACS_peak_1951 chr18 27291948 27292848 184.6 MACS_peak_1959 chr18 30487045 30487676 129.77 Pik3c3 (+214465), Rit2 (+829767) MACS_peak_1961 chr18 33463537 33464484 281.22 D0H4S114 (+18) MACS_peak_1962 chr18 33471013 33471426 263.07 D0H4S114 (-7191), Epb4.1l4a (+535986) MACS_peak_1963 chr18 33659480 33660066 82.88 D0H4S114 (-195744), Epb4.1l4a (+347433) MACS_peak_1964 chr18 33757693 33758403 142.31 D0H4S114 (-294019), Epb4.1l4a (+249158) MACS_peak_1966 chr18 34860387 34861222 204.11 Egr1 (-402) MACS_peak_1967 chr18 34884451 34884812 81.62 Egr1 (+23425), Etf1 (+47371) MACS_peak_1968 chr18 35598458 35598880 63.27 Paip2 (+2) MACS_peak_1969 chr18 35829561 35830481 94.2 Cxxc5 (+203) MACS_peak_1969 chr18 35829561 35830481 94.2 Cxxc5 (+203) MACS_peak_1970 chr18 35832263 35832811 66.91 Psd2 (-132298), Cxxc5 (+2719) MACS_peak_1973 chr18 36353707 36354485 189.23 0610010O12Rik (+5472), Pfdn1 (+100399) MACS_peak_1976 chr18 38631616 38631924 92.6 Gm5820 (-260686), 9630014M24Rik (+30236) MACS_peak_1982 chr18 44542557 44543361 434.24 Dcp2 (+162459), Mcc (+269223) MACS_peak_1983 chr18 44686323 44687221 62.86 Mcc (+125410), Dcp2 (+306272) MACS_peak_1992 chr18 54119023 54120202 88.3 Csnk1g3 (+257500), Zfp608 (+870567) MACS_peak_1995 chr18 55256706 55257327 213.32 Zfp608 (-266837) MACS_peak_1996 chr18 55258439 55259148 192.54 Zfp608 (-268614) MACS_peak_1997 chr18 55549046 55549733 253.42 Gramd3 (-882729), Zfp608 (-559210) MACS_peak_1998 chr18 55815663 55816254 79.79 Zfp608 (-825779), Gramd3 (-616160) MACS_peak_2001 chr18 56707337 56708003 58.74 Lmnb1 (-143) MACS_peak_2006 chr18 60606207 60606833 52.74 Myoz3 (-14804), Synpo (+23565) MACS_peak_2007 chr18 60609772 60610632 127.19 Myoz3 (-18486), Synpo (+19883) MACS_peak_2009 chr18 60619035 60619816 321.12 Myoz3 (-27710), Synpo (+10659) MACS_peak_2010 chr18 60744584 60745310 78.32 Ndst1 (-31315), Rps14 (-29649) MACS_peak_2011 chr18 60746797 60747309 122.05 Ndst1 (-33421), Rps14 (-27543) MACS_peak_2013 chr18 61058358 61058927 94.39 Csf1r (-46929), Pdgfrb (+13493) MACS_peak_2014 chr18 61059400 61059890 113.65 Csf1r (-45927), Pdgfrb (+14495) MACS_peak_2015 chr18 61335949 61336335 318.22 Ppargc1b (+64289), Pde6a (+115643) MACS_peak_2017 chr18 61634750 61635149 70.11 Il17b (-52985), Csnk1a1 (+79368) MACS_peak_2018 chr18 61637842 61638378 170.26 Il17b (-49825), Csnk1a1 (+82528) MACS_peak_2019 chr18 61639507 61640400 207.88 Il17b (-47981), Csnk1a1 (+84372) MACS_peak_2020 chr18 61880532 61881242 62.57 Afap1l1 (-94225), Ablim3 (+30965) MACS_peak_2021 chr18 61894402 61894972 220.64 Afap1l1 (-108025), Ablim3 (+17165) MACS_peak_2022 chr18 61952468 61953232 126.22 Sh3tc2 (-225) MACS_peak_2023 chr18 64565887 64566291 61.34 Nars (-49532), Atp8b1 (+94911) MACS_peak_2024 chr18 64605883 64606502 100.24 Nars (-89636), Atp8b1 (+54807) MACS_peak_2025 chr18 64643761 64644173 112.46 Nars (-127410), Atp8b1 (+17033) MACS_peak_2026 chr18 64660068 64660659 63.72 Atp8b1 (+636) MACS_peak_2027 chr18 64660845 64661474 79.31 Atp8b1 (-160) MACS_peak_2028 chr18 64661590 64661921 71.01 Atp8b1 (-756) MACS_peak_2030 chr18 65430277 65430847 72.87 Malt1 (-435) MACS_peak_2031 chr18 65437496 65437950 96.77 Zfp532 (-142507), Malt1 (+6726) MACS_peak_2035 chr18 66510149 66510784 69.61 Pmaip1 (+51863), Mc4r (+350005) MACS_peak_2038 chr18 67460680 67461404 184.79 Slmo1 (-3807) MACS_peak_2041 chr18 70529800 70530404 62.81 Poli (+219) MACS_peak_2042 chr18 70564079 70564829 55.69 Mbd2 (-3838) MACS_peak_2047 chr18 73571831 73572637 97.78 Mex3c (-471) MACS_peak_2048 chr18 73899761 73900437 64.26 Mro (+40712), Mapk4 (+164850) MACS_peak_2052 chr18 76022224 76022583 127.52 Smad2 (-219521), Zbtb7c (+202226) MACS_peak_2054 chr18 76056753 76057873 203.27 Smad2 (-184612), Zbtb7c (+237135) MACS_peak_2055 chr18 76062810 76063660 179.43 Smad2 (-178690), Zbtb7c (+243057) MACS_peak_2056 chr18 76083762 76084651 96.41 Smad2 (-157718), Zbtb7c (+264029) MACS_peak_2057 chr18 76084779 76085315 141.56 Smad2 (-156878), Zbtb7c (+264869) MACS_peak_2058 chr18 76087398 76088521 601.84 Smad2 (-153965), Zbtb7c (+267782) MACS_peak_2060 chr18 76119616 76120626 163.05 Smad2 (-121804), Zbtb7c (+299943) MACS_peak_2061 chr18 76140384 76141409 328.47 Smad2 (-101028), Zbtb7c (+320719) MACS_peak_2062 chr18 76153877 76154206 115.57 Smad2 (-87883), Zbtb7c (+333864) MACS_peak_2064 chr18 80285131 80285936 382.9 Pqlc1 (+29228), Kcng2 (+78720) MACS_peak_2065 chr18 80349226 80349786 138.38 Kcng2 (+14748), Pqlc1 (+93200) MACS_peak_2066 chr18 80390813 80391178 81.62 Kcng2 (-26742), Ctdp1 (+78671) MACS_peak_2067 chr18 80588960 80589605 336.07 Ctdp1 (-119616), Nfatc1 (+118890) MACS_peak_2071 chr18 83840909 83841513 166.77 Tshz1 (+245351), Zfp516 (+926579) MACS_peak_2080 chr18 88625665 88627203 216.92 Socs6 (+267773) MACS_peak_2081 chr18 88627601 88628182 50.56 Socs6 (+266315) MACS_peak_2084 chr19 4150752 4151249 91.3 Ptprcap (-3645) MACS_peak_2086 chr19 4175416 4175932 132.82 Carns1 (-195) MACS_peak_2088 chr19 4285751 4286088 115.57 Ankrd13d (-2783) MACS_peak_2089 chr19 4625149 4625871 55.43 Rce1 (+107) MACS_peak_2091 chr19 5072012 5072456 108.23 Cd248 (+4156), Tmem151a (+13243) MACS_peak_2092 chr19 5087777 5088643 68.55 Tmem151a (-2733), Yif1a (-343) MACS_peak_2094 chr19 5662980 5663550 74.6 Sipa1 (+442) MACS_peak_2095 chr19 5741601 5742156 127.83 Ltbp3 (+975) MACS_peak_2096 chr19 5803133 5803786 71.48 Scyl1 (-32059), Frmd8 (+71748) MACS_peak_2097 chr19 5846266 5846849 153.16 Scyl1 (-75157), Frmd8 (+28650) MACS_peak_2098 chr19 6241294 6241815 120.93 Atg2a (-113) MACS_peak_2099 chr19 6308029 6308591 62.57 Men1 (-26669), Cdc42bpg (+1853) MACS_peak_2102 chr19 7135207 7136369 308.1 Flrt1 (-30059), Otub1 (+70496) MACS_peak_2103 chr19 7307007 7307322 92.6 Mark2 (+34679), Rcor2 (+37400) MACS_peak_2104 chr19 8819806 8820364 83.91 Ttc9c (-791), Hnrnpul2 (+684) MACS_peak_2105 chr19 8871286 8871778 52.54 Ubxn1 (-27) MACS_peak_2106 chr19 10266671 10267296 89.24 Gm98 (-26236), Dagla (+37893) MACS_peak_2107 chr19 10286520 10287078 75.59 Gm98 (-46051), Dagla (+18078) MACS_peak_2108 chr19 10290000 10290665 229.05 Gm98 (-49585), Dagla (+14544) MACS_peak_2109 chr19 10603468 10604163 118.28 Ddb1 (-1809), Dak (+457) MACS_peak_2110 chr19 12714441 12715147 99.52 Keg1 (+19004), Cntf (+50838) MACS_peak_2111 chr19 14499766 14500471 102.66 Tle4 (+97864), Olfr1505 (+581097) MACS_peak_2113 chr19 15552728 15553538 143.45 Tle4 (-955150), Psat1 (+371892) MACS_peak_2120 chr19 18640969 18641711 154.68 2410127L17Rik (-29440), BC016495 (+9324) MACS_peak_2123 chr19 22800466 22801022 85.55 Klf9 (-340482), Trpm3 (+661627) MACS_peak_2124 chr19 23134666 23135243 158.97 Klf9 (-6271), Trpm3 (+995838) MACS_peak_2125 chr19 23140601 23141235 78.91 Klf9 (-308) MACS_peak_2126 chr19 23959725 23960484 351.4 Fam189a2 (+70914), Apba1 (+201229) MACS_peak_2127 chr19 24469237 24469887 58.76 Fxn (-188976), Fam122a (+7912) MACS_peak_2128 chr19 24961545 24961912 188.96 Cbwd1 (-113) MACS_peak_2129 chr19 25169422 25169885 64.92 Kank1 (-67548), Dock8 (+170125) MACS_peak_2130 chr19 25174563 25175381 105.62 Kank1 (-62230), Dock8 (+175443) MACS_peak_2131 chr19 25237734 25238604 51.78 Kank1 (+967) MACS_peak_2134 chr19 26604582 26605235 51.16 Smarca2 (-251) MACS_peak_2135 chr19 26606329 26608233 197.37 Gm815 (-278644), Smarca2 (+2121) MACS_peak_2135 chr19 26606329 26608233 197.37 Gm815 (-278644), Smarca2 (+2121) MACS_peak_2139 chr19 32346084 32347140 182.48 Minpp1 (-139157), Sgms1 (-135599) MACS_peak_2140 chr19 32381282 32381723 436.41 Sgms1 (-170490), Minpp1 (-104266) MACS_peak_2141 chr19 32387604 32388228 61.45 Sgms1 (-176903), Minpp1 (-97853) MACS_peak_2142 chr19 32388424 32388932 60.67 Sgms1 (-177665), Minpp1 (-97091) MACS_peak_2143 chr19 33128736 33129336 91.47 Rnls (+263259), Pten (+371459) MACS_peak_2147 chr19 34879132 34879646 76.58 Pank1 (+66) MACS_peak_2150 chr19 37881276 37881999 68.54 Myof (+161939), Cyp26a1 (+183830) MACS_peak_2151 chr19 38021335 38021682 115.57 Myof (+22068), Cyp26a1 (+323701) MACS_peak_2152 chr19 38041926 38042867 120.19 Myof (+1180), Cyp26a1 (+344589) MACS_peak_2153 chr19 38504517 38505103 435.53 Plce1 (-19387), Tmem20 (+108830) MACS_peak_2154 chr19 38521149 38521902 192.29 Plce1 (-2671) MACS_peak_2155 chr19 38528454 38529057 227.29 Plce1 (+4559), Noc3l (+290481) MACS_peak_2157 chr19 41980751 41981160 69.13 Ubtd1 (-807), Mms19 (+180) MACS_peak_2158 chr19 42128780 42129366 54.35 Avpi1 (-80) MACS_peak_2159 chr19 42148325 42149028 73.76 Zfyve27 (-21890), Marveld1 (+1288) MACS_peak_2160 chr19 42163983 42164500 301.11 Zfyve27 (-6325), Marveld1 (+16853) MACS_peak_2161 chr19 43698961 43699769 88.18 Entpd7 (+9676), Cox15 (+53635) MACS_peak_2163 chr19 44144621 44145228 145.1 Cwf19l1 (-9049), Bloc1s2 (+1521) MACS_peak_2164 chr19 44266796 44267589 233.01 Scd2 (-26483), Scd3 (+63905) MACS_peak_2165 chr19 44283962 44284610 127.86 Scd2 (-9390), Scd3 (+80998) MACS_peak_2166 chr19 44293553 44294127 61.44 Scd2 (+164) MACS_peak_2167 chr19 44311744 44312424 96.94 Scd4 (-21242), Scd2 (+18408) MACS_peak_2168 chr19 44514435 44515323 208.51 Wnt8b (+21407), Sec31b (+30969) MACS_peak_2170 chr19 45047364 45047871 51.67 Pdzd7 (-1846), Sfxn3 (+42) MACS_peak_2173 chr19 45304431 45305152 645.94 Lbx1 (-69556), Btrc (-58942) MACS_peak_2174 chr19 45783297 45783915 110.04 Mgea5 (-315) MACS_peak_2176 chr19 46039468 46040149 214.36 Ldb1 (+5402), Hps6 (+36331) MACS_peak_2177 chr19 46357793 46358469 84.98 Tmem180 (+1251), Actr1a (+37604) MACS_peak_2178 chr19 46447776 46448484 54.35 Trim8 (-53518), Sufu (+51212) MACS_peak_2181 chr19 46503548 46504158 62.4 Trim8 (+2205), Arl3 (+69232) MACS_peak_2183 chr19 46661594 46662094 90.99 Cyp17a1 (+11156), D19Wsu162e (+62738) MACS_peak_2184 chr19 46864772 46865122 409.89 Cnnm2 (+103338), Nt5c2 (+104620) MACS_peak_2185 chr19 47228533 47229320 319.99 Neurl1a (+50107), Sh3pxd2a (+235484) MACS_peak_2186 chr19 47276567 47277198 140.65 Neurl1a (+98063), Sh3pxd2a (+187528) MACS_peak_2187 chr19 47320349 47320931 124.6 Neurl1a (+141820), Sh3pxd2a (+143771) MACS_peak_2188 chr19 47891896 47892360 64.18 Gsto2 (+26583), Itprip (+27171) MACS_peak_2192 chr19 53040294 53040742 52.54 Xpnpep1 (-1976) MACS_peak_2193 chr19 53051936 53052731 344.12 Add3 (-91663), Xpnpep1 (-13792) MACS_peak_2197 chr19 53437318 53437948 88.8 Dusp5 (-91685), Smndc1 (-47060) MACS_peak_2199 chr19 55096637 55097029 58 Gpam (+2614) MACS_peak_2200 chr19 55098248 55098895 322.21 Gpam (+875) MACS_peak_2201 chr19 55147262 55147959 147.2 Gpam (-48164), Tectb (-33274) MACS_peak_2202 chr19 55158699 55159304 111.39 Gpam (-59555), Tectb (-21883) MACS_peak_2203 chr19 55622145 55622496 52.77 Tcf7l2 (-119489), Vti1a (+305970) MACS_peak_2205 chr19 55754004 55754559 74.48 Ppnr (-91610), Tcf7l2 (+12472) MACS_peak_2206 chr19 56544996 56545433 59.1 Nhlrc2 (-3046), Dclre1a (+2811) MACS_peak_2208 chr19 57362826 57363422 63.37 Trub1 (-89782), Fam160b1 (+2115) MACS_peak_2209 chr19 58833433 58834318 260.49 1700019N19Rik (-39462), Hspa12a (+27108) MACS_peak_2210 chr19 58838303 58839125 130.73 1700019N19Rik (-44300), Hspa12a (+22270) MACS_peak_2213 chr19 60873375 60873893 116.39 Prdx3 (+904) MACS_peak_2216 chr2 5200769 5201522 117.19 Ccdc3 (+63370), Camk1d (+513518) MACS_peak_2217 chr2 5746312 5747047 71.56 Camk1d (-32016), Cdc123 (+98280) MACS_peak_2218 chr2 5950479 5951346 52.77 Upf2 (-556) MACS_peak_2219 chr2 6164625 6165103 57.33 5430407P10Rik (-34679), Echdc3 (+48130) MACS_peak_2221 chr2 11425588 11426292 144.86 Pfkfb3 (+76150), Prkcq (+253558) MACS_peak_2222 chr2 12019300 12020045 165.64 Ankrd16 (+241920), Itga8 (+282247) MACS_peak_2224 chr2 13553786 13554706 57.86 Vim (-20065), Trdmt1 (-9582) MACS_peak_2227 chr2 16355875 16356803 124.59 Plxdc2 (+17) MACS_peak_2228 chr2 16450897 16451558 116.93 Plxdc2 (+94906), Nebl (+939780) MACS_peak_2230 chr2 17647888 17648411 50.61 Nebl (-185361), Nebl (+82918) MACS_peak_2231 chr2 17658064 17658534 65.36 Nebl (-195510), Nebl (+72769) MACS_peak_2232 chr2 18056853 18057449 66.11 Mllt10 (+1880), Dnajc1 (+335679) MACS_peak_2233 chr2 18064200 18064866 183.36 Mllt10 (+9262), Dnajc1 (+328297) MACS_peak_2235 chr2 22551574 22553167 52.01 Gad2 (-69956), Myo3a (+258761) MACS_peak_2239 chr2 26122669 26123278 71.53 Nacc2 (-163) MACS_peak_2241 chr2 27540116 27540540 57.86 Rxra (-136873), Wdr5 (+25181) MACS_peak_2242 chr2 27676013 27676678 158.62 Rxra (-855) MACS_peak_2243 chr2 27745879 27746542 160.3 Col5a1 (-140214), Rxra (+69010) MACS_peak_2244 chr2 27758382 27759118 83.34 Col5a1 (-127675), Rxra (+81549) MACS_peak_2245 chr2 27774112 27774837 100.02 Col5a1 (-111950), Rxra (+97274) MACS_peak_2246 chr2 29239301 29239722 58.11 Ntng2 (+8528), Setx (+114520) MACS_peak_2247 chr2 29245450 29245870 68.08 Ntng2 (+2380), Setx (+120668) MACS_peak_2248 chr2 29696191 29696938 240.06 Gm13547 (-64963), Rapgef1 (+76845) MACS_peak_2250 chr2 29964988 29965671 94.8 Spna2 (-230) MACS_peak_2251 chr2 30066177 30066916 89.37 Pkn3 (-12219), Set (+4504) MACS_peak_2252 chr2 30441693 30442158 93.39 Ppp2r4 (+25876), Ier5l (+32273) MACS_peak_2254 chr2 30981954 30982375 122.84 BC005624 (-224), Usp20 (-114) MACS_peak_2255 chr2 31025414 31026148 266.67 Usp20 (+43502), Fnbp1 (+116227) MACS_peak_2256 chr2 31088202 31088679 82.96 Fnbp1 (+53567), Usp20 (+106162) MACS_peak_2257 chr2 31132585 31133275 74.68 Fnbp1 (+9078), Usp20 (+150651) MACS_peak_2259 chr2 31263725 31264410 103.56 Hmcn2 (-173994), Ncs1 (+18145) MACS_peak_2260 chr2 31749230 31749679 404.21 Abl1 (-10490), Exosc2 (+78718) MACS_peak_2261 chr2 31953634 31954118 53.26 Nup214 (-20574), Aif1l (+3573) MACS_peak_2263 chr2 32608407 32609141 142.73 Ak1 (-20726), St6galnac6 (+1813) MACS_peak_2264 chr2 32713078 32713830 61.94 Cdk9 (-670) MACS_peak_2265 chr2 32727416 32727834 132.75 Tor2a (-29646), Sh2d3c (+6553) MACS_peak_2266 chr2 32856170 32856547 127.52 Fam129b (-19775), Stxbp1 (-9122) MACS_peak_2268 chr2 33165400 33166283 120.3 Garnl3 (-78638), Angptl2 (-50119) MACS_peak_2270 chr2 33513684 33514054 71.01 Zbtb43 (-45337), Lmx1b (+126642) MACS_peak_2272 chr2 33594048 33594602 95.86 Zbtb43 (-125793), Lmx1b (+46186) MACS_peak_2273 chr2 33605118 33606252 576.16 Zbtb43 (-137153), Lmx1b (+34826) MACS_peak_2274 chr2 35258462 35258911 61.73 Rab14 (-57567), Gsn (-23753) MACS_peak_2275 chr2 35270358 35270863 101.01 Rab14 (-69491), Gsn (-11829) MACS_peak_2277 chr2 35302440 35302990 139.69 Gsn (+20275), Stom (+34294) MACS_peak_2278 chr2 37784512 37784867 60.81 Crb2 (+8441), Dennd1a (+502694) MACS_peak_2279 chr2 37788151 37789099 158.99 Crb2 (+12376), Dennd1a (+498759) MACS_peak_2280 chr2 37796208 37796549 92.89 Crb2 (+20130), Dennd1a (+491005) MACS_peak_2281 chr2 38287176 38287628 54.34 Dennd1a (-18) MACS_peak_2282 chr2 38647531 38648368 218.18 Psmb7 (-4044) MACS_peak_2283 chr2 38933837 38934366 379.41 Wdr38 (-64207), Olfml2a (+2122) MACS_peak_2293 chr2 44978882 44979528 63.29 Gtdc1 (-117583), Zeb2 (+134074) MACS_peak_2294 chr2 44999708 45000325 53.27 Gtdc1 (-138395), Zeb2 (+113262) MACS_peak_2295 chr2 46669147 46669832 62.89 MACS_peak_2298 chr2 48882453 48883258 59.92 Orc4 (+66411), Acvr2a (+68747) MACS_peak_2299 chr2 48948956 48950238 76.73 Orc4 (-330), Mbd5 (+89) MACS_peak_2301 chr2 52369900 52370584 98.43 Neb (-31444), Arl5a (+54632) MACS_peak_2307 chr2 57356009 57356677 84.06 Galnt5 (-641812), Gpd2 (+118665) MACS_peak_2311 chr2 59613077 59613795 60.01 Tanc1 (+1392), Wdsub1 (+269170) MACS_peak_2315 chr2 60913067 60913737 166.69 Tank (-665184), Rbms1 (-31964) MACS_peak_2317 chr2 61058366 61059187 97.11 Tank (-519809), Rbms1 (-177339) MACS_peak_2318 chr2 61100676 61101342 145.19 Tank (-477577), Rbms1 (-219571) MACS_peak_2319 chr2 61138784 61139256 111.79 Tank (-439566), Rbms1 (-257582) MACS_peak_2323 chr2 62423363 62424029 136.55 Dpp4 (-11465), Gcg (+59957) MACS_peak_2324 chr2 62448248 62449071 83.19 Dpp4 (-36429), Gcg (+34993) MACS_peak_2331 chr2 68805680 68806482 78.99 Lass6 (-55476), 4932414N04Rik (+148197) MACS_peak_2332 chr2 68815498 68815946 117.04 Lass6 (-45835), 4932414N04Rik (+157838) MACS_peak_2334 chr2 68871345 68871887 298.87 Nostrin (-264184), Lass6 (+10059) MACS_peak_2335 chr2 68873712 68874461 116.98 Nostrin (-261713), Lass6 (+12530) MACS_peak_2336 chr2 69080611 69081421 98.94 Nostrin (-54784), Lass6 (+219459) MACS_peak_2337 chr2 69084335 69084940 57.87 Nostrin (-51162), Lass6 (+223081) MACS_peak_2338 chr2 69263981 69264651 98.63 G6pc2 (+44318), Abcb11 (+78300) MACS_peak_2339 chr2 71146122 71146907 134.35 Dync1i2 (-65431), Cybrd1 (+28461) MACS_peak_2340 chr2 71872833 71873662 110.44 Pdk1 (-24) MACS_peak_2341 chr2 73038107 73038892 144.72 Sp3 (-58054), Ola1 (+175947) MACS_peak_2342 chr2 73592501 73593473 105.76 Chrna1 (-12681), Chn1 (+182359) MACS_peak_2343 chr2 73596593 73597267 106.82 Chrna1 (-16624), Chn1 (+178416) MACS_peak_2345 chr2 74647195 74647883 144.82 Lnp (-68591), Hoxd10 (-44409), Hoxd11 (-34854), Hoxd12 (-27491), Hoxd13 (-20771), Evx2 (+11880) MACS_peak_2346 chr2 74749463 74750340 297 Hoxd1 (-13078), Hoxd4 (+27924) MACS_peak_2348 chr2 76564418 76565128 61.78 Prkra (+83221), Osbpl6 (+158235) MACS_peak_2351 chr2 77746447 77746847 91.38 Sestd1 (-466022), Zfp385b (+70169) MACS_peak_2352 chr2 77777500 77778422 151.78 Sestd1 (-497336), Zfp385b (+38855) MACS_peak_2353 chr2 77815730 77816205 64.88 Zfp385b (+848) MACS_peak_2354 chr2 77816911 77817394 53.34 Zfp385b (-337) MACS_peak_2357 chr2 80581232 80581727 54.76 Nckap1 (-515) MACS_peak_2360 chr2 83723758 83724508 86.37 Itgav (-264) MACS_peak_2361 chr2 83739601 83740445 94.99 Fam171b (-72705), Itgav (+15626) MACS_peak_2369 chr2 90543068 90543786 616.74 Ptprj (+37220), Olfr1274-ps (+142787) MACS_peak_2373 chr2 92313913 92314586 66.35 Gyltl1b (+56786), Phf21a (+92778) MACS_peak_2374 chr2 92389038 92389856 162.26 1700029I15Rik (+6529), Mapk8ip1 (+11816) MACS_peak_2375 chr2 92433794 92434838 99.48 Cry2 (-247) MACS_peak_2376 chr2 92490936 92491427 222.87 Chst1 (-108525), Slc35c1 (-30664) MACS_peak_2377 chr2 92491845 92492418 104.28 Chst1 (-107575), Slc35c1 (-31614) MACS_peak_2378 chr2 92512309 92512701 50.89 Chst1 (-87202), Slc35c1 (-51987) MACS_peak_2380 chr2 93462406 93463243 170.83 Cd82 (+121) MACS_peak_2381 chr2 93759164 93759489 71.01 Ext2 (+63241), Alx4 (+116893) MACS_peak_2382 chr2 94103462 94104089 68.12 Alkbh3 (-93046), Hsd17b12 (+54133) MACS_peak_2383 chr2 94273309 94274060 127.5 Hsd17b12 (-115776), Ttc17 (+133004) MACS_peak_2384 chr2 95156090 95157269 139.66 Api5 (-718533) MACS_peak_2401 chr2 103631221 103631859 51.87 Abtb2 (+65230), Nat10 (+129710) MACS_peak_2402 chr2 104096282 104096767 57.87 Cd59a (+724) MACS_peak_2404 chr2 105003599 105003982 64.35 Eif3m (+13236), Ccdc73 (+117467) MACS_peak_2405 chr2 105058658 105059082 129.27 Wt1 (-67659), Eif3m (-41843) MACS_peak_2407 chr2 105097120 105097849 99.67 Eif3m (-80458), Wt1 (-29044) MACS_peak_2408 chr2 105126013 105126675 95.77 Wt1 (-185) MACS_peak_2410 chr2 107519092 107520012 80.75 Kcna4 (+228963) MACS_peak_2415 chr2 110179754 110180297 180.55 Bbox1 (+125699), Ccdc34 (+162209) MACS_peak_2417 chr2 110196454 110197094 90.63 Bbox1 (+108951), Ccdc34 (+178957) MACS_peak_2423 chr2 114261496 114262365 72.94 Zfp770 (-60499), Atpbd4 (+392997) MACS_peak_2426 chr2 117120279 117121012 99.23 Spred1 (-804) MACS_peak_2427 chr2 117380958 117381981 251.1 Thbs1 (-730452), Rasgrp1 (-38593) MACS_peak_2430 chr2 119803539 119803912 73.92 Mga (-93502), Tyro3 (+4212) MACS_peak_2431 chr2 119804037 119804963 160.54 Mga (-92728), Tyro3 (+4986) MACS_peak_2432 chr2 120124172 120124856 51.4 Ehd4 (+30061), Pla2g4b (+91081) MACS_peak_2433 chr2 121308202 121308540 71.01 Mtap1a (+18769), Ppip5k1 (+42642) MACS_peak_2434 chr2 121955850 121956773 383.58 Ctdspl2 (-141) MACS_peak_2435 chr2 122575148 122575830 75.26 Gatm (+35788), Gm14085 (+90548) MACS_peak_2436 chr2 122625858 122626542 56.47 Spata5l1 (-4426) MACS_peak_2438 chr2 124609547 124610069 84.5 Sema6d (-488) MACS_peak_2441 chr2 126875957 126876361 90.9 Trpm7 (+102) MACS_peak_2443 chr2 128127278 128127744 64.01 Bcl2l11 (+1473), Anapc1 (+559884) MACS_peak_2449 chr2 130450218 130450830 53.58 Ptpra (+246) MACS_peak_2450 chr2 131909583 131910120 76.36 Prnp (-76) MACS_peak_2452 chr2 135577821 135578702 107.33 Plcb4 (-163568), Plcb1 (+792098) MACS_peak_2453 chr2 135711855 135712347 56.45 Plcb4 (-29729), Plcb1 (+925937) MACS_peak_2454 chr2 136678304 136679177 156.33 Snap25 (-34709), Ankrd5 (+146420) MACS_peak_2457 chr2 143682094 143682572 289.46 Pcsk2 (+136200), Bfsp1 (+180840) MACS_peak_2459 chr2 146888426 146889157 145.56 Xrn2 (-124268), Plk1s1 (+32903) MACS_peak_2463 chr2 152180406 152180896 52.84 Csnk2a1 (-46189), Tcf15 (+37042) MACS_peak_2465 chr2 152396123 152396550 57.62 Nrsn2 (-19771), Sox12 (+1709) MACS_peak_2467 chr2 152410626 152411606 136.08 6820408C15Rik (-4471), Zcchc3 (+3928) MACS_peak_2468 chr2 152414587 152415320 172.35 6820408C15Rik (-633), Zcchc3 (+90) MACS_peak_2470 chr2 152928195 152928961 389.72 Foxs1 (+4630), Mylk2 (+17226) MACS_peak_2472 chr2 152949916 152950737 111.12 Foxs1 (-17119), Dusp15 (+1255) MACS_peak_2473 chr2 152952238 152952795 127.59 Dusp15 (-935) MACS_peak_2473 chr2 152952238 152952795 127.59 Dusp15 (-935) MACS_peak_2475 chr2 153436472 153437055 73.55 Asxl1 (+90625), 8430427H17Rik (+93207) MACS_peak_2476 chr2 154559133 154559668 67.93 Necab3 (-548) MACS_peak_2477 chr2 154565564 154566006 59.93 Necab3 (-6932), E2f1 (+4067) MACS_peak_2478 chr2 154566409 154567122 131.4 Necab3 (-7913), E2f1 (+3086) MACS_peak_2480 chr2 156323980 156324795 162.6 Epb4.1l1 (-96664), Scand1 (-11684) MACS_peak_2482 chr2 156841125 156841529 90.9 1110008F13Rik (-21795), Tgif2 (+1250) MACS_peak_2483 chr2 158794608 158794952 71.01 Dhx35 (-40) MACS_peak_2484 chr2 159270093 159271078 416.35 Dhx35 (+475766) MACS_peak_2485 chr2 159356511 159357021 201.74 Dhx35 (+561946), Gm826 (+970728) MACS_peak_2486 chr2 159607026 159607693 208.38 Gm826 (+720134), Dhx35 (+812540) MACS_peak_2487 chr2 159631608 159632209 72.14 Gm826 (+695585), Dhx35 (+837089) MACS_peak_2488 chr2 159646477 159646949 61.16 Gm826 (+680781), Dhx35 (+851893) MACS_peak_2490 chr2 160201723 160202378 68.08 Gm826 (+125443) MACS_peak_2491 chr2 160288456 160289255 548.24 Gm826 (+38638) MACS_peak_2492 chr2 160366703 160367631 164.46 Mafb (-102) MACS_peak_2493 chr2 160507715 160508443 279.6 Mafb (-141014), Top1 (-137818) MACS_peak_2495 chr2 163661312 163661996 190.3 Pkig (+3268), Ada (+88523) MACS_peak_2496 chr2 163685204 163685976 76.82 Pkig (+27204), Ada (+64587) MACS_peak_2497 chr2 163691752 163692478 269.6 Pkig (+33729), Ada (+58062) MACS_peak_2498 chr2 164432341 164433427 404.69 Matn4 (-28270), Sdc4 (+10304) MACS_peak_2499 chr2 164436986 164437375 139.73 Matn4 (-32567), Sdc4 (+6007) MACS_peak_2500 chr2 164438323 164438933 263.18 Matn4 (-34014), Sdc4 (+4560) MACS_peak_2503 chr2 164785550 164786366 131.3 Snx21 (+134) MACS_peak_2504 chr2 164879658 164880311 77.43 Pcif1 (+617) MACS_peak_2507 chr2 165314191 165314602 90.08 Slc35c2 (-26570), Elmo2 (+12082) MACS_peak_2508 chr2 165326367 165326958 72.92 Elmo2 (-184) MACS_peak_2509 chr2 165831985 165833029 186.61 Zmynd8 (+52181), Eya2 (+177209) MACS_peak_2511 chr2 166091856 166092282 99.3 Sulf2 (+63587), Ncoa3 (+99432) MACS_peak_2512 chr2 166115704 166116856 286.25 Sulf2 (+39376), Ncoa3 (+123643) MACS_peak_2514 chr2 167250690 167251135 75.85 Ptgis (-10376), B4galt5 (+98265) MACS_peak_2515 chr2 167871470 167872069 133.52 Ptpn1 (-60557), Cebpb (+182855) MACS_peak_2516 chr2 167931882 167932770 54.6 Ptpn1 (-1) MACS_peak_2517 chr2 168072424 168072982 57.08 Fam65c (-62110), Pard6b (-8301) MACS_peak_2518 chr2 168080508 168081202 286.52 Pard6b (-149) MACS_peak_2519 chr2 168096734 168097251 353.98 Pard6b (+15989), Adnp (+110069) MACS_peak_2520 chr2 168123560 168124034 93.75 Pard6b (+42793), Adnp (+83265) MACS_peak_2524 chr2 172862989 172863845 310.19 Bmp7 (+76876), Tcfap2c (+312427) MACS_peak_2525 chr2 172940177 172940929 117.28 Bmp7 (-260) MACS_peak_2526 chr2 173226657 173227073 58.53 Zbp1 (-7943), Pmepa1 (+49668) MACS_peak_2527 chr2 173276999 173277466 52.54 Pmepa1 (-700) MACS_peak_2528 chr2 173307198 173307904 111.59 1700021F07Rik (-215041), Pmepa1 (-31018) MACS_peak_2529 chr2 173459221 173459914 93.1 Pmepa1 (-183035), 1700021F07Rik (-63024) MACS_peak_2530 chr2 174075550 174076248 61.8 Stx16 (-1152) MACS_peak_2531 chr2 174112916 174113426 70.83 Gnas (-171149), Npepl1 (+2820) MACS_peak_2532 chr2 174342597 174343454 140.79 Th1l (-72778), Gnas (+45167) MACS_peak_2533 chr2 180024561 180025167 90.93 Lsm14b (-123) MACS_peak_2535 chr2 180227009 180227819 93.17 Lama5 (-1555) MACS_peak_2537 chr2 181460416 181461000 181.49 Zbtb46 (-36320), Abhd16b (-32498) MACS_peak_2541 chr3 9739021 9739900 103.61 Zfp704 (-129376), Pag1 (+94218) MACS_peak_2542 chr3 9834083 9835026 246.49 Pag1 (-876) MACS_peak_2543 chr3 9943212 9944024 99.89 Pag1 (-109939), Fabp5 (-68988) MACS_peak_2552 chr3 14663970 14664951 134.32 Car13 (+22734), Car1 (+113999) MACS_peak_2555 chr3 18643494 18644245 81.01 Cyp7b1 (-400532), Armc1 (+519195) MACS_peak_2561 chr3 27710604 27711095 67.33 Fndc3b (-411) MACS_peak_2562 chr3 27988108 27988817 62 Tnik (-274751), Pld1 (+49783) MACS_peak_2565 chr3 30995718 30996530 67.87 Prkci (+353) MACS_peak_2566 chr3 32822677 32823140 283.31 Usp13 (+5283), Pex5l (+260127) MACS_peak_2569 chr3 37666666 37667652 235.25 Spry1 (+27209), Gm5148 (+57201) MACS_peak_2570 chr3 37747664 37748242 83.58 Gm5148 (-23593), Ankrd50 (+707894) MACS_peak_2572 chr3 37846508 37847130 70.56 Gm5148 (-122459), Ankrd50 (+609028) MACS_peak_2573 chr3 37860072 37860545 102.08 Gm5148 (-135949), Ankrd50 (+595538) MACS_peak_2587 chr3 51219754 51220131 152.22 Ccrn4l (-4504) MACS_peak_2588 chr3 51340521 51341137 110.24 Elf2 (-14794), 4930583H14Rik (+55718) MACS_peak_2590 chr3 51560600 51561086 91.59 Setd7 (-20) MACS_peak_2591 chr3 51771876 51772344 74.4 Mgst2 (+110917), Maml3 (+332896) MACS_peak_2592 chr3 51880088 51880347 93.5 Mgst2 (+219025), Maml3 (+224788) MACS_peak_2593 chr3 51915814 51916920 689.66 Maml3 (+188639), Mgst2 (+255174) MACS_peak_2594 chr3 51965766 51966251 240.15 Maml3 (+138997), Mgst2 (+304816) MACS_peak_2595 chr3 52034884 52035879 109.65 Maml3 (+69624), Mgst2 (+374189) MACS_peak_2596 chr3 52101607 52103306 185.76 Maml3 (+2549), Mgst2 (+441264) MACS_peak_2597 chr3 52104503 52105097 71.14 Maml3 (+206) MACS_peak_2598 chr3 57293849 57294599 197.56 Tm4sf1 (+7695) MACS_peak_2599 chr3 57575600 57576660 93.55 Wwtr1 (-220) MACS_peak_2599 chr3 57575600 57576660 93.55 Wwtr1 (-220) MACS_peak_2600 chr3 59060059 59060743 114.42 Gpr171 (+41420), Med12l (+53527) MACS_peak_2603 chr3 60500450 60501373 122.22 Mbnl1 (-340) MACS_peak_2613 chr3 65974294 65974916 285.51 Ptx3 (-245282), Ccnl1 (-16380) MACS_peak_2618 chr3 67975009 67975592 54.35 Il12a (-715343), Iqcj-schip1 (+83081) MACS_peak_2619 chr3 68573744 68574286 84.96 Il12a (-116629), Iqcj-schip1 (+681795) MACS_peak_2628 chr3 75930577 75931422 51.06 Golim4 (+25831), Serpini1 (+373467) MACS_peak_2640 chr3 84582424 84582987 53.81 Arfip1 (-81) MACS_peak_2641 chr3 85372926 85373497 65.17 Dear1 (-407632), Pet112l (-200917) MACS_peak_2642 chr3 85924128 85924927 145.61 Glt28d2 (-37010), Prss48 (+77963) MACS_peak_2643 chr3 86223426 86224141 61.42 Lrba (-906) MACS_peak_2644 chr3 86852805 86853197 119.49 Mab21l2 (-304718), Dclk2 (+67883) MACS_peak_2645 chr3 86862013 86862722 131.82 Mab21l2 (-314085), Dclk2 (+58516) MACS_peak_2647 chr3 87164952 87165920 220.7 Cd1d1 (-166096), Kirrel (+9311) MACS_peak_2648 chr3 87970905 87971588 134.64 Nes (+154) MACS_peak_2649 chr3 87972251 87972938 103.38 Nes (+1502), Bcan (+27761) MACS_peak_2650 chr3 87982736 87983781 138.97 Nes (+12166), Bcan (+17097) MACS_peak_2653 chr3 88141895 88142539 78.13 Mef2d (-178) MACS_peak_2654 chr3 89393491 89394504 215.25 Zbtb7b (-795) MACS_peak_2655 chr3 89613836 89614494 59.24 Adar (-116553), Kcnn3 (+94001) MACS_peak_2657 chr3 89874989 89875726 183.07 Il6ra (+37804), She (+43988) MACS_peak_2658 chr3 89951722 89952267 163.6 Il6ra (-38833), Atp8b2 (+11513) MACS_peak_2659 chr3 90051316 90052051 59.32 4933434E20Rik (-1133), Ubap2l (+791) MACS_peak_2660 chr3 90292741 90293152 58.96 Gatad2b (-48709), Dennd4b (+26413) MACS_peak_2661 chr3 90432792 90434084 119.88 Ints3 (+198) MACS_peak_2662 chr3 90445983 90446850 68.08 Ints3 (-12781), Npr1 (+19449) MACS_peak_2663 chr3 90447111 90447657 151.73 Ints3 (-13748), Npr1 (+18482) MACS_peak_2664 chr3 90466140 90466688 128.7 Npr1 (-548) MACS_peak_2666 chr3 93520612 93521309 112.44 S100a11 (+465) MACS_peak_2667 chr3 93536952 93537587 129.72 S100a10 (-17847), S100a11 (+16774) MACS_peak_2668 chr3 94371565 94372083 50.94 Rorc (-1002) MACS_peak_2670 chr3 94917686 94918096 90.19 Psmb4 (-30933), Selenbp1 (-15192) MACS_peak_2671 chr3 95179958 95180472 354.81 Sema6c (+15876), Gabpb2 (+37727) MACS_peak_2672 chr3 95216921 95217392 63.6 Gabpb2 (+785) MACS_peak_2674 chr3 95306873 95307460 108.33 Anxa9 (+9) MACS_peak_2675 chr3 95627782 95628225 107 Mcl1 (-30717), Ensa (+3024) MACS_peak_2676 chr3 95675332 95675742 101.3 Adamtsl4 (+12321), Mcl1 (+16817) MACS_peak_2677 chr3 95905227 95905863 88.29 Car14 (-906) MACS_peak_2679 chr3 96040024 96040576 78.77 Plekho1 (-44461), Vps45 (+18155) MACS_peak_2680 chr3 96128084 96128563 404.63 Mtmr11 (-33646), Otud7b (+23797) MACS_peak_2682 chr3 97158384 97159214 224.65 Acp6 (+22) MACS_peak_2683 chr3 97683497 97683970 102.21 Prkab2 (+25522), Pde4dip (+204973) MACS_peak_2687 chr3 98040856 98041278 91.35 Adam30 (-119745), Notch2 (+27529) MACS_peak_2688 chr3 98267020 98267713 247.62 Hmgcs2 (-13064), Reg4 (+45211) MACS_peak_2689 chr3 100706778 100707352 99.52 Vtcn1 (-118394), Man1a2 (-21592) MACS_peak_2690 chr3 100796526 100797165 60.2 Man1a2 (-111373), Vtcn1 (-28613) MACS_peak_2691 chr3 100835261 100835909 59.14 Trim45 (-86908), Vtcn1 (+10126) MACS_peak_2698 chr3 108770724 108771370 107.24 Aknad1 (+31389), Stxbp3a (+69455) MACS_peak_2703 chr3 111111237 111111750 81.86 Prmt6 (-860496) MACS_peak_2715 chr3 116338563 116339152 449.26 Gpr88 (-85374), Cdc14a (+85174) MACS_peak_2716 chr3 116345564 116346373 147.76 Gpr88 (-92485), Cdc14a (+78063) MACS_peak_2720 chr3 119948765 119949533 286.35 Ptbp2 (-165761) MACS_peak_2723 chr3 122048011 122048722 430.1 Gclm (-197225), Abca4 (+3907) MACS_peak_2726 chr3 122130360 122131235 55.25 Gclm (-114794), Abca4 (+86338) MACS_peak_2728 chr3 122419530 122420355 120.5 Bcar3 (+163) MACS_peak_2730 chr3 122438951 122439507 66.3 Bcar3 (+19449), Fnbp1l (+180438) MACS_peak_2731 chr3 122482263 122483341 264.55 Bcar3 (+63022), Fnbp1l (+136865) MACS_peak_2731 chr3 122482263 122483341 264.55 Bcar3 (+63022), Fnbp1l (+136865) MACS_peak_2732 chr3 122567182 122567727 56.31 Fnbp1l (+52212), Bcar3 (+147675) MACS_peak_2742 chr3 128144730 128145826 151.24 5730508B09Rik (-248955) MACS_peak_2744 chr3 129321514 129321956 55.3 Enpep (+11014), Pitx2 (+121817) MACS_peak_2745 chr3 129327939 129328697 64.7 Enpep (+4431), Pitx2 (+128400) MACS_peak_2746 chr3 129369581 129370121 93.92 Elovl6 (-162535), Enpep (-37102) MACS_peak_2747 chr3 129397149 129397906 134.75 Elovl6 (-134858), Enpep (-64779) MACS_peak_2748 chr3 129455516 129455925 63.52 Enpep (-122972), Elovl6 (-76665) MACS_peak_2749 chr3 129698801 129699282 82.57 Egf (+56280), Elovl6 (+166656) MACS_peak_2753 chr3 133544542 133544972 50.76 Tet2 (-367) MACS_peak_2762 chr3 137864041 137864526 53.19 Dnajb14 (-3391), H2afz (-315) MACS_peak_2764 chr3 138735795 138736159 92.6 Tspan5 (-6218), Eif4e (+209786) MACS_peak_2771 chr3 144201707 144202624 81.59 Lmo4 (+166) MACS_peak_2772 chr3 144685062 144685744 276.02 Sh3glb1 (+34920), Sep15 (+114976) MACS_peak_2776 chr3 145988230 145988853 79.79 Syde2 (+672) MACS_peak_2779 chr3 148914907 148915277 52.14 Lphn2 (+39643) MACS_peak_2786 chr3 151894675 151895262 51.19 Ptgfr (-57441), Gipc2 (+270931) MACS_peak_2787 chr3 153261616 153262240 53.25 St6galnac5 (-279721), St6galnac3 (+463205) MACS_peak_2802 chr4 9220767 9221209 206.36 Clvs1 (-48329), Chd7 (+530067) MACS_peak_2806 chr4 14775944 14776553 201.63 Slc26a7 (-154471), Lrrc69 (+19803) MACS_peak_2807 chr4 14826402 14827101 60.05 Otud6b (-165) MACS_peak_2808 chr4 14863627 14864460 59.44 Tmem55a (-175) MACS_peak_2811 chr4 19560369 19560824 87.87 Cpne3 (+9507), Cngb3 (+279747) MACS_peak_2828 chr4 40722065 40722829 139.28 Dnaja1 (-21) MACS_peak_2829 chr4 40818234 40818973 125.33 Smu1 (-60719), B4galt1 (+35394) MACS_peak_2830 chr4 40874074 40874921 284.52 Spink4 (-45558), B4galt1 (-20500) MACS_peak_2834 chr4 43726808 43727497 93.43 Hrct1 (-45) MACS_peak_2835 chr4 45472908 45473521 68.08 Mcart1 (-64449), Shb (+9587) MACS_peak_2836 chr4 46489020 46489593 84.02 Nans (-22) MACS_peak_2837 chr4 47225983 47226384 102.47 Tgfbr1 (-127121), Col15a1 (+18172) MACS_peak_2838 chr4 47227797 47228482 162.49 Tgfbr1 (-125165), Col15a1 (+20128) MACS_peak_2846 chr4 54945272 54945703 57.29 Zfp462 (-2457) MACS_peak_2847 chr4 54945900 54946420 54.89 Zfp462 (-1785) MACS_peak_2848 chr4 56802207 56802754 58.13 Ikbkap (-150), BC026590 (+152) MACS_peak_2849 chr4 56828837 56829452 94.76 Ikbkap (-26814), Ctnnal1 (+36066) MACS_peak_2850 chr4 56829614 56830126 138.94 Ikbkap (-27539), Ctnnal1 (+35341) MACS_peak_2853 chr4 56947248 56947747 123.71 D730040F13Rik (-69) MACS_peak_2854 chr4 57258468 57259291 172.54 Epb4.1l4b (-115724), Ptpn3 (+42957) MACS_peak_2856 chr4 57559936 57560668 83.34 Akap2 (-294260), Ptpn3 (-258465) MACS_peak_2857 chr4 57821743 57822480 89.53 Ptpn3 (-520275), Akap2 (-32450) MACS_peak_2860 chr4 58254182 58255110 161.01 Svep1 (-48050), Musk (-31316) MACS_peak_2862 chr4 59330872 59331271 406.52 Susd1 (+107561), Ugcg (+141522) MACS_peak_2863 chr4 59558563 59559288 225.56 Hsdl2 (-22637), Rod1 (-9562) MACS_peak_2864 chr4 62287475 62288216 158.4 Slc31a2 (+1401), Fkbp15 (+72702) MACS_peak_2865 chr4 62699288 62699769 62.78 Zfp618 (-266045), Rgs3 (+79857) MACS_peak_2866 chr4 62727521 62728099 62.57 Zfp618 (-237764), Rgs3 (+108138) MACS_peak_2867 chr4 63547829 63548340 98.29 6330416G13Rik (-12275), Atp6v1g1 (+3320) MACS_peak_2868 chr4 65496410 65496809 88.71 Trim32 (-108376), Pappa (+372436) MACS_peak_2869 chr4 66202011 66202641 138.24 Astn2 (+202157), Trim32 (+597340) MACS_peak_2870 chr4 66450123 66450528 122.72 Tlr4 (-377485), Astn2 (-45843) MACS_peak_2879 chr4 76386819 76387748 160.56 Ptprd (+207021) MACS_peak_2886 chr4 82148258 82148970 84.14 Mpdz (-705809), Nfib (+356694) MACS_peak_2889 chr4 86748430 86748875 56.18 Dennd4c (+98) MACS_peak_2890 chr4 87933355 87934030 79.14 Slc24a2 (-703153), Mllt3 (+99714) MACS_peak_2891 chr4 87965761 87966291 139.88 Slc24a2 (-735486), Mllt3 (+67381) MACS_peak_2897 chr4 95161023 95161928 182.85 Fggy (-396031), Jun (-109254) MACS_peak_2898 chr4 97772131 97772602 114.72 E130114P18Rik (+5681), Nfia (+190424) MACS_peak_2899 chr4 97774939 97775635 75.94 E130114P18Rik (+2761), Nfia (+193344) MACS_peak_2901 chr4 98923754 98924334 50.01 Usp1 (+234) MACS_peak_2902 chr4 100214563 100215264 123.89 Ube2u (-263953), Ror1 (+119123) MACS_peak_2903 chr4 100307072 100307820 65.45 Ube2u (-171421), Ror1 (+211655) MACS_peak_2904 chr4 100349976 100350620 225.1 Ube2u (-128569), Ror1 (+254507) MACS_peak_2905 chr4 101065003 101065754 74.09 Raver2 (-3659) MACS_peak_2906 chr4 101146764 101147294 364.73 Raver2 (+77991), Jak1 (+118253) MACS_peak_2907 chr4 103050842 103051229 66.84 Insl5 (-24308), Wdr78 (+63263) MACS_peak_2908 chr4 103189001 103189560 57.62 Slc35d1 (+25603), Mier1 (+69891) MACS_peak_2910 chr4 105230121 105230889 146.54 Ppap2b (+73158) MACS_peak_2911 chr4 106633311 106633945 217.09 Pars2 (-17441), Ttc22 (+11179) MACS_peak_2912 chr4 106828040 106828555 51.13 Ssbp3 (-83172), Acot11 (-28467) MACS_peak_2916 chr4 107314212 107314540 81.62 Yipf1 (-55) MACS_peak_2917 chr4 107318691 107319392 92.43 Tmem48 (-48742), Yipf1 (+4611) MACS_peak_2918 chr4 108894800 108895309 122.43 Nrd1 (-105750), Rab3b (+15985) MACS_peak_2919 chr4 109103087 109104014 169.98 Osbpl9 (+98721), Nrd1 (+102746) MACS_peak_2920 chr4 109149062 109149628 122.76 Osbpl9 (+52927), Nrd1 (+148540) MACS_peak_2921 chr4 109201684 109202369 68.99 Osbpl9 (+245) MACS_peak_2922 chr4 109229721 109230147 57.7 Osbpl9 (-27662), Calr4 (-5698) MACS_peak_2923 chr4 109676098 109676880 114.98 Faf1 (-138) MACS_peak_2925 chr4 111432265 111432918 106.82 Spata6 (-287418), Bend5 (+17586) MACS_peak_2926 chr4 111515063 111516029 177.82 Spata6 (-204464), Bend5 (+100540) MACS_peak_2928 chr4 114460342 114460956 97.2 Gm12824 (+53925), Foxd2 (+448249) MACS_peak_2930 chr4 114550183 114550711 50.28 Gm12824 (+143723), Foxd2 (+358451) MACS_peak_2931 chr4 114593863 114594298 85.58 Gm12824 (+187357), Foxd2 (+314817) MACS_peak_2932 chr4 114688120 114689010 317.04 Foxd2 (+220333), Gm12824 (+281841) MACS_peak_2933 chr4 114779779 114780479 107.48 Foxd2 (+128769), Gm12824 (+373405) MACS_peak_2934 chr4 114821639 114822144 70.4 Foxd2 (+87006), Gm12824 (+415168) MACS_peak_2935 chr4 114843053 114843741 262.29 Foxd2 (+65501), Gm12824 (+436673) MACS_peak_2936 chr4 114870017 114870502 319.87 Foxd2 (+38638), Gm12824 (+463536) MACS_peak_2937 chr4 114903947 114904277 81.62 Foxd2 (+4786), Gm12824 (+497388) MACS_peak_2938 chr4 114910757 114911370 87.95 Foxd2 (-2166) MACS_peak_2939 chr4 116220924 116221759 107.3 Pik3r3 (-572) MACS_peak_2940 chr4 116371676 116372270 60.82 Mast2 (+92210), Pik3r3 (+150059) MACS_peak_2941 chr4 116821397 116821940 58.44 Hpdl (-161) MACS_peak_2942 chr4 117484672 117485347 104.48 Rnf220 (+11905), Tmem53 (+233021) MACS_peak_2943 chr4 117581622 117582340 110.72 Eri3 (+31487), Dmap1 (+100244) MACS_peak_2944 chr4 117649408 117649976 56.4 Dmap1 (+32533), Eri3 (+99198) MACS_peak_2945 chr4 117834863 117835412 76.35 Slc6a9 (-120) MACS_peak_2946 chr4 117866064 117866498 87.46 Ccdc24 (+6189), Slc6a9 (+31023) MACS_peak_2948 chr4 118134759 118135236 72.85 St3gal3 (-108) MACS_peak_2949 chr4 118179395 118179979 72.47 Kdm4a (+356) MACS_peak_2950 chr4 118553071 118553598 409.18 Ebna1bp2 (-67464), Tmem125 (-9609) MACS_peak_2951 chr4 119108955 119109492 108.15 Slc2a1 (+479) MACS_peak_2952 chr4 119244331 119244965 221.95 Cldn19 (-10793), Lepre1 (+11733) MACS_peak_2956 chr4 120172056 120172521 54.65 Edn2 (+10865), Foxo6 (+114972) MACS_peak_2958 chr4 122885662 122886347 233.72 Cap1 (-124) MACS_peak_2959 chr4 122955233 122955756 80.39 Cap1 (-69614), Mfsd2a (+5693) MACS_peak_2960 chr4 123004912 123005632 120.36 Trit1 (-11325), Mycl1 (+9173) MACS_peak_2961 chr4 123411772 123412505 73.02 Bmp8a (-69336), Macf1 (+272221) MACS_peak_2964 chr4 124384938 124385784 135.33 Pou3f1 (-272285), Rragc (+467928) MACS_peak_2965 chr4 124388823 124389263 159.41 Pou3f1 (-268603), Rragc (+471610) MACS_peak_2968 chr4 125122723 125123362 69.32 Zc3h12a (+4838), Meaf6 (+37896) MACS_peak_2970 chr4 126147530 126147981 75.27 Fam176b (-247) MACS_peak_2971 chr4 128734091 128734577 94.84 A3galt2 (-24924), Phc2 (+79632) MACS_peak_2973 chr4 129096560 129096945 79.32 Tmem54 (-8777), Rnf19b (+38482) MACS_peak_2976 chr4 130663946 130664808 237.45 Sdc3 (-128160), Pum1 (+1018) MACS_peak_2978 chr4 131405246 131406002 72.9 Ptpru (+432654), Matn1 (+461239) MACS_peak_2981 chr4 132409229 132409564 64.85 Rcc1 (-63647), Phactr4 (+13049) MACS_peak_2982 chr4 133038661 133039311 96.84 Wasf2 (-91647), Ahdc1 (+27480) MACS_peak_2983 chr4 133056092 133056515 78.06 Wasf2 (-74329), Ahdc1 (+44798) MACS_peak_2984 chr4 133085099 133085605 286.62 Wasf2 (-45281), Ahdc1 (+73846) MACS_peak_2986 chr4 133094812 133095507 338.47 Wasf2 (-35473), Ahdc1 (+83654) MACS_peak_2987 chr4 133292927 133293487 85.19 Tmem222 (-15417), Wdtc1 (+46108) MACS_peak_2988 chr4 133338981 133339661 66.48 Wdtc1 (-6) MACS_peak_2989 chr4 133660054 133660815 120.24 Zdhhc18 (-27006), Pigv (+12212) MACS_peak_2990 chr4 133688320 133689033 74.02 Pigv (-16030), Arid1a (+64934) MACS_peak_2991 chr4 133756809 133757595 165.92 Arid1a (-3591) MACS_peak_2992 chr4 133813028 133814638 340.44 Arid1a (-60222), Rps6ka1 (+73966) MACS_peak_2994 chr4 134535333 134535937 128.47 Fam54b (-2883) MACS_peak_2996 chr4 134685600 134686296 188.61 Sepn1 (-133782), Man1c1 (+18342) MACS_peak_2997 chr4 135353078 135353752 85.14 Srrm1 (-201) MACS_peak_2998 chr4 135404012 135404460 205.42 A330049M08Rik (-18564), Rcan3 (+29569) MACS_peak_2999 chr4 135876514 135877348 73.77 Pnrc2 (-3085) MACS_peak_3000 chr4 135918855 135919289 98.33 Fuca1 (-1654) MACS_peak_3002 chr4 138131266 138131753 113.12 Hp1bp3 (-85117), Eif4g3 (+138040) MACS_peak_3003 chr4 139226529 139227141 121.19 Capzb (+33904), Pqlc2 (+83865) MACS_peak_3004 chr4 139582138 139582580 76.15 Aldh4a1 (-40535), Iffo2 (+7223) MACS_peak_3005 chr4 139587286 139587982 165.87 Aldh4a1 (-35260), Iffo2 (+12498) MACS_peak_3006 chr4 139598747 139599637 188.25 Aldh4a1 (-23702), Iffo2 (+24056) MACS_peak_3007 chr4 139619531 139620069 58.47 Aldh4a1 (-3094) MACS_peak_3008 chr4 140465483 140466055 74.43 Igsf21 (-218958), Arhgef10l (+182987) MACS_peak_3009 chr4 140610760 140611736 107.93 Igsf21 (-364437), Arhgef10l (+37508) MACS_peak_3010 chr4 141538639 141539112 109.39 Spen (-279) MACS_peak_3011 chr4 141545857 141546556 143.89 Spen (-7610), Fblim1 (+53717) MACS_peak_3018 chr4 148327271 148327768 330.87 Ptchd2 (-39555), Ubiad1 (+117231) MACS_peak_3020 chr4 148517584 148518604 124.37 Exosc10 (-40333), Angptl7 (-17632) MACS_peak_3021 chr4 148919087 148919627 200.9 Casz1 (+114965), Pex14 (+180455) MACS_peak_3022 chr4 148923623 148924392 96.36 Casz1 (+119616), Pex14 (+175804) MACS_peak_3023 chr4 148967521 148968280 124.34 Pex14 (+131911), Casz1 (+163509) MACS_peak_3024 chr4 148969339 148970010 57.6 Pex14 (+130137), Casz1 (+165283) MACS_peak_3025 chr4 149780602 149781292 75.59 Slc25a33 (-6680), Spsb1 (+174059) MACS_peak_3027 chr4 149990118 149990979 107.8 Spsb1 (-35543), H6pd (+18474) MACS_peak_3028 chr4 150070124 150070534 124.46 H6pd (-61306), Gpr157 (-17174) MACS_peak_3029 chr4 150862914 150863398 58.85 Errfi1 (+8065), Park7 (+46765) MACS_peak_3030 chr4 151181162 151181923 232.8 Vamp3 (-123590), Camta1 (+680225) MACS_peak_3031 chr4 151385958 151386785 104.3 Vamp3 (-328419), Camta1 (+475396) MACS_peak_3032 chr4 151862104 151862750 97.2 Camta1 (-659) MACS_peak_3033 chr4 151996237 151996921 156.25 Phf13 (-400) MACS_peak_3037 chr4 153110364 153111004 113.74 Ajap1 (+372146), Nphp4 (+632542) MACS_peak_3038 chr4 153175757 153176397 97.75 Ajap1 (+306753), Nphp4 (+697935) MACS_peak_3039 chr4 153207264 153208017 119.88 Ajap1 (+275189), Nphp4 (+729499) MACS_peak_3040 chr4 153224643 153225062 89.15 Ajap1 (+257977), Nphp4 (+746711) MACS_peak_3041 chr4 153236146 153236532 92.6 Ajap1 (+246491), Nphp4 (+758197) MACS_peak_3042 chr4 153263246 153263790 58.04 Ajap1 (+219312), Nphp4 (+785376) MACS_peak_3043 chr4 153268056 153268341 81.62 Ajap1 (+214631), Nphp4 (+790057) MACS_peak_3045 chr4 153968318 153968923 121.97 Dffb (+6460), A430005L14Rik (+11384) MACS_peak_3046 chr4 154022439 154022773 81.62 1190007F08Rik (+3438), Lrrc47 (+10803) MACS_peak_3047 chr4 154279546 154280083 334.49 Arhgef16 (+20080), Megf6 (+109102) MACS_peak_3048 chr4 154293818 154294528 274.75 Arhgef16 (+5722), Megf6 (+123460) MACS_peak_3049 chr4 155249766 155250304 188.85 2610002J02Rik (+69) MACS_peak_3050 chr4 155280352 155280878 108.33 2610002J02Rik (+30649), Prkcz (+80776) MACS_peak_3051 chr4 155282116 155283209 249.43 2610002J02Rik (+32697), Prkcz (+78728) MACS_peak_3052 chr4 155651398 155652293 87.08 Mmp23 (+1538), Cdk11b (+26977) MACS_peak_3053 chr4 155839531 155840121 54.96 Mxra8 (+146) MACS_peak_3054 chr4 156192210 156192908 118.45 Agrn (-7424), Isg15 (+8259) MACS_peak_3067 chr5 14025134 14025750 100.36 Sema3e (+166) MACS_peak_3068 chr5 14038944 14039679 154.05 Pclo (-475606), Sema3e (+14036) MACS_peak_3069 chr5 14048720 14049212 81.02 Pclo (-465952), Sema3e (+23690) MACS_peak_3072 chr5 17923895 17924726 60.01 Cd36 (-74519), Gnat3 (-38259) MACS_peak_3075 chr5 19171173 19171760 335.96 Gnai1 (-811054), Magi2 (-55579) MACS_peak_3076 chr5 19180496 19181573 212.99 Gnai1 (-820622), Magi2 (-46011) MACS_peak_3078 chr5 19226289 19227210 112.87 Magi2 (-296) MACS_peak_3080 chr5 22813179 22813840 57.65 Mll5 (-620919), Lhfpl3 (+67317) MACS_peak_3081 chr5 23432559 23433072 57.33 Mll5 (-1613) MACS_peak_3085 chr5 24512214 24512945 71.83 Gbx1 (+14268), Agap3 (+60403) MACS_peak_3086 chr5 24550903 24551505 101.36 Asb10 (-10756), 4931409K22Rik (+4265) MACS_peak_3087 chr5 24604712 24605385 75.93 Smarcd3 (-3047) MACS_peak_3088 chr5 24842389 24843016 70.19 Rheb (-342) MACS_peak_3089 chr5 25498963 25499957 174.88 Mll3 (-677) MACS_peak_3090 chr5 25529462 25530133 58.44 Cct8l1 (+13731), Xrcc2 (+175999) MACS_peak_3092 chr5 30912978 30913781 103.06 Emilin1 (-406) MACS_peak_3093 chr5 30968282 30968993 62.57 Tcf23 (-39) MACS_peak_3094 chr5 31079933 31080852 141.59 Slc30a3 (+13134), Cad (+25582) MACS_peak_3095 chr5 31564596 31565416 162.28 Mrpl33 (-48945), Slc4a1ap (+38011) MACS_peak_3096 chr5 32068602 32069063 171.57 Fosl2 (-67639), Bre (+370783) MACS_peak_3097 chr5 32132998 32133462 84.28 Fosl2 (-3242) MACS_peak_3098 chr5 32135221 32136747 513.8 Fosl2 (-488) MACS_peak_3099 chr5 32151106 32151787 156.62 Plb1 (-87637), Fosl2 (+14975) MACS_peak_3100 chr5 32991279 32991723 86.38 Ywhah (-27315), Depdc5 (+127780) MACS_peak_3101 chr5 33657910 33658533 79.79 Tmem129 (-390), Tacc3 (+75) MACS_peak_3103 chr5 34465895 34466483 55.4 Fam193a (+45405), Tnip2 (+47790) MACS_peak_3104 chr5 35221110 35221601 147.96 Lrpap1 (-115659), Adra2c (-57210) MACS_peak_3105 chr5 35233220 35233819 81.77 Lrpap1 (-127823), Adra2c (-45046) MACS_peak_3106 chr5 35922081 35922584 70.57 Psapl1 (-281688), Afap1 (+29014) MACS_peak_3107 chr5 35973778 35974111 81.62 Psapl1 (-230076), Afap1 (+80626) MACS_peak_3116 chr5 45101813 45103259 116.81 Ldb2 (-302829), Qdpr (+347693) MACS_peak_3123 chr5 52256589 52256996 51.95 Sod3 (-107011), Dhx15 (-66274) MACS_peak_3141 chr5 62213307 62214786 155.64 G6pd2 (+405204), Arap2 (+552130) MACS_peak_3147 chr5 64159765 64160395 148.89 Tbc1d1 (-131) MACS_peak_3148 chr5 64287080 64287850 65.04 Klf3 (-516058), Tbc1d1 (+127254) MACS_peak_3150 chr5 64296116 64296918 75.84 Klf3 (-507006), Tbc1d1 (+136306) MACS_peak_3153 chr5 64876098 64876636 149.48 Tlr1 (+56332), Klf3 (+72844) MACS_peak_3154 chr5 65021894 65022402 194.03 Klhl5 (-109083), Fam114a1 (+52073) MACS_peak_3155 chr5 65492756 65493367 123.13 1110003E01Rik (-227) MACS_peak_3157 chr5 66337988 66338500 78.75 Nsun7 (+78119), Apbb2 (+280573) MACS_peak_3158 chr5 66339899 66340691 123.53 Nsun7 (+80170), Apbb2 (+278522) MACS_peak_3159 chr5 66365322 66365872 83.4 Nsun7 (+105472), Apbb2 (+253220) MACS_peak_3160 chr5 67581268 67581764 263.59 Bend4 (-153717), Shisa3 (-26367) MACS_peak_3167 chr5 71656517 71657222 136.1 Cox7b2 (-108665), Gabra4 (+1438) MACS_peak_3168 chr5 73209101 73209709 70.49 Fryl (+47213), Slc10a4 (+202501) MACS_peak_3170 chr5 73373107 73373650 76.86 Ociad2 (-34740), Cwh43 (-32699) MACS_peak_3173 chr5 74315643 74316240 62.75 Rasl11b (+120616), Scfd2 (+215807) MACS_peak_3175 chr5 76951036 76951849 70.92 Paics (+32), Ppat (+135) MACS_peak_3176 chr5 77357579 77358387 88.18 Polr2b (+47499), Igfbp7 (+50062) MACS_peak_3178 chr5 77387076 77387534 153.07 Igfbp7 (+20740), Polr2b (+76821) MACS_peak_3188 chr5 81519162 81519844 64.07 Lphn3 (+497910) MACS_peak_3198 chr5 92137602 92138099 52.35 Uso1 (-87) MACS_peak_3199 chr5 92834425 92835047 56.28 Shroom3 (+151301), Ankrd56 (+210286) MACS_peak_3200 chr5 92841341 92841894 89.58 Shroom3 (+158183), Ankrd56 (+203404) MACS_peak_3201 chr5 92856152 92856616 116.94 Shroom3 (+172949), Ankrd56 (+188638) MACS_peak_3203 chr5 93093124 93093725 79.92 Sept11 (-32) MACS_peak_3205 chr5 93123863 93124413 76.26 Sept11 (+30681), Ccni (+82357) MACS_peak_3206 chr5 93124552 93125130 73.95 Sept11 (+31384), Ccni (+81654) MACS_peak_3207 chr5 93127717 93128354 144.88 Sept11 (+34579), Ccni (+78459) MACS_peak_3209 chr5 99444516 99445442 114.01 Rasgef1b (-192052), A930011G23Rik (+284081) MACS_peak_3210 chr5 100125407 100125915 119.48 Tmem150c (+34147), Enoph1 (+85667) MACS_peak_3211 chr5 101992832 101993436 178.47 Wdfy3 (+76787), Cds1 (+228004) MACS_peak_3212 chr5 101993978 101994396 172.47 Wdfy3 (+75734), Cds1 (+229057) MACS_peak_3213 chr5 102069686 102070098 64.49 Wdfy3 (+29) MACS_peak_3214 chr5 102751741 102752915 135.78 Arhgap24 (+270937), Mapk10 (+459006) MACS_peak_3215 chr5 102829685 102830124 274.67 Arhgap24 (+348514), Mapk10 (+381429) MACS_peak_3216 chr5 102844928 102846010 177.43 Arhgap24 (+364078), Mapk10 (+365865) MACS_peak_3217 chr5 102867917 102868662 107.23 Mapk10 (+343044), Arhgap24 (+386899) MACS_peak_3218 chr5 103376844 103377229 67.28 Mapk10 (-165703), Ptpn13 (-48155) MACS_peak_3219 chr5 103606066 103606907 261.34 Slc10a6 (+22916), Ptpn13 (+181295) MACS_peak_3221 chr5 103691854 103692585 71.83 Aff1 (-61942), 1700016H13Rik (-36488) MACS_peak_3222 chr5 107046396 107047325 218.18 Cdc7 (+82539), Tgfbr3 (+242734) MACS_peak_3223 chr5 107087294 107087916 543 Cdc7 (+123283), Tgfbr3 (+201990) MACS_peak_3224 chr5 107088157 107088621 84.02 Cdc7 (+124067), Tgfbr3 (+201206) MACS_peak_3225 chr5 107167656 107168260 143.98 Tgfbr3 (+121637), Cdc7 (+203636) MACS_peak_3227 chr5 107289258 107289807 50.5 Tgfbr3 (+62) MACS_peak_3230 chr5 110598429 110599231 408.56 Galnt9 (+54485), Noc4l (+54552) MACS_peak_3231 chr5 110807935 110808551 90.03 Pus1 (-27647), Ulk1 (+1838) MACS_peak_3234 chr5 114571332 114571909 55.8 BC057022 (+3370), Trpv4 (+86800) MACS_peak_3235 chr5 114587842 114588251 90.31 BC057022 (+19796), Trpv4 (+70374) MACS_peak_3236 chr5 114592916 114593691 125.15 BC057022 (+25053), Trpv4 (+65117) MACS_peak_3237 chr5 114647574 114648058 53.26 Trpv4 (+10605), BC057022 (+79565) MACS_peak_3238 chr5 115299953 115300457 90.58 Dynll1 (+785) MACS_peak_3240 chr5 115531219 115531734 51.13 Rplp0 (-27990), Pxn (+24775) MACS_peak_3241 chr5 116422837 116423300 189.58 Hspb8 (-205) MACS_peak_3244 chr5 117550732 117551554 83.26 Nos1 (-315696), Ksr2 (+137143) MACS_peak_3246 chr5 120563413 120563969 85.55 Tpcn1 (+24922), Slc24a6 (+52499) MACS_peak_3247 chr5 120578572 120579142 297.36 Tpcn1 (+9756), Slc24a6 (+67665) MACS_peak_3248 chr5 123144360 123145214 81.09 Setd1b (+2594), Hpd (+37899) MACS_peak_3250 chr5 123946379 123946871 61.91 Hip1r (-27003), Ccdc62 (+15936) MACS_peak_3251 chr5 123947026 123947630 127.97 Hip1r (-26300), Ccdc62 (+16639) MACS_peak_3253 chr5 124453691 124454132 86.7 Setd8 (+13982), Rilpl2 (+24323) MACS_peak_3255 chr5 124875537 124875992 95.87 Fam101a (-127710), Zfp664 (+13060) MACS_peak_3256 chr5 125040753 125041291 77.29 Fam101a (+37547), Ncor2 (+138192) MACS_peak_3257 chr5 125046281 125046826 89.18 Fam101a (+43079), Ncor2 (+132660) MACS_peak_3258 chr5 125177507 125178390 391.44 Ncor2 (+1265), Fam101a (+174474) MACS_peak_3259 chr5 125465574 125465991 135.36 Aacs (-10090), Bri3bp (+24215) MACS_peak_3260 chr5 129163944 129164464 99.38 Sfswap (-337027), Gpr133 (+67454) MACS_peak_3261 chr5 131089771 131090217 56.1 A330070K13Rik (-705363), Wbscr17 (+217528) MACS_peak_3262 chr5 131241434 131242018 205.75 A330070K13Rik (-857095), Wbscr17 (+65796) MACS_peak_3263 chr5 131583925 131584840 103.59 Auts2 (-109210) MACS_peak_3264 chr5 131855248 131855813 98.63 Auts2 (-380358) MACS_peak_3265 chr5 131881851 131882644 318.87 Auts2 (-407075) MACS_peak_3267 chr5 134456685 134457175 61.73 Gtf2ird1 (-219) MACS_peak_3268 chr5 134571515 134572274 180.23 Gm52 (-11802), Rfc2 (-10795) MACS_peak_3269 chr5 134676022 134676799 105.23 Eif4h (-37083), Limk1 (+12179) MACS_peak_3271 chr5 134932235 134932958 130.35 Wbscr27 (+224) MACS_peak_3272 chr5 135465589 135466491 217.91 Pom121 (-71494), Hip1 (+79082) MACS_peak_3273 chr5 135962471 135962877 90.66 Ywhag (-28033), Srcrb4d (+11802) MACS_peak_3274 chr5 136523062 136523528 54.57 Sh2b2 (-278392), Cux1 (+42533) MACS_peak_3277 chr5 138255683 138256202 69.23 0910001L09Rik (+461) MACS_peak_3279 chr5 139252407 139253166 106.78 Get4 (+463) MACS_peak_3280 chr5 139380362 139380788 67.52 Gpr146 (-92) MACS_peak_3281 chr5 139391528 139391949 78.27 C130050O18Rik (-14648), Gpr146 (+11072) MACS_peak_3282 chr5 140610192 140611369 250.19 Lfng (+3440), Ttyh3 (+38250) MACS_peak_3283 chr5 140776938 140777445 194.21 Amz1 (+53065), Gna12 (+53239) MACS_peak_3285 chr5 141946846 141947176 64.64 Foxk1 (-454486), Sdk1 (+705477) MACS_peak_3286 chr5 142340092 142340701 110.97 Foxk1 (-61100) MACS_peak_3287 chr5 142405324 142405757 57.13 C330006K01Rik (-58390), Foxk1 (+4044) MACS_peak_3288 chr5 142440353 142440753 138.08 C330006K01Rik (-23378), Foxk1 (+39056) MACS_peak_3289 chr5 143053412 143054128 58.42 Rnf216 (+59250), Fscn1 (+93415) MACS_peak_3291 chr5 144255749 144256562 131.59 Bri3 (+931) MACS_peak_3292 chr5 144357925 144358649 75.63 Baiap2l1 (-175) MACS_peak_3293 chr5 146841365 146841660 127.52 Rasl11a (-3558) MACS_peak_3294 chr5 146846254 146846857 70.14 Gtf3a (-102101), Rasl11a (+1485) MACS_peak_3295 chr5 146907452 146908063 225.89 Gtf3a (-40899), Rasl11a (+62687) MACS_peak_3296 chr5 147860028 147860731 336.76 Pomp (-248) MACS_peak_3298 chr5 148552272 148553072 81.35 Ubl3 (+116) MACS_peak_3299 chr5 148768280 148768794 69.64 Ubl3 (-215749), Katnal1 (+160110) MACS_peak_3300 chr5 148789044 148789615 64.62 Ubl3 (-236542), Katnal1 (+139317) MACS_peak_3303 chr5 150151983 150152509 68.66 Fry (-107684), Rxfp2 (+133571) MACS_peak_3304 chr5 150384753 150385240 52.54 Fry (+125067), Zar1l (+133162) MACS_peak_3305 chr5 150490754 150491166 89.96 Zar1l (+27199), Fry (+231030) MACS_peak_3308 chr6 8511333 8511902 71.36 Glcci1 (+2022), Ica1 (+266866) MACS_peak_3312 chr6 12892991 12893991 126.67 Tmem106b (-176268), Thsd7a (-144238) MACS_peak_3324 chr6 24564038 24564751 67.35 Lmod2 (-33376), Asb15 (+36251) MACS_peak_3331 chr6 29022108 29022774 87.97 Lrrc4 (-190694), Lep (-37780) MACS_peak_3333 chr6 29735274 29735986 186.41 Smo (+133) MACS_peak_3334 chr6 30303583 30303970 52.28 Gm2058 (+762) MACS_peak_3336 chr6 31148037 31148902 94.36 Mkln1 (-250358), Klf14 (-189480) MACS_peak_3339 chr6 31627955 31628673 334.22 1700012A03Rik (-421974), Podxl (-64377) MACS_peak_3340 chr6 31629830 31630369 279.05 1700012A03Rik (-420188), Podxl (-66163) MACS_peak_3342 chr6 32397062 32397479 89.44 Plxna4 (+190921), 1700012A03Rik (+346983) MACS_peak_3343 chr6 34145868 34146677 62.4 Slc35b4 (+30781), Lrguk (+116825) MACS_peak_3346 chr6 37419363 37419934 192 Dgki (-119673), Creb3l2 (+22499) MACS_peak_3347 chr6 37430730 37431935 334.46 Dgki (-131357), Creb3l2 (+10815) MACS_peak_3349 chr6 37617174 37618164 116.28 Atp6v0c (-188321), Akr1d1 (+87496) MACS_peak_3350 chr6 38432909 38433962 129.6 Ubn2 (-489) MACS_peak_3351 chr6 38554516 38555301 91.39 Luc7l2 (+3465), Klrg2 (+82330) MACS_peak_3352 chr6 38662671 38663184 51.27 Clec2l (-141) MACS_peak_3356 chr6 42264679 42265265 162.37 Casp2 (-67) MACS_peak_3359 chr6 44756401 44757095 142.85 Cntnap2 (-303313) MACS_peak_3363 chr6 47813457 47813839 245.84 Pdia4 (-136) MACS_peak_3365 chr6 52164711 52165285 82.39 Hoxa2 (-167) MACS_peak_3366 chr6 52233333 52233792 99.25 Hoxa9 (-6193), Hoxa10 (+1376) MACS_peak_3367 chr6 52640123 52640750 192.49 Hibadh (-137) MACS_peak_3368 chr6 54327400 54328072 148.82 Prr15 (+724) MACS_peak_3369 chr6 54351686 54352473 144.45 Wipf3 (-100803), Prr15 (+25068) MACS_peak_3371 chr6 54398469 54398839 69.06 Wipf3 (-54229), Prr15 (+71642) MACS_peak_3372 chr6 54429428 54429872 108.23 Wipf3 (-23233), Prr15 (+102638) MACS_peak_3373 chr6 54450457 54451180 130.35 Wipf3 (-2064) MACS_peak_3374 chr6 54573237 54573960 122.41 Scrn1 (-7217), Fkbp14 (+19529) MACS_peak_3375 chr6 54594877 54595505 84.43 Fkbp14 (-2063), Plekha8 (+80) MACS_peak_3388 chr6 67075857 67076560 89.18 Serbp1 (-190770), Gadd45a (-38802) MACS_peak_3389 chr6 67102420 67103274 69.31 Serbp1 (-164132), Gadd45a (-65440) MACS_peak_3392 chr6 70073792 70074571 124.77 Rpia (+717993) MACS_peak_3393 chr6 70116829 70117209 62.71 Rpia (+675156) MACS_peak_3395 chr6 70340576 70341023 118.28 Rpia (+451375) MACS_peak_3396 chr6 70749741 70750589 63.91 Rpia (+42010) MACS_peak_3397 chr6 71268585 71269272 237.65 Krcc1 (-3090) MACS_peak_3398 chr6 71428081 71428790 60.47 Rmnd5a (+12201), Cd8a (+55009) MACS_peak_3399 chr6 71440354 71440833 115.02 Rmnd5a (+43) MACS_peak_3400 chr6 71632863 71633817 112.55 Kdm3a (-654) MACS_peak_3401 chr6 71989625 71990385 73.39 St3gal5 (-107608), Polr1a (+80952) MACS_peak_3402 chr6 72234985 72235621 151.12 Atoh8 (+274) MACS_peak_3403 chr6 72389754 72390528 115.25 Vamp8 (+526) MACS_peak_3404 chr6 72743528 72744448 189.76 Tgoln2 (-126988), Tcf7l1 (+44968) MACS_peak_3406 chr6 72981325 72982009 176.65 Tmsb10 (-23184), Dnahc6 (+239964) MACS_peak_3418 chr6 82429688 82430460 72.48 Tacr1 (+27599), Pole4 (+222791) MACS_peak_3419 chr6 83033916 83034305 71.01 Dok1 (-640), Loxl3 (-113) MACS_peak_3421 chr6 83441304 83441913 100.67 Tet3 (+69) MACS_peak_3422 chr6 83443068 83444460 380.22 Tet3 (-2086) MACS_peak_3424 chr6 85451108 85451877 274.75 1700040I03Rik (-191), Cct7 (-12) MACS_peak_3426 chr6 86222332 86222887 150.47 Fam136a (-143073), Tgfa (+27359) MACS_peak_3427 chr6 86247773 86248157 81.62 Fam136a (-117718), Tgfa (+52714) MACS_peak_3428 chr6 86252217 86252830 110.55 Fam136a (-113159), Tgfa (+57273) MACS_peak_3430 chr6 86822274 86822839 221.54 Anxa4 (-28973), Aak1 (-26960) MACS_peak_3432 chr6 88841812 88842611 76.03 Abtb1 (-277) MACS_peak_3434 chr6 90983984 90984462 64.6 Iqsec1 (-174100), Nup210 (+132603) MACS_peak_3435 chr6 91566394 91566769 93.5 Slc6a6 (-117485), Lsm3 (+50547) MACS_peak_3436 chr6 91675095 91675605 79.8 Slc6a6 (-8717), Lsm3 (+159315) MACS_peak_3437 chr6 92091857 92092430 54.66 Nr2c2 (+726) MACS_peak_3438 chr6 92850093 92850846 87.64 Prickle2 (-144286), Adamts9 (+50971) MACS_peak_3445 chr6 97568332 97569067 157.78 Lmod3 (-315920), Frmd4b (+48957) MACS_peak_3449 chr6 99439688 99440443 57.91 Foxp1 (-4721) MACS_peak_3450 chr6 99523233 99523655 89.17 Foxp1 (-88099), Eif4e3 (+143327) MACS_peak_3458 chr6 108212394 108213228 64.46 Itpr1 (-285) MACS_peak_3459 chr6 108531686 108532713 316.37 Bhlhe40 (-128429), Itpr1 (+319104) MACS_peak_3460 chr6 108659891 108660538 207.67 Bhlhe40 (-414) MACS_peak_3466 chr6 113046053 113046518 65.85 Thumpd3 (-41) MACS_peak_3467 chr6 113076011 113076971 149.79 Setd5 (-1148) MACS_peak_3469 chr6 113341947 113342369 58.03 Camk1 (+1764), Ogg1 (+15182) MACS_peak_3470 chr6 114450694 114451277 80.4 Atg7 (-192163), Hrh1 (+53050) MACS_peak_3471 chr6 114873921 114875442 243.21 Vgll4 (+47070), Atg7 (+231557) MACS_peak_3471 chr6 114873921 114875442 243.21 Vgll4 (+47070), Atg7 (+231557) MACS_peak_3472 chr6 114882604 114882986 60.93 Vgll4 (+38957), Atg7 (+239670) MACS_peak_3473 chr6 114919399 114920044 53.07 Vgll4 (+2030), Atg7 (+276597) MACS_peak_3474 chr6 114921716 114922259 102.88 Vgll4 (-236) MACS_peak_3478 chr6 115906721 115907361 118.17 Rho (-24886), Ift122 (+53513) MACS_peak_3479 chr6 116006797 116007359 197.13 Plxnd1 (-12073), Tmcc1 (+186296) MACS_peak_3481 chr6 117407085 117407717 79.07 Zfp637 (-433841), Cxcl12 (+238866) MACS_peak_3482 chr6 117437659 117438263 71.91 Zfp637 (-403281), Cxcl12 (+269426) MACS_peak_3483 chr6 118808250 118808709 203.22 Dcp1b (-366773), Ankrd26 (-246224) MACS_peak_3484 chr6 118845723 118846221 158.83 Dcp1b (-329281), Ankrd26 (-283716) MACS_peak_3485 chr6 119452181 119452675 71.34 Adipor2 (-34945), Fbxl14 (-27240) MACS_peak_3486 chr6 119479017 119479471 74.99 Fbxl14 (-424) MACS_peak_3487 chr6 119562491 119562884 269.63 Wnt5b (-18341), Erc1 (+285462) MACS_peak_3488 chr6 119565182 119566073 114.82 Wnt5b (-21281), Erc1 (+282522) MACS_peak_3489 chr6 120109178 120109670 361.04 Ninj2 (+16044), B4galnt3 (+185135) MACS_peak_3490 chr6 120531159 120531819 67.84 Cecr5 (-190) MACS_peak_3492 chr6 120987300 120988201 218.04 Mical3 (-5024), Mical3 (+93858) MACS_peak_3493 chr6 120999727 121000572 229.23 Mical3 (-17423), Mical3 (+81459) MACS_peak_3494 chr6 121110016 121110937 95.89 Pex26 (-73190), Mical3 (-28868) MACS_peak_3496 chr6 122810753 122811831 128.36 Slc2a3 (-68547), Foxj2 (-8892) MACS_peak_3497 chr6 122826296 122826743 179.82 Foxj2 (+6336), C3ar1 (+29637) MACS_peak_3499 chr6 124919656 124920409 102.44 Ptms (-2087) MACS_peak_3500 chr6 125089202 125090161 189.15 Chd4 (-6481), Lpar5 (+21762) MACS_peak_3501 chr6 125099381 125100097 110.65 Nop2 (-32144), Chd4 (+3576) MACS_peak_3502 chr6 125148073 125148679 100.97 Iffo1 (+3135), Gapdh (+17207) MACS_peak_3503 chr6 125377974 125378686 64.4 Plekhg6 (+2174), Tnfrsf1a (+28607) MACS_peak_3504 chr6 127916929 127917402 81.28 Tspan11 (+29544), Tspan9 (+226412) MACS_peak_3505 chr6 127932735 127933413 71.07 Tspan11 (+45452), Tspan9 (+210504) MACS_peak_3506 chr6 128285472 128286353 97 Tspan9 (-142335), Tead4 (+14900) MACS_peak_3513 chr6 134050305 134050776 104.91 Bcl2l14 (-345788), Etv6 (+14834) MACS_peak_3514 chr6 134920321 134920845 80.96 Cdkn1b (+182) MACS_peak_3516 chr6 137280580 137281111 50.25 Ptpro (+28547), Eps8 (+368274) MACS_peak_3517 chr6 137287612 137288286 130.42 Ptpro (+35650), Eps8 (+361171) MACS_peak_3518 chr6 137294893 137295753 188.48 Ptpro (+43024), Eps8 (+353797) MACS_peak_3524 chr6 140623119 140623870 159.16 Aebp2 (-194) MACS_peak_3526 chr6 141395754 141396684 88.73 Slco1c1 (-128167), Pde3a (+146950) MACS_peak_3527 chr6 141434030 141434741 265.65 Slco1c1 (-90000), Pde3a (+185117) MACS_peak_3528 chr6 142506250 142507277 56.74 Gys2 (-33655), Ldhb (+1179) MACS_peak_3531 chr6 144105197 144105920 157.32 Sox5 (+103999), Etnk1 (+938329) MACS_peak_3532 chr6 144647987 144648688 322.23 Sox5 (-438780), Bcat1 (+400474) MACS_peak_3534 chr6 145781964 145782405 111.85 Rassf8 (-26198), Tuba3b (+166222) MACS_peak_3535 chr6 146642293 146642634 67.7 Med21 (-115) MACS_peak_3536 chr6 146884828 146885214 77.95 Ppfibp1 (-3473) MACS_peak_3537 chr6 148315333 148315793 86.12 Ergic2 (-103189), Rps4x (-39093) MACS_peak_3550 chr7 15962044 15963057 172.94 Gltscr2 (-16443), Ehd2 (+4984) MACS_peak_3551 chr7 16296732 16297201 214.25 Bbc3 (-12616), Ccdc9 (-10172) MACS_peak_3552 chr7 16917644 16918439 98.29 Calm3 (+5990), Ptgir (+11552) MACS_peak_3553 chr7 19078624 19079202 103.77 Dmpk (-4936) MACS_peak_3554 chr7 19093821 19094370 57.69 Six5 (-448) MACS_peak_3555 chr7 19131158 19131729 67.54 Fbxo46 (+11585), Qpctl (+17752) MACS_peak_3556 chr7 19186375 19186914 67.62 Gpr4 (-25893), Eml2 (+5475) MACS_peak_3557 chr7 19271494 19272165 50.15 Vasp (+24) MACS_peak_3559 chr7 19746398 19746975 257.73 Tomm40 (-31258), Pvrl2 (+2886) MACS_peak_3560 chr7 24399170 24399954 60.08 1500002O20Rik (-66) MACS_peak_3561 chr7 24850049 24850529 56.02 Lypd4 (+19402), Ceacam10 (+73085) MACS_peak_3563 chr7 25275826 25276314 62.22 Cic (+8371), Pafah1b3 (+21885) MACS_peak_3564 chr7 25619078 25619718 107.83 Gm7092 (-3506), Atp5sl (-95) MACS_peak_3565 chr7 25686735 25687431 65.42 Tgfb1 (+81) MACS_peak_3567 chr7 25802096 25802664 196.14 Axl (-13647), Cyp2s1 (+14150) MACS_peak_3568 chr7 25804733 25805302 285.8 Axl (-16285), Cyp2s1 (+11512) MACS_peak_3569 chr7 25815478 25816237 137.01 Cyp2s1 (+672) MACS_peak_3572 chr7 27486900 27487782 115.56 Sertad1 (+388) MACS_peak_3573 chr7 27490079 27491023 129.51 Prx (-8773), Sertad1 (+3598) MACS_peak_3574 chr7 27605490 27605915 68.72 Akt2 (-157) MACS_peak_3575 chr7 27838348 27838742 50.74 Zfp59 (-39) MACS_peak_3578 chr7 28925021 28925641 53.03 Actn4 (+36949), Capn12 (+43675) MACS_peak_3579 chr7 28930462 28931152 72.62 Actn4 (+31473), Capn12 (+49151) MACS_peak_3580 chr7 28939571 28940396 129.79 Actn4 (+22296), Capn12 (+58328) MACS_peak_3581 chr7 28945554 28946147 78.91 Actn4 (+16429), Capn12 (+64195) MACS_peak_3583 chr7 29470809 29471787 108.01 Sipa1l3 (+34162), Dpf1 (+167293) MACS_peak_3585 chr7 30441480 30442159 80.02 Aplp1 (+3741), Nfkbid (+18516) MACS_peak_3586 chr7 30459227 30459833 107.67 Kirrel2 (-2015), Nphs1 (-528) MACS_peak_3587 chr7 30477681 30478452 105.74 Prodh2 (-15591), Nphs1 (+18009) MACS_peak_3588 chr7 34655078 34655729 68.47 Kctd15 (-2563) MACS_peak_3589 chr7 35333846 35334492 68.82 Rhpn2 (-68) MACS_peak_3600 chr7 44929351 44930115 157.66 Ap2a1 (-243) MACS_peak_3602 chr7 45054110 45054629 69.23 Prr12 (-1489) MACS_peak_3603 chr7 45313188 45313623 77.33 Trpm4 (+20374), 1700039E15Rik (+30680) MACS_peak_3605 chr7 45567732 45568952 655.65 Bcat2 (-2021) MACS_peak_3607 chr7 49247880 49248828 179.76 Nav2 (+2165), Dbx1 (+388481) MACS_peak_3609 chr7 49437773 49438639 343.36 Nav2 (+192017), Dbx1 (+198629) MACS_peak_3610 chr7 49444108 49444882 83.09 Dbx1 (+192340), Nav2 (+198306) MACS_peak_3611 chr7 49448420 49448992 56.13 Dbx1 (+188129), Nav2 (+202517) MACS_peak_3618 chr7 59228222 59229124 64.23 Ube3a (-77) MACS_peak_3623 chr7 63903042 63903582 93.07 Klf13 (+35603), Otud7a (+458540) MACS_peak_3626 chr7 64019909 64020569 193.78 Trpm1 (-133596), Klf13 (-81324) MACS_peak_3627 chr7 64021453 64022103 207.2 Trpm1 (-132057), Klf13 (-82863) MACS_peak_3628 chr7 65378973 65379486 87.7 Tarsl2 (-265668), Tjp1 (-7986) MACS_peak_3629 chr7 65413740 65414790 242.49 Tarsl2 (-230633), Tjp1 (-43021) MACS_peak_3631 chr7 65902178 65903210 257.28 Snrpa1 (-157642), Pcsk6 (+40558) MACS_peak_3633 chr7 68264388 68264949 91.54 Pgpep1l (-436) MACS_peak_3635 chr7 71383108 71384085 123.82 Mctp2 (+922998) MACS_peak_3636 chr7 71960542 71961873 122.41 Mctp2 (+345387) MACS_peak_3638 chr7 73513714 73514450 54.87 Chd2 (+27664), Rgma (+138562) MACS_peak_3639 chr7 73606542 73607405 109.07 Fam174b (-133333), Chd2 (-65228) MACS_peak_3642 chr7 77304072 77304717 125.33 MACS_peak_3643 chr7 77338351 77339174 228.64 MACS_peak_3648 chr7 78650914 78652157 196.9 Ntrk3 (-73698), Mrpl46 (+131553) MACS_peak_3649 chr7 78660550 78661356 217.28 Ntrk3 (-83115), Mrpl46 (+122136) MACS_peak_3650 chr7 78690848 78691648 464.16 Ntrk3 (-113410), Mrpl46 (+91841) MACS_peak_3651 chr7 80192495 80192881 71.01 Sema4b (+5847), Cib1 (+39928) MACS_peak_3654 chr7 83921521 83922048 86.15 Mesdc2 (+29785), 9930013L23Rik (+164720) MACS_peak_3655 chr7 84358276 84358701 73.14 Fam108c (-206596), Arnt2 (+51470) MACS_peak_3656 chr7 84397245 84397824 62.03 Fam108c (-245642), Arnt2 (+12424) MACS_peak_3657 chr7 84409069 84409838 280.36 Arnt2 (+505) MACS_peak_3665 chr7 92782766 92783708 67.44 Rab30 (+41523), 4632434I11Rik (+90995) MACS_peak_3671 chr7 95787602 95788403 54.85 Odz4 (-422634) MACS_peak_3672 chr7 95789281 95789900 130.77 Odz4 (-421046) MACS_peak_3673 chr7 96745738 96746385 87.35 AK053790 (-50579), Odz4 (+535425) MACS_peak_3674 chr7 96747328 96747785 153.23 AK053790 (-49084), Odz4 (+536920) MACS_peak_3675 chr7 97082649 97083297 53.84 Kctd21 (-249350), Gab2 (+1222) MACS_peak_3678 chr7 97850304 97850755 58.68 Gdpd4 (-69428), Pak1 (+7591) MACS_peak_3679 chr7 97852202 97852545 62.71 Gdpd4 (-67584), Pak1 (+9435) MACS_peak_3681 chr7 99546184 99546733 92.86 Arrb1 (+10973), Gm4980 (+80644) MACS_peak_3682 chr7 99548051 99548513 64.35 Arrb1 (+12796), Gm4980 (+78821) MACS_peak_3683 chr7 99562298 99563084 284.86 Arrb1 (+27205), Gm4980 (+64412) MACS_peak_3685 chr7 100590759 100591471 131.51 Rab6 (-16471), Mrpl48 (-7985) MACS_peak_3686 chr7 100607132 100607797 94.79 Rab6 (-121) MACS_peak_3688 chr7 100706232 100706825 82.28 Fam168a (-173) MACS_peak_3689 chr7 100894237 100894980 118.13 Relt (-31196), Arhgef17 (+37552) MACS_peak_3690 chr7 100911132 100911663 255.45 Relt (-47985), Arhgef17 (+20763) MACS_peak_3691 chr7 100926400 100927093 200.69 Relt (-63334), Arhgef17 (+5414) MACS_peak_3692 chr7 100930777 100931310 165.41 Relt (-67631), Arhgef17 (+1117) MACS_peak_3693 chr7 101107915 101108483 62.57 Fchsd2 (-576) MACS_peak_3694 chr7 101119248 101119808 231.49 Fchsd2 (+10753), Atg16l2 (+182560) MACS_peak_3695 chr7 101323038 101323602 119.49 Arap1 (-24749), Stard10 (+2070) MACS_peak_3696 chr7 101837783 101838700 107.93 Inppl1 (-418) MACS_peak_3697 chr7 101895947 101896297 81.62 3200002M19Rik (-293) MACS_peak_3704 chr7 107521460 107521879 181.52 Olfml1 (-45763), Syt9 (+150880) MACS_peak_3706 chr7 107690790 107691873 100.66 Cyb5r2 (+66664), Ppfibp2 (+84488) MACS_peak_3707 chr7 107708444 107709079 124.23 Cyb5r2 (+49234), Ppfibp2 (+101918) MACS_peak_3709 chr7 110121823 110122421 68.52 Wee1 (+63) MACS_peak_3710 chr7 110539280 110539816 52.73 Sbf2 (+75372), Swap70 (+317845) MACS_peak_3711 chr7 110613971 110614575 91.11 Sbf2 (+647) MACS_peak_3712 chr7 110615102 110615624 191.58 Sbf2 (-443) MACS_peak_3714 chr7 112316266 112316690 293.61 Micalcl (-51830), Mical2 (+90642) MACS_peak_3715 chr7 112462813 112463363 151.16 Tead1 (-216232), Parva (+35382) MACS_peak_3716 chr7 112467256 112467809 57.42 Tead1 (-211787), Parva (+39827) MACS_peak_3717 chr7 112533653 112534285 119.02 Tead1 (-145351), Parva (+106263) MACS_peak_3719 chr7 112614973 112615643 80.01 Tead1 (-64012), Parva (+187602) MACS_peak_3720 chr7 112697370 112697906 67.85 Rassf10 (-256324), Tead1 (+18318) MACS_peak_3721 chr7 112731426 112732326 288.09 Rassf10 (-222086), Tead1 (+52556) MACS_peak_3724 chr7 112930587 112930954 51.9 Rassf10 (-23191), Tead1 (+251451) MACS_peak_3725 chr7 112957400 112958209 54.34 Arntl (-249660), Rassf10 (+3843) MACS_peak_3726 chr7 114012322 114012768 56.1 Rras2 (+105236), Spon1 (+246547) MACS_peak_3727 chr7 114086327 114086850 142.94 Rras2 (+31192), Spon1 (+320591) MACS_peak_3729 chr7 117380442 117381015 56.07 Xylt1 (-250) MACS_peak_3732 chr7 118541742 118542661 112.55 Coq7 (-8889), Tmc7 (+42484) MACS_peak_3733 chr7 118543475 118544167 70.85 Coq7 (-10508), Tmc7 (+40865) MACS_peak_3735 chr7 120102406 120102996 63.79 Tmem159 (+275) MACS_peak_3739 chr7 120979364 120979934 237.91 4933427G17Rik (-2860), Cdr2 (+2663) MACS_peak_3741 chr7 122066555 122067049 53.68 Ubfd1 (-396), Ears2 (+261) MACS_peak_3742 chr7 123098010 123098328 103.93 Tnrc6a (-25716), Rbbp6 (+127605) MACS_peak_3745 chr7 126503348 126503853 60.9 Atxn2l (-299) MACS_peak_3746 chr7 126625062 126626008 120.21 Nupr1 (-65) MACS_peak_3748 chr7 126799904 126800553 87.19 Aldoa (-975) MACS_peak_3749 chr7 127027145 127027839 93.01 Maz (-1013) MACS_peak_3751 chr7 127266243 127266813 56.27 Dctpp1 (-5861), Sephs2 (+7531) MACS_peak_3753 chr7 130121504 130121914 145.67 Fgfr2 (+145099), Wdr11 (+529846) MACS_peak_3756 chr7 130654251 130655017 157.43 Btbd16 (-119435), Tacc2 (+77150) MACS_peak_3757 chr7 130982231 130983061 110.35 Dmbt1 (-49430), Htra1 (+46443) MACS_peak_3759 chr7 133088932 133089361 151.1 Ctbp2 (-73900), 4930404H21Rik (+512968) MACS_peak_3761 chr7 137048024 137049013 235.28 Mgmt (+153908), Ebf3 (+265926) MACS_peak_3762 chr7 138909307 138910146 82.1 Bnip3 (-221) MACS_peak_3766 chr7 141476160 141477204 147.74 Polr2l (-1529), Tspan4 (+1442) MACS_peak_3767 chr7 141876084 141876538 95.98 Tollip (+26095), Muc5b (+37239) MACS_peak_3768 chr7 142019098 142019885 82.74 2700078K21Rik (+41542), Brsk2 (+69741) MACS_peak_3769 chr7 142021505 142022155 89.58 2700078K21Rik (+39204), Brsk2 (+72079) MACS_peak_3770 chr7 142025836 142026502 50.43 2700078K21Rik (+34865), Brsk2 (+76418) MACS_peak_3773 chr7 143015687 143017007 183.93 Cd81 (-36403), Tspan32 (+11301) MACS_peak_3774 chr7 143389163 143389901 54.54 Cdkn1c (+71518), Kcnq1 (+282278) MACS_peak_3775 chr7 143738436 143739191 70.24 Tnfrsf23 (-52942), Osbpl5 (+3149) MACS_peak_3776 chr7 143783951 143784402 85.63 Mrgpre (+323) MACS_peak_3777 chr7 145299277 145299962 84.26 Mrgprf (-1289) MACS_peak_3778 chr7 145302466 145302949 224.5 Mrgprd (-12127), Mrgprf (+1799) MACS_peak_3779 chr8 3394693 3395497 153.19 Arhgef18 (+2087), Pex11c (+72553) MACS_peak_3785 chr8 11044389 11045414 340.57 Irs2 (-36472), Col4a1 (+267924) MACS_peak_3789 chr8 12643930 12644593 86.03 Tubgcp3 (+27838), 1700094C09Rik (+71213) MACS_peak_3791 chr8 15046794 15047346 211.29 BB014433 (-1001) MACS_peak_3793 chr8 22757084 22757821 75.19 Plat (-291) MACS_peak_3794 chr8 22758258 22758856 170.85 Plat (+813) MACS_peak_3796 chr8 25098139 25098811 265.39 Htra4 (-59513), Plekha2 (+3336) MACS_peak_3798 chr8 25437121 25437844 105.24 Tacc1 (-236034), Fgfr1 (-81289) MACS_peak_3799 chr8 25440483 25441420 224.62 Tacc1 (-239503), Fgfr1 (-77820) MACS_peak_3801 chr8 25546892 25547434 67.38 Fgfr1 (+28391), Letm2 (+50324) MACS_peak_3802 chr8 25805860 25806711 179.31 Star (-2227) MACS_peak_3803 chr8 25962099 25962621 99.16 Hgsnat (+14384), Kcnu1 (+112737) MACS_peak_3804 chr8 26778877 26779748 92.53 Zfp703 (-198023), Thap1 (+621144) MACS_peak_3806 chr8 27260944 27261589 68.89 Eif4ebp1 (+940) MACS_peak_3815 chr8 33875895 33876658 107.82 Rbpms (+53564), Gtf2e2 (+144363) MACS_peak_3816 chr8 33892178 33892633 85.21 Rbpms (+37435), Gtf2e2 (+160492) MACS_peak_3817 chr8 33902505 33903316 113.48 Rbpms (+26930), Gtf2e2 (+170997) MACS_peak_3818 chr8 33905650 33906386 239.24 Rbpms (+23823), Gtf2e2 (+174104) MACS_peak_3819 chr8 33916502 33916910 70.47 Rbpms (+13135), Gtf2e2 (+184792) MACS_peak_3825 chr8 40963023 40963754 99.5 Pdgfrl (+37156), Mtus1 (+170337) MACS_peak_3826 chr8 41039484 41039907 99.09 Mtus1 (+94030), Pdgfrl (+113463) MACS_peak_3834 chr8 44959396 44960237 136.61 Mtnr1a (-109393), Fat1 (+9609) MACS_peak_3837 chr8 48126703 48127369 125.9 Dctd (+27944), Odz3 (+547654) MACS_peak_3849 chr8 54530030 54530597 54.28 Spcs3 (-316) MACS_peak_3859 chr8 61590643 61591462 73.86 Cbr4 (+103319), Palld (+311637) MACS_peak_3860 chr8 61642252 61643051 202.95 Cbr4 (+154918), Palld (+260038) MACS_peak_3861 chr8 61645185 61646137 60.52 Cbr4 (+157927), Palld (+257029) MACS_peak_3863 chr8 62284416 62285224 98.99 Spock3 (-666626), Anxa10 (-161702) MACS_peak_3868 chr8 64849962 64850559 63.3 Klhl2 (-443) MACS_peak_3871 chr8 68276350 68276959 62.39 Sh2d4a (+127) MACS_peak_3872 chr8 68279326 68280076 76.7 Sh2d4a (+3173), Csgalnact1 (+455441) MACS_peak_3873 chr8 68307517 68307895 156.99 Sh2d4a (+31178), Csgalnact1 (+427436) MACS_peak_3874 chr8 68869297 68870036 265.81 Lpl (-10888), Ints10 (+75713) MACS_peak_3875 chr8 68880170 68880836 96 Lpl (-52) MACS_peak_3876 chr8 68880860 68881786 74.89 Lpl (+768) MACS_peak_3877 chr8 68930119 68930674 57.28 Atp6v1b2 (-158339), Lpl (+49842) MACS_peak_3880 chr8 69935418 69935761 204.48 Ndufa13 (-33032), Gatad2a (+60789) MACS_peak_3881 chr8 70418811 70419241 236.07 Crtc1 (+20547), Comp (+45478) MACS_peak_3882 chr8 70439125 70439872 127.9 Crtc1 (+74) MACS_peak_3883 chr8 70593026 70593632 70.65 Isyna1 (-1152) MACS_peak_3884 chr8 70593709 70594284 104.08 Isyna1 (-484) MACS_peak_3885 chr8 70609892 70610669 156.18 Ssbp4 (-1967) MACS_peak_3886 chr8 70671342 70671995 122.15 Lsm4 (-1562) MACS_peak_3887 chr8 70682026 70682729 82.86 Jund (-15361), Lsm4 (+9147) MACS_peak_3888 chr8 70698727 70699508 134.75 Pde4c (-24946), Jund (+1379) MACS_peak_3890 chr8 70707077 70707725 138.63 Pde4c (-16663), Jund (+9662) MACS_peak_3892 chr8 70754499 70754954 74.89 Rab3a (+48) MACS_peak_3895 chr8 71569787 71570633 99.64 Nxnl1 (-3561), Slc27a1 (+1283) MACS_peak_3899 chr8 72571220 72571652 57.21 Tmem38a (-667), 9130011J15Rik (-388) MACS_peak_3901 chr8 73177984 73178862 116.54 Large (+174133), F2rl3 (+416543) MACS_peak_3903 chr8 75062934 75063738 174.68 Hmox1 (-30282), Tom1 (+29650) MACS_peak_3904 chr8 75089138 75089753 136.91 Hmox1 (-4172) MACS_peak_3909 chr8 77517269 77517788 50.87 Arhgap10 (+378) MACS_peak_3913 chr8 83079037 83079627 152.3 Tbc1d9 (-86020), Rnf150 (+215976) MACS_peak_3915 chr8 83666183 83666611 59.12 Ptger1 (-243) MACS_peak_3918 chr8 84071496 84072196 165.36 Rfx1 (+5010), Dcaf15 (+32916) MACS_peak_3920 chr8 84236985 84237731 83.34 Zswim4 (-316) MACS_peak_3922 chr8 85324884 85325431 107.05 Orc6 (+25526), Mylk3 (+40166) MACS_peak_3925 chr8 87198133 87198627 182.49 N4bp1 (-313122), Cbln1 (+274212) MACS_peak_3927 chr8 87913846 87914848 184.45 Zfp423 (+45248), 4933402J07Rik (+350440) MACS_peak_3928 chr8 87933382 87934466 273.03 Zfp423 (+25671), 4933402J07Rik (+370017) MACS_peak_3929 chr8 87938350 87939382 257.28 Zfp423 (+20729), 4933402J07Rik (+374959) MACS_peak_3931 chr8 88118302 88119591 121.66 Tmem188 (+188) MACS_peak_3933 chr8 89043135 89043709 64.95 Sall1 (+740) MACS_peak_3938 chr8 90876867 90877502 52.2 Rbl2 (-192909), Chd9 (+48350) MACS_peak_3939 chr8 90907933 90909023 206.5 Rbl2 (-161616), Chd9 (+79643) MACS_peak_3941 chr8 91558434 91559166 161.42 Irx3 (+242574), Fto (+245275) MACS_peak_3942 chr8 92846479 92847072 63.62 Lpcat2 (-8574), Mmp2 (+19448) MACS_peak_3943 chr8 92847140 92847974 113.2 Lpcat2 (-7793), Mmp2 (+20229) MACS_peak_3944 chr8 94822777 94823365 62.57 Ccl17 (+12618), Ciapin1 (+15269) MACS_peak_3960 chr8 103288457 103289001 73.8 Cdh5 (-812896), Cdh11 (-503618) MACS_peak_3961 chr8 103408977 103409753 145.68 Cdh5 (-692260), Cdh11 (-624254) MACS_peak_3963 chr8 103880484 103881299 111.63 Cdh5 (-220733) MACS_peak_3964 chr8 104007219 104007779 75.42 Cdh5 (-94126) MACS_peak_3965 chr8 105460589 105461186 156.22 Tppp3 (+10534), Lrrc36 (+47266) MACS_peak_3967 chr8 105594796 105595179 92.6 Agrp (-26690), Fam65a (-10241) MACS_peak_3968 chr8 105606274 105606895 79.95 Ctcf (-29953), Fam65a (+1356) MACS_peak_3972 chr8 108859997 108860584 92.68 Pmfbp1 (-633736), Zfhx3 (+145647) MACS_peak_3973 chr8 109105539 109106176 83.9 Pmfbp1 (-388169), Zfhx3 (+391214) MACS_peak_3974 chr8 109565550 109565936 177.91 Txnl4b (-243), Dhx38 (-142) MACS_peak_3977 chr8 111360503 111361540 350.77 Mlkl (-23119), Fa2h (+32799) MACS_peak_3978 chr8 111363461 111363886 61.73 Mlkl (-25771), Fa2h (+30147) MACS_peak_3979 chr8 111716386 111717172 68.28 Ctrb1 (-25769), Bcar1 (+27070) MACS_peak_3980 chr8 111729670 111730129 89.18 Ctrb1 (-38890), Bcar1 (+13949) MACS_peak_3983 chr8 114098672 114099214 89.18 Adamts18 (-250104), Nudt7 (-34636) MACS_peak_3985 chr8 114671200 114671707 58.41 Wwox (+231802) MACS_peak_3986 chr8 115038348 115038992 58.95 Wwox (+599018), Maf (+668224) MACS_peak_3987 chr8 119674246 119674614 177.91 Atp2c2 (-25579), Wfdc1 (+8065) MACS_peak_3988 chr8 119824768 119825321 66.53 4632415K11Rik (-46629), Cotl1 (+15534) MACS_peak_3989 chr8 120017274 120017717 180.56 Crispld2 (+25026), Zdhhc7 (+83976) MACS_peak_3990 chr8 120151308 120151757 107.6 Fam92b (+25936), 6430548M08Rik (+37381) MACS_peak_3991 chr8 120334962 120335565 54.14 Fam92b (-157795), Gse1 (-153602) MACS_peak_3992 chr8 120335604 120336277 66.95 Fam92b (-158472), Gse1 (-152925) MACS_peak_3993 chr8 120368891 120369289 126.27 Fam92b (-191621), Gse1 (-119776) MACS_peak_3994 chr8 120382289 120382864 104.08 Fam92b (-205108), Gse1 (-106289) MACS_peak_3995 chr8 120504925 120505350 59.39 Gse1 (+16272), Gins2 (+83937) MACS_peak_3996 chr8 121125477 121126001 60.48 Foxl1 (-1946) MACS_peak_3997 chr8 121127231 121128004 64.97 Foxl1 (-67) MACS_peak_3999 chr8 121241704 121242546 322.51 Foxl1 (+114440), 1700018B08Rik (+299829) MACS_peak_4000 chr8 121258068 121258905 286.17 Foxl1 (+130802), 1700018B08Rik (+283467) MACS_peak_4001 chr8 121280491 121281027 77.47 Foxl1 (+153074), 1700018B08Rik (+261195) MACS_peak_4002 chr8 121300808 121301412 54.08 Foxl1 (+173425), 1700018B08Rik (+240844) MACS_peak_4004 chr8 121342831 121343432 101.46 1700018B08Rik (+198822), Foxl1 (+215447) MACS_peak_4006 chr8 121397196 121397833 69.46 1700018B08Rik (+144439), Foxl1 (+269830) MACS_peak_4007 chr8 121526826 121527265 181.31 1700018B08Rik (+14908), Foxl1 (+399361) MACS_peak_4009 chr8 121921946 121922647 143.33 Slc7a5 (-14611), Car5a (+22615) MACS_peak_4010 chr8 122281221 122281830 53.77 Zfpm1 (-615) MACS_peak_4011 chr8 122661022 122661726 247.08 Pabpn1l (-38639), Cbfa2t3 (+37735) MACS_peak_4012 chr8 122665231 122666140 228.28 Pabpn1l (-42951), Cbfa2t3 (+33423) MACS_peak_4013 chr8 124643928 124644739 121.77 2310022B05Rik (+19035), Capn9 (+68223) MACS_peak_4015 chr8 125342615 125343338 184.92 Sipa1l2 (+149856), Disc1 (+288782) MACS_peak_4016 chr8 125385419 125386268 81.43 Sipa1l2 (+106989), Disc1 (+331649) MACS_peak_4018 chr8 126566342 126567056 221.22 Tarbp1 (-91634), Irf2bp2 (+26737) MACS_peak_4020 chr8 126735618 126736368 199.51 Irf2bp2 (-142557), Tomm20 (+209837) MACS_peak_4021 chr8 126805422 126805812 73.92 Irf2bp2 (-212181), Tomm20 (+140213) MACS_peak_4022 chr8 126960812 126961426 64.97 Tomm20 (-15289), Rbm34 (+9960) MACS_peak_4023 chr8 126961477 126962015 67.69 Tomm20 (-15916), Rbm34 (+9333) MACS_peak_4024 chr8 127080328 127080767 78.73 Pard3 (+16492) MACS_peak_4025 chr8 127719755 127720204 54.44 Nrp1 (-639093), Pard3 (+655924) MACS_peak_4026 chr8 127768102 127769130 117.26 Nrp1 (-590457), Pard3 (+704560) MACS_peak_4027 chr8 128608648 128609319 57.1 Itgb1 (-76670), Nrp1 (+249911) MACS_peak_4028 chr8 128803685 128804836 97.4 Itgb1 (+118607), Ccdc7 (+261231) MACS_peak_4030 chr9 5944223 5944962 85.67 Pdgfd (-224019), Casp12 (+599117) MACS_peak_4034 chr9 15525259 15525630 60.81 BC017612 (+19950), Ccdc67 (+102488) MACS_peak_4035 chr9 15746170 15746819 51.46 Slc36a4 (+36726), Mtnr1b (+128061) MACS_peak_4041 chr9 20651804 20652265 94.33 Pin1 (-95) MACS_peak_4042 chr9 20976389 20977084 108.33 S1pr2 (+56) MACS_peak_4043 chr9 21354224 21354705 54.68 Ilf3 (-13538), Slc44a2 (+16637) MACS_peak_4044 chr9 21367569 21368433 131.01 Ilf3 (-2) MACS_peak_4045 chr9 21509877 21510834 92.86 Tmed1 (-170) MACS_peak_4047 chr9 21752290 21752857 265.39 Spc24 (+7712), Ldlr (+28980) MACS_peak_4052 chr9 28177530 28177895 52.77 Spata19 (+780892) MACS_peak_4057 chr9 32646643 32647324 64.02 Fli1 (-105616), Ets1 (-49058) MACS_peak_4058 chr9 32672102 32672997 129.95 Fli1 (-131182), Ets1 (-23492) MACS_peak_4060 chr9 32718019 32718689 91.83 Ets1 (+22312) MACS_peak_4061 chr9 34682723 34683549 82.99 Kirrel3 (+194432), St3gal4 (+433674) MACS_peak_4062 chr9 34689251 34689789 67.69 Kirrel3 (+200816), St3gal4 (+427290) MACS_peak_4064 chr9 35467364 35467859 109 Cdon (+15567), Ddx25 (+90858) MACS_peak_4067 chr9 36973169 36973819 103.05 Fez1 (+129832), Pknox2 (+173820) MACS_peak_4068 chr9 37054598 37055375 278.89 Pknox2 (+92327), Fez1 (+211325) MACS_peak_4069 chr9 37144018 37144567 86.2 Pknox2 (+3021), Fez1 (+300631) MACS_peak_4071 chr9 37735736 37736678 245.72 Olfr874 (-9929), Olfr151 (-5146) MACS_peak_4077 chr9 43071538 43072241 159.95 Grik4 (-127519), Arhgef12 (+33828) MACS_peak_4079 chr9 43239804 43240257 65.12 Oaf (-215) MACS_peak_4080 chr9 43863608 43864537 200.35 Thy1 (-179311), Pvrl1 (+119497) MACS_peak_4082 chr9 44406553 44407182 88.89 Rps25 (-846), Trappc4 (+680) MACS_peak_4084 chr9 44604873 44605234 60.81 Ddx6 (+162) MACS_peak_4085 chr9 46110675 46111223 88.09 Apoa1 (-117681), Sik3 (+98129) MACS_peak_4086 chr9 48480361 48481133 52.72 Rexo2 (-136) MACS_peak_4088 chr9 48787250 48787914 141.05 Nnmt (-182505), Zbtb16 (+48363) MACS_peak_4091 chr9 50190873 50191741 58.68 Ncam1 (-392238), 1600029D21Rik (-303218) MACS_peak_4092 chr9 51239420 51240072 75.59 Pou2af1 (+26056), Gm684 (+38808) MACS_peak_4093 chr9 51312806 51313427 87.2 Gm684 (-34563), 1810046K07Rik (+15800) MACS_peak_4096 chr9 56572533 56573257 162.39 Lingo1 (+112358), Hmg20a (+154049) MACS_peak_4097 chr9 57073276 57073807 51.74 Man2c1 (-57235), Sin3a (+1502) MACS_peak_4098 chr9 57502727 57503380 81.11 Rpp25 (-1048) MACS_peak_4099 chr9 57547157 57547720 84.91 Mpi (+5313), 2310046O06Rik (+9911) MACS_peak_4101 chr9 57831281 57831935 109.61 Clk3 (-65748), Arid3b (+2624) MACS_peak_4102 chr9 58009067 58009508 391.74 Cyp11a1 (-5729), Sema7a (+69153) MACS_peak_4103 chr9 59750295 59751551 159.47 Senp8 (-274), Myo9a (-251) MACS_peak_4104 chr9 60687673 60688290 108.38 Lrrc49 (+152) MACS_peak_4105 chr9 60712741 60713208 73.76 Larp6 (-146) MACS_peak_4106 chr9 60838202 60838699 71.43 Tle3 (-533915), Uaca (+43903) MACS_peak_4108 chr9 61361049 61361691 448.44 Tle3 (-10996), Uaca (+566822) MACS_peak_4111 chr9 62435792 62436366 186.78 Anp32a (+94736), Coro2b (+100965) MACS_peak_4112 chr9 62451908 62452271 60.81 Coro2b (+84954), Anp32a (+110747) MACS_peak_4113 chr9 62455974 62456351 164.94 Coro2b (+80881), Anp32a (+114820) MACS_peak_4117 chr9 62517261 62517835 93.91 Coro2b (+19496), Anp32a (+176205) MACS_peak_4118 chr9 62531564 62532282 120.55 Coro2b (+5121), Anp32a (+190580) MACS_peak_4119 chr9 62811432 62812342 113.27 Fem1b (-239) MACS_peak_4120 chr9 63035483 63035945 54.87 Pias1 (-54835), Skor1 (+111266) MACS_peak_4121 chr9 63074528 63075216 72.77 Pias1 (-93993), Skor1 (+72108) MACS_peak_4122 chr9 63091819 63092426 117.46 Pias1 (-111244), Skor1 (+54857) MACS_peak_4124 chr9 63575863 63576305 80.5 2300009A05Rik (-176840), Iqch (+26364) MACS_peak_4127 chr9 63677430 63678071 78.36 Aagab (+75096), Smad3 (+80243) MACS_peak_4128 chr9 63696356 63697040 75.12 Smad3 (+61296), Aagab (+94043) MACS_peak_4129 chr9 63757813 63758579 183.48 Smad3 (-202) MACS_peak_4131 chr9 63965518 63966200 118.28 Smad3 (-207865), Smad6 (+56200) MACS_peak_4132 chr9 63980342 63980873 116.49 Smad3 (-222614), Smad6 (+41451) MACS_peak_4133 chr9 64116806 64117291 103.27 Lctl (-98) MACS_peak_4134 chr9 64232327 64233035 131.93 Uchl4 (-2520) MACS_peak_4136 chr9 66733315 66733736 172.95 Car12 (+19840), Aph1c (+101180) MACS_peak_4138 chr9 70111838 70112566 243.11 Gcnt3 (-74114), Fam81a (+29355) MACS_peak_4139 chr9 70131903 70132671 138.83 Gcnt3 (-94199), Fam81a (+9270) MACS_peak_4140 chr9 70221663 70222329 79.92 Myo1e (+14646), Ccnb2 (+199558) MACS_peak_4141 chr9 70322489 70323280 233.3 Ccnb2 (+98669), Myo1e (+115535) MACS_peak_4142 chr9 70325805 70326639 191.66 Ccnb2 (+95332), Myo1e (+118872) MACS_peak_4144 chr9 70848239 70848767 59.19 Lipc (+86305), Adam10 (+169502) MACS_peak_4145 chr9 70862848 70863553 121.85 Lipc (+71607), Adam10 (+184200) MACS_peak_4146 chr9 71578981 71579647 50.43 Grinl1a (-93331), Gcom1 (+13046) MACS_peak_4147 chr9 71592123 71592616 57.99 Gcom1 (-10) MACS_peak_4149 chr9 71674470 71674868 89.18 Gcom1 (-82309), Cgnl1 (+96933) MACS_peak_4150 chr9 71752889 71753829 124.31 Gcom1 (-160999), Cgnl1 (+18243) MACS_peak_4151 chr9 72132813 72133301 185.04 Zfp280d (-141842), Tcf12 (-21238) MACS_peak_4152 chr9 72639982 72640724 138.81 Nedd4 (-21994), Rfx7 (+108113) MACS_peak_4154 chr9 75523541 75524084 68.38 Tmod3 (+35844), Leo1 (+82289) MACS_peak_4156 chr9 77529709 77530451 64.97 2310046A06Rik (-182210), Lrrc1 (+14772) MACS_peak_4157 chr9 77544661 77545245 79.36 Lrrc1 (-101) MACS_peak_4158 chr9 77909932 77910884 138.56 Elovl5 (-6957), Gclc (+155598) MACS_peak_4159 chr9 77970822 77971281 140.89 Gcm1 (-80906), Elovl5 (+53687) MACS_peak_4163 chr9 80012657 80013201 71.14 Senp6 (-53974), Filip1 (-35047) MACS_peak_4164 chr9 80172575 80173444 60.78 Myo6 (+7976), Impg1 (+338228) MACS_peak_4165 chr9 80173497 80174126 140.32 Myo6 (+8778), Impg1 (+337426) MACS_peak_4173 chr9 83440877 83441543 74.48 Lca5 (-111) MACS_peak_4178 chr9 89770732 89771506 64.97 Rasgrf1 (-138656), Ankrd34c (-32644) MACS_peak_4179 chr9 90270728 90271061 71.01 Tbc1d2b (-126) MACS_peak_4182 chr9 92569983 92570878 109.96 Plod2 (+28208) MACS_peak_4186 chr9 94538048 94538681 68.49 1190002N15Rik (-284) MACS_peak_4187 chr9 96195979 96196382 113.71 Tfdp2 (-94) MACS_peak_4188 chr9 96536727 96537447 78.78 Rnf7 (-58492), Rasa2 (+94416) MACS_peak_4190 chr9 96977795 96978713 162.03 Acpl2 (-88832), Spsb4 (+40101) MACS_peak_4192 chr9 99242983 99243613 60.39 Cep70 (-170) MACS_peak_4193 chr9 100642702 100643552 138.12 Stag1 (-496) MACS_peak_4195 chr9 101592582 101593116 93.93 Ppp2r3a (-341017), Ephb1 (+761844) MACS_peak_4196 chr9 102267029 102267602 56.07 Ephb1 (+87377) MACS_peak_4198 chr9 102717248 102717917 441.03 Amotl2 (-221) MACS_peak_4199 chr9 102726147 102726840 72.39 Ryk (-108426), Amotl2 (+8690) MACS_peak_4200 chr9 103370490 103371041 96.16 Cdv3 (-4986) MACS_peak_4201 chr9 103376601 103377215 71.15 Cdv3 (-11128), Bfsp2 (+103420) MACS_peak_4205 chr9 104101455 104102102 177.81 Uba5 (-38658), Ccrl1 (+24864) MACS_peak_4206 chr9 107456577 107457261 169.9 Tmem115 (-77026), Cacna2d2 (+57039) MACS_peak_4207 chr9 107699120 107699970 90.22 Gnat1 (-19953), Sema3f (+10930) MACS_peak_4208 chr9 107708086 107708542 55.33 Gnat1 (-28722), Sema3f (+2161) MACS_peak_4210 chr9 108559849 108560446 71.57 Impdh2 (-353) MACS_peak_4211 chr9 108569568 108569938 59.7 Ndufaf3 (-2411), Dalrd3 (-139) MACS_peak_4213 chr9 108796314 108797241 72.58 Ip6k2 (+784) MACS_peak_4214 chr9 109096684 109097781 365.27 Plxnb1 (+1797), Fbxw21 (+64789) MACS_peak_4216 chr9 109832513 109833082 73.14 Nme6 (+4) MACS_peak_4217 chr9 110019183 110019739 75.75 Mtap4 (+87687), Dhx30 (+96121) MACS_peak_4218 chr9 110683707 110684331 199.25 Ccdc12 (+27516), Pth1r (+58591) MACS_peak_4219 chr9 110778619 110779496 261.77 Prss42 (-19127), Myl3 (+15377) MACS_peak_4221 chr9 114767288 114768208 182.86 Cmtm7 (+14081), Cmtm6 (+36545) MACS_peak_4223 chr9 116090957 116091793 122.2 Tgfbr2 (+83988), Gadl1 (+181920) MACS_peak_4226 chr9 117253274 117253818 129.2 Rbms3 (+376367) MACS_peak_4227 chr9 117461664 117462310 59.28 Rbms3 (+167926) MACS_peak_4228 chr9 118960175 118960976 70.35 Vill (-92202), Ctdspl (+34040) MACS_peak_4229 chr9 118975150 118975785 246.68 Vill (-77310), Ctdspl (+48932) MACS_peak_4230 chr9 119631796 119632288 89.18 Scn5a (-53026), Scn10a (+62315) MACS_peak_4232 chr9 121314001 121314438 61.73 Trak1 (-52738), Ulk4 (-37048) MACS_peak_4233 chr9 122805174 122806061 70.55 D9Ertd402e (+71) MACS_peak_4235 chrX 7416301 7417089 95.26 Usp27x (-40865), Ppp1r3f (+157425) MACS_peak_4236 chrX 7658179 7658887 56.23 Prickle3 (0) MACS_peak_4240 chrX 11999099 11999416 92.6 Bcor (+81295), Gm4906 (+671436) MACS_peak_4241 chrX 12761767 12762517 88.52 Med14 (-169) MACS_peak_4242 chrX 13072201 13072770 57.34 Usp9x (+988) MACS_peak_4243 chrX 18163777 18164464 84.75 Kdm6a (+1454), 4930578C19Rik (+297153) MACS_peak_4250 chrX 36904285 36904861 57.33 Nkrf (-1674) MACS_peak_4256 chrX 49553855 49555454 70.84 Olfr1320 (-128849), Arhgap36 (+84205) MACS_peak_4263 chrX 67548578 67549094 111.45 4933436I01Rik (+372614), Slitrk2 (+899518) MACS_peak_4272 chrX 77050852 77051421 160.1 Tbl1x (-460090), 4930468A15Rik (-448213) MACS_peak_4274 chrX 77734219 77734787 71.14 Prkx (+61457), Tbl1x (+223276) MACS_peak_4285 chrX 95444647 95445346 74.04 Fam123b (-157) MACS_peak_4288 chrX 99172043 99172838 197.21 Efnb1 (+36311), Pja1 (+298294) MACS_peak_4290 chrX 99294487 99295249 126.41 Efnb1 (+158738), Pja1 (+175867) MACS_peak_4291 chrX 99316377 99317245 147.4 Pja1 (+153924), Efnb1 (+180681) MACS_peak_4292 chrX 99326162 99326535 62.71 Pja1 (+144386), Efnb1 (+190219) MACS_peak_4294 chrX 99389896 99390485 63.86 Pja1 (+80544), Efnb1 (+254061) MACS_peak_4295 chrX 99391343 99391990 117.44 Pja1 (+79068), Efnb1 (+255537) MACS_peak_4296 chrX 99463905 99464423 59.92 Pja1 (+6571), Efnb1 (+328034) MACS_peak_4316 chrX 139684600 139685120 58.34 Tbc1d8b (-136) MACS_peak_4318 chrX 141475621 141476383 81.13 Col4a6 (-1926), Col4a5 (+583) MACS_peak_4318 chrX 141475621 141476383 81.13 Col4a6 (-1926), Col4a5 (+583) MACS_peak_4319 chrX 142516227 142517010 155.51 Tmem164 (-164781), Acsl4 (-126084) MACS_peak_4327 chrX 159254493 159255215 81.43 Rps6ka3 (-1266) MACS_peak_4329 chrX 160502048 160502769 100.36 Phka2 (+243) MACS_peak_4330 chrX 160516164 160516846 84.5 Phka2 (+14339), Ppef1 (+203467) MACS_peak_4331 chrX 160598392 160599553 296.79 Phka2 (+96807), Ppef1 (+120999) MACS_peak_4335 chrY 1718576 1719929 92.12 Usp9y (-178976), Zfy2 (+451156) Excel 2: Differentially expressed gene list upon microarray analysis of wild type and mutant glomeruli AffyID ACC SYMBOL DESCRIPTION Log2 fold changesAverage intensityt statistics P.Value log-Odd 7020802 NM_133211 Tlr7 toll-like receptor 7 -1.896905 8.1272775 -9.119044 0.0001498 6.16613739 7007282 NM_207648 H2-Q6 histocompatibility 2, Q region locus 6 -1.344017 10.684667 -6.34169 0.0019588 2.46877248 6899966 NM_178594 Vtcn1 V-set domain containing T cell activation inhibitor-1.320487 1 8.2879983 -12.32111 1.86E-05 9.37585851 6944734 NM_080847 Asb15 ankyrin repeat and SOCS box-containing 15-1.315487 8.87354 -16.71152 2.01E-06 12.5511546 6785251 NM_172948 Mgat5b mannoside acetylglucosaminyltransferase 5,-1.268892 isoenzyme5.9706708 B -10.65398 5.10E-05 7.82256279 6771207 NM_011915 Wif1 Wnt inhibitory factor 1 -1.265563 6.9751 -6.950418 0.0010869 3.36693784 6771586 NM_080436 Rdh1 retinol dehydrogenase 1 (all trans) -1.242297 7.9503533 -11.32703 3.08E-05 8.47775731 6892190 NM_001159376 Dusp15 dual specificity phosphatase-like 15 -1.19336 7.0918133 -8.282107 0.000295 5.15542396 6977108 NM_133358 Zfp617 zinc finger protein 617 -1.094905 4.2393708 -4.398091 0.0173711 -0.7511104 6792122 NM_147220 Abca9 ATP-binding cassette, sub-family A (ABC1),-1.090067 member 9 7.59821 -11.36933 3.08E-05 8.51761698 4751288 NA NA NA -1.04611 7.59821 -3.799147 0.0361194 -1.8356463 6836767 NM_028404 Top1mt DNA topoisomerase 1, mitochondrial -1.021728 7.59821 -6.953587 0.0010869 3.37147675 6771587 NM_153133 Rdh9 retinol dehydrogenase 9 -1.019272 7.59821 -9.087242 0.0001544 6.12920724 6962742 NM_153591 Nars2 asparaginyl-tRNA synthetase 2 (mitochondrial)(putative)-1.00835 7.59821 -12.79825 1.61E-05 9.77987109 6922382 NM_207109 Astn2 astrotactin 2 -1.005118 7.59821 -12.46115 1.86E-05 9.49617025 6839863 NM_013805 Cldn5 claudin 5 -1.000918 7.59821 -6.805308 0.0012318 3.15760313 6880513 NM_019454 Dll4 delta-like 4 (Drosophila) -0.984535 7.59821 -8.886683 0.000183 5.89368575 5222292 NA NA NA -0.969457 7.59821 -6.489787 0.001686 2.69215327 6785558 NM_144797 Metrnl meteorin, glial cell differentiation regulator-like-0.965965 7.59821 -12.47044 1.86E-05 9.50409842 6892307 NM_007891 E2f1 E2F transcription factor 1 -0.965483 7.59821 -8.781674 0.0002008 5.76854175 6976002 NR_027759 Dctd dCMP deaminase -0.962198 7.59821 -9.139659 0.0001481 6.19001744 6885671 NM_133501 Ntng2 netrin G2 -0.934858 7.59821 -10.61753 5.18E-05 7.78591981 6875723 NM_027085 Clic3 chloride intracellular channel 3 -0.933592 7.59821 -8.067412 0.0003601 4.88262271 6998327 NM_173447 Ephb1 Eph receptor B1 -0.932352 7.59821 -5.606906 0.0043327 1.31350502 5163090 NA NA NA -0.920825 7.59821 -3.93374 0.0305799 -1.5894683 6980694 BC139040 BB014433 expressed sequence BB014433 -0.911492 7.59821 -5.081153 0.0078631 0.43934909 6892699 NM_010658 Mafb v-maf musculoaponeurotic fibrosarcoma oncogene-0.900025 family,7.59821 protein B (avian)-7.019 0.0010111 3.46485067 6787947 NM_172793 Btnl9 butyrophilin-like 9 -0.898003 7.59821 -6.355865 0.0019403 2.4902904 6835004 NM_025712 Snx31 sorting nexin 31 -0.897563 7.59821 -7.780501 0.0004681 4.50899631 6768868 NM_011820 Ggt5 gamma-glutamyltransferase 5 -0.89537 7.59821 -9.269509 0.0001384 6.33934829 6987685 NM_177906 Opcml opioid binding protein/cell adhesion molecule-like-0.893905 7.59821 -8.710697 0.0002148 5.68323357 5060047 NA NA NA -0.892858 7.59821 -4.832334 0.010402 0.01244445 6810333 NM_023612 Esm1 endothelial cell-specific molecule 1 -0.889735 7.59821 -7.858467 0.0004408 4.61156846 6836341 NM_001029841 Sla src-like adaptor -0.888612 7.59821 -6.214289 0.0022079 2.27407565 6884446 NM_181848 Optn optineurin -0.881577 7.59821 -12.27838 1.86E-05 9.3388543 6758001 NM_010678 Aff3 AF4/FMR2 family, member 3 -0.870288 7.59821 -7.590217 0.0005641 4.2553432 6773655 NM_007548 Prdm1 PR domain containing 1, with ZNF domain -0.86513 7.59821 -11.27421 3.08E-05 8.4277728 6838995 NM_008762 Olfr15 olfactory receptor 15 -0.859858 7.59821 -3.688989 0.0418593 -2.0378757 4915584 NA NA NA -0.857297 7.59821 -6.331049 0.001981 2.45260125 6850055 NM_134116 Gpsm3 G-protein signalling modulator 3 (AGS3-like,-0.85546 C. elegans) 7.59821 -9.310294 0.0001341 6.38587106 6965146 NM_026820 Ifitm1 interferon induced transmembrane protein -0.846121 7.59821 -5.829428 0.0033547 1.67162853 6763146 NM_028749 Npl N-acetylneuraminate pyruvate lyase -0.831448 7.59821 -8.295915 0.0002925 5.17277438 6770721 NR_033603 Gm5176 predicted gene 5176 -0.822763 7.59821 -6.44874 0.0017649 2.63055593 6910592 NM_133871 Ifi44 interferon-induced protein 44 -0.806513 7.59821 -5.216286 0.0067477 0.66771984 6791765 NM_008740 Nsf N-ethylmaleimide sensitive fusion protein -0.796118 7.59821 -13.78123 8.47E-06 10.5619259 6821514 NM_022886 Scel sciellin -0.776362 7.59821 -5.036855 0.0082559 0.36394723 6973555 NM_146389 Olfr1350 olfactory receptor 1350 -0.753275 7.59821 -4.169949 0.0229031 -1.1605869 6917789 NM_009924 Cnr2 cannabinoid receptor 2 (macrophage) -0.746905 7.59821 -7.087215 0.0009437 3.56159099 6959586 NM_019459 Nphs1 nephrosis 1 homolog, nephrin (human) -0.737202 7.59821 -8.438784 0.0002667 5.35092794 6978784 NM_172759 Ces5 carboxylesterase 5 -0.735885 7.59821 -5.057949 0.0080592 0.39988619 4703012 NA NA NA -0.733045 7.59821 -3.79075 0.0364976 -1.851041 6849317 NM_001012402 Hs3st6 heparan sulfate (glucosamine) 3-O-sulfotransferase-0.730812 6 7.59821 -6.067921 0.0026225 2.04749082 6876238 NM_011923 Angptl2 angiopoietin-like 2 -0.730742 7.59821 -8.079709 0.0003585 4.89840292 6814206 NM_172053 Adamts16 a disintegrin-like and metallopeptidase (reprolysin-0.729293 type) with7.59821 thrombospondin-7.908777 type0.000418 1 motif, 4.6773409516 6787940 NM_146337 Olfr1396 olfactory receptor 1396 -0.724392 7.59821 -6.91367 0.0011049 3.31420416 6985363 NM_178086 Fa2h fatty acid 2-hydroxylase -0.716007 7.59821 -7.73954 0.0004751 4.45479412 6929018 NM_001170746 Magi2 membrane associated guanylate kinase, WW-0.713182 and PDZ domain7.59821 containing-11.27735 2 3.08E-05 8.43075106 6986234 ENSMUST00000054120Gm9909 predicted gene 9909 -0.711605 7.59821 -5.071838 0.0079439 0.42351585 6791049 NM_130858 Nxph3 neurexophilin 3 -0.706058 7.59821 -8.29295 0.0002925 5.16905049 6832321 NM_146061 Prr5 proline rich 5 (renal) -0.702995 7.59821 -11.06932 3.62E-05 8.23160662 6998879 NM_011199 Pth1r parathyroid hormone 1 receptor -0.701173 7.59821 -7.145683 0.0008815 3.64399743 6849762 NM_021332 Glp1r glucagon-like peptide 1 receptor -0.700343 7.59821 -4.383215 0.0175998 -0.7776495 6757975 NM_173870 Mgat4a mannoside acetylglucosaminyltransferase 4,-0.695687 isoenzyme A7.59821 -6.882754 0.0011322 3.26969433 5458586 NA NA NA -0.687992 7.59821 -4.185808 0.0225282 -1.1319601 6976498 NM_175089 Nek1 NIMA (never in mitosis gene a)-related expressed-0.684018 kinase 17.59821 -6.910461 0.0011049 3.30959117 6849481 NM_080553 Itpr3 inositol 1,4,5-triphosphate receptor 3 -0.674238 7.59821 -10.16666 7.06E-05 7.32227703 6876210 NM_016973 St6galnac6 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide-0.673912 7.59821 -8.776961 0.0002008 alpha-2,6-sialyltransferase5.76289587 6 4669349 NA NA NA -0.665445 7.59821 -3.640472 0.0441583 -2.1271101 6774384 NM_197996 Tspan15 tetraspanin 15 -0.66398 7.59821 -7.321399 0.000739 3.88883882 6850056 NM_017463 Pbx2 pre B-cell leukemia transcription factor 2 -0.6628 7.59821 -10.51124 5.49E-05 7.6783522 6772723 NM_011545 Tcf21 transcription factor 21 -0.662202 7.59821 -7.455475 0.0006456 4.07284482 6832146 NM_145473 Csdc2 cold shock domain containing C2, RNA binding-0.66085 7.59821 -6.652098 0.0014142 2.93336046 6753700 NM_020025 B3galt2 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase,-0.659567 polypeptide7.59821 2 -4.915775 0.0094999 0.15651264 4462384 NA NA NA -0.657018 7.59821 -4.943623 0.0092021 0.20439319 6934348 BC053444 Fam101a family with sequence similarity 101, member-0.655692 A 7.59821 -6.490116 0.001686 2.69264548 6752848 NM_145128 Mgat5 mannoside acetylglucosaminyltransferase 5 -0.65223 7.59821 -7.178383 0.0008538 3.68988104 6802505 NM_022414 Ngb neuroglobin -0.650932 7.59821 -5.582911 0.0044456 1.27446119 6946348 NM_030024 Prr15 proline rich 15 -0.645645 7.59821 -5.264073 0.0064077 0.74787545 4567624 NA NA NA -0.643412 7.59821 -5.83557 0.003351 1.68141219 6877895 NM_172856 Lass6 LAG1 homolog, ceramide synthase 6 -0.643102 7.59821 -15.75788 3.31E-06 11.9541974 4364724 NA NA NA -0.633918 7.59821 -4.096002 0.0251701 -1.2943621 6760847 NM_009183 St8sia4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase-0.631533 7.59821 4 -4.382336 0.0175998 -0.7792189 6855659 NM_001025250 Vegfa vascular endothelial growth factor A -0.6255 7.59821 -9.05469 0.0001593 6.09128881 6906821 NM_010107 Efna1 ephrin A1 -0.624158 7.59821 -6.561094 0.0015784 2.79858435 6816160 NM_010370 Gzma granzyme A -0.61826 7.59821 -4.434255 0.0166378 -0.6866915 6839744 NM_175178 Aifm3 apoptosis-inducing factor, mitochondrion-associated-0.61734 3 7.59821 -6.373123 0.001909 2.51644786 6864456 NM_053078 D0H4S114 DNA segment, human D4S114 -0.616928 7.59821 -5.696589 0.003912 1.45870011 6987924 NM_177379 Arhgap32 Rho GTPase activating protein 32 -0.616767 7.59821 -8.678681 0.0002166 5.6445611 6796305 NM_019579 Mpp5 membrane protein, palmitoylated 5 (MAGUK-0.614148 p55 subfamily7.59821 member-6.38781 5) 0.0018856 2.53867542 6916023 NM_080555 Ppap2b phosphatidic acid phosphatase type 2B -0.61352 7.59821 -9.538404 0.0001172 6.64275843 6876279 ENSMUST00000065087C130021I20Rik Riken cDNA C130021I20 gene -0.606417 7.59821 -8.321332 0.0002895 5.20465012 6782305 NM_207224 Olfr384 olfactory receptor 384 -0.605308 7.59821 -5.00252 0.0085554 0.30532155 6978794 NM_197999 2210023G05Rik RIKEN cDNA 2210023G05 gene -0.605133 7.59821 -5.374416 0.0057092 0.9317434 6996638 BC025646 Fam81a family with sequence similarity 81, member-0.60403 A 7.59821 -8.09075 0.0003562 4.91255467 6799173 NM_144551 Trib2 tribbles homolog 2 (Drosophila) -0.598502 7.59821 -10.44898 5.72E-05 7.6148585 6761692 NM_001085409 Steap3 STEAP family member 3 -0.592923 7.59821 -8.921663 0.0001767 5.93509202 6954385 NM_007836 Gadd45a growth arrest and DNA-damage-inducible 45-0.583647 alpha 7.59821 -7.287217 0.000758 3.84153932 7011124 NM_133729 2610018G03Rik RIKEN cDNA 2610018G03 gene -0.577513 7.59821 -5.481967 0.0050131 1.10930532 6984011 NM_033327 Zfp423 zinc finger protein 423 -0.572475 7.59821 -7.033401 0.0009993 3.4853278 6870979 NM_134148 Carns1 carnosine synthase 1 -0.57063 7.59821 -6.720992 0.0013403 3.03460663 6784498 NM_001038609 Mapt microtubule-associated protein tau -0.566555 7.59821 -8.316353 0.0002898 5.19841247 4895101 NA NA NA -0.56558 7.59821 -3.979518 0.0289403 -1.5060096 6978843 NM_001081241 Fam65a family with sequence similarity 65, member-0.561912 A 7.59821 -7.165366 0.0008664 3.67163324 6979575 NM_013519 Foxc2 forkhead box C2 -0.561422 7.59821 -4.632509 0.0130208 -0.3361417 6903088 NM_010423 Hey1 hairy/enhancer-of-split related with YRPW -0.559818motif 1 7.59821 -5.247699 0.0064916 0.72044662 6879140 NM_023850 Chst1 carbohydrate (keratan sulfate Gal-6) sulfotransferase-0.554882 1 7.59821 -5.158774 0.0072009 0.57083194 6915856 NM_019840 Pde4b phosphodiesterase 4B, cAMP specific -0.553918 7.59821 -5.250877 0.0064854 0.72577285 6747641 NM_172294 Sulf1 sulfatase 1 -0.552097 7.59821 -8.784746 0.0002008 5.77222145 6871499 NM_145496 Dak dihydroxyacetone kinase 2 homolog (yeast)-0.550293 7.59821 -7.567476 0.0005747 4.2247108 6854404 NM_001001183 Tmem204 transmembrane protein 204 -0.550153 7.59821 -7.373417 0.0007058 3.96051574 6881139 NM_001177646 Sirpa signal-regulatory protein alpha -0.54868 7.59821 -6.163919 0.0023375 2.19645204 5082301 NA NA NA -0.547508 7.59821 -4.009526 0.0278726 -1.4513844 7016711 NM_019680 Elf4 E74-like factor 4 (ets domain transcription -0.545865factor) 7.59821 -7.606129 0.000555 4.27673598 6847748 NM_009384 Tiam1 T-cell lymphoma invasion and metastasis 1-0.545483 7.59821 -6.351239 0.0019441 2.48327076 6880544 NM_019392 Tyro3 TYRO3 protein tyrosine kinase 3 -0.544515 7.59821 -4.178031 0.0226968 -1.1459959 6846497 NM_018784 St3gal6 ST3 beta-galactoside alpha-2,3-sialyltransferase-0.544365 6 7.59821 -9.9315 8.56E-05 7.07261822 6791529 NM_007863 Mpp3 membrane protein, palmitoylated 3 (MAGUK-0.544137 p55 subfamily7.59821 member-6.065214 3) 0.0026226 2.04327125 6840115 NM_145933 St6gal1 beta galactoside alpha 2,6 sialyltransferase-0.542362 1 7.59821 -8.93724 0.0001757 5.95348574 6825872 NM_133720 Cysltr2 cysteinyl leukotriene receptor 2 -0.540597 7.59821 -4.68691 0.012225 -0.2407535 5433074 NA NA NA -0.540592 7.59821 -3.939209 0.0304409 -1.5794896 6871283 NM_201411 Flrt1 fibronectin leucine rich transmembrane protein-0.536655 1 7.59821 -4.644055 0.0128898 -0.3158663 6770718 NM_001146707 Nap1l1 nucleosome assembly protein 1-like 1 -0.536537 7.59821 -9.428766 0.0001249 6.51998604 5388753 NA NA NA -0.534358 7.59821 -5.18198 0.0070222 0.60998054 6768572 NM_177794 Tmem26 transmembrane protein 26 -0.534255 7.59821 -6.914536 0.0011049 3.31545029 6941029 NM_008993 Pxmp2 peroxisomal membrane protein 2 -0.53019 7.59821 -4.839231 0.0103033 0.02438737 6762024 NM_009911 Cxcr4 chemokine (C-X-C motif) receptor 4 -0.528825 7.59821 -5.756867 0.0036382 1.55563642 6825553 NM_177780 Dock5 dedicator of cytokinesis 5 -0.526392 7.59821 -6.327635 0.0019865 2.44740937 6790952 NM_027984 Epn3 epsin 3 -0.522887 7.59821 -6.006501 0.0027902 1.95148396 5518182 NA NA NA -0.521947 7.59821 -3.689946 0.0418593 -2.036116 6748699 NM_030266 Inpp4a inositol polyphosphate-4-phosphatase, type-0.521313 I 7.59821 -10.56266 5.33E-05 7.73051929 6868884 NM_011416 Smarca2 SWI/SNF related, matrix associated, actin dependent-0.51887 regulator7.59821 of chromatin,-9.143635 subfamily0.0001481 a, member6.19461758 2 4921834 NA NA NA -0.518763 7.59821 -3.637036 0.0443629 -2.1334332 4528637 NA NA NA -0.51528 7.59821 -4.348274 0.0184683 -0.8400775 6983184 NM_001004062 Crtc1 CREB regulated transcription coactivator 1 -0.511712 7.59821 -7.370424 0.0007061 3.95640118 6755210 NM_013489 Cd84 CD84 antigen -0.511553 7.59821 -4.848762 0.0102299 0.04087994 6837046 NM_130859 Card10 caspase recruitment domain family, member-0.510628 10 7.59821 -5.822813 0.0033631 1.6610869 6965984 NM_028775 Cyp2s1 cytochrome P450, family 2, subfamily s, polypeptide-0.510162 1 7.59821 -3.59766 0.0465478 -2.2059215 6963550 NM_175279 Rassf10 Ras association (RalGDS/AF-6) domain family-0.506368 (N-terminal)7.59821 member 10-3.75158 0.0385656 -1.922899 6861627 NM_172833 Malt1 mucosa associated lymphoid tissue lymphoma-0.506128 translocation7.59821 gene 1 -8.36288 0.0002778 5.25658611 6865267 NM_018744 Sema6a sema domain, transmembrane domain (TM),-0.50495 and cytoplasmic7.59821 domain,-6.465903 (semaphorin)0.0017292 6A 2.6563419 6880776 NM_199241 Sema6d sema domain, transmembrane domain (TM),-0.499608 and cytoplasmic7.59821 domain,-6.090984 (semaphorin)0.0025473 6D 2.08340072 6840637 NM_001145884 Itgb5 integrin beta 5 -0.496815 7.59821 -8.404006 0.0002695 5.30778927 6802989 NM_008079 Galc galactosylceramidase -0.490945 7.59821 -8.032604 0.0003714 4.83785099 6767258 NM_001122893 Fyn Fyn proto-oncogene -0.49069 7.59821 -7.913868 0.0004175 4.68397851 6766350 NM_010511 Ifngr1 interferon gamma receptor 1 -0.486913 7.59821 -4.758218 0.0113082 -0.1162693 4699459 NA NA NA -0.484092 7.59821 -5.885146 0.0031893 1.76018001 6763941 NA NA NA -0.483337 7.59821 -4.550526 0.0145413 -0.4805556 6997040 NM_001146048 Lrrc1 leucine rich repeat containing 1 -0.4818 7.59821 -9.739658 0.0001016 6.86482836 6858871 NM_001146287 Cables1 CDK5 and Abl enzyme substrate 1 -0.478677 7.59821 -4.755926 0.0113354 -0.1202604 6762094 NM_010016 Cd55 CD55 antigen -0.47793 7.59821 -5.711186 0.0038359 1.48222248 6998907 NM_153100 Rtp3 receptor transporter protein 3 -0.474157 7.59821 -5.105964 0.007659 0.48146657 4544073 NA NA NA -0.473992 7.59821 -3.683906 0.0421774 -2.0472194 6906895 NM_008727 Npr1 natriuretic peptide receptor 1 -0.473377 7.59821 -9.134647 0.0001481 6.18421596 6856710 NM_001114098 1110012J17Rik RIKEN cDNA 1110012J17 gene -0.472397 7.59821 -7.556492 0.000581 4.20989173 6939241 NM_010612 Kdr kinase insert domain protein receptor -0.469795 7.59821 -10.48392 5.58E-05 7.65053315 6818203 NM_181529 Syt15 synaptotagmin XV -0.467813 7.59821 -5.485129 0.0049954 1.11450062 6869796 NM_183195 Marveld1 MARVEL (membrane-associating) domain containing-0.46468 1 7.59821 -4.678699 0.0123743 -0.2551291 6757035 NM_010164 Eya1 eyes absent 1 homolog (Drosophila) -0.464207 7.59821 -4.79015 0.0109134 -0.0607292 6907352 NM_001039376 Pde4dip phosphodiesterase 4D interacting protein (myomegalin)-0.464198 7.59821 -4.853342 0.0102172 0.04880169 6989861 NM_145835 Lctl lactase-like -0.463818 7.59821 -4.18174 0.022605 -1.1393001 6895838 NM_024495 Car13 carbonic anhydrase 13 -0.463133 7.59821 -6.652207 0.0014142 2.93352111 6996127 NM_145616 Lrrc49 leucine rich repeat containing 49 -0.461177 7.59821 -8.937179 0.0001757 5.95341408 6791015 NM_133667 Pdk2 pyruvate dehydrogenase kinase, isoenzyme-0.460508 2 7.59821 -6.265313 0.0021198 2.35233422 5537063 NA NA NA -0.460155 7.59821 -4.390675 0.0175233 -0.7643379 6992387 NM_172775 Plxnb1 plexin B1 -0.458947 7.59821 -6.143033 0.0023832 2.16415697 4674796 NA NA NA -0.457615 7.59821 -4.691147 0.0121891 -0.2333406 6758036 NM_170597 Creg2 cellular repressor of E1A-stimulated genes 2-0.45418 7.59821 -6.964699 0.0010783 3.38738044 6874080 NM_175199 Hspa12a heat shock protein 12A -0.453535 7.59821 -8.991835 0.0001692 6.01773585 6996213 NM_175484 Coro2b coronin, actin binding protein, 2B -0.452515 7.59821 -6.279662 0.002096 2.37427331 6869932 NM_009128 Scd2 stearoyl-Coenzyme A desaturase 2 -0.452412 7.59821 -9.431436 0.0001249 6.5229906 6755175 NM_027893 Pvrl4 poliovirus receptor-related 4 -0.450157 7.59821 -5.084265 0.0078402 0.44463694 4498429 NA NA NA -0.448995 7.59821 -3.587206 0.0470953 -2.2251733 6948111 NR_015530 9530026P05Rik RIKEN cDNA 9530026P05 gene -0.446527 7.59821 -4.225737 0.0214278 -1.0599882 6921058 NM_001136056 Cntfr ciliary neurotrophic factor receptor -0.44551 7.59821 -6.021901 0.0027559 1.97560811 6939162 NM_177561 Usp46 ubiquitin specific peptidase 46 -0.44441 7.59821 -7.477717 0.0006289 4.10313662 6933791 NM_021539 Wsb2 WD repeat and SOCS box-containing 2 -0.444237 7.59821 -5.446326 0.0052875 1.0506451 6885939 NM_010725 Lmx1b LIM homeobox transcription factor 1 beta -0.441648 7.59821 -4.729917 0.0115757 -0.1656009 6933913 NM_011535 Tbx3 T-box 3 -0.440577 7.59821 -5.444187 0.0052875 1.0471195 6813844 NM_008957 Ptch1 patched homolog 1 -0.437117 7.59821 -7.039071 0.0009993 3.49338188 6933606 BC057022 BC057022 cDNA sequence BC057022 -0.436017 7.59821 -4.641288 0.0129388 -0.3207241 6803319 NM_053155 Clmn calmin -0.435662 7.59821 -3.595126 0.0466604 -2.210587 6990922 NM_172507 Sh3bgrl2 SH3 domain binding glutamic acid-rich protein-0.43409 like 2 7.59821 -8.220593 0.0003125 5.07784495 4883821 NA NA NA -0.433837 7.59821 -4.123019 0.0243945 -1.2454301 6950674 NM_144920 Plekha5 pleckstrin homology domain containing, family-0.427533 A member7.59821 5 -8.419985 0.000268 5.32762718 6950675 BC006653 MGC7817 hypothetical protein LOC620031 -0.427435 7.59821 -5.327574 0.0059491 0.85389766 4667053 NA NA NA -0.42707 7.59821 -6.380821 0.0018917 2.52810242 6852181 NM_020578 Ehd3 EH-domain containing 3 -0.426632 7.59821 -4.516801 0.0150919 -0.5401907 6754403 NM_007495 Astn1 astrotactin 1 -0.424958 7.59821 -3.744325 0.0389162 -1.9362174 6974261 NM_008664 Myom2 myomesin 2 -0.424578 7.59821 -5.670125 0.004038 1.41597619 4431450 NA NA NA -0.422333 7.59821 -4.702419 0.0120122 -0.2136268 6876226 NM_146119 Fam129b family with sequence similarity 129, member-0.421128 B 7.59821 -5.037319 0.0082559 0.36473861 6790015 NM_013571 Ksr1 kinase suppressor of ras 1 -0.417608 7.59821 -4.465101 0.0160279 -0.6318582 4563997 NA NA NA -0.416095 7.59821 -3.990376 0.0286732 -1.4862366 6897908 NM_008772 P2ry1 purinergic receptor P2Y, G-protein coupled-0.415027 1 7.59821 -3.751109 0.0385755 -1.9237637 6894187 NM_008093 Gata5 GATA binding protein 5 -0.414982 7.59821 -4.46543 0.0160279 -0.6312748 5154591 NA NA NA -0.414362 7.59821 -5.779228 0.003531 1.59146259 6782737 NM_010927 Nos2 nitric oxide synthase 2, inducible -0.411785 7.59821 -4.888751 0.0098025 0.10995148 6766353 NM_172786 Il20ra interleukin 20 receptor, alpha -0.41132 7.59821 -6.893069 0.001119 3.28455991 6946912 NM_009858 Cd8b1 CD8 antigen, beta chain 1 -0.410508 7.59821 -3.900206 0.0317972 -1.6506969 6913001 NM_177195 4930417M19Rik RIKEN cDNA 4930417M19 gene -0.407442 7.59821 -7.585774 0.0005652 4.24936377 6839836 NM_033474 Arvcf armadillo repeat gene deleted in velo-cardio-facial-0.405138 syndrome7.59821 -4.510898 0.0151917 -0.5506411 6852235 NM_207246 Rasgrp3 RAS, guanyl releasing protein 3 -0.40462 7.59821 -6.777945 0.0012737 3.11779662 6833471 NM_010466 Hoxc8 homeobox C8 -0.404487 7.59821 -3.757192 0.038218 -1.9125989 6836366 NM_009177 St3gal1 ST3 beta-galactoside alpha-2,3-sialyltransferase-0.404447 1 7.59821 -7.75272 0.0004735 4.47225815 6947596 NM_031199 Tgfa transforming growth factor alpha -0.39879 7.59821 -6.752515 0.0013024 3.08070868 6772050 NM_177271 Samd5 sterile alpha motif domain containing 5 -0.396145 7.59821 -4.169441 0.0229031 -1.1615044 6888533 NM_146849 Olfr1157 olfactory receptor 1157 -0.395597 7.59821 -3.905675 0.0315862 -1.6407054 6810421 NM_013826 Mocs2 molybdenum cofactor synthesis 2 -0.394357 7.59821 -5.260897 0.0064322 0.74255745 6980016 NM_008737 Nrp1 neuropilin 1 -0.392817 7.59821 -5.932366 0.0030142 1.83487115 6907576 NM_010763 Man1a2 mannosidase, alpha, class 1A, member 2 -0.390338 7.59821 -6.008861 0.0027856 1.95518265 6764118 NM_033509 Vangl2 vang-like 2 (van gogh, Drosophila) -0.387463 7.59821 -4.023282 0.0273998 -1.4263662 6910668 NM_011372 St6galnac3 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide-0.38451 7.59821 -4.621138 0.0132019 alpha-2,6-sialyltransferase-0.3561238 3 6840400 NM_008235 Hes1 hairy and enhancer of split 1 (Drosophila) -0.383785 7.59821 -4.098096 0.0251148 -1.290567 6941657 NM_145211 Oas1a 2'-5' oligoadenylate synthetase 1A -0.381695 7.59821 -3.553246 0.0488725 -2.2877356 6786610 NM_016888 B3gnt2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-0.37866 7.59821 2 -4.562916 0.014299 -0.4586812 6897579 NM_019483 Smad9 MAD homolog 9 (Drosophila) -0.378172 7.59821 -4.286639 0.0198574 -0.9505045 6813887 NM_009984 Ctsl cathepsin L -0.376615 7.59821 -8.076614 0.0003585 4.89443309 5450331 NA NA NA -0.375693 7.59821 -3.596841 0.0465868 -2.2074292 6909278 NM_007934 Enpep glutamyl aminopeptidase -0.375645 7.59821 -6.348193 0.0019444 2.47864732 6763062 NM_197990 1700025G04Rik RIKEN cDNA 1700025G04 gene -0.374495 7.59821 -3.60603 0.0461093 -2.190508 6966448 NM_146188 Kctd15 potassium channel tetramerisation domain-0.371228 containing 157.59821 -5.275472 0.0063153 0.76694913 6856796 NM_172964 Arhgap28 Rho GTPase activating protein 28 -0.370625 7.59821 -6.546273 0.0015918 2.77652301 6785347 NM_019959 C1qtnf1 C1q and tumor necrosis factor related protein-0.370618 1 7.59821 -4.865917 0.0100837 0.0705374 5339393 NA NA NA -0.368797 7.59821 -4.244702 0.020959 -1.025856 6970944 NM_007672 Cdr2 cerebellar degeneration-related 2 -0.367965 7.59821 -5.304542 0.0060984 0.81550747 6944019 NM_133236 Glcci1 glucocorticoid induced transcript 1 -0.367172 7.59821 -4.594709 0.0137272 -0.4026297 6921916 NM_018761 Ctnnal1 catenin (cadherin associated protein), alpha-like-0.36616 1 7.59821 -6.655604 0.0014142 2.93852891 6907351 NM_001039376 Pde4dip phosphodiesterase 4D interacting protein (myomegalin)-0.360847 7.59821 -5.405351 0.0055283 0.98298391 6874215 NM_007452 Prdx3 peroxiredoxin 3 -0.35862 7.59821 -6.222858 0.002205 2.28724529 6791995 NM_145823 Pitpnc1 phosphatidylinositol transfer protein, cytoplasmic-0.357107 1 7.59821 -7.147886 0.0008815 3.64709293 6873887 NM_008149 Gpam glycerol-3-phosphate acyltransferase, mitochondrial-0.356812 7.59821 -4.722638 0.0116787 -0.1783032 6749069 NM_010879 Nck2 non-catalytic region of tyrosine kinase adaptor-0.353893 protein 2 7.59821 -5.163287 0.0071662 0.57845197 6820050 NM_028560 Pebp4 phosphatidylethanolamine binding protein-0.353218 4 7.59821 -3.790405 0.0364976 -1.8516735 6963907 NM_145586 Tmem159 transmembrane protein 159 -0.352962 7.59821 -4.314933 0.0191849 -0.8997643 6860256 NM_022996 Ndfip1 Nedd4 family interacting protein 1 -0.351805 7.59821 -6.910485 0.0011049 3.30962516 6908886 NM_001114665 Fnbp1l formin binding protein 1-like -0.351107 7.59821 -6.010429 0.0027844 1.95763999 6792832 NM_009854 Cd7 CD7 antigen -0.349467 7.59821 -3.578735 0.04758 -2.2407763 5000573 NA NA NA -0.348803 7.59821 -3.573981 0.047725 -2.2495333 6777960 NM_008668 Nab2 Ngfi-A binding protein 2 -0.348727 7.59821 -4.663386 0.0126164 -0.2819572 6868830 NM_028785 Dock8 dedicator of cytokinesis 8 -0.348563 7.59821 -4.932043 0.0093398 0.18449587 6867646 NM_016933 Ptprcap protein tyrosine phosphatase, receptor type,-0.345792 C polypeptide-associated7.59821 -3.989257 protein 0.0286914 -1.4882737 6806673 NM_021878 Jarid2 jumonji, AT rich interactive domain 2 -0.343563 7.59821 -6.790179 0.0012551 3.13560673 6761675 NM_145506 Epb4.1l5 erythrocyte protein band 4.1-like 5 -0.342593 7.59821 -6.224922 0.002205 2.29041582 6790124 NM_177390 Myo1d myosin ID -0.342248 7.59821 -6.086804 0.0025584 2.07689702 6947672 NM_001040106 Aak1 AP2 associated kinase 1 -0.34198 7.59821 -5.174578 0.0070614 0.59750218 6879643 NM_212433 Fbxo3 F-box protein 3 -0.341248 7.59821 -6.171795 0.0023195 2.2086133 4459234 NA NA NA -0.341173 7.59821 -3.661219 0.0430893 -2.0889401 7017621 NM_027109 Dnase1l1 deoxyribonuclease 1-like 1 -0.341143 7.59821 -3.579809 0.047523 -2.2387981 6866118 NM_001001488 Atp8b1 ATPase, class I, type 8B, member 1 -0.337255 7.59821 -4.164465 0.0230296 -1.1704914 6992465 NM_153099 Prss42 protease, serine, 42 -0.333713 7.59821 -4.435257 0.0166378 -0.6849086 6983925 NM_175441 Mylk3 myosin light chain kinase 3 -0.333575 7.59821 -3.944166 0.0302703 -1.5704476 6751525 NM_008515 Lrrfip1 leucine rich repeat (in FLII) interacting protein-0.333468 1 7.59821 -5.982626 0.0028606 1.91401636 6854425 NM_011447 Sox8 SRY-box containing gene 8 -0.333007 7.59821 -3.583936 0.0472573 -2.2311967 6754274 NM_130456 Nphs2 nephrosis 2 homolog, podocin (human) -0.332568 7.59821 -4.782209 0.0109801 -0.0745295 6987312 NM_146825 Olfr39 olfactory receptor 39 -0.330293 7.59821 -3.64726 0.043795 -2.1146201 6976200 NM_009506 Vegfc vascular endothelial growth factor C -0.329835 7.59821 -4.18193 0.022605 -1.1389574 6879646 NM_001111060 Cd59a CD59a antigen -0.32956 7.59821 -4.248419 0.0208604 -1.0191696 6805158 NM_080288 Elmo1 engulfment and cell motility 1, ced-12 homolog-0.329325 (C. elegans)7.59821 -5.17962 0.0070361 0.60600308 6755845 NM_173378 Trp53bp2 transformation related protein 53 binding protein-0.328672 2 7.59821 -6.900889 0.00111 3.29581989 6957356 NM_010737 Klrb1a killer cell lectin-like receptor subfamily B member-0.328482 1A 7.59821 -5.678715 0.0039969 1.42985476 4562671 NA NA NA -0.328373 7.59821 -3.937083 0.0305126 -1.5833672 6818051 NM_030166 Galntl2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide-0.327962 N-acetylgalactosaminyltransferase-like7.59821 -3.993675 0.0285226 2 -1.4802297 6990774 NM_001039546 Myo6 myosin VI -0.325465 7.59821 -6.307587 0.0020284 2.41688642 6916220 NM_023537 Rab3b RAB3B, member RAS oncogene family -0.324792 7.59821 -3.534056 0.0499955 -2.323101 6750628 NM_007463 Speg SPEG complex locus -0.32232 7.59821 -4.135073 0.0240223 -1.2236208 6990270 AK082972 4833444G19Rik RIKEN cDNA 4833444G19 gene -0.322015 7.59821 -4.918366 0.0094804 0.16097203 6877139 NM_172409 Fmnl2 formin-like 2 -0.321652 7.59821 -6.097627 0.0025268 2.09372924 6862188 NM_145356 Zbtb7c zinc finger and BTB domain containing 7C -0.32038 7.59821 -3.936888 0.0305126 -1.5837242 6828522 NM_013584 Lifr leukemia inhibitory factor receptor -0.320055 7.59821 -4.66945 0.0124976 -0.2713303 6781885 NM_001109657 Gas7 growth arrest specific 7 -0.31863 7.59821 -5.128307 0.0074272 0.5193215 6945032 NM_176996 Smo smoothened homolog (Drosophila) -0.318537 7.59821 -3.880848 0.0325525 -1.6860756 6784305 NM_001160711 Cd300lg CD300 antigen like family member G -0.317338 7.59821 -4.601348 0.0135831 -0.3909385 6915871 NM_144906 Sgip1 SH3-domain GRB2-like (endophilin) interacting-0.317038 protein 1 7.59821 -3.824421 0.0352095 -1.789336 6825638 NM_026331 Slc25a37 solute carrier family 25, member 37 -0.315292 7.59821 -4.614531 0.0133149 -0.3677424 6784236 NM_016920 Atp6v0a1 ATPase, H+ transporting, lysosomal V0 subunit-0.314837 A1 7.59821 -7.075771 0.0009527 3.54540669 6903157 NM_053182 Pag1 phosphoprotein associated with glycosphingolipid-0.314478 microdomains7.59821 1 -4.591695 0.0137459 -0.4079383 6776667 NM_177368 Tmtc2 transmembrane and tetratricopeptide repeat-0.3137 containing 7.598212 -5.409898 0.0055074 0.99050296 6953339 NM_009787 Pdia4 protein disulfide isomerase associated 4 -0.313395 7.59821 -4.376979 0.017706 -0.7887823 6940333 NM_182841 Tmem150c transmembrane protein 150C -0.313078 7.59821 -5.221182 0.0067075 0.67594617 6943162 NM_010228 Flt1 FMS-like tyrosine kinase 1 -0.311413 7.59821 -4.549197 0.0145473 -0.4829038 6972242 NM_023764 Tollip toll interacting protein -0.31077 7.59821 -4.313498 0.0191849 -0.9023349 6911679 NM_021897 Trp53inp1 transformation related protein 53 inducible-0.309612 nuclear protein7.59821 1 -5.650301 0.004125 1.38390466 6925559 NM_028603 Zbtb8a zinc finger and BTB domain containing 8a -0.309457 7.59821 -4.208597 0.021919 -1.090864 6833599 NM_134099 Fbxo4 F-box protein 4 -0.309348 7.59821 -3.545468 0.049403 -2.3020686 6771985 NM_138667 Tab2 TGF-beta activated kinase 1/MAP3K7 binding-0.308355 protein 2 7.59821 -7.489194 0.0006216 4.11874094 6999154 NM_027294 Cmtm8 CKLF-like MARVEL transmembrane domain-0.306933 containing 8 7.59821 -4.463833 0.0160491 -0.6341095 6763090 NM_016846 Rgl1 ral guanine nucleotide dissociation stimulator,-like-0.306 1 7.59821 -3.661309 0.0430893 -2.0887755 6989815 NM_025857 Aagab alpha- and gamma-adaptin binding protein -0.30558 7.59821 -3.930222 0.0306323 -1.5958869 6918999 NM_001004156 Plekhg5 pleckstrin homology domain containing, family-0.304992 G (with RhoGef7.59821 domain)-4.236556 member0.021136 5 -1.0405126 6913269 NM_009928 Col15a1 collagen, type XV, alpha 1 -0.304902 7.59821 -3.555639 0.0486887 -2.2833271 6875722 NM_007379 Abca2 ATP-binding cassette, sub-family A (ABC1),-0.302555 member 2 7.59821 -3.879102 0.0326138 -1.6892684 6763937 NM_183355 Pbx1 pre B-cell leukemia transcription factor 1 -0.30182 7.59821 -5.54418 0.0046445 1.21126606 6768143 NM_144822 Cbara1 calcium binding atopy-related autoantigen-0.301577 1 7.59821 -5.295191 0.0061663 0.79990016 6908488 NM_001080818 Cdc14a CDC14 cell division cycle 14 homolog A (S. -0.301342cerevisiae) 7.59821 -6.26757 0.0021198 2.35578685 6927277 NM_011985 Mmp23 matrix metallopeptidase 23 -0.300937 7.59821 -3.959136 0.0297103 -1.5431498 6952766 NM_178661 Creb3l2 cAMP responsive element binding protein -0.3008473-like 2 7.59821 -4.115133 0.0245701 -1.2597062 6899654 NM_011351 Sema6c sema domain, transmembrane domain (TM),-0.296113 and cytoplasmic7.59821 domain,-4.838101 (semaphorin)0.0103117 6C 0.02243025 6808211 NM_145376 Lpcat1 lysophosphatidylcholine acyltransferase 1 -0.295808 7.59821 -5.923025 0.0030413 1.82012082 6784400 NM_138753 Hexim1 hexamethylene bis-acetamide inducible 1 -0.294858 7.59821 -4.946218 0.0091726 0.20885085 6866054 NM_001039485 Fam38b family with sequence similarity 38, member-0.294177 B 7.59821 -4.085625 0.0254956 -1.3131719 6837045 NM_008595 Mfng MFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase-0.293538 7.59821 -4.290871 0.0197412 -0.9429099 6786516 NM_173752 1110067D22Rik RIKEN cDNA 1110067D22 gene -0.289118 7.59821 -4.850735 0.0102299 0.04429338 6994954 NM_027144 Arhgef12 Rho guanine nucleotide exchange factor (GEF)-0.28859 12 7.59821 -6.034026 0.0027178 1.99457703 6848806 NM_001083882 1600012H06Rik RIKEN cDNA 1600012H06 gene -0.288202 7.59821 -4.856953 0.0101775 0.05504547 6813666 NM_027307 Golm1 golgi membrane protein 1 -0.285378 7.59821 -4.736913 0.0114945 -0.153396 6845943 NM_172506 Boc biregional cell adhesion molecule-related/down-regulated-0.285153 7.59821 by oncogenes-3.759725 (Cdon)0.0380872 binding protein-1.9079508 6883350 NM_021409 Pard6b par-6 (partitioning defective 6) homolog beta-0.282357 (C. elegans)7.59821 -4.325158 0.0190132 -0.8814473 6883722 NM_213733 Npepl1 aminopeptidase-like 1 -0.281795 7.59821 -4.172423 0.022826 -1.1561191 7012774 NM_010110 Efnb1 ephrin B1 -0.281643 7.59821 -4.190175 0.0224227 -1.1240815 6879637 NM_008505 Lmo2 LIM domain only 2 -0.279973 7.59821 -4.971214 0.0089069 0.25173188 6942751 NM_010302 Gna12 guanine nucleotide binding protein, alpha 12-0.279435 7.59821 -4.086918 0.0254737 -1.3108269 6962779 NM_011035 Pak1 p21 protein (Cdc42/Rac)-activated kinase 1 -0.27904 7.59821 -4.640643 0.0129404 -0.3218572 6789979 NM_008702 Nlk nemo like kinase -0.27874 7.59821 -5.628525 0.0042207 1.34861189 6881031 NM_207680 Bcl2l11 BCL2-like 11 (apoptosis facilitator) -0.276048 7.59821 -3.766658 0.0376762 -1.8952284 6980091 NM_133238 Cd209a CD209a antigen -0.275215 7.59821 -3.686891 0.0419715 -2.0417319 6747497 NM_133220 Sgk3 serum/glucocorticoid regulated kinase 3 -0.27482 7.59821 -3.569915 0.0479288 -2.2570251 6926928 NM_019781 Pex14 peroxisomal biogenesis factor 14 -0.274435 7.59821 -3.664592 0.0429479 -2.0827374 6782136 NM_001045959 Mink1 misshapen-like kinase 1 (zebrafish) -0.273357 7.59821 -4.116664 0.0245636 -1.2569339 6934308 NM_030241 Setd8 SET domain containing (lysine methyltransferase)-0.272148 8 7.59821 -3.603644 0.0462611 -2.1949016 6890206 NM_028104 Ppp1r14d protein phosphatase 1, regulatory (inhibitor)-0.271613 subunit 14D7.59821 -3.665945 0.0429145 -2.080249 6814151 ENSMUST00000070942A530095I07Rik RIKEN cDNA A530095I07 gene -0.26846 7.59821 -4.267628 0.0203307 -0.9846407 6847553 NM_144853 Cyyr1 cysteine and tyrosine-rich protein 1 -0.262625 7.59821 -4.842463 0.0102695 0.02998128 7011910 NM_009549 Zfp185 zinc finger protein 185 -0.262355 7.59821 -5.533274 0.0046964 1.19343218 6756238 NM_008976 Ptpn14 protein tyrosine phosphatase, non-receptor-0.26218 type 14 7.59821 -4.411252 0.0171443 -0.7276508 6927362 NM_021604 Agrn agrin -0.260595 7.59821 -3.707523 0.0408187 -2.0038106 6941681 NM_172126 Adam1a a disintegrin and metallopeptidase domain-0.259717 1a 7.59821 -4.123865 0.0243758 -1.2438992 6876211 NM_021515 Ak1 adenylate kinase 1 -0.258975 7.59821 -4.173554 0.0228065 -1.1540775 6886730 NM_182994 Arl5a ADP-ribosylation factor-like 5A -0.25501 7.59821 -5.283408 0.0062511 0.78021635 6985818 NM_028071 Cotl1 coactosin-like 1 (Dictyostelium) -0.254418 7.59821 -3.53851 0.0497206 -2.3148912 6788368 NM_178626 Cdc42se2 CDC42 small effector 2 -0.254327 7.59821 -4.576474 0.0140195 -0.4347636 5589492 NA NA NA -0.25359 7.59821 -3.558837 0.048552 -2.2774342 6807214 NM_008011 Fgfr4 fibroblast growth factor receptor 4 -0.253295 7.59821 -3.677898 0.042437 -2.0582669 6853249 NM_198958 Nox3 NADPH oxidase 3 -0.252488 7.59821 -4.5924 0.0137424 -0.4066955 6948918 NM_138677 Edem1 ER degradation enhancer, mannosidase alpha-like-0.250823 1 7.59821 -3.888793 0.0322315 -1.6715513 6996695 NM_001033208 Gcom1 GRINL1A complex locus -0.25053 7.59821 -5.23581 0.0065903 0.70050645 6781982 NM_009497 Vamp2 vesicle-associated membrane protein 2 -0.250288 7.59821 -4.527752 0.0149173 -0.5208122 6789329 NM_023517 Tnfsf13 tumor necrosis factor (ligand) superfamily,-0.249903 member 13 7.59821 -4.176941 0.022712 -1.1479628 6953721 NM_025817 1200009O22Rik RIKEN cDNA 1200009O22 gene -0.249067 7.59821 -3.914343 0.0312778 -1.6248745 6852820 NM_011104 Prkce protein kinase C, epsilon -0.248635 7.59821 -4.109324 0.0247274 -1.2702258 6931602 NM_153567 Slain2 SLAIN motif family, member 2 -0.245067 7.59821 -5.137816 0.0073489 0.53541198 6924684 NM_008593 Foxd2 forkhead box D2 -0.244677 7.59821 -3.941717 0.0303483 -1.5749136 6954565 NM_024288 Rmnd5a required for meiotic nuclear division 5 homolog-0.243245 A (S. cerevisiae)7.59821 -5.445333 0.0052875 1.04900869 6861389 NM_146087 Csnk1a1 casein kinase 1, alpha 1 -0.242483 7.59821 -5.444308 0.0052875 1.0473191 6990685 NM_010357 Gsta4 glutathione S-transferase, alpha 4 -0.242365 7.59821 -3.681104 0.0423207 -2.0523722 6928880 NM_011348 Sema3e sema domain, immunoglobulin domain (Ig),-0.241965 short basic domain,7.59821 secreted,-4.404935 (semaphorin)0.0172532 3E -0.7389092 5542718 NA NA NA -0.24108 7.59821 -4.122025 0.0244197 -1.24723 6781214 NM_134189 Galnt10 UDP-N-acetyl-alpha-D-galactosamine:polypeptide-0.240555 N-acetylgalactosaminyltransferase7.59821 -4.13588 0.0240223 10 -1.2221599 6840819 NM_177093 Lrrc58 leucine rich repeat containing 58 -0.239978 7.59821 -3.987953 0.0287161 -1.4906484 6980270 NM_010111 Efnb2 ephrin B2 -0.239683 7.59821 -4.373546 0.017768 -0.794912 7012769 NM_199018 Stard8 START domain containing 8 -0.239335 7.59821 -3.812958 0.0356387 -1.8103359 6869997 NM_001037758 Btrc beta-transducin repeat containing protein -0.237562 7.59821 -4.88842 0.0098025 0.10938107 6823302 NM_001163513 Dlg5 discs, large homolog 5 (Drosophila) -0.237428 7.59821 -3.64134 0.0441583 -2.1255137 6979313 NM_024437 Nudt7 nudix (nucleoside diphosphate linked moiety-0.23728 X)-type motif7.59821 7 -3.835188 0.0347665 -1.769618 6829591 NM_009154 Sema5a sema domain, seven thrombospondin repeats-0.236633 (type 1 and7.59821 type 1-like),-3.700679 transmembrane0.0412125 domain-2.0163883 (TM) and short cytoplasmic domain, (semaphorin) 5A 6881438 NM_019677 Plcb1 phospholipase C, beta 1 -0.236557 7.59821 -3.572463 0.0477981 -2.2523304 6944293 NM_175088 Mdfic MyoD family inhibitor domain containing -0.236457 7.59821 -4.868607 0.0100572 0.07518375 6855876 NM_001008231 Daam2 dishevelled associated activator of morphogenesis-0.233725 2 7.59821 -3.790486 0.0364976 -1.8515246 6991368 NM_178711 Plscr4 phospholipid scramblase 4 -0.23228 7.59821 -3.64904 0.0437151 -2.1113453 6966964 NM_175130 Trpm4 transient receptor potential cation channel,-0.232188 subfamily M,7.59821 member 4-4.087286 0.0254737 -1.3101611 6769887 NM_021320 Ntn4 netrin 4 -0.229822 7.59821 -3.980073 0.0289311 -1.5049984 7014222 NM_177592 Tmem164 transmembrane protein 164 -0.229725 7.59821 -4.831281 0.0104092 0.0106208 6900095 NM_177857 Dennd2c DENN/MADD domain containing 2C -0.227778 7.59821 -3.823269 0.0352169 -1.7914452 6987153 NM_172289 Slc36a4 solute carrier family 36 (proton/amino acid-0.226755 symporter), member7.59821 4 -4.426289 0.0168382 -0.7008695 6871361 NM_001161413 Slc3a2 solute carrier family 3 (activators of dibasic-0.226402 and neutral amino7.59821 acid transport),-4.31804 member0.0191421 2 -0.8941981 6881771 NM_008792 Pcsk2 proprotein convertase subtilisin/kexin type-0.222328 2 7.59821 -4.305764 0.0193854 -0.9161983 6936744 NM_015739 Gbx1 gastrulation brain homeobox 1 -0.222235 7.59821 -3.732896 0.0394896 -1.9572023 6824967 NM_015771 Lats2 large tumor suppressor 2 -0.220617 7.59821 -4.297027 0.0196231 -0.9318656 6782456 NM_008916 Inpp5k inositol polyphosphate 5-phosphatase K -0.218632 7.59821 -3.802191 0.0359637 -1.8300674 6941049 NM_009469 Ulk1 Unc-51 like kinase 1 (C. elegans) -0.21732 7.59821 -3.691881 0.0417599 -2.0325595 6783762 NM_201609 Zfp652 zinc finger protein 652 -0.216882 7.59821 -4.955274 0.0090889 0.22439641 6761964 NM_028135 Tmem163 transmembrane protein 163 -0.216512 7.59821 -4.227433 0.0213801 -1.0569331 6833600 NM_145930 AW549877 expressed sequence AW549877 -0.216422 7.59821 -3.91923 0.0310837 -1.6159515 6885070 NM_008845 Pip4k2a phosphatidylinositol-5-phosphate 4-kinase,-0.216188 type II, alpha 7.59821 -4.069235 0.0259539 -1.3429011 6971996 NM_021302 Stk32c serine/threonine kinase 32C -0.215425 7.59821 -4.475515 0.0158527 -0.6133688 6884986 NM_028757 Nebl nebulette -0.215232 7.59821 -3.606251 0.0461093 -2.1901018 6837335 NM_134095 Pppde2 PPPDE peptidase domain containing 2 -0.214997 7.59821 -4.175928 0.0227357 -1.1497906 6848479 NM_146073 Zdhhc14 zinc finger, DHHC domain containing 14 -0.21407 7.59821 -3.794169 0.0363593 -1.844772 6791472 NM_007970 Ezh1 enhancer of zeste homolog 1 (Drosophila) -0.212673 7.59821 -3.927699 0.0307115 -1.6004923 6956678 NM_177683 Vgll4 vestigial like 4 (Drosophila) -0.212362 7.59821 -4.372753 0.0177777 -0.7963281 6868070 NM_009962 Gpr44 G protein-coupled receptor 44 -0.211122 7.59821 -3.807608 0.0358468 -1.8201386 6940432 NM_172882 Wdfy3 WD repeat and FYVE domain containing 3 -0.210792 7.59821 -4.056879 0.0262147 -1.3653258 6919003 NM_033042 Tnfrsf25 tumor necrosis factor receptor superfamily,-0.210673 member 25 7.59821 -3.836069 0.0347548 -1.7680039 6750566 NM_024264 Cyp27a1 cytochrome P450, family 27, subfamily a, polypeptide-0.207023 1 7.59821 -3.570722 0.0479069 -2.2555368 7014855 NM_172783 Phka2 phosphorylase kinase alpha 2 -0.206457 7.59821 -3.988446 0.0287136 -1.4897504 6924358 NM_009949 Cpt2 carnitine palmitoyltransferase 2 -0.204988 7.59821 -3.617361 0.0453587 -2.1696483 6852750 NM_177606 Plekhh2 pleckstrin homology domain containing, family-0.202662 H (with MyTH47.59821 domain)-3.666624 member0.0428857 2 -2.0790001 6932517 NM_001009818 Sept11 septin 11 -0.201718 7.59821 -5.278039 0.0062976 0.77124085 6892230 NM_001134300 8430427H17Rik RIKEN cDNA 8430427H17 gene -0.199732 7.59821 -3.93643 0.0305126 -1.5845588 6908137 NM_029522 Gpsm2 G-protein signalling modulator 2 (AGS3-like,-0.19595 C. elegans) 7.59821 -3.936623 0.0305126 -1.5842079 6932164 NM_007784 Csn1s1 casein alpha s1 -0.193048 7.59821 -3.627369 0.0449055 -2.1512253 6843433 NM_011809 Ets2 E26 avian leukemia oncogene 2, 3' domain-0.192043 7.59821 -3.810426 0.0357144 -1.8149748 6772009 NM_175155 Sash1 SAM and SH3 domain containing 1 -0.185095 7.59821 -3.548114 0.0492064 -2.2971924 6771643 NM_133992 Pan2 PAN2 polyA specific ribonuclease subunit homolog-0.183175 (S. cerevisiae)7.59821 -4.699258 0.0120532 -0.2191537 6913619 NM_172867 Zfp462 zinc finger protein 462 -0.178113 7.59821 -3.7304 0.0395637 -1.961785 6789358 NM_153143 Kctd11 potassium channel tetramerisation domain-0.178003 containing 117.59821 -3.555611 0.0486887 -2.2833785 6844110 NM_001081154 4921513D23Rik RIKEN cDNA 4921513D23 gene -0.17538 7.59821 -3.7778 0.037097 -1.8747891 6798258 NM_177039 A530016L24Rik RIKEN cDNA A530016L24 gene -0.17233 7.59821 -3.803392 0.0359637 -1.8278655 6803863 NM_011625 Ppp1r13b protein phosphatase 1, regulatory (inhibitor)-0.17188 subunit 13B7.59821 -3.576794 0.0476583 -2.2443521 6853661 NM_021881 Qk quaking -0.169315 7.59821 -3.671285 0.0426808 -2.0704275 6926941 NM_022022 Ube4b ubiquitination factor E4B, UFD2 homolog (S. 0.14441cerevisiae) 7.59821 3.8342971 0.0348008 -1.7712485 6919596 NM_023066 Asph aspartate-beta-hydroxylase 0.1448383 7.59821 3.6254103 0.0450171 -2.1548305 6828582 NM_001162906 2410089E03Rik RIKEN cDNA 2410089E03 gene 0.1490467 7.59821 3.5391526 0.0497206 -2.3137071 6950688 NM_001005605 Aebp2 AE binding protein 2 0.14937 7.59821 3.9402607 0.0304033 -1.5775707 6890788 NM_008569 Anapc1 anaphase promoting complex subunit 1 0.1594917 7.59821 3.5749593 0.0477017 -2.2477318 6789696 NM_013761 Srr serine racemase 0.16014 7.59821 3.5396607 0.0497206 -2.3127708 6840828 NM_019827 Gsk3b glycogen synthase kinase 3 beta 0.1602883 7.59821 3.6208508 0.0451705 -2.1632232 6791543 NM_001077696 Hdac5 histone deacetylase 5 0.16069 7.59821 3.5748504 0.0477017 -2.2479324 6960836 NM_001164661 Cyfip1 cytoplasmic FMR1 interacting protein 1 0.1610883 7.59821 3.5827721 0.0473157 -2.2333405 6909648 NM_008689 Nfkb1 nuclear factor of kappa light polypeptide gene0.1619033 enhancer in7.59821 B-cells 1, 3.941659p105 0.0303483 -1.57502 5266491 NA NA NA 0.1621967 7.59821 3.5620864 0.0484012 -2.2714472 6806824 NM_172262 Kdm1b lysine (K)-specific demethylase 1B 0.1640133 7.59821 3.6233153 0.0451152 -2.1586866 6925381 NM_011986 Ncdn neurochondrin 0.16468 7.59821 3.6902132 0.0418593 -2.0356251 6876219 NM_178595 Ptrh1 peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae)0.16544 7.59821 3.707047 0.0408303 -2.0046859 6909871 NM_001040690 Rap1gds1 RAP1, GTP-GDP dissociation stimulator 1 0.1680967 7.59821 3.9302653 0.0306323 -1.5958087 6926938 NM_207682 Kif1b kinesin family member 1B 0.1700533 7.59821 3.5609605 0.0484399 -2.2735216 6769192 NM_025313 Atp5d ATP synthase, H+ transporting, mitochondrial0.1710517 F1 complex,7.59821 delta subunit3.5754691 0.0477017 -2.2467926 6973156 NM_019649 Clptm1 cleft lip and palate associated transmembrane0.17136 protein 1 7.59821 3.8496737 0.0341212 -1.7430997 6783020 NM_001035854 Ap2b1 adaptor-related protein complex 2, beta 1 subunit0.171795 7.59821 3.6822721 0.0422547 -2.0502242 6996792 NM_018889 Pigb phosphatidylinositol glycan anchor biosynthesis,0.1719233 class B 7.59821 3.9175014 0.0311607 -1.6191078 6908041 NM_145542 Ahcyl1 S-adenosylhomocysteine hydrolase-like 1 0.17243 7.59821 3.8354041 0.0347665 -1.7692216 6799064 NM_134040 Ddx1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10.1726817 7.59821 3.7123466 0.0406514 -1.9949481 6867755 NM_010235 Fosl1 fos-like antigen 1 0.1731367 7.59821 4.0674448 0.0259999 -1.3461487 6764721 NM_009794 Capn2 calpain 2 0.1732683 7.59821 3.7888293 0.0365579 -1.854562 6925592 NM_008468 Kpna6 karyopherin (importin) alpha 6 0.1733383 7.59821 4.1733304 0.0228065 -1.1544809 6873410 NM_016860 Actr1a ARP1 actin-related protein 1 homolog A, centractin0.1736533 alpha7.59821 (yeast) 3.8039889 0.0359637 -1.8267714 6819694 NM_007798 Ctsb cathepsin B 0.1753417 7.59821 3.6296622 0.0447667 -2.1470045 6917073 NM_175246 Snip1 Smad nuclear interacting protein 1 0.176155 7.59821 3.6609223 0.0430893 -2.0894867 6929714 NM_181279 Bre brain and reproductive organ-expressed protein0.1764433 7.59821 3.654342 0.0433821 -2.1015914 6778420 NM_172438 Thoc5 THO complex 5 0.17769 7.59821 4.0912389 0.0253325 -1.3029945 6798309 NM_001081170 Pacs2 phosphofurin acidic cluster sorting protein 20.177745 7.59821 3.7593967 0.0380872 -1.9085524 6960343 NM_029406 Pih1d1 PIH1 domain containing 1 0.1777833 7.59821 3.6645828 0.0429479 -2.0827537 6971272 NM_146200 Eif3c eukaryotic translation initiation factor 3, subunit0.1782483 C 7.59821 3.8619093 0.0335198 -1.7207112 6828573 NM_133227 Nup155 nucleoporin 155 0.1787567 7.59821 3.5909495 0.0468376 -2.2182792 6820534 NM_027906 1300010F03Rik RIKEN cDNA 1300010F03 gene 0.1791367 7.59821 3.7871015 0.0366285 -1.8577302 6822167 NM_175341 Mbnl2 muscleblind-like 2 0.1796133 7.59821 3.7106416 0.0407303 -1.9980809 6937066 NM_008622 Mpv17 MpV17 mitochondrial inner membrane protein0.1802283 7.59821 3.819912 0.0352557 -1.7975946 6892052 NM_024465 Abhd12 abhydrolase domain containing 12 0.1803617 7.59821 3.5800113 0.047523 -2.2384257 6956550 NM_133926 Camk1 calcium/calmodulin-dependent protein kinase0.1803717 I 7.59821 4.2809255 0.0199867 -0.96076 6869763 NM_023740 Zdhhc16 zinc finger, DHHC domain containing 16 0.1803917 7.59821 3.7873177 0.0366285 -1.8573338 6860252 NM_024179 0610009O20Rik RIKEN cDNA 0610009O20 gene 0.184465 7.59821 3.5957104 0.0466582 -2.2095115 6981108 NM_007404 Adam9 a disintegrin and metallopeptidase domain 90.18606 (meltrin gamma)7.59821 4.0662209 0.0260235 -1.3483696 6873744 NM_133216 Xpnpep1 X-prolyl aminopeptidase (aminopeptidase 0.1864133P) 1, soluble 7.59821 3.8208165 0.0352557 -1.7959378 6924824 NM_009478 Urod uroporphyrinogen decarboxylase 0.1868283 7.59821 3.6599178 0.0430941 -2.0913344 6804608 NM_145131 Pitrm1 pitrilysin metallepetidase 1 0.186845 7.59821 3.909526 0.0314487 -1.6336718 6820241 NM_011506 Sucla2 succinate-Coenzyme A ligase, ADP-forming,0.187375 beta subunit 7.59821 3.6136741 0.0456167 -2.176435 6840631 NM_175256 Heg1 HEG homolog 1 (zebrafish) 0.1890017 7.59821 3.5594629 0.0485424 -2.2762809 7017595 NM_008323 Idh3g isocitrate dehydrogenase 3 (NAD+), gamma0.1896067 7.59821 4.002544 0.0281475 -1.4640878 6885811 NM_001177648 Fnbp1 formin binding protein 1 0.18973 7.59821 3.9829349 0.028918 -1.4997858 6750351 NM_026195 Atic 5-aminoimidazole-4-carboxamide ribonucleotide0.1902617 formyltransferase/IMP7.59821 3.9811192 cyclohydrolase0.028918 -1.5030927 6934323 NM_011596 Atp6v0a2 ATPase, H+ transporting, lysosomal V0 subunit0.190375 A2 7.59821 3.8033581 0.0359637 -1.8279276 6977093 NM_146211 Glt25d1 glycosyltransferase 25 domain containing 10.1905233 7.59821 4.5463843 0.0146049 -0.4878727 6832356 NM_016843 Atxn10 ataxin 10 0.19138 7.59821 4.0779342 0.0257186 -1.3271188 6791656 NM_026551 Dcakd dephospho-CoA kinase domain containing0.1914633 7.59821 4.0353141 0.0269066 -1.4044958 6978960 NM_133957 Nfat5 nuclear factor of activated T-cells 5 0.1914733 7.59821 3.576014 0.047701 -2.2457889 6868048 NM_015735 Ddb1 damage specific DNA binding protein 1 0.191515 7.59821 3.7112682 0.0407077 -1.9969297 6849342 NM_011930 Clcn7 chloride channel 7 0.1915967 7.59821 3.7097896 0.0407362 -1.9996465 6791921 NM_023913 Ern1 endoplasmic reticulum (ER) to nucleus signalling0.1924283 1 7.59821 3.6014158 0.0463744 -2.1990051 6862258 NM_008602 Pias2 protein inhibitor of activated STAT 2 0.1925833 7.59821 3.5775566 0.047638 -2.2429474 4536393 NA NA NA 0.1926867 7.59821 3.7752284 0.0372263 -1.8795057 6836979 NM_019913 Txn2 thioredoxin 2 0.19346 7.59821 3.7275998 0.0397197 -1.9669283 6994356 NM_001102455 Aplp2 amyloid beta (A4) precursor-like protein 2 0.1941683 7.59821 4.4347436 0.0166378 -0.6858225 6995534 NM_178710 Sik2 salt inducible kinase 2 0.19429 7.59821 3.9163779 0.0311912 -1.6211592 6949073 NM_026849 Mtmr14 myotubularin related protein 14 0.1944767 7.59821 4.0810587 0.0256119 -1.3214521 6876100 NM_178760 Gpr107 G protein-coupled receptor 107 0.195315 7.59821 3.8882858 0.0322404 -1.6724792 6938710 BC009097 1110003E01Rik RIKEN cDNA 1110003E01 gene 0.1955167 7.59821 3.8178141 0.0353687 -1.801438 6934962 NM_023742 Dtx2 deltex 2 homolog (Drosophila) 0.196245 7.59821 3.6120883 0.0457246 -2.1793544 6811914 NM_001164058 Prl7a1 prolactin family 7, subfamily a, member 1 0.19638 7.59821 3.6000749 0.0464424 -2.2014742 6871194 NM_026912 Snx15 sorting nexin 15 0.1963817 7.59821 3.5369463 0.0497898 -2.3177733 6971238 NM_207239 Gtf3c1 general transcription factor III C 1 0.19655 7.59821 4.0957342 0.0251701 -1.2948469 6760777 NM_133808 Hdlbp high density lipoprotein (HDL) binding protein0.1972117 7.59821 3.7938092 0.0363608 -1.8454314 6751226 NM_133781 Cab39 calcium binding protein 39 0.1981817 7.59821 3.8316496 0.0349469 -1.7760965 6954611 NM_138592 Usp39 ubiquitin specific peptidase 39 0.1987783 7.59821 4.057643 0.0262129 -1.3639393 6819241 NM_001037938 Dhrs4 dehydrogenase/reductase (SDR family) member0.1988017 4 7.59821 3.5451896 0.049403 -2.3025816 6782134 NM_008876 Pld2 phospholipase D2 0.1990633 7.59821 4.0019976 0.0281557 -1.4650821 6777929 NM_001171582 Mars methionine-tRNA synthetase 0.199295 7.59821 3.6214493 0.0451705 -2.1621215 6897777 NM_001040396 2810407C02Rik RIKEN cDNA 2810407C02 gene 0.1993133 7.59821 4.2045833 0.0220419 -1.0980988 6979772 NM_139272 Galnt2 UDP-N-acetyl-alpha-D-galactosamine:polypeptide0.19935 N-acetylgalactosaminyltransferase7.59821 3.6884008 0.0418799 2 -2.0389567 6984999 NM_177150 Cenpt centromere protein T 0.1993667 7.59821 4.6390706 0.0129628 -0.3246174 6839956 NM_145941 Eif4g1 eukaryotic translation initiation factor 4, gamma0.1996717 1 7.59821 3.8418542 0.0344859 -1.7574125 6991718 NM_015827 Copb2 coatomer protein complex, subunit beta 2 (beta0.19973 prime) 7.59821 3.7986018 0.036133 -1.8366456 6964244 NM_011952 Mapk3 mitogen-activated protein kinase 3 0.19994 7.59821 4.3956764 0.0173998 -0.755417 6783873 NM_019877 Copz2 coatomer protein complex, subunit zeta 2 0.2003083 7.59821 3.9318624 0.0306005 -1.592894 6769747 NM_026166 Ikbip IKBKB interacting protein 0.2011333 7.59821 4.4564596 0.0161704 -0.6472093 6751304 NM_001172157 Dis3l2 DIS3 mitotic control homolog (S. cerevisiae)-like0.2016033 2 7.59821 4.3307133 0.0189383 -0.8715005 6779288 NM_145425 AV249152 expressed sequence AV249152 0.2019917 7.59821 3.6208295 0.0451705 -2.1632625 6942176 NM_133900 Psph phosphoserine phosphatase 0.202765 7.59821 4.1839613 0.0225852 -1.135292 6992022 NM_176979 Topbp1 topoisomerase (DNA) II binding protein 1 0.202775 7.59821 3.6237193 0.0451069 -2.1579431 6825137 NM_170591 Nupl1 nucleoporin like 1 0.2033667 7.59821 3.7096719 0.0407362 -1.9998627 6993739 NM_018793 Tyk2 tyrosine kinase 2 0.2038517 7.59821 4.1215884 0.0244205 -1.2480202 6949264 NM_026585 D6Wsu116e DNA segment, Chr 6, Wayne State University0.2041717 116, expressed7.59821 4.5443546 0.0146232 -0.491459 6885506 NM_011512 Surf4 surfeit gene 4 0.2044133 7.59821 4.387362 0.0175897 -0.7702495 6762019 NM_177445 Dars aspartyl-tRNA synthetase 0.2045667 7.59821 3.7193771 0.0402027 -1.9820321 6854562 NM_026836 Taf11 TAF11 RNA polymerase II, TATA box binding0.2050117 protein (TBP)-associated7.59821 4.5121456 factor 0.0151727 -0.5484323 6966181 NM_021895 Actn4 actinin alpha 4 0.2052067 7.59821 4.8548891 0.0102018 0.05147679 6870010 NM_172639 Dpcd deleted in primary ciliary dyskinesia 0.2052083 7.59821 3.9577903 0.029733 -1.5456026 6876014 NM_001039087 Rapgef1 Rap guanine nucleotide exchange factor (GEF)0.2052267 1 7.59821 3.6168762 0.0453739 -2.17054 6849044 NM_016891 Ppp2r1a protein phosphatase 2 (formerly 2A), regulatory0.2057217 subunit A7.59821 (PR 65), 4.1033223alpha isoform0.0248986 -1.2810975 6803321 NM_001042699 4831426I19Rik RIKEN cDNA 4831426I19 gene 0.2063583 7.59821 4.1692511 0.0229031 -1.1618469 5581317 NA NA NA 0.2065217 7.59821 4.18256 0.022605 -1.1378208 6781472 NM_001172112 Dhrs7b dehydrogenase/reductase (SDR family) member0.206555 7B 7.59821 3.9705547 0.0292887 -1.5223384 6929152 NM_011188 Psmc2 proteasome (prosome, macropain) 26S subunit,0.206645 ATPase 27.59821 3.8212217 0.0352557 -1.7951954 6847525 NM_016755 Atp5j ATP synthase, H+ transporting, mitochondrial0.2067033 F0 complex,7.59821 subunit F3.9007577 0.0317861 -1.6496885 6977025 NM_015816 Lsm4 LSM4 homolog, U6 small nuclear RNA associated0.2067833 (S. cerevisiae)7.59821 4.0661368 0.0260235 -1.3485222 6960436 NM_153057 Nomo1 nodal modulator 1 0.2069433 7.59821 3.6178504 0.045343 -2.1687466 6908079 NM_008183 Gstm2 glutathione S-transferase, mu 2 0.2072167 7.59821 3.7095944 0.0407362 -2.000005 6944997 NM_007594 Calu calumenin 0.20781 7.59821 4.0157043 0.027699 -1.440146 6926072 NM_013885 Clic4 chloride intracellular channel 4 (mitochondrial)0.20816 7.59821 3.8489617 0.0341436 -1.7444028 6929298 NM_029020 Abcb8 ATP-binding cassette, sub-family B (MDR/TAP),0.2085433 member 87.59821 3.5514323 0.0489842 -2.2910779 6792100 NM_145940 Wipi1 WD repeat domain, phosphoinositide interacting0.2087083 1 7.59821 4.3111762 0.0192312 -0.9064968 6856276 NM_025877 Slc25a23 solute carrier family 25 (mitochondrial carrier;0.20881 phosphate7.59821 carrier), member3.7327285 23 0.0394896 -1.9575094 6798218 NM_021516 Mark3 MAP/microtubule affinity-regulating kinase0.2096233 3 7.59821 4.0429264 0.026653 -1.3906648 6966166 NM_010908 Nfkbib nuclear factor of kappa light polypeptide gene0.2097667 enhancer in7.59821 B-cells inhibitor,4.4704993 beta0.0159202 -0.6222727 6761615 NM_011650 Tsn translin 0.2097933 7.59821 4.0600979 0.0261944 -1.3594828 6845195 BC060601 1700021K19Rik RIKEN cDNA 1700021K19 gene 0.2098683 7.59821 4.3137647 0.0191849 -0.9018579 6760364 NM_010880 Ncl nucleolin 0.2103067 7.59821 3.8898272 0.0321919 -1.6696619 6887703 NM_172436 Slc25a12 solute carrier family 25 (mitochondrial carrier,0.210395 Aralar), member7.59821 12 4.7217633 0.0116787 -0.179831 6807209 NM_012017 Zfp346 zinc finger protein 346 0.2108533 7.59821 4.2806844 0.0199867 -0.9611929 6999114 NM_019922 Crtap cartilage associated protein 0.2110833 7.59821 3.7229435 0.0400122 -1.9754808 6979716 NM_018855 Gas8 growth arrest specific 8 0.211395 7.59821 4.0101507 0.0278607 -1.4502478 6963534 NM_177282 Mical2 microtubule associated monoxygenase, calponin0.2114767 and LIM7.59821 domain containing4.6035275 2 0.013545 -0.3871025 6992974 NM_175114 Trak1 trafficking protein, kinesin binding 1 0.2118317 7.59821 4.320133 0.0191031 -0.8904479 6834025 NM_008728 Npr3 natriuretic peptide receptor 3 0.212285 7.59821 3.6927845 0.0417152 -2.0308984 6795936 NM_026102 Daam1 dishevelled associated activator of morphogenesis0.2125017 1 7.59821 4.0579176 0.0262129 -1.3634407 6983351 NM_010687 Large like-glycosyltransferase 0.2132 7.59821 4.9899591 0.0086954 0.28383558 6935082 NM_146164 Lrch4 leucine-rich repeats and calponin homology0.213715 (CH) domain 7.59821containing4.1308873 4 0.0241433 -1.2311921 6781909 NM_018768 Stx8 syntaxin 8 0.2137883 7.59821 3.7027319 0.041106 -2.0126156 6882476 NM_029362 Chmp4b chromatin modifying protein 4B 0.2141133 7.59821 3.6619263 0.0430893 -2.0876398 6882305 NM_001159551 H13 histocompatibility 13 0.21412 7.59821 4.7477901 0.0113912 -0.1344342 6814956 NM_001081249 Vcan versican 0.2141483 7.59821 3.6052992 0.0461459 -2.1918545 6791424 NM_001102650 Nt5c3l 5'-nucleotidase, cytosolic III-like 0.2142467 7.59821 4.4341152 0.0166378 -0.6869406 6964657 NM_198017 Fam175b family with sequence similarity 175, member0.214545 B 7.59821 3.6991854 0.0412833 -2.0191334 6986090 NM_053207 Egln1 EGL nine homolog 1 (C. elegans) 0.214705 7.59821 3.8972286 0.0318863 -1.6561364 6996704 NM_011544 Tcf12 transcription factor 12 0.2148567 7.59821 5.093575 0.0077588 0.4604463 6906220 NM_025794 Etfdh electron transferring flavoprotein, dehydrogenase0.2155367 7.59821 4.6621051 0.0126317 -0.2842029 6881837 NM_019787 Sec23b SEC23B (S. cerevisiae) 0.2155933 7.59821 3.6395386 0.0442092 -2.1288285 6864760 NM_007858 Diap1 diaphanous homolog 1 (Drosophila) 0.21586 7.59821 3.7059838 0.0408858 -2.0066396 6983838 NM_001007571 D8Ertd738e DNA segment, Chr 8, ERATO Doi 738, expressed0.2163 7.59821 3.7218893 0.0400657 -1.9774172 6844530 NM_001001881 2510009E07Rik RIKEN cDNA 2510009E07 gene 0.2165483 7.59821 3.9738163 0.0291782 -1.5163957 6986031 NM_009606 Acta1 actin, alpha 1, skeletal muscle 0.21668 7.59821 3.6356662 0.0444247 -2.1359546 6957134 NM_013700 Usp5 ubiquitin specific peptidase 5 (isopeptidase 0.216705T) 7.59821 3.5494876 0.049108 -2.2946616 6864709 NM_008214 Hars histidyl-tRNA synthetase 0.2176283 7.59821 4.0495426 0.026431 -1.3786476 6864497 NM_007874 Reep5 receptor accessory protein 5 0.2178167 7.59821 4.4577982 0.0161615 -0.6448306 6825325 NM_177594 Mtmr9 myotubularin related protein 9 0.2186733 7.59821 5.1436421 0.0073067 0.54526443 6899359 NM_009113 S100a13 S100 calcium binding protein A13 0.2189667 7.59821 3.6618216 0.0430893 -2.0878325 6783674 NM_133807 Lrrc59 leucine rich repeat containing 59 0.2191617 7.59821 4.3256947 0.0190132 -0.8804865 6857030 NM_023402 Myl12b myosin, light chain 12B, regulatory 0.2192783 7.59821 3.9954206 0.0284525 -1.4770525 6880881 NM_025613 Eid1 EP300 interacting inhibitor of differentiation0.2193017 1 7.59821 4.0956386 0.0251701 -1.2950201 6939358 NM_001159518 Igfbp7 insulin-like growth factor binding protein 70.2194383 7.59821 4.4883879 0.0155846 -0.5905317 6873510 NM_175360 Obfc1 oligonucleotide/oligosaccharide-binding fold0.2194667 containing 17.59821 4.1890449 0.022442 -1.1261197 6969255 NM_021876 Eed embryonic ectoderm development 0.2196633 7.59821 3.5381834 0.0497206 -2.3154934 6871295 NM_134150 Otub1 OTU domain, ubiquitin aldehyde binding 1 0.21971 7.59821 4.2996313 0.0195649 -0.9271951 6804033 NM_146039 Wdr60 WD repeat domain 60 0.219975 7.59821 4.8159893 0.0106139 -0.0158805 7012831 NM_008784 Igbp1 immunoglobulin (CD79A) binding protein 1 0.220235 7.59821 3.6411683 0.0441583 -2.1258296 6768978 NM_030262 Pofut2 protein O-fucosyltransferase 2 0.2209817 7.59821 3.8865097 0.0323236 -1.6757256 7015746 NM_009806 Cask calcium/calmodulin-dependent serine protein0.2210667 kinase (MAGUK7.59821 family)4.7555239 0.0113354 -0.1209609 6998594 NM_011573 Tex264 testis expressed gene 264 0.2212317 7.59821 3.997245 0.0283786 -1.4737316 6812051 NM_025588 Exoc2 exocyst complex component 2 0.2213983 7.59821 4.3317623 0.0189191 -0.8696226 6810260 NM_010560 Il6st interleukin 6 signal transducer 0.2219167 7.59821 5.3949471 0.005613 0.96576561 6795093 NM_013780 Npas3 neuronal PAS domain protein 3 0.222055 7.59821 3.5448041 0.049403 -2.3032921 6947396 NM_133641 Rtkn rhotekin 0.2221733 7.59821 5.0550382 0.0080885 0.39492982 6888763 BC085239 1110051M20Rik RIKEN cDNA 1110051M20 gene 0.2222367 7.59821 3.9268334 0.030719 -1.6020721 6855785 NM_001164729 Tomm6 translocase of outer mitochondrial membrane0.2224217 6 homolog7.59821 (yeast) 3.8287534 0.0350209 -1.7814003 6789941 NM_080849 Nek8 NIMA (never in mitosis gene a)-related expressed0.222515 kinase 87.59821 4.0467548 0.0265451 -1.3837107 6958271 NM_138757 4933424B01Rik RIKEN cDNA 4933424B01 gene 0.222585 7.59821 4.3254949 0.0190132 -0.8808442 6933973 NM_133221 Slc24a6 solute carrier family 24 (sodium/potassium/calcium0.223005 exchanger),7.59821 member4.9221067 6 0.0094633 0.16740834 6958904 NM_198613 Ap2s1 adaptor-related protein complex 2, sigma 0.22334171 subunit 7.59821 3.6777064 0.042437 -2.0586191 6970904 NM_145585 Thumpd1 THUMP domain containing 1 0.22343 7.59821 4.0316232 0.0270665 -1.4112035 6760711 NM_207225 Hdac4 histone deacetylase 4 0.2236883 7.59821 4.8935393 0.0097513 0.11820914 6812652 NM_001111324 Nedd9 neural precursor cell expressed, developmentally0.2237383 down-regulated7.59821 gene4.8735192 9 0.0099964 0.08366706 6993744 NM_016742 Cdc37 cell division cycle 37 homolog (S. cerevisiae) 0.22374 7.59821 3.7452648 0.0388857 -1.9344912 6913901 NM_024255 Hsdl2 hydroxysteroid dehydrogenase like 2 0.223985 7.59821 3.9040559 0.0316377 -1.6436633 6988230 NM_011734 Siae sialic acid acetylesterase 0.2240117 7.59821 4.037892 0.0268387 -1.3998114 6849294 NM_025954 Pgp phosphoglycolate phosphatase 0.2241817 7.59821 3.8811381 0.0325525 -1.6855451 6882582 NM_025516 Ergic3 ERGIC and golgi 3 0.2253767 7.59821 3.8927113 0.0321071 -1.664391 6749720 NM_022988 Nif3l1 Ngg1 interacting factor 3-like 1 (S. pombe) 0.22544 7.59821 3.5674528 0.0480692 -2.2615603 6934122 NM_177242 Pptc7 PTC7 protein phosphatase homolog (S. cerevisiae)0.2254783 7.59821 3.6798532 0.042369 -2.0546717 6772193 NM_011682 Utrn utrophin 0.22645 7.59821 4.7799288 0.0109873 -0.0784932 5055125 NA NA NA 0.2265783 7.59821 3.6671344 0.0428743 -2.0780607 6869370 NM_183046 Kif20b kinesin family member 20B 0.22666 7.59821 4.0623736 0.0261214 -1.355352 6773546 NM_145743 Lace1 lactation elevated 1 0.2267 7.59821 4.0862952 0.0254836 -1.3119567 6862751 NM_025797 Cyb5 cytochrome b-5 0.22709 7.59821 3.8641497 0.0334265 -1.7166127 5098882 NA NA NA 0.2274067 7.59821 3.6208901 0.0451705 -2.163151 6851734 NM_146081 Ppp4r1 protein phosphatase 4, regulatory subunit0.2276633 1 7.59821 4.355751 0.018257 -0.8267082 6946396 NM_180678 Gars glycyl-tRNA synthetase 0.228235 7.59821 3.6733104 0.0426569 -2.0667027 6975566 NM_030254 Tusc3 tumor suppressor candidate 3 0.2283533 7.59821 3.6713455 0.0426808 -2.0703161 6995453 NM_172770 Ttc12 tetratricopeptide repeat domain 12 0.2283667 7.59821 3.6708013 0.0426808 -2.071317 6995259 NM_172257 Sidt2 SID1 transmembrane family, member 2 0.2284 7.59821 3.6276263 0.0449055 -2.1507517 6902148 NM_001162538 Odf2l outer dense fiber of sperm tails 2-like 0.2286017 7.59821 3.745083 0.0388857 -1.9348249 6748557 NM_145516 Plekhb2 pleckstrin homology domain containing, family0.2288083 B (evectins)7.59821 member3.610718 2 0.045798 -2.1818774 7019504 NM_001167994 Trmt2b TRM2 tRNA methyltransferase 2 homolog B0.228965 (S. cerevisiae)7.59821 5.1791621 0.0070361 0.60523068 6933226 NM_009863 Cdc7 cell division cycle 7 (S. cerevisiae) 0.2290983 7.59821 4.073991 0.0258047 -1.3342714 6762425 NM_153774 Ipo9 importin 9 0.2292617 7.59821 4.9706957 0.0089069 0.25084359 6966108 NM_011874 Psmc4 proteasome (prosome, macropain) 26S subunit,0.229715 ATPase, 7.598214 4.1328689 0.0240759 -1.2276072 6749742 NM_172656 Stradb STE20-related kinase adaptor beta 0.2299033 7.59821 4.4121735 0.0171398 -0.7260091 6921074 NM_011014 Sigmar1 sigma non-opioid intracellular receptor 1 0.2301117 7.59821 3.8066577 0.0358714 -1.8218803 6854371 NM_001172113 Traf7 TNF receptor-associated factor 7 0.230145 7.59821 4.3960132 0.0173998 -0.7548163 6837447 NM_178869 Ttll1 tubulin tyrosine ligase-like 1 0.2302333 7.59821 4.0738037 0.0258047 -1.3346112 6828793 NM_172958 Mtmr12 myotubularin related protein 12 0.2305 7.59821 3.8261407 0.0351436 -1.7861854 6796658 NM_030225 Dlst dihydrolipoamide S-succinyltransferase (E20.2306383 component of7.59821 2-oxo-glutarate4.2461848 complex)0.0209267 -1.0231886 6856269 NM_133801 Gtf2f1 general transcription factor IIF, polypeptide0.2312817 1 7.59821 3.9563265 0.0297917 -1.5482714 6969196 NM_028343 Tmem135 transmembrane protein 135 0.2315133 7.59821 4.2989646 0.019572 -0.9283909 6887053 NM_028118 Wdsub1 WD repeat, SAM and U-box domain containing0.2323833 1 7.59821 4.6879311 0.0122159 -0.2389671 6771647 NM_026444 Cs citrate synthase 0.2326817 7.59821 4.1802259 0.0226487 -1.1420332 6871139 NM_181452 Mtvr2 mammary tumor virus receptor 2 0.2326967 7.59821 3.5365745 0.0497898 -2.3184586 6957465 NM_139117 Csda cold shock domain protein A 0.2331783 7.59821 4.8608412 0.0101333 0.06176611 6920990 NM_022305 B4galt1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase,0.2331917 polypeptide7.59821 15.1009877 0.0077029 0.47302557 6784253 NM_026776 Vps25 vacuolar protein sorting 25 (yeast) 0.2334033 7.59821 3.6601626 0.0430941 -2.090884 6958832 NM_025898 Napa N-ethylmaleimide sensitive fusion protein 0.2335617attachment protein7.59821 alpha3.5668482 0.048097 -2.2626742 6929960 NM_024478 Grpel1 GrpE-like 1, mitochondrial 0.23368 7.59821 3.7727176 0.0373591 -1.8841115 6788303 NM_019723 Slc22a21 solute carrier family 22 (organic cation transporter),0.2338333 member7.59821 21 3.9020127 0.0317345 -1.6473958 6982289 NM_011857 Odz3 odd Oz/ten-m homolog 3 (Drosophila) 0.2340033 7.59821 3.913563 0.0313014 -1.6262992 6807178 NM_178397 Faf2 Fas associated factor family member 2 0.2340767 7.59821 4.2962321 0.0196347 -0.9332918 6781083 NM_008248 Hint1 histidine triad nucleotide binding protein 10.2345933 7.59821 3.594772 0.0466604 -2.2112396 6845553 NM_007414 Adprh ADP-ribosylarginine hydrolase 0.2348233 7.59821 4.0552036 0.0262631 -1.3683681 6860952 NM_152809 Csnk1g3 casein kinase 1, gamma 3 0.2349317 7.59821 3.7992919 0.0361194 -1.8353806 6992439 NM_010628 Kif9 kinesin family member 9 0.2351833 7.59821 5.3312813 0.0059325 0.86006984 6885424 NM_001081199 Mamdc4 MAM domain containing 4 0.235315 7.59821 4.0434432 0.0266509 -1.3897261 6959309 NM_175107 2310022A10Rik RIKEN cDNA 2310022A10 gene 0.23571 7.59821 4.5619133 0.0143103 -0.4604502 6904979 NM_080793 Setd7 SET domain containing (lysine methyltransferase)0.236035 7 7.59821 3.9606638 0.0296794 -1.5403645 6791479 NM_026618 Ccdc56 coiled-coil domain containing 56 0.2362733 7.59821 3.5944933 0.0466604 -2.2117529 6950160 NM_020590 Gabarapl1 gamma-aminobutyric acid (GABA) A receptor-associated0.2364017 7.59821protein-like3.5642667 1 0.0482571 -2.2674303 6949811 NM_013539 Spsb2 splA/ryanodine receptor domain and SOCS box0.23647 containing7.59821 2 3.8263427 0.0351436 -1.7858155 6780940 NM_153117 9530068E07Rik RIKEN cDNA 9530068E07 gene 0.2369133 7.59821 4.1966964 0.0222323 -1.1123187 6990532 NM_138719 Gnb5 guanine nucleotide binding protein (G protein),0.236975 beta 5 7.59821 4.7477535 0.0113912 -0.1344979 6917190 NM_011970 Psmb2 proteasome (prosome, macropain) subunit,0.2370683 beta type 2 7.59821 4.540449 0.014701 -0.4983612 7016666 NM_053123 Smarca1 SWI/SNF related, matrix associated, actin dependent0.2371917 regulator7.59821 of chromatin,4.3759319 subfamily0.0177129 a, member-0.790652 1 6762413 NM_145417 Rnpep arginyl aminopeptidase (aminopeptidase B)0.2372433 7.59821 4.3188242 0.0191315 -0.8927925 6833980 NM_001166408 Rai14 retinoic acid induced 14 0.2376783 7.59821 4.4485053 0.0163828 -0.6613468 6860787 NM_008292 Hsd17b4 hydroxysteroid (17-beta) dehydrogenase 40.2377133 7.59821 4.8396922 0.0103033 0.0251854 6837437 NM_025445 Arfgap3 ADP-ribosylation factor GTPase activating 0.2378833protein 3 7.59821 4.6456632 0.0128667 -0.313044 6839504 NM_153588 Mkl2 MKL/myocardin-like 2 0.2380783 7.59821 4.6271947 0.0131154 -0.3454786 6972990 NM_145578 Ube2m ubiquitin-conjugating enzyme E2M (UBC120.2383283 homolog, yeast)7.59821 4.4589906 0.0161422 -0.6427122 6882670 NM_009271 Src Rous sarcoma oncogene 0.239125 7.59821 3.8055385 0.0359102 -1.8239314 6814407 NM_009817 Cast calpastatin 0.239305 7.59821 4.8693201 0.0100565 0.07641544 6836784 NM_031201 Tsta3 tissue specific transplantation antigen P35B0.2395633 7.59821 4.4844095 0.0156791 -0.5975879 6769304 NM_010347 Aes amino-terminal enhancer of split 0.23978 7.59821 3.8653313 0.0333762 -1.7144513 6763217 NM_011273 Xpr1 xenotropic and polytropic retrovirus receptor0.24036 1 7.59821 4.9497109 0.0091403 0.2148473 6790734 NM_011505 Stxbp4 syntaxin binding protein 4 0.240435 7.59821 3.5648394 0.0482495 -2.2663751 6971714 NM_009980 Ctbp2 C-terminal binding protein 2 0.2404383 7.59821 5.0326995 0.0083034 0.35686022 6859411 NM_153058 Mapre2 microtubule-associated protein, RP/EB family,0.2413983 member 27.59821 4.4180406 0.0170088 -0.7155573 6989553 NM_010421 Hexa hexosaminidase A 0.241405 7.59821 4.0550381 0.0262631 -1.3686685 6989414 NM_022813 Scamp2 secretory carrier membrane protein 2 0.2417767 7.59821 3.538313 0.0497206 -2.3152545 6982246 NM_023503 Ing2 inhibitor of growth family, member 2 0.2419333 7.59821 3.6709486 0.0426808 -2.071046 6869795 NM_145501 Pi4k2a phosphatidylinositol 4-kinase type 2 alpha0.2419433 7.59821 3.9495636 0.0300568 -1.5606026 6875850 NM_029981 Adamtsl2 ADAMTS-like 2 0.2421017 7.59821 3.8528287 0.0339475 -1.7373258 6978263 NM_010308 Gnao1 guanine nucleotide binding protein, alpha 0.2421267O 7.59821 3.6530438 0.0434441 -2.1039796 6820381 NM_207652 Tsc22d1 TSC22 domain family, member 1 0.2423833 7.59821 3.8208413 0.0352557 -1.7958924 6946979 NM_019802 Ggcx gamma-glutamyl carboxylase 0.2424117 7.59821 3.9721607 0.0292275 -1.5194123 6842926 NM_026366 N6amt1 N-6 adenine-specific DNA methyltransferase0.2428417 1 (putative) 7.59821 3.6305965 0.0447401 -2.1452848 6750643 NM_009208 Slc4a3 solute carrier family 4 (anion exchanger), member0.2432017 3 7.59821 3.9348346 0.0305396 -1.5874705 6775171 NM_133182 Prmt2 protein arginine N-methyltransferase 2 0.243645 7.59821 3.5744221 0.047712 -2.2487214 6768145 NM_019965 Dnajb12 DnaJ (Hsp40) homolog, subfamily B, member0.2437567 12 7.59821 4.2016703 0.0220875 -1.1033502 6916535 NM_026651 Pomgnt1 protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase0.2443 7.59821 4.4010263 0.0173268 -0.7458771 6782656 NM_008028 Flot2 flotillin 2 0.2445733 7.59821 4.1457457 0.0236696 -1.2043191 6913132 NM_022811 Polr1e polymerase (RNA) I polypeptide E 0.244935 7.59821 3.9815695 0.028918 -1.5022727 6835806 NM_026759 Mrpl13 mitochondrial ribosomal protein L13 0.245335 7.59821 3.8079344 0.0358468 -1.8195406 6908493 NM_025517 Rtcd1 RNA terminal phosphate cyclase domain 10.2456467 7.59821 4.4102987 0.0171443 -0.7293495 6886073 NM_026703 Ndufa8 NADH dehydrogenase (ubiquinone) 1 alpha0.245985 subcomplex, 7.598218 4.5137126 0.0151453 -0.5456576 6824007 NM_078478 Ghitm growth hormone inducible transmembrane protein0.2462 7.59821 4.593199 0.0137366 -0.4052884 6812320 NM_201358 Lyrm4 LYR motif containing 4 0.2463467 7.59821 3.5995438 0.0464424 -2.2024522 6988592 NM_021424 Pvrl1 poliovirus receptor-related 1 0.24636 7.59821 4.4789007 0.0157754 -0.6073611 6886170 NM_011187 Psmb7 proteasome (prosome, macropain) subunit,0.2466283 beta type 7 7.59821 3.7964138 0.036239 -1.8406565 6795234 NM_011968 Psma6 proteasome (prosome, macropain) subunit,0.2467517 alpha type 6 7.59821 4.808199 0.0106643 -0.0293931 6811977 NM_009238 Sox4 SRY-box containing gene 4 0.24689 7.59821 3.6238216 0.0451069 -2.1577548 6917283 NM_134151 Yars tyrosyl-tRNA synthetase 0.24699 7.59821 4.2370505 0.0211342 -1.0396224 6791686 NM_016896 Map3k14 mitogen-activated protein kinase kinase kinase0.2470067 14 7.59821 4.0584174 0.0262129 -1.3625333 6864607 NM_029669 Dnajc18 DnaJ (Hsp40) homolog, subfamily C, member0.2476267 18 7.59821 3.9315288 0.0306005 -1.5935028 6796768 NR_033623 2310044G17Rik RIKEN cDNA 2310044G17 gene 0.24765 7.59821 4.7893459 0.0109166 -0.0621262 6789360 BC069874 2810408A11Rik RIKEN cDNA 2810408A11 gene 0.2477083 7.59821 3.8373368 0.0346967 -1.7656828 6918036 NM_001037761 Capzb capping protein (actin filament) muscle Z-line,0.2477167 beta 7.59821 5.2394597 0.0065622 0.70662967 6769357 NM_001042523 Txnrd1 thioredoxin reductase 1 0.2479017 7.59821 4.1143886 0.0245701 -1.2610547 6952529 NM_025336 Chchd3 coiled-coil-helix-coiled-coil-helix domain containing0.2486333 3 7.59821 4.8584154 0.0101637 0.05757311 6763208 NM_008209 Mr1 major histocompatibility complex, class I-related0.248765 7.59821 3.7492661 0.0386591 -1.927146 6785675 NM_010898 Nf2 neurofibromatosis 2 0.2487767 7.59821 4.9342269 0.0093273 0.18824979 6812894 NM_009124 Atxn1 ataxin 1 0.248905 7.59821 5.3301681 0.0059325 0.85821677 6859967 BC057111 Fam53c family with sequence similarity 53, member0.2490817 C 7.59821 4.8133776 0.0106264 -0.0204098 6880899 NM_175154 Galk2 galactokinase 2 0.2493317 7.59821 5.0762004 0.0079162 0.43093254 6887819 NM_025942 Ola1 Obg-like ATPase 1 0.2495717 7.59821 4.4568715 0.0161704 -0.6464773 6832191 BC092006 1500032L24Rik RIKEN cDNA 1500032L24 gene 0.2496817 7.59821 3.8477167 0.0341992 -1.7466815 6985655 NM_026844 2310061C15Rik RIKEN cDNA 2310061C15 gene 0.249895 7.59821 3.7924184 0.0364308 -1.8479814 6763972 NM_023284 Nuf2 NUF2, NDC80 kinetochore complex component,0.25055 homolog7.59821 (S. cerevisiae)3.5692066 0.0479398 -2.2583292 6748646 NM_001039551 Cnnm3 cyclin M3 0.2506633 7.59821 4.690382 0.0121891 -0.2346784 7019492 NM_013757 Sytl4 synaptotagmin-like 4 0.2507283 7.59821 3.6029779 0.0462923 -2.1961287 6865709 NM_001127338 Aldh7a1 aldehyde dehydrogenase family 7, member A10.25084 7.59821 4.4225229 0.01692 -0.707575 6909972 NM_019808 Pdlim5 PDZ and LIM domain 5 0.2510217 7.59821 4.3781382 0.0177001 -0.7867128 6949826 NM_145385 Mlf2 myeloid leukemia factor 2 0.2510317 7.59821 4.882067 0.0098861 0.09842147 6824829 NM_024267 Ipo4 importin 4 0.251035 7.59821 3.9631619 0.0295656 -1.5358111 6847632 NM_009840 Cct8 chaperonin containing Tcp1, subunit 8 (theta)0.251155 7.59821 3.8073734 0.0358468 -1.8205686 6791992 NM_133702 Nol11 nucleolar protein 11 0.2515333 7.59821 3.7187575 0.0402244 -1.9831703 6922573 NM_011599 Tle1 transducin-like enhancer of split 1, homolog 0.25162of Drosophila7.59821 E(spl) 4.27995 0.0199965 -0.9625113 6789324 NM_011900 Mpdu1 mannose-P-dolichol utilization defect 1 0.2519017 7.59821 4.4792838 0.0157754 -0.6066813 6884788 NM_009105 Rsu1 Ras suppressor protein 1 0.2519033 7.59821 4.2555978 0.0206787 -1.006262 6872250 NM_011597 Tjp2 tight junction protein 2 0.2522833 7.59821 5.8712996 0.0032344 1.73821595 6989290 NM_011992 Rcn2 reticulocalbin 2 0.2522983 7.59821 4.1183215 0.024509 -1.253934 6751231 NM_022417 Itm2c integral membrane protein 2C 0.25242 7.59821 4.8613955 0.0101333 0.06272402 6847928 NM_138597 Atp5o ATP synthase, H+ transporting, mitochondrial0.25264 F1 complex,7.59821 O subunit4.7055786 0.0119715 -0.2081031 6854444 NM_019719 Stub1 STIP1 homology and U-Box containing protein0.25328 1 7.59821 3.7566169 0.038235 -1.9136539 6791423 NM_176830 1110036O03Rik RIKEN cDNA 1110036O03 gene 0.253555 7.59821 4.0819693 0.0256041 -1.3198007 6824195 NM_172597 Txndc16 thioredoxin domain containing 16 0.25361 7.59821 4.5102169 0.0151957 -0.5518476 6983141 NM_023312 Ndufa13 NADH dehydrogenase (ubiquinone) 1 alpha0.2539183 subcomplex, 7.5982113 3.953085 0.0299264 -1.5541815 6775206 NR_004429 Adarb1 adenosine deaminase, RNA-specific, B1 0.2539433 7.59821 4.4604254 0.0161162 -0.6401632 6992632 NM_009752 Glb1 galactosidase, beta 1 0.2540667 7.59821 3.8309951 0.0349665 -1.777295 6964329 NM_026888 Phkg2 phosphorylase kinase, gamma 2 (testis) 0.2540783 7.59821 4.3211566 0.0191004 -0.8886143 6971750 NM_133941 Dhx32 DEAH (Asp-Glu-Ala-His) box polypeptide 320.254305 7.59821 5.0279676 0.0083375 0.34878748 6835692 NM_010162 Ext1 exostoses (multiple) 1 0.2549767 7.59821 4.7685326 0.0111562 -0.0983147 6899326 NM_026677 Rab13 RAB13, member RAS oncogene family 0.255055 7.59821 3.8575639 0.0337337 -1.7286613 6775213 NM_133998 1810008A18Rik RIKEN cDNA 1810008A18 gene 0.2551767 7.59821 4.780192 0.0109873 -0.0780356 6995879 NM_025417 Commd4 COMM domain containing 4 0.255375 7.59821 3.8979329 0.0318678 -1.6548496 6763259 NM_009230 Soat1 sterol O-acyltransferase 1 0.2553817 7.59821 4.008982 0.0278806 -1.4523739 6844542 NM_025693 Tmem41a transmembrane protein 41a 0.2553933 7.59821 3.6649577 0.0429479 -2.0820641 6995233 NM_001081373 Cep164 centrosomal protein 164 0.2557233 7.59821 4.5343696 0.0148156 -0.5091084 6748525 NM_134448 Dst dystonin 0.2557617 7.59821 5.5665175 0.0045392 1.2477387 6866960 NM_015805 Atp9b ATPase, class II, type 9B 0.25579 7.59821 3.9259753 0.0307465 -1.6036383 6856196 NM_013664 Sh3gl1 SH3-domain GRB2-like 1 0.2558933 7.59821 4.4954518 0.015464 -0.5780077 6902122 NM_053102 15-Sep selenoprotein 0.2561333 7.59821 4.1668047 0.0229509 -1.1662649 6841372 NM_172616 C330027C09Rik RIKEN cDNA C330027C09 gene 0.256195 7.59821 3.9325239 0.0305861 -1.5916869 6782430 NM_001102611 Smyd4 SET and MYND domain containing 4 0.2562067 7.59821 3.6760494 0.0424831 -2.0616659 6840586 NM_016788 Tnk2 tyrosine kinase, non-receptor, 2 0.2564667 7.59821 4.410565 0.0171443 -0.728875 6801499 NM_022028 Sav1 salvador homolog 1 (Drosophila) 0.2565467 7.59821 4.0649865 0.0260582 -1.3506098 6829612 NM_018755 Pgcp plasma glutamate carboxypeptidase 0.25663 7.59821 4.2720141 0.0202126 -0.9767625 6966990 NM_001163662 Nucb1 nucleobindin 1 0.2567 7.59821 3.5390948 0.0497206 -2.3138137 6931243 NM_153391 Wdr19 WD repeat domain 19 0.2568033 7.59821 4.2141972 0.0217525 -1.0807728 4373687 NA NA NA 0.2569617 7.59821 5.1555225 0.0072208 0.5653406 7015697 NM_012005 Med14 mediator complex subunit 14 0.2572 7.59821 4.7358209 0.0114945 -0.1553009 6789725 NM_001164223 Rpa1 replication protein A1 0.25729 7.59821 3.6555657 0.0433171 -2.0993402 6824325 NM_172598 Wdhd1 WD repeat and HMG-box DNA binding protein0.2574883 1 7.59821 4.0718591 0.0258504 -1.3381392 6753280 NM_145510 Rabif RAB interacting factor 0.257625 7.59821 4.0922538 0.025305 -1.3011549 6961201 NM_021336 Snrpa1 small nuclear ribonucleoprotein polypeptide0.2579283 A' 7.59821 4.4788298 0.0157754 -0.6074869 6864695 NR_028355 Sra1 steroid receptor RNA activator 1 0.2579667 7.59821 3.8159084 0.0354696 -1.8049294 6996379 NM_019727 Snx1 sorting nexin 1 0.258005 7.59821 3.8979072 0.0318678 -1.6548966 6823100 NM_030180 Usp54 ubiquitin specific peptidase 54 0.2583 7.59821 3.6183697 0.0453249 -2.1677905 6972882 NM_027328 Prpf31 PRP31 pre-mRNA processing factor 31 homolog0.258385 (yeast) 7.59821 3.7890282 0.0365579 -1.8541973 6788380 NM_021327 Tnip1 TNFAIP3 interacting protein 1 0.25887 7.59821 3.8829042 0.032494 -1.6823165 6992409 NM_018757 Nme6 non-metastatic cells 6, protein expressed in0.259105 (nucleoside-diphosphate7.59821 3.5509021 kinase) 0.049006 -2.292055 6835984 NM_001146180 Mtss1 metastasis suppressor 1 0.2591417 7.59821 4.4398082 0.0165753 -0.6768126 6901413 NM_011863 Papss1 3'-phosphoadenosine 5'-phosphosulfate synthase0.259585 1 7.59821 4.9080531 0.009572 0.14321833 6835932 BC050895 9130401M01Rik RIKEN cDNA 9130401M01 gene 0.259715 7.59821 4.1825266 0.022605 -1.1378811 6781487 NM_008928 Map2k3 mitogen-activated protein kinase kinase 3 0.2597483 7.59821 4.5710013 0.0141264 -0.4444148 6942474 NM_001160366 Srcrb4d scavenger receptor cysteine rich domain containing,0.2600267 group7.59821 B (4 domains)4.7605492 0.0112858 -0.1122101 6833470 NM_008272 Hoxc9 homeobox C9 0.2604167 7.59821 4.5440346 0.0146232 -0.4920245 6787190 NM_026042 Med29 mediator complex subunit 29 0.260655 7.59821 4.2006862 0.0221091 -1.1051244 5446670 NA NA NA 0.2609267 7.59821 3.8425697 0.0344772 -1.7561028 6999097 NM_178624 Fbxl2 F-box and leucine-rich repeat protein 2 0.2613717 7.59821 4.2874538 0.0198449 -0.9490419 6978327 NM_024191 Arl2bp ADP-ribosylation factor-like 2 binding protein0.261455 7.59821 3.9042723 0.0316377 -1.6432679 6931790 NM_020611 Srd5a3 steroid 5 alpha-reductase 3 0.2616517 7.59821 4.1902452 0.0224227 -1.1239543 6836006 NM_153548 E430025E21Rik RIKEN cDNA E430025E21 gene 0.2619583 7.59821 5.5965805 0.0043902 1.29671377 6850678 NM_026768 Mrps18a mitochondrial ribosomal protein S18A 0.262285 7.59821 4.210004 0.0218813 -1.0883286 6759248 NM_001160038 Ndufs1 NADH dehydrogenase (ubiquinone) Fe-S protein0.2625067 1 7.59821 3.9328781 0.0305861 -1.5910406 6888153 NM_016965 Nckap1 NCK-associated protein 1 0.262745 7.59821 4.6217569 0.0132007 -0.3550363 6819152 NM_026851 Mrpl52 mitochondrial ribosomal protein L52 0.2628183 7.59821 4.0104547 0.0278607 -1.4496946 6934631 NM_025450 Mrps17 mitochondrial ribosomal protein S17 0.2630967 7.59821 3.6486685 0.0437202 -2.1120293 6893636 NM_025531 Slmo2 slowmo homolog 2 (Drosophila) 0.2632517 7.59821 4.2278211 0.0213801 -1.0562351 6992347 NM_133794 Qars glutaminyl-tRNA synthetase 0.2638233 7.59821 4.135726 0.0240223 -1.2224388 6995825 NM_019793 Tspan3 tetraspanin 3 0.2638317 7.59821 4.4900106 0.0155689 -0.5876542 6977169 NM_176940 Nwd1 NACHT and WD repeat domain containing 1 0.26402 7.59821 4.5262482 0.0149202 -0.5234721 6925361 NM_011902 Tekt2 tektin 2 0.2643 7.59821 3.6798136 0.042369 -2.0547445 6829504 NM_146057 Dap death-associated protein 0.2649333 7.59821 5.5381576 0.0046702 1.2014194 6837131 NM_028763 Cbx6 chromobox homolog 6 0.2652133 7.59821 3.695335 0.041545 -2.0262102 6897592 NM_001144987 Spg20 spastic paraplegia 20, spartin (Troyer syndrome)0.26545 homolog7.59821 (human) 3.9196606 0.03108 -1.6151656 6768928 NM_146006 Lss lanosterol synthase 0.2655117 7.59821 4.0401781 0.0267663 -1.3956577 6943862 NM_181595 Ppp1r9a protein phosphatase 1, regulatory (inhibitor)0.2657867 subunit 9A 7.59821 4.3632095 0.0180335 -0.8133775 7012151 NM_020601 Tbl1x transducin (beta)-like 1 X-linked 0.2662217 7.59821 5.3194722 0.0060111 0.84040211 7002583 NM_133739 Tmem123 transmembrane protein 123 0.26657 7.59821 5.1546426 0.0072218 0.56385449 6835149 NM_172402 Slc25a32 solute carrier family 25, member 32 0.2667717 7.59821 4.5497581 0.0145469 -0.4819127 6944128 NM_029404 Phf14 PHD finger protein 14 0.2667917 7.59821 5.3601909 0.0057851 0.90813545 6867593 BC019471 1810055G02Rik RIKEN cDNA 1810055G02 gene 0.2668967 7.59821 3.6428031 0.0440939 -2.1228213 6983526 NM_145599 Tmem184c transmembrane protein 184C 0.2669833 7.59821 4.2062158 0.021995 -1.0951561 6864565 NM_010481 Hspa9 heat shock protein 9 0.2670483 7.59821 3.89912 0.0318392 -1.6526806 6836237 NM_010026 Asap1 ArfGAP with SH# domain, ankyrin repeat and0.2674533 PH domain17.59821 4.590812 0.0137537 -0.409493 6870897 NM_018869 Grk5 G protein-coupled receptor kinase 5 0.2677467 7.59821 4.0736491 0.0258047 -1.3348918 6784207 NM_028024 Nkiras2 NFKB inhibitor interacting Ras-like protein 0.26797172 7.59821 4.848447 0.0102299 0.04033521 6921162 NM_011602 Tln1 talin 1 0.2682133 7.59821 5.3224718 0.0059903 0.84539972 6977058 NM_001142322 Myo9b myosin IXb 0.2683967 7.59821 5.8529244 0.0033032 1.70902605 6966193 NM_026545 Psmd8 proteasome (prosome, macropain) 26S subunit,0.2684783 non-ATPase,7.59821 8 5.4086132 0.0055074 0.98837907 6781372 NM_012027 Mprip myosin phosphatase Rho interacting protein0.268485 7.59821 5.3452766 0.0058705 0.8833534 6786561 NM_139297 Ugp2 UDP-glucose pyrophosphorylase 2 0.2687133 7.59821 3.7168204 0.0403435 -1.9867289 6800906 NM_007688 Cfl2 cofilin 2, muscle 0.2688433 7.59821 4.1494875 0.0235473 -1.1975546 6766623 NM_010217 Ctgf connective tissue growth factor 0.26894 7.59821 4.7543108 0.011347 -0.1230738 6758984 NM_172406 Trak2 trafficking protein, kinesin binding 2 0.2690067 7.59821 5.5223833 0.0047642 1.17560596 6933675 NM_011223 Pxn paxillin 0.26905 7.59821 5.1858238 0.0069964 0.6164579 6913777 NM_001035533 Akap2 A kinase (PRKA) anchor protein 2 0.269285 7.59821 3.9786945 0.0289635 -1.5075091 6900143 NM_013629 Phtf1 putative homeodomain transcription factor0.2694667 1 7.59821 4.4374474 0.0166145 -0.6810121 6788739 NM_011480 Srebf1 sterol regulatory element binding transcription0.26982 factor 1 7.59821 3.8201452 0.0352557 -1.7971674 6762132 NM_008551 Mapkapk2 MAP kinase-activated protein kinase 2 0.269915 7.59821 5.0055203 0.0085326 0.31045116 6819510 NM_026908 Cab39l calcium binding protein 39-like 0.2700233 7.59821 4.2026085 0.0220808 -1.1016587 6785247 NM_178620 Mfsd11 major facilitator superfamily domain containing0.2701083 11 7.59821 5.1036687 0.0076785 0.47757338 6916712 NM_019422 Elovl1 elongation of very long chain fatty acids (FEN1/Elo2,0.270315 SUR4/Elo3,7.59821 yeast)-like4.9167744 1 0.0094949 0.15823316 6784709 NM_025894 Psmd12 proteasome (prosome, macropain) 26S subunit,0.2703483 non-ATPase,7.59821 12 4.9783992 0.0088343 0.26404306 6792691 NM_172443 Tbc1d16 TBC1 domain family, member 16 0.27035 7.59821 4.4741917 0.0158751 -0.6157181 6890638 NM_207669 Gabpb1 GA repeat binding protein, beta 1 0.2703717 7.59821 4.6278654 0.013113 -0.3443001 6941754 NM_009879 Ift81 intraflagellar transport 81 homolog (Chlamydomonas)0.2706317 7.59821 3.5585332 0.0485533 -2.2779938 6974743 NM_010206 Fgfr1 fibroblast growth factor receptor 1 0.270665 7.59821 4.784856 0.0109801 -0.0699282 7018220 NM_008892 Pola1 polymerase (DNA directed), alpha 1 0.2707633 7.59821 4.7635065 0.0112407 -0.1070619 6963578 NM_026143 Far1 fatty acyl CoA reductase 1 0.2711717 7.59821 3.9416315 0.0303483 -1.57507 6764854 NM_198653 Iars2 isoleucine-tRNA synthetase 2, mitochondrial 0.27122 7.59821 4.9544619 0.0090889 0.22300206 6944385 NM_022332 St7 suppression of tumorigenicity 7 0.2715917 7.59821 4.7443139 0.0114108 -0.1404927 6789977 NM_133706 Tmem97 transmembrane protein 97 0.271685 7.59821 4.0546641 0.0262631 -1.3693475 6970846 NM_019580 Gde1 glycerophosphodiester phosphodiesterase0.2717583 1 7.59821 4.6999858 0.0120503 -0.2178804 6882521 NM_025735 Map1lc3a microtubule-associated protein 1 light chain0.271785 3 alpha 7.59821 4.1292054 0.0241907 -1.2342353 6789474 NM_007573 C1qbp complement component 1, q subcomponent0.2718217 binding protein7.59821 3.9099529 0.031445 -1.6328921 6881787 NM_019771 Dstn destrin 0.2722233 7.59821 4.0816786 0.0256041 -1.320328 6977643 NM_177378 Rnf150 ring finger protein 150 0.27228 7.59821 3.5400023 0.0497206 -2.3121412 6807609 NM_028079 2010111I01Rik RIKEN cDNA 2010111I01 gene 0.27231 7.59821 4.8051356 0.0107068 -0.0347088 6942523 NM_007457 Ap1s1 adaptor protein complex AP-1, sigma 1 0.27242 7.59821 4.5388347 0.0147146 -0.5012146 6937269 NM_181857 Poln DNA polymerase N 0.2726533 7.59821 4.3292516 0.0189713 -0.8741175 6824834 NM_008683 Nedd8 neural precursor cell expressed, developmentally0.27287 down-regulated7.59821 gene4.1137124 8 0.0245701 -1.262279 6934397 NM_029752 Bri3bp Bri3 binding protein 0.2730317 7.59821 4.6747355 0.0124341 -0.26207 6906634 NM_027539 Dclk2 doublecortin-like kinase 2 0.27313 7.59821 3.7769685 0.0371308 -1.8763139 6947814 NM_001166251 Mgll monoglyceride lipase 0.2731533 7.59821 4.221982 0.0215205 -1.0667496 6998165 NM_025485 Mrps22 mitochondrial ribosomal protein S22 0.273505 7.59821 3.5949312 0.0466604 -2.2109464 6767636 NM_008162 Gpx4 glutathione peroxidase 4 0.273765 7.59821 3.5722726 0.0477981 -2.252681 6984484 NM_134141 Ciapin1 cytokine induced apoptosis inhibitor 1 0.273785 7.59821 3.7311096 0.0395595 -1.9604823 6984975 NM_013477 Atp6v0d1 ATPase, H+ transporting, lysosomal V0 subunit0.2738883 D1 7.59821 3.7840014 0.0367464 -1.8634151 7020507 NM_008810 Pdha1 pyruvate dehydrogenase E1 alpha 1 0.2739067 7.59821 4.1672706 0.0229493 -1.1654234 6832412 NM_172611 Gramd4 GRAM domain containing 4 0.2739917 7.59821 4.2325539 0.0212533 -1.0477152 6926021 NM_029100 Sepn1 selenoprotein N, 1 0.274065 7.59821 3.9359934 0.0305163 -1.585356 6884277 NM_025482 Tpd52l2 tumor protein D52-like 2 0.2745567 7.59821 5.2851481 0.0062421 0.7831253 6987460 BC054761 9530077C05Rik RIKEN cDNA 9530077C05 gene 0.2745667 7.59821 3.5592341 0.0485424 -2.2767025 6831651 NM_025567 Cyc1 cytochrome c-1 0.2747783 7.59821 4.9206592 0.0094633 0.16491798 6765222 NM_025424 Nenf neuron derived neurotrophic factor 0.2750167 7.59821 3.5619746 0.0484012 -2.2716532 6970382 NM_020050 Tmem9b TMEM9 domain family, member B 0.275095 7.59821 5.6883506 0.0039498 1.44541058 6974621 NM_011394 Slc20a2 solute carrier family 20, member 2 0.2751933 7.59821 4.8466035 0.0102299 0.03714591 4884456 NA NA NA 0.2751983 7.59821 4.5935675 0.0137366 -0.4046394 6764048 NM_001037170 Tomm40l translocase of outer mitochondrial membrane0.2754183 40 homolog-like7.59821 (yeast)4.036477 0.0268828 -1.4023827 6791443 NM_031871 Ghdc GH3 domain containing 0.2754667 7.59821 3.7688295 0.0375498 -1.8912443 6933602 NM_023556 Mvk mevalonate kinase 0.27573 7.59821 4.261545 0.0204943 -0.9955721 6969640 NM_007602 Capn5 calpain 5 0.2759433 7.59821 4.5019438 0.0153317 -0.5665025 6965015 NM_026391 Ppp2r2d protein phosphatase 2, regulatory subunit0.2760417 B, delta isoform7.59821 4.6357679 0.0129959 -0.3304171 4738627 NA NA NA 0.2761083 7.59821 3.6407531 0.0441583 -2.1265936 5322594 NA NA NA 0.2761883 7.59821 4.472918 0.0158817 -0.6179789 6951766 NR_024619 2610001J05Rik RIKEN cDNA 2610001J05 gene 0.2763417 7.59821 4.9226263 0.0094633 0.1683023 6996743 NM_009359 Tex9 testis expressed gene 9 0.2765267 7.59821 4.0526948 0.0263188 -1.3729234 6949235 NM_031177 Ift122 intraflagellar transport 122 homolog (Chlamydomonas)0.2766267 7.59821 4.1255226 0.0243217 -1.2408997 6825216 NM_008466 Kpna3 karyopherin (importin) alpha 3 0.27683 7.59821 4.0311653 0.0270665 -1.4120357 6951403 NM_183308 Pon2 paraoxonase 2 0.277465 7.59821 4.2210119 0.0215408 -1.0684968 6974138 NM_010684 Lamp1 lysosomal-associated membrane protein 10.2776583 7.59821 6.2165987 0.002205 2.27762668 6871580 NM_152220 Stx3 syntaxin 3 0.2778083 7.59821 4.0114849 0.0278506 -1.4478206 6798232 NM_001025360 Klc1 kinesin light chain 1 0.2778467 7.59821 6.8545692 0.0011648 3.2289981 6928889 NM_011995 Pclo piccolo (presynaptic cytomatrix protein) 0.27807 7.59821 3.8211013 0.0352557 -1.795416 6837263 NM_011399 Slc25a17 solute carrier family 25 (mitochondrial carrier,0.27833 peroxisomal7.59821 membrane4.0451749 protein),0.0266018 member 17 -1.3865804 6908092 NM_028779 Ampd2 adenosine monophosphate deaminase 2 0.2784267 7.59821 4.137334 0.0239924 -1.2195302 6839607 NM_008576 Abcc1 ATP-binding cassette, sub-family C (CFTR/MRP),0.27845 member7.59821 1 5.0223235 0.0083663 0.3391546 6929653 NM_133918 Emilin1 elastin microfibril interfacer 1 0.2789617 7.59821 4.0738648 0.0258047 -1.3345003 6916630 NM_026837 Tmem53 transmembrane protein 53 0.2791 7.59821 3.569429 0.0479398 -2.2579197 6929647 NM_133350 Mapre3 microtubule-associated protein, RP/EB family,0.279115 member 37.59821 4.7581556 0.0113082 -0.1163778 6850786 NM_001081636 Ccnd3 cyclin D3 0.2792717 7.59821 3.5641729 0.0482571 -2.2676031 6965906 NM_008168 Grik5 glutamate receptor, ionotropic, kainate 5 (gamma0.2793683 2) 7.59821 4.5177194 0.0150818 -0.5385646 6817970 NM_027289 Nt5dc2 5'-nucleotidase domain containing 2 0.2797433 7.59821 4.1207443 0.0244392 -1.2495481 6924871 NM_033617 Atp6v0b ATPase, H+ transporting, lysosomal V0 subunit0.2798317 B 7.59821 4.0816339 0.0256041 -1.320409 6933259 NM_144911 Rpap2 RNA polymerase II associated protein 2 0.2798533 7.59821 4.5259827 0.0149202 -0.5239419 6983837 NM_172503 Zswim4 zinc finger, SWIM domain containing 4 0.2801183 7.59821 4.5306599 0.0148697 -0.5156686 4688207 NA NA NA 0.2801633 7.59821 4.2435193 0.020959 -1.0279834 6789378 NM_017366 Acadvl acyl-Coenzyme A dehydrogenase, very long chain0.2804 7.59821 4.6717786 0.0124725 -0.2672498 6941635 NM_023625 Plbd2 phospholipase B domain containing 2 0.2805833 7.59821 4.6605093 0.0126539 -0.2870007 6787100 NM_010117 Rhbdf1 rhomboid family 1 (Drosophila) 0.280655 7.59821 4.2716124 0.0202126 -0.977484 6999642 NM_026917 Zdhhc3 zinc finger, DHHC domain containing 3 0.28075 7.59821 6.3059113 0.0020288 2.41433199 6843680 NM_133185 Rogdi rogdi homolog (Drosophila) 0.2808783 7.59821 3.63345 0.044581 -2.1400332 6873408 NM_001164290 Cuedc2 CUE domain containing 2 0.2811167 7.59821 3.9292366 0.0306463 -1.597686 6919190 NM_024263 Mxra8 matrix-remodelling associated 8 0.2811183 7.59821 4.2628548 0.0204797 -0.9932181 6767292 NM_011264 Rev3l REV3-like, catalytic subunit of DNA polymerase0.2811517 zeta RAD547.59821 like (S. cerevisiae)3.6106139 0.045798 -2.1820691 6861632 NM_025468 Sec11c SEC11 homolog C (S. cerevisiae) 0.2813033 7.59821 3.7422832 0.0389915 -1.9399651 6751215 NM_025386 Fbxo36 F-box protein 36 0.28154 7.59821 4.1050876 0.0248667 -1.2778996 6747805 NM_133832 Rdh10 retinol dehydrogenase 10 (all-trans) 0.2815683 7.59821 3.9702489 0.0292887 -1.5228957 7010434 NM_175180 Wdr44 WD repeat domain 44 0.281915 7.59821 4.5453737 0.0146168 -0.4896583 6791501 NM_012037 Vat1 vesicle amine transport protein 1 homolog (T0.28212 californica) 7.59821 4.471411 0.0159092 -0.6206541 6785130 NM_026729 Ict1 immature colon carcinoma transcript 1 0.282235 7.59821 3.9513929 0.0299777 -1.5572669 6854369 NM_019988 Mlst8 MTOR associated protein, LST8 homolog (S. cerevisiae)0.28245 7.59821 4.1048616 0.0248667 -1.2783089 6929728 NM_172707 Ppp1cb protein phosphatase 1, catalytic subunit, beta 0.2825isoform 7.59821 3.5773192 0.047638 -2.2433847 6933341 NM_054071 Fgfrl1 fibroblast growth factor receptor-like 1 0.2828917 7.59821 4.5325494 0.0148424 -0.512327 4538720 NA NA NA 0.2830317 7.59821 3.6373346 0.0443629 -2.1328843 6796211 NM_145927 Fntb farnesyltransferase, CAAX box, beta 0.283055 7.59821 4.8089988 0.0106643 -0.0280054 6753273 NM_028057 Cyb5r1 cytochrome b5 reductase 1 0.2832717 7.59821 4.5704102 0.0141274 -0.4454575 6856282 NM_011617 Cd70 CD70 antigen 0.2833267 7.59821 3.6991009 0.0412833 -2.0192888 6783761 NM_008831 Phb prohibitin 0.2834483 7.59821 3.7367956 0.0392907 -1.9500408 6804582 NM_011803 Klf6 Kruppel-like factor 6 0.2837467 7.59821 4.7244086 0.0116617 -0.1752131 6929797 NM_021500 Maea macrophage erythroblast attacher 0.2837617 7.59821 5.9402975 0.0029952 1.84738551 6936560 NM_172992 Phtf2 putative homeodomain transcription factor 20.28391 7.59821 3.8923259 0.0321087 -1.6650954 6961184 NM_178056 Tm2d3 TM2 domain containing 3 0.28453 7.59821 5.1903261 0.0069538 0.6240424 6966600 NM_007633 Ccne1 cyclin E1 0.2848233 7.59821 5.0394658 0.0082403 0.36839842 6864466 NM_013512 Epb4.1l4a erythrocyte protein band 4.1-like 4a 0.2849733 7.59821 4.1777476 0.0226968 -1.1465066 6934942 NM_008617 Mdh2 malate dehydrogenase 2, NAD (mitochondrial)0.28544 7.59821 5.7844286 0.0035119 1.59978528 6824477 NM_207214 Exoc5 exocyst complex component 5 0.2856717 7.59821 3.8112276 0.0357067 -1.8135057 6953395 NM_027852 Rarres2 retinoic acid receptor responder (tazarotene0.2858017 induced) 2 7.59821 3.8532456 0.0339434 -1.736563 6791639 NM_011431 Eftud2 elongation factor Tu GTP binding domain containing0.28591 2 7.59821 5.5834893 0.0044456 1.27540305 6917039 NM_029157 Sf3a3 splicing factor 3a, subunit 3 0.2859717 7.59821 4.2022779 0.0220808 -1.1022548 6978953 NM_025558 Cyb5b cytochrome b5 type B 0.2860033 7.59821 4.0645963 0.0260582 -1.3513181 6939985 NM_025972 Naaa N-acylethanolamine acid amidase 0.2861717 7.59821 4.4100218 0.0171443 -0.729843 6934661 NM_025551 Ndufa12 NADH dehydrogenase (ubiquinone) 1 alpha0.2862933 subcomplex, 7.5982112 4.3145402 0.0191849 -0.9004682 6896120 NM_030732 Tbl1xr1 transducin (beta)-like 1X-linked receptor 10.2863167 7.59821 5.7848683 0.0035119 1.60048872 6970839 NM_009940 Coq7 demethyl-Q 7 0.2865617 7.59821 6.1414669 0.0023832 2.16173242 6754701 NM_138314 Nme7 non-metastatic cells 7, protein expressed in0.2865933 (nucleoside-diphosphate7.59821 3.9734741 kinase) 0.0291782 -1.5170193 6989437 NM_001122873 Ubl7 ubiquitin-like 7 (bone marrow stromal cell-derived)0.286715 7.59821 4.1544912 0.0233601 -1.188511 6978390 NM_145602 Ndrg4 N-myc downstream regulated gene 4 0.2868917 7.59821 4.1386985 0.023952 -1.2170623 6925273 NM_153159 Zc3h12a zinc finger CCCH type containing 12A 0.2869433 7.59821 3.7255894 0.0398425 -1.9706208 6782465 NM_009536 Ywhae tyrosine 3-monooxygenase/tryptophan 5-monooxygenase0.2872233 7.59821 activation4.7327664 protein, epsilon0.0115415 polypeptide-0.1606288 6856192 NM_145934 Stap2 signal transducing adaptor family member 2 0.28734 7.59821 4.52912 0.0148957 -0.5183922 7020804 NM_026662 Prps2 phosphoribosyl pyrophosphate synthetase0.2874467 2 7.59821 4.2275512 0.0213801 -1.0567211 6882615 NM_013510 Epb4.1l1 erythrocyte protein band 4.1-like 1 0.2874533 7.59821 4.0064826 0.0279871 -1.4569211 6775201 NM_001109991 Col18a1 collagen, type XVIII, alpha 1 0.2877433 7.59821 4.3832891 0.0175998 -0.777518 6857415 NM_199448 Fez2 fasciculation and elongation protein zeta 2 (zygin0.28786 II) 7.59821 5.8171512 0.0033808 1.65205777 6860254 NM_001164621 Rnf14 ring finger protein 14 0.2881017 7.59821 5.4098459 0.0055074 0.99041759 6907623 NM_011197 Ptgfrn prostaglandin F2 receptor negative regulator0.2882817 7.59821 4.740784 0.0114576 -0.1466462 6765716 NM_172784 Lrp11 low density lipoprotein receptor-related protein0.2884483 11 7.59821 3.5857661 0.0471707 -2.2278258 6792942 NR_027869 Dtnb dystrobrevin, beta 0.2889467 7.59821 4.3825949 0.0175998 -0.778757 7014542 NM_198105 Fam120c family with sequence similarity 120, member C0.2896 7.59821 4.7940042 0.0108534 -0.0540341 7015061 NM_001177956 Gpm6b glycoprotein m6b 0.2902467 7.59821 4.4193603 0.0169843 -0.7132069 6971678 NM_016978 Oat ornithine aminotransferase 0.2911567 7.59821 3.5704546 0.0479069 -2.2560302 6926988 NM_173371 H6pd hexose-6-phosphate dehydrogenase (glucose0.2912167 1-dehydrogenase)7.59821 4.7517456 0.0113663 -0.1275423 6754205 NM_021433 Stx6 syntaxin 6 0.2912917 7.59821 4.068299 0.0259788 -1.3445986 6807154 NM_027324 Sfxn1 sideroflexin 1 0.291435 7.59821 4.6726485 0.0124663 -0.2657258 6896507 NM_027016 Sec62 SEC62 homolog (S. cerevisiae) 0.2923533 7.59821 4.7816002 0.0109801 -0.0755875 6961889 NM_026498 Mrps11 mitochondrial ribosomal protein S11 0.2924533 7.59821 4.5047993 0.0152977 -0.5614434 6893635 NM_025983 Atp5e ATP synthase, H+ transporting, mitochondrial0.2928783 F1 complex,7.59821 epsilon subunit5.8318747 0.0033547 1.67552713 6945275 NM_009148 Exoc4 exocyst complex component 4 0.2931717 7.59821 5.1105608 0.0076104 0.48925994 6803918 NM_025399 Nudt14 nudix (nucleoside diphosphate linked moiety0.2935133 X)-type motif7.59821 14 5.3768089 0.0056955 0.93571148 6965668 NM_011155 Ppp5c protein phosphatase 5, catalytic subunit 0.293755 7.59821 3.9075698 0.0315318 -1.6372447 6838557 NM_008732 Slc11a2 solute carrier family 11 (proton-coupled divalent0.2940583 metal ion7.59821 transporters),5.729717 member0.0037576 2 1.5120402 6879015 NM_009023 Rapsn receptor-associated protein of the synapse0.2940867 7.59821 3.9523627 0.0299453 -1.5554985 6873217 NM_010324 Got1 glutamate oxaloacetate transaminase 1, soluble0.2941533 7.59821 4.3923106 0.017488 -0.7614205 6852229 NM_019919 Ltbp1 latent transforming growth factor beta binding0.2951267 protein 1 7.59821 4.7452309 0.0114048 -0.1388944 6992062 NM_175324 Acad11 acyl-Coenzyme A dehydrogenase family, member0.2951517 11 7.59821 5.8414075 0.0033328 1.69070584 6917437 NM_025297 Mecr mitochondrial trans-2-enoyl-CoA reductase0.2952033 7.59821 5.8172542 0.0033808 1.6522222 6992487 NM_001164838 Lrrfip2 leucine rich repeat (in FLII) interacting protein0.2954167 2 7.59821 5.4602356 0.0051841 1.07356014 6993845 NM_031874 Rab3d RAB3D, member RAS oncogene family 0.29606 7.59821 5.9978621 0.0028216 1.93793601 6899682 NM_007802 Ctsk cathepsin K 0.2961133 7.59821 3.9329612 0.0305861 -1.5908889 6963049 NM_009103 Rrm1 ribonucleotide reductase M1 0.2967067 7.59821 5.5027291 0.0049018 1.14339364 6882057 NM_028986 Gzf1 GDNF-inducible zinc finger protein 1 0.29709 7.59821 4.6524871 0.0128005 -0.3010701 6876026 NM_207298 Cercam cerebral endothelial cell adhesion molecule0.297125 7.59821 4.0160769 0.027699 -1.4394683 6838492 NM_001113545 Lima1 LIM domain and actin binding 1 0.2971283 7.59821 5.147434 0.0072895 0.55167431 6833468 NM_010462 Hoxc10 homeobox C10 0.29745 7.59821 4.2128317 0.0217884 -1.0832332 6796696 NM_030887 Jdp2 Jun dimerization protein 2 0.2975133 7.59821 4.0215598 0.0274657 -1.4294977 5420528 NA NA NA 0.2976867 7.59821 5.3156695 0.0060313 0.83406464 6936725 NM_007668 Cdk5 cyclin-dependent kinase 5 0.297715 7.59821 4.7384343 0.0114906 -0.1507431 7010645 NM_133990 Il13ra1 interleukin 13 receptor, alpha 1 0.2979017 7.59821 5.3379855 0.0058913 0.87122682 6782141 NM_007933 Eno3 enolase 3, beta muscle 0.298005 7.59821 4.1687943 0.0229043 -1.1626716 6989406 NM_007747 Cox5a cytochrome c oxidase, subunit Va 0.298335 7.59821 3.5837377 0.0472573 -2.2315618 6864926 NM_023311 Yipf5 Yip1 domain family, member 5 0.29834 7.59821 4.5742207 0.014061 -0.4387366 6998088 NR_015511 E030011O05Rik RIKEN cDNA E030011O05 gene 0.2984317 7.59821 3.7469434 0.0388003 -1.9314096 6824286 NM_009919 Cnih cornichon homolog (Drosophila) 0.29848 7.59821 5.4948765 0.0049485 1.13050811 6899213 NM_008094 Gba glucosidase, beta, acid 0.298535 7.59821 6.2400854 0.002185 2.31368819 6945786 NM_011777 Zyx zyxin 0.2987167 7.59821 4.5258605 0.0149202 -0.5241581 6968799 NM_016721 Iqgap1 IQ motif containing GTPase activating protein0.2987483 1 7.59821 7.8745999 0.0004336 4.6326949 6867728 NM_026553 Yif1a Yip1 interacting factor homolog A (S. cerevisiae)0.2993167 7.59821 4.8475121 0.0102299 0.03871794 6841849 NM_028523 Dcbld2 discoidin, CUB and LCCL domain containing0.2995483 2 7.59821 5.0809905 0.0078631 0.43907341 6764056 NM_025388 Ufc1 ubiquitin-fold modifier conjugating enzyme0.2999033 1 7.59821 5.0699285 0.0079492 0.42026863 6994030 NM_172920 Dpy19l1 dpy-19-like 1 (C. elegans) 0.30012 7.59821 4.2583781 0.0205934 -1.0012641 6880497 ENSMUST00000028795Rad51 RAD51 homolog (S. cerevisiae) 0.30012 7.59821 3.9808855 0.028918 -1.5035185 6875214 NM_026162 Plxdc2 plexin domain containing 2 0.3002317 7.59821 4.059081 0.0262129 -1.3613288 6924892 NM_023223 Cdc20 cell division cycle 20 homolog (S. cerevisiae)0.3002883 7.59821 3.6893468 0.0418593 -2.0372177 6954603 NM_153778 Atoh8 atonal homolog 8 (Drosophila) 0.3003517 7.59821 4.4239545 0.0168925 -0.7050258 6829945 NM_025494 Atp6v1c1 ATPase, H+ transporting, lysosomal V1 subunit0.3003617 C1 7.59821 3.9650527 0.0294847 -1.5323648 6895702 NM_025519 Chmp4c chromatin modifying protein 4C 0.3009667 7.59821 4.0519566 0.0263351 -1.3742637 6786666 NM_027860 0610010F05Rik RIKEN cDNA 0610010F05 gene 0.301485 7.59821 4.4095294 0.0171443 -0.7307205 6948107 NM_175314 Adamts9 a disintegrin-like and metallopeptidase (reprolysin0.301725 type) with7.59821 thrombospondin3.6724755 type0.0426729 1 motif, 9-2.0682381 6890617 NM_009939 Cops2 COP9 (constitutive photomorphogenic) homolog,0.3019883 subunit7.59821 2 (Arabidopsis3.969348 thaliana)0.0293164 -1.5245372 6919748 NM_026558 Fam92a family with sequence similarity 92, member0.3020133 A 7.59821 4.4029926 0.017282 -0.7423715 6748503 NM_008999 Rab23 RAB23, member RAS oncogene family 0.30234 7.59821 3.6222213 0.0451705 -2.1607004 6990027 NM_145617 Herc1 hect (homologous to the E6-AP (UBE3A) carboxyl0.3025367 terminus)7.59821 domain3.6602948 and RCC1 (CHC1)-like0.0430941 domain-2.0906408 (RLD) 1 6983339 BC055692 9130011J15Rik RIKEN cDNA 9130011J15 gene 0.3027117 7.59821 3.9660178 0.0294534 -1.530606 6854031 NM_172827 Lnpep leucyl/cystinyl aminopeptidase 0.3027417 7.59821 4.8153378 0.0106141 -0.0170103 6758325 NM_026430 Uxs1 UDP-glucuronate decarboxylase 1 0.3028917 7.59821 5.0471837 0.0081575 0.38155187 6837507 NM_177630 Ldoc1l leucine zipper, down-regulated in cancer 1-like0.3031817 7.59821 4.2147603 0.0217478 -1.0797583 6926029 NM_145554 Ldlrap1 low density lipoprotein receptor adaptor protein0.3033667 1 7.59821 3.7206649 0.0401318 -1.9796664 6912999 NM_001081413 Unc13b unc-13 homolog B (C. elegans) 0.3040283 7.59821 6.4329371 0.0017935 2.60677757 6999449 NM_153287 Csrnp1 cysteine-serine-rich nuclear protein 1 0.304125 7.59821 3.629903 0.0447667 -2.1465612 6844283 NM_144852 Slc7a4 solute carrier family 7 (cationic amino acid0.3043367 transporter, y+7.59821 system), 5.6286382member 4 0.0042207 1.34879522 6757127 NM_025773 Ube2w ubiquitin-conjugating enzyme E2W (putative)0.3044133 7.59821 4.4377622 0.0166145 -0.6804522 6816158 NM_027127 Gpx8 glutathione peroxidase 8 (putative) 0.3044317 7.59821 3.6715762 0.0426808 -2.0698919 6880087 NM_010230 Fmn1 formin 1 0.304555 7.59821 3.8203423 0.0352557 -1.7968064 6837127 NM_194342 Sun2 Sad1 and UNC84 domain containing 2 0.304715 7.59821 5.312914 0.0060412 0.82947123 6834013 NM_033074 Tars threonyl-tRNA synthetase 0.3047717 7.59821 4.8182305 0.010585 -0.0119944 5471747 NA NA NA 0.30478 7.59821 3.9489718 0.0300688 -1.561682 6871265 NM_207220 Gpr137 G protein-coupled receptor 137 0.3049067 7.59821 4.8812819 0.009888 0.09706677 6882669 NM_026968 Manbal mannosidase, beta A, lysosomal-like 0.305015 7.59821 3.6670826 0.0428743 -2.078156 6962752 NM_024220 Ndufc2 NADH dehydrogenase (ubiquinone) 1, subcomplex0.305055 unknown,7.59821 2 5.2989982 0.0061453 0.8062569 6918814 NM_023051 Clstn1 calsyntenin 1 0.3050583 7.59821 4.4203301 0.0169704 -0.7114798 4607035 NA NA NA 0.30506 7.59821 4.0111257 0.0278506 -1.448474 6934885 NM_024479 Wbscr27 Williams Beuren syndrome chromosome region0.305095 27 (human)7.59821 3.6456164 0.0438914 -2.1176448 6921918 NM_175518 D730040F13Rik RIKEN cDNA D730040F13 gene 0.30514 7.59821 5.4936878 0.0049502 1.12855681 6969017 NM_133722 Fam108c family with sequence similarity 108, member0.305465 C 7.59821 4.6493084 0.0128369 -0.306647 4539257 NA NA NA 0.305625 7.59821 3.6792129 0.042369 -2.055849 6851269 NM_027244 Ndufa11 NADH dehydrogenase (ubiquinone) 1 alpha0.3056867 subcomplex 117.59821 3.8631081 0.0334683 -1.7185181 6766835 NM_008983 Ptprk protein tyrosine phosphatase, receptor type,0.3059533 K 7.59821 4.1887093 0.022442 -1.1267251 6989933 NM_138584 Spg21 spastic paraplegia 21 homolog (human) 0.306115 7.59821 4.3995128 0.0173428 -0.7485756 6919741 NM_177861 Tmem67 transmembrane protein 67 0.3066333 7.59821 3.8801307 0.0325739 -1.6873868 6871275 NM_026675 Nudt22 nudix (nucleoside diphosphate linked moiety0.3068817 X)-type motif7.59821 22 4.9547994 0.0090889 0.22358121 6989672 NM_001083927 Tle3 transducin-like enhancer of split 3, homolog0.3069917 of Drosophila7.59821 E(spl) 4.3867274 0.0175897 -0.7713818 6870957 NM_144870 Ndufs8 NADH dehydrogenase (ubiquinone) Fe-S protein0.3075567 8 7.59821 4.9078898 0.009572 0.14293717 6793652 NM_009072 Rock2 Rho-associated coiled-coil containing protein0.3078517 kinase 2 7.59821 4.1035324 0.0248986 -1.2807169 6998670 NM_010017 Dag1 dystroglycan 1 0.3082767 7.59821 5.500468 0.0049119 1.13968417 6987046 NR_024025 Mtmr2 myotubularin related protein 2 0.3092467 7.59821 4.2220781 0.0215205 -1.0665766 6935035 NM_026073 Rabl5 RAB, member of RAS oncogene family-like0.3093617 5 7.59821 5.2337973 0.0065965 0.69712892 6814157 NM_175283 Srd5a1 steroid 5 alpha-reductase 1 0.3096317 7.59821 4.5517773 0.0145234 -0.4783462 6787019 NM_025745 Erlec1 endoplasmic reticulum lectin 1 0.3098217 7.59821 6.4175846 0.0018259 2.58364186 6784345 NM_008175 Grn granulin 0.31092 7.59821 4.9620195 0.0090165 0.23596799 6825207 NM_026598 Ebpl emopamil binding protein-like 0.3116083 7.59821 5.2157367 0.0067477 0.66679602 6811997 NM_144536 Cdkal1 CDK5 regulatory subunit associated protein0.3116667 1-like 1 7.59821 3.6262403 0.0449736 -2.1533026 6929719 NM_008037 Fosl2 fos-like antigen 2 0.311895 7.59821 4.751478 0.0113663 -0.1280084 6840175 NM_178665 Lpp LIM domain containing preferred translocation0.3119317 partner in7.59821 lipoma 5.5311996 0.0047046 1.19003756 6818212 NM_008133 Glud1 glutamate dehydrogenase 1 0.3119783 7.59821 6.9479291 0.0010869 3.36337281 6768157 NM_028732 4632428N05Rik RIKEN cDNA 4632428N05 gene 0.312405 7.59821 3.9808959 0.028918 -1.5034994 6874683 NM_016918 Nudt5 nudix (nucleoside diphosphate linked moiety0.3125933 X)-type motif7.59821 5 4.6521034 0.0128005 -0.3017432 6777614 NM_153059 Tmem5 transmembrane protein 5 0.3128183 7.59821 3.6214719 0.0451705 -2.1620799 5430153 NA NA NA 0.3129883 7.59821 4.6351387 0.0129959 -0.3315223 6924873 NM_146152 Ipo13 importin 13 0.313235 7.59821 5.3592759 0.0057851 0.90661584 6924691 NM_025647 Cmpk1 cytidine monophosphate (UMP-CMP) kinase0.3133117 1 7.59821 3.6524553 0.0434664 -2.1050624 6885871 NM_010065 Dnm1 dynamin 1 0.3139333 7.59821 4.4631455 0.016054 -0.6353313 6874542 NM_008708 Nmt2 N-myristoyltransferase 2 0.314065 7.59821 4.7969641 0.0108103 -0.0488939 6794648 NM_053122 Immp2l IMP2 inner mitochondrial membrane peptidase-like0.314585 (S. cerevisiae)7.59821 4.8453869 0.0102299 0.03504094 6850192 NM_008027 Flot1 flotillin 1 0.3147283 7.59821 6.6639191 0.0014126 2.95078022 6925558 NM_023485 Sync syncoilin 0.3151017 7.59821 5.829223 0.0033547 1.67130269 6757301 NM_133252 Tram2 translocating chain-associating membrane0.3159167 protein 2 7.59821 4.5322543 0.0148424 -0.5128488 6843928 NM_029582 Txndc11 thioredoxin domain containing 11 0.3161167 7.59821 4.2405562 0.0210362 -1.0333142 6875680 NM_001039386 Nelf nasal embryonic LHRH factor 0.316285 7.59821 3.960178 0.0296853 -1.54125 6998192 NM_029094 Pik3cb phosphatidylinositol 3-kinase, catalytic, beta0.3163517 polypeptide 7.59821 3.9294913 0.0306463 -1.5972211 5138467 NA NA NA 0.316495 7.59821 3.6726347 0.0426729 -2.0679453 6937522 NM_011716 Wfs1 Wolfram syndrome 1 homolog (human) 0.3167017 7.59821 6.0114914 0.0027844 1.95930484 6895532 NM_008862 Pkia protein kinase inhibitor, alpha 0.31676 7.59821 3.7963217 0.036239 -1.8408254 6764133 NM_011063 Pea15a phosphoprotein enriched in astrocytes 15A0.3169467 7.59821 5.4883121 0.0049777 1.11972963 6899028 NM_008231 Hdgf hepatoma-derived growth factor 0.3169917 7.59821 6.3596542 0.001934 2.49603706 6867761 NM_021474 Efemp2 epidermal growth factor-containing fibulin-like0.3170133 extracellular7.59821 matrix 4.1979987protein 2 0.022198 -1.1099703 6786991 NM_029344 Acyp2 acylphosphatase 2, muscle type 0.3170667 7.59821 4.2415114 0.0210173 -1.0315957 6992224 NM_008317 Hyal1 hyaluronoglucosaminidase 1 0.31738 7.59821 6.4194312 0.0018253 2.58642638 6756536 NM_008882 Plxna2 plexin A2 0.3176633 7.59821 4.4887109 0.0155846 -0.5899589 6773080 NM_009413 Tpd52l1 tumor protein D52-like 1 0.318485 7.59821 4.0573151 0.0262129 -1.3645345 6790478 NM_027421 Ints2 integrator complex subunit 2 0.318635 7.59821 5.9745515 0.0028852 1.90132588 6882515 NM_025947 Dynlrb1 dynein light chain roadblock-type 1 0.3186783 7.59821 6.4349535 0.0017925 2.60981363 6837428 NM_029787 Cyb5r3 cytochrome b5 reductase 3 0.3188 7.59821 5.889359 0.0031865 1.76685652 6924784 NM_001042743 Mast2 microtubule associated serine/threonine kinase0.3192933 2 7.59821 6.8658648 0.0011496 3.24532103 4315244 NA NA NA 0.31972 7.59821 4.4432181 0.0165059 -0.6707479 6985942 NM_009698 Aprt adenine phosphoribosyl transferase 0.3197983 7.59821 5.3417457 0.0058809 0.87748178 6960562 NM_028031 Zdhhc13 zinc finger, DHHC domain containing 13 0.3208817 7.59821 5.164031 0.0071662 0.57970691 6980943 NM_001162947 Nek3 NIMA (never in mitosis gene a)-related expressed0.3211683 kinase 37.59821 4.2933445 0.0196922 -0.9384721 6833100 NM_007581 Cacnb3 calcium channel, voltage-dependent, beta0.3211717 3 subunit 7.59821 4.783343 0.0109801 -0.072558 6784485 NM_007477 Arf2 ADP-ribosylation factor 2 0.3213133 7.59821 4.1289551 0.0241907 -1.2346883 6855134 NM_011655 Tubb5 tubulin, beta 5 0.321345 7.59821 4.0804525 0.0256211 -1.3225514 6932601 NM_175473 Fras1 Fraser syndrome 1 homolog (human) 0.3213983 7.59821 4.0843816 0.0255339 -1.3154264 6790536 NM_025638 Gdpd1 glycerophosphodiester phosphodiesterase0.3216117 domain containing7.59821 1 3.6696467 0.0427467 -2.0734403 6941193 NM_175016 Alkbh2 alkB, alkylation repair homolog 2 (E. coli) 0.3225867 7.59821 4.2620484 0.0204925 -0.9946673 6957125 NM_013509 Eno2 enolase 2, gamma neuronal 0.322625 7.59821 3.9899257 0.0286766 -1.4870559 6989152 NM_212445 Kdelc2 KDEL (Lys-Asp-Glu-Leu) containing 2 0.3229167 7.59821 5.5542731 0.0045865 1.22775446 6951118 NM_001170433 Ppfibp1 PTPRF interacting protein, binding protein 10.323045 (liprin beta 1)7.59821 4.1136123 0.0245701 -1.2624603 6876161 NM_145144 Aif1l allograft inflammatory factor 1-like 0.323225 7.59821 4.323373 0.0190415 -0.8846444 6870172 NM_026377 6330577E15Rik RIKEN cDNA 6330577E15 gene 0.3233433 7.59821 4.1480122 0.0235916 -1.2002216 6839052 NM_031184 Glis2 GLIS family zinc finger 2 0.32359 7.59821 4.4000679 0.017341 -0.7475858 6891905 NM_009976 Cst3 cystatin C 0.3239017 7.59821 4.5210651 0.0150219 -0.532643 7012681 NM_010833 Msn moesin 0.3239667 7.59821 5.9847535 0.0028576 1.91735814 6839746 NM_025808 Lztr1 leucine-zipper-like transcriptional regulator,0.3239967 1 7.59821 4.7088128 0.0119173 -0.2024509 4750808 NA NA NA 0.3244483 7.59821 3.7076148 0.0408187 -2.0036425 6813410 NM_134059 Ddx41 DEAD (Asp-Glu-Ala-Asp) box polypeptide 410.3245967 7.59821 5.4129552 0.0055023 0.9955582 6839681 NM_026163 Pkp2 plakophilin 2 0.3250867 7.59821 5.8602333 0.0032724 1.72064238 6774947 NM_134007 Cisd1 CDGSH iron sulfur domain 1 0.3255833 7.59821 3.5421167 0.0496222 -2.3082445 6870697 NM_181415 Atrnl1 attractin like 1 0.3256217 7.59821 4.3795237 0.0176721 -0.7842392 6853780 NM_010515 Igf2r insulin-like growth factor 2 receptor 0.3257483 7.59821 6.2117026 0.0022118 2.27009918 6782034 NM_026991 Sat2 spermidine/spermine N1-acetyl transferase0.3258317 2 7.59821 3.9099585 0.031445 -1.632882 6876109 NM_019681 Ncs1 neuronal calcium sensor 1 0.32618 7.59821 3.6560833 0.0433123 -2.098388 6832923 NM_175344 Ano6 anoctamin 6 0.3262733 7.59821 6.7345599 0.0013254 3.05446672 6921130 NM_023231 Stoml2 stomatin (Epb7.2)-like 2 0.3268767 7.59821 5.1361018 0.0073507 0.53251241 6885930 NM_175211 Ralgps1 Ral GEF with PH domain and SH3 binding motif0.3275517 1 7.59821 4.9970903 0.008614 0.29603673 6881291 NM_023043 Prnd prion protein dublet 0.3281367 7.59821 4.9206751 0.0094633 0.16494542 6753083 NM_173865 Slc41a1 solute carrier family 41, member 1 0.3282183 7.59821 4.5838608 0.0138673 -0.4217412 6761691 NM_001037999 Dbi diazepam binding inhibitor 0.3282917 7.59821 6.3234955 0.0019941 2.44111098 5464701 NA NA NA 0.3282933 7.59821 5.1451366 0.0073067 0.54779104 6996703 NM_026599 Cgnl1 cingulin-like 1 0.32834 7.59821 5.0705282 0.0079492 0.42128856 6937597 NM_011715 Wdr1 WD repeat domain 1 0.3283883 7.59821 6.2173588 0.002205 2.27879504 6944184 NM_027992 Tmem106b transmembrane protein 106B 0.32839 7.59821 5.599344 0.0043781 1.30120922 6763495 NM_013862 Rabgap1l RAB GTPase activating protein 1-like 0.3286833 7.59821 5.1501851 0.0072658 0.55632362 6925579 NM_018799 Eif3i eukaryotic translation initiation factor 3, subunit0.32873 I 7.59821 4.1792682 0.0226701 -1.1437619 6899251 NM_146131 Pbxip1 pre-B-cell leukemia transcription factor interacting0.3287717 protein7.59821 1 5.371345 0.0057292 0.92664886 6901055 NM_027135 Sec24d Sec24 related gene family, member D (S. cerevisiae)0.328875 7.59821 5.1397057 0.0073354 0.53860822 6919927 NM_026172 Decr1 2,4-dienoyl CoA reductase 1, mitochondrial0.3289617 7.59821 4.5053433 0.0152973 -0.5604797 6867655 NM_027196 Pold4 polymerase (DNA-directed), delta 4 0.3292967 7.59821 3.7312051 0.0395595 -1.960307 6940006 NM_007644 Scarb2 scavenger receptor class B, member 2 0.329305 7.59821 4.2931953 0.0196922 -0.9387396 6785114 NM_001163753 Rab37 RAB37, member of RAS oncogene family 0.3293483 7.59821 3.7634124 0.0378545 -1.9011836 6872496 NM_021299 Ak3 adenylate kinase 3 0.3297283 7.59821 5.0273059 0.0083375 0.34765837 6819154 NM_022993 Lrp10 low-density lipoprotein receptor-related protein0.33015 10 7.59821 5.1970438 0.0069049 0.63535374 6982155 NM_207213 Snx25 sorting nexin 25 0.3303283 7.59821 4.305242 0.0193873 -0.9171343 6843184 NM_008338 Ifngr2 interferon gamma receptor 2 0.3303717 7.59821 5.4355345 0.0053538 1.03284851 7019923 NM_019496 Ammecr1 Alport syndrome, mental retardation, midface0.3303917 hypoplasia7.59821 and elliptocytosis5.3497703 chromosomal0.005847 region0.89082348 gene 1 homolog (human) 6845348 NM_133704 Sec22a SEC22 vesicle trafficking protein homologe A0.33093 (S. cerevisiae)7.59821 4.5886645 0.0137918 -0.4132762 6942941 BC048077 AU022870 expressed sequence AU022870 0.3309983 7.59821 3.7716232 0.0373855 -1.8861191 6878511 NM_024181 Dnajc10 DnaJ (Hsp40) homolog, subfamily C, member 100.3311 7.59821 5.6684517 0.0040419 1.41327109 7016713 NM_012019 Aifm1 apoptosis-inducing factor, mitochondrion-associated0.3318333 1 7.59821 5.556073 0.0045861 1.23069352 6772736 NM_010167 Eya4 eyes absent 4 homolog (Drosophila) 0.33185 7.59821 4.014907 0.0277194 -1.441596 6843880 NM_007929 Emp2 epithelial membrane protein 2 0.332115 7.59821 4.8657224 0.0100837 0.07020064 6778972 NM_207655 Egfr epidermal growth factor receptor 0.3323467 7.59821 3.5785695 0.04758 -2.2410816 6973152 NM_027189 Gemin7 gem (nuclear organelle) associated protein0.3331517 7 7.59821 4.7469035 0.0113959 -0.1359791 6784241 NM_011550 Mlx MAX-like protein X 0.3333167 7.59821 4.7766213 0.0110262 -0.0842442 6771644 NM_019953 Cnpy2 canopy 2 homolog (zebrafish) 0.3337033 7.59821 3.7842222 0.0367464 -1.8630102 6981604 NM_019733 Rbpms RNA binding protein gene with multiple splicing0.3341717 7.59821 4.9715886 0.0089069 0.25237395 6867715 NM_145495 Rin1 Ras and Rab interactor 1 0.334475 7.59821 5.2655054 0.0064016 0.75027337 6837787 NM_001159521 Plxnb2 plexin B2 0.334725 7.59821 5.4221303 0.0054294 1.01071992 6926936 NM_001081274 Pgd phosphogluconate dehydrogenase 0.3350283 7.59821 5.9245889 0.0030397 1.82259179 6775846 NM_144807 Chpt1 choline phosphotransferase 1 0.33512 7.59821 3.8604718 0.0335861 -1.7233411 7017513 NM_017369 Gabre gamma-aminobutyric acid (GABA) A receptor,0.3355683 subunit epsilon7.59821 3.5556409 0.0486887 -2.2833232 6870566 NM_027976 Acsl5 acyl-CoA synthetase long-chain family member0.33562 5 7.59821 4.552226 0.0145234 -0.4775537 7016421 NM_001110142 Cul4b cullin 4B 0.3358767 7.59821 4.3174027 0.0191478 -0.8953393 6850646 NM_028662 Slc35b2 solute carrier family 35, member B2 0.3359817 7.59821 4.8518904 0.0102299 0.04629116 6778047 NM_011772 Ikzf4 IKAROS family zinc finger 4 0.336075 7.59821 4.4085467 0.0171589 -0.7324717 6966308 NM_027215 Tmem147 transmembrane protein 147 0.33625 7.59821 4.4290749 0.0167709 -0.6959106 6871002 NM_007485 Rhod ras homolog gene family, member D 0.3364183 7.59821 5.2150826 0.0067477 0.66569662 6762017 NM_008567 Mcm6 minichromosome maintenance deficient 6 (MIS50.33684 homolog,7.59821 S. pombe)5.028416 (S. cerevisiae)0.0083375 0.34955248 7010326 NM_133669 Rp2h retinitis pigmentosa 2 homolog (human) 0.3368867 7.59821 3.9814264 0.028918 -1.5025331 4585269 NA NA NA 0.3373567 7.59821 4.0578656 0.0262129 -1.3635351 6962054 NM_008803 Pde8a phosphodiesterase 8A 0.3374983 7.59821 3.7715615 0.0373855 -1.8862322 6997555 NM_199316 4922501C03Rik RIKEN cDNA 4922501C03 gene 0.337555 7.59821 4.1883907 0.022442 -1.1272999 5547572 NA NA NA 0.33758 7.59821 4.1543719 0.0233601 -1.1887265 6801823 NM_012024 Ppp2r5e protein phosphatase 2, regulatory subunit B0.338125 (B56), epsilon7.59821 isoform 5.8270601 0.0033547 1.66785609 6972750 NM_008817 Peg3 paternally expressed 3 0.3388717 7.59821 4.9836891 0.0087771 0.27310261 6797230 NM_178914 Spata7 spermatogenesis associated 7 0.3389583 7.59821 4.0620495 0.0261214 -1.3559404 6987490 NM_028472 Bmper BMP-binding endothelial regulator 0.3394283 7.59821 5.3903969 0.005613 0.95823048 6917366 NM_026441 Pef1 penta-EF hand domain containing 1 0.33978 7.59821 4.3850679 0.0175998 -0.7743433 6763129 NM_008485 Lamc2 laminin, gamma 2 0.339985 7.59821 3.5880458 0.047063 -2.223627 6917270 NM_016895 Ak2 adenylate kinase 2 0.340015 7.59821 3.779641 0.0370176 -1.8714119 6955653 NM_001029850 Magi1 membrane associated guanylate kinase, WW0.340235 and PDZ domain7.59821 containing5.6363791 1 0.0042033 1.36134911 6790655 NM_029023 Scpep1 serine carboxypeptidase 1 0.34129 7.59821 5.295257 0.0061663 0.80001118 6954994 NM_019752 Htra2 HtrA serine peptidase 2 0.3415383 7.59821 6.5579198 0.0015805 2.7938626 6782016 NM_030083 Lsmd1 LSM domain containing 1 0.34202 7.59821 4.1924346 0.0223846 -1.120005 6792079 NM_011268 Rgs9 regulator of G-protein signaling 9 0.342195 7.59821 5.5861903 0.0044456 1.27980198 6888744 NM_026721 Slc39a13 solute carrier family 39 (metal ion transporter),0.342385 member 137.59821 5.2853971 0.0062421 0.78354134 6996444 NM_030717 Lactb lactamase, beta 0.3434 7.59821 3.6891887 0.0418593 -2.0375085 6967542 NM_153578 Nipa1 non imprinted in Prader-Willi/Angelman syndrome0.34383 1 homolog7.59821 (human)4.0054155 0.0280215 -1.4588626 6949094 NM_134159 Il17rc interleukin 17 receptor C 0.34442 7.59821 4.2910358 0.0197412 -0.9426141 6918158 NM_010139 Epha2 Eph receptor A2 0.3444883 7.59821 5.3788567 0.0056851 0.93910681 6754047 NM_177756 Glt25d2 glycosyltransferase 25 domain containing 20.3450167 7.59821 3.5856207 0.0471707 -2.2280936 6996267 NM_026507 Zwilch Zwilch, kinetochore associated, homolog (Drosophila)0.3450517 7.59821 4.7322385 0.0115415 -0.1615497 6934322 NM_026486 Tctn2 tectonic family member 2 0.3453183 7.59821 5.8239253 0.0033631 1.66285963 6769735 NM_029166 Uhrf1bp1l UHRF1 (ICBP90) binding protein 1-like 0.34555 7.59821 6.6551491 0.0014142 2.93785827 6972115 NM_026928 1810014F10Rik RIKEN cDNA 1810014F10 gene 0.345975 7.59821 3.7791075 0.0370311 -1.8723906 6904130 NM_026222 Ccdc39 coiled-coil domain containing 39 0.346185 7.59821 5.7510955 0.0036585 1.54637807 6782093 NM_007864 Dlg4 discs, large homolog 4 (Drosophila) 0.346445 7.59821 5.2124719 0.0067677 0.66130793 6966720 NM_001033530 AW146154 expressed sequence AW146154 0.3471167 7.59821 4.28483 0.019905 -0.9537511 6934126 NM_019780 Vps29 vacuolar protein sorting 29 (S. pombe) 0.34727 7.59821 6.0498159 0.0026635 2.01924752 6892393 NM_010579 Eif6 eukaryotic translation initiation factor 6 0.34748 7.59821 4.2231551 0.0215095 -1.064637 6793050 ENSMUST000000379532810032G03Rik RIKEN cDNA 2810032G03 gene 0.34758 7.59821 3.5734895 0.0477425 -2.2504394 6988741 NM_011792 Bace1 beta-site APP cleaving enzyme 1 0.3476467 7.59821 6.2646692 0.0021198 2.35134869 6798180 NM_011632 Traf3 TNF receptor-associated factor 3 0.34813 7.59821 5.9383527 0.0029985 1.84431783 6795869 NM_028339 Tmx1 thioredoxin-related transmembrane protein0.3481633 1 7.59821 3.8301407 0.0349685 -1.7788598 6770030 NM_007569 Btg1 B-cell translocation gene 1, anti-proliferative0.3483833 7.59821 5.4230795 0.0054294 1.01228777 5582677 NA NA NA 0.3485833 7.59821 4.2503658 0.020805 -1.0156693 6818722 NM_008477 Ktn1 kinectin 1 0.348925 7.59821 3.5367402 0.0497898 -2.3181532 6825684 NM_011366 Sorbs3 sorbin and SH3 domain containing 3 0.3489583 7.59821 4.6957296 0.0121143 -0.2253236 6810782 NM_019703 Pfkp phosphofructokinase, platelet 0.3495467 7.59821 4.7504291 0.0113748 -0.1298358 6981125 NM_177089 Tacc1 transforming, acidic coiled-coil containing 0.3497567protein 1 7.59821 7.1338922 0.0008931 3.62741738 6756790 NM_008651 Mybl1 myeloblastosis oncogene-like 1 0.349785 7.59821 5.3598059 0.0057851 0.90749603 6942558 NM_008788 Pcolce procollagen C-endopeptidase enhancer protein0.3500517 7.59821 5.3437259 0.0058705 0.88077486 6897707 NM_001113413 Rnf13 ring finger protein 13 0.350605 7.59821 5.0024893 0.0085554 0.30526946 6828005 NM_028651 Tmtc4 transmembrane and tetratricopeptide repeat0.3514033 containing 7.598214 6.2612347 0.002126 2.34609261 4582400 NA NA NA 0.3521717 7.59821 4.1331605 0.0240759 -1.2270796 6878430 NM_009454 Ube2e3 ubiquitin-conjugating enzyme E2E 3, UBC4/50.3523167 homolog (yeast)7.59821 5.9778506 0.0028761 1.906512 6826179 NM_025384 Dnajc15 DnaJ (Hsp40) homolog, subfamily C, member0.3526917 15 7.59821 4.7971396 0.0108103 -0.0485892 6778560 NM_010956 Ogdh oxoglutarate dehydrogenase (lipoamide) 0.3533283 7.59821 4.9321352 0.0093398 0.18465437 6841160 NM_026439 Ccdc80 coiled-coil domain containing 80 0.3533817 7.59821 5.1115729 0.0076074 0.49097569 6963202 NM_011421 Smpd1 sphingomyelin phosphodiesterase 1, acid lysosomal0.35357 7.59821 6.9139045 0.0011049 3.31454187 6785632 NM_015749 Tcn2 transcobalamin 2 0.35416 7.59821 4.0361974 0.0268828 -1.4028906 6919944 NM_138952 Ripk2 receptor (TNFRSF)-interacting serine-threonine0.35478 kinase 2 7.59821 4.1148955 0.0245701 -1.2601368 6796208 NM_206534 Churc1 churchill domain containing 1 0.354815 7.59821 4.3433521 0.0185824 -0.8488817 6964241 NM_175103 Bola2 bolA-like 2 (E. coli) 0.3549467 7.59821 4.9014904 0.0096651 0.13191333 6815490 NM_008634 Mtap1b microtubule-associated protein 1B 0.35512 7.59821 4.6476974 0.0128412 -0.3094741 6798403 NM_133762 Ncapg2 non-SMC condensin II complex, subunit G2 0.355425 7.59821 4.8009505 0.0107632 -0.0419727 6867925 NM_146091 Atl3 atlastin GTPase 3 0.3554667 7.59821 5.5579167 0.0045799 1.23370351 6934130 NM_019824 Arpc3 actin related protein 2/3 complex, subunit0.3556867 3 7.59821 6.1266461 0.0024275 2.13877398 6868650 NM_031997 Tmem2 transmembrane protein 2 0.3559183 7.59821 3.6409136 0.0441583 -2.1262983 5282565 NA NA NA 0.356245 7.59821 3.8118575 0.035688 -1.8123516 6986066 NM_175149 2310022B05Rik RIKEN cDNA 2310022B05 gene 0.3562717 7.59821 6.5821483 0.0015454 2.82987096 6854259 NM_001008425 Thoc6 THO complex 6 homolog (Drosophila) 0.3564217 7.59821 4.7407154 0.0114576 -0.1467658 6965593 NM_009156 Sepw1 selenoprotein W, muscle 1 0.35719 7.59821 5.2500488 0.0064854 0.72438469 6890713 NM_016902 Nphp1 nephronophthisis 1 (juvenile) homolog (human)0.3576317 7.59821 5.3607202 0.0057851 0.90901438 6899520 NM_009112 S100a10 S100 calcium binding protein A10 (calpactin)0.3598733 7.59821 3.8443403 0.0343881 -1.7528616 6766240 NM_010828 Cited2 Cbp/p300-interacting transactivator, with 0.3601017Glu/Asp-rich carboxy-terminal7.59821 5.7017567 domain,0.0038869 2 1.46703102 6806933 NM_013610 Ninj1 ninjurin 1 0.3609467 7.59821 5.2279762 0.006651 0.68735733 6844348 NM_213614 5-Sep septin 5 0.361645 7.59821 4.7455917 0.0114048 -0.1382654 6824961 NM_026526 N6amt2 N-6 adenine-specific DNA methyltransferase0.3618233 2 (putative) 7.59821 3.5612565 0.0484393 -2.2729762 6786945 NM_025740 Ccdc104 coiled-coil domain containing 104 0.3620267 7.59821 3.8740978 0.0328906 -1.6984179 6999579 NM_133979 Ano10 anoctamin 10 0.3624517 7.59821 6.2377911 0.0021877 2.31016913 6868018 NM_021890 Fads3 fatty acid desaturase 3 0.363155 7.59821 7.5397048 0.0005897 4.18721075 6906753 NM_001002011 Lmna lamin A 0.3634583 7.59821 4.9121326 0.0095365 0.15024291 6993834 NM_145611 Kank2 KN motif and ankyrin repeat domains 2 0.364075 7.59821 5.253686 0.0064854 0.73047979 5272827 NA NA NA 0.3648367 7.59821 3.6541299 0.0433821 -2.1019816 6980968 NM_001122820 Ap3m2 adaptor-related protein complex 3, mu 2 subunit0.3652167 7.59821 5.0943684 0.0077588 0.46179307 4393485 NA NA NA 0.3655567 7.59821 3.5994233 0.0464424 -2.2026741 6784280 NM_144830 Tmem106a transmembrane protein 106A 0.3659283 7.59821 4.0627961 0.0261214 -1.3545852 6784363 NM_001110778 Adam11 a disintegrin and metallopeptidase domain0.3660967 11 7.59821 5.3396452 0.0058839 0.87398796 6961913 NM_018811 Abhd2 abhydrolase domain containing 2 0.3662883 7.59821 5.0519778 0.0081198 0.38971833 6820109 NM_010071 Dok2 docking protein 2 0.3670717 7.59821 3.7860238 0.0366781 -1.8597064 6964428 NM_178641 Inpp5f inositol polyphosphate-5-phosphatase F 0.3672767 7.59821 5.3062313 0.0060984 0.81832646 6955431 NM_008881 Plxna1 plexin A1 0.3674467 7.59821 5.8421866 0.0033328 1.6919457 6923059 NM_007408 Plin2 perilipin 2 0.3676717 7.59821 4.5189028 0.0150647 -0.53647 6926881 NM_015797 Fbxo6 F-box protein 6 0.3682333 7.59821 6.9991771 0.0010337 3.43661747 6946475 NM_012056 Fkbp9 FK506 binding protein 9 0.3685267 7.59821 4.721841 0.0116787 -0.1796954 6882264 NM_029688 Srxn1 sulfiredoxin 1 homolog (S. cerevisiae) 0.369015 7.59821 3.8029918 0.0359637 -1.8285989 6798213 NM_009396 Tnfaip2 tumor necrosis factor, alpha-induced protein0.3690767 2 7.59821 5.1594519 0.0072009 0.57197654 6899660 NM_172395 Cdc42se1 CDC42 small effector 1 0.369245 7.59821 6.351727 0.0019441 2.48401167 6885195 NM_001128084 Arhgap21 Rho GTPase activating protein 21 0.369395 7.59821 5.5648026 0.0045443 1.24494114 6921131 BC046771 B230312A22Rik RIKEN cDNA B230312A22 gene 0.36996 7.59821 5.6649526 0.0040556 1.40761356 7015941 NM_177353 Slc9a7 solute carrier family 9 (sodium/hydrogen exchanger),0.37026 member7.59821 7 3.9068384 0.0315403 -1.6385807 6945335 NM_145575 Cald1 caldesmon 1 0.370665 7.59821 4.6231432 0.0131819 -0.3525994 6934976 NM_011293 Polr2j polymerase (RNA) II (DNA directed) polypeptide0.3709633 J 7.59821 4.5254959 0.0149202 -0.5248031 6875720 NM_008721 Npdc1 neural proliferation, differentiation and control0.3712717 gene 1 7.59821 4.7749743 0.0110455 -0.0871085 6972178 NM_001172100 Rnh1 ribonuclease/angiogenin inhibitor 1 0.3715333 7.59821 5.8152295 0.0033849 1.64899233 6989038 NM_009964 Cryab crystallin, alpha B 0.3716917 7.59821 5.4248067 0.0054225 1.01514031 6827825 NM_001081252 Uggt2 UDP-glucose glycoprotein glucosyltransferase0.3720967 2 7.59821 4.494515 0.0154751 -0.5796682 6854514 NM_007523 Bak1 BCL2-antagonist/killer 1 0.372545 7.59821 4.2522529 0.020752 -1.0122758 6757732 NM_008922 Prim2 DNA primase, p58 subunit 0.3726283 7.59821 4.1151887 0.0245701 -1.2596059 6968683 NM_008594 Mfge8 milk fat globule-EGF factor 8 protein 0.3726367 7.59821 6.2173828 0.002205 2.2788319 6798281 NM_001024602 AW555464 expressed sequence AW555464 0.3729183 7.59821 3.8053828 0.0359102 -1.8242167 6885422 NM_009422 Traf2 TNF receptor-associated factor 2 0.372985 7.59821 5.0119586 0.0084613 0.32145361 6977778 NM_011563 Prdx2 peroxiredoxin 2 0.37305 7.59821 3.5935123 0.0466936 -2.2135594 6965944 NM_010719 Lipe lipase, hormone sensitive 0.37336 7.59821 3.6622681 0.0430893 -2.0870112 6769138 NM_009768 Bsg basigin 0.3733617 7.59821 6.8273059 0.0012005 3.1895268 6907202 NM_144899 Adamtsl4 ADAMTS-like 4 0.37405 7.59821 5.8744202 0.0032248 1.74316841 7010644 NM_001009947 Dock11 dedicator of cytokinesis 11 0.3745683 7.59821 4.4955167 0.015464 -0.5778926 6957331 NR_027360 5930416I19Rik RIKEN cDNA 5930416I19 gene 0.3746217 7.59821 4.940283 0.0092432 0.1986563 6933073 NM_008861 Pkd2 polycystic kidney disease 2 0.3750383 7.59821 8.6122212 0.000228 5.56389808 6789343 NM_009601 Chrnb1 cholinergic receptor, nicotinic, beta polypeptide0.3752667 1 (muscle)7.59821 6.6594227 0.0014142 2.94415643 4423030 NA NA NA 0.3756783 7.59821 3.8300369 0.0349685 -1.7790498 6794518 NM_178629 Ispd isoprenoid synthase domain containing 0.3758517 7.59821 5.0631395 0.0080196 0.40871956 6873663 NM_021377 Sorcs1 VPS10 domain receptor protein SORCS 1 0.3784283 7.59821 3.7726135 0.0373591 -1.8843024 6976190 NM_001005847 Aga aspartylglucosaminidase 0.3788567 7.59821 4.6378905 0.0129765 -0.3266895 6786046 NM_010345 Grb10 growth factor receptor bound protein 10 0.379125 7.59821 5.2351964 0.0065903 0.69947675 5609689 NA NA NA 0.3792617 7.59821 4.8141071 0.0106248 -0.0191445 6968772 NM_011870 Cib1 calcium and integrin binding 1 (calmyrin) 0.3794533 7.59821 3.655936 0.0433123 -2.098659 4461072 NA NA NA 0.3795367 7.59821 4.3243883 0.0190232 -0.8828261 6974195 NM_181854 Zfp828 zinc finger protein 828 0.3797683 7.59821 5.3647984 0.0057735 0.91578501 6859406 NM_207650 Dtna dystrobrevin alpha 0.37993 7.59821 5.1941415 0.0069194 0.63046756 6811724 NM_026825 Lrrc16a leucine rich repeat containing 16A 0.38015 7.59821 4.0390441 0.026802 -1.3977181 6950070 NM_008021 Foxm1 forkhead box M1 0.380275 7.59821 3.7502844 0.0386104 -1.9252767 6809550 NM_027592 Taf9 TAF9 RNA polymerase II, TATA box binding0.3804183 protein (TBP)-associated7.59821 3.8246701 factor 0.0352095 -1.7888789 5357768 NA NA NA 0.3805617 7.59821 4.1142813 0.0245701 -1.2612489 6773174 NM_172508 Dse dermatan sulfate epimerase 0.3806867 7.59821 5.9966504 0.0028216 1.93603491 6983234 NM_026964 Ccdc124 coiled-coil domain containing 124 0.38082 7.59821 4.2836772 0.0199227 -0.9558203 6756358 NM_025864 Tmem206 transmembrane protein 206 0.3809917 7.59821 4.4815207 0.0157442 -0.6027124 6929109 NM_175437 Pion pigeon homolog (Drosophila) 0.3812167 7.59821 4.2287902 0.0213792 -1.0544904 6790902 NM_008704 Nme1 non-metastatic cells 1, protein (NM23A) expressed0.3813617 in 7.59821 5.8081557 0.0034165 1.6377035 6859474 NM_175276 Fhod3 formin homology 2 domain containing 3 0.38137 7.59821 4.848644 0.0102299 0.04067606 6955879 NM_053202 Foxp1 forkhead box P1 0.3813867 7.59821 7.5003563 0.0006169 4.13390149 6846029 NM_021496 Pvrl3 poliovirus receptor-related 3 0.3814083 7.59821 5.3912454 0.005613 0.9596359 6962751 NM_199035 Alg8 asparagine-linked glycosylation 8 homolog0.3814117 (yeast, alpha-1,3-glucosyltransferase)7.59821 5.3841025 0.0056537 0.94780221 6953763 NM_153573 Fkbp14 FK506 binding protein 14 0.382005 7.59821 4.3869808 0.0175897 -0.7709297 6766863 NM_025855 Echdc1 enoyl Coenzyme A hydratase domain containing0.38213 1 7.59821 4.3203696 0.0191031 -0.8900241 7011263 NM_027642 Phf6 PHD finger protein 6 0.3826433 7.59821 3.552459 0.0489175 -2.2891862 6965598 NM_153068 Ehd2 EH-domain containing 2 0.3833233 7.59821 6.1270969 0.0024275 2.13947267 6968828 NM_007755 Cpeb1 cytoplasmic polyadenylation element binding0.383555 protein 1 7.59821 7.3829681 0.0006992 3.9736364 6916540 NM_181585 Pik3r3 phosphatidylinositol 3 kinase, regulatory subunit,0.3836283 polypeptide7.59821 3 (p55)4.6341822 0.0129959 -0.3332023 6775518 NM_029102 Glt8d2 glycosyltransferase 8 domain containing 2 0.3838433 7.59821 5.2930267 0.0061794 0.79628699 6998706 NM_031392 Wdr6 WD repeat domain 6 0.384065 7.59821 3.5564153 0.0486887 -2.2818961 6900659 NM_001163514 Extl2 exostoses (multiple)-like 2 0.3840667 7.59821 4.8457339 0.0102299 0.03564147 6963213 NM_010562 Ilk integrin linked kinase 0.3845617 7.59821 8.6582564 0.0002194 5.61982651 6872646 NM_018830 Asah2 N-acylsphingosine amidohydrolase 2 0.38463 7.59821 4.7831709 0.0109801 -0.0728571 7014178 NM_001163155 Col4a5 collagen, type IV, alpha 5 0.384695 7.59821 4.6502133 0.0128296 -0.3050593 6766250 NM_138628 Txlnb taxilin beta 0.38473 7.59821 5.0904399 0.0077796 0.4551238 6760177 NM_010570 Irs1 insulin receptor substrate 1 0.384975 7.59821 4.3663558 0.0179489 -0.8077559 6982094 NM_008455 Klkb1 kallikrein B, plasma 1 0.38523 7.59821 7.0284068 0.0010016 3.47822946 6822891 NM_011243 Rarb retinoic acid receptor, beta 0.38538 7.59821 3.8959905 0.0319372 -1.6583987 6885937 NM_027947 Zbtb43 zinc finger and BTB domain containing 43 0.3857533 7.59821 5.0308836 0.0083184 0.35376258 6953906 NM_026004 Nt5c3 5'-nucleotidase, cytosolic III 0.3858067 7.59821 5.0600128 0.0080415 0.40339844 4918982 NA NA NA 0.3860867 7.59821 3.8299222 0.0349685 -1.7792599 6864678 NM_026027 Pfdn1 prefoldin 1 0.3861667 7.59821 4.8500545 0.0102299 0.04311594 6813070 NM_207232 Ptpdc1 protein tyrosine phosphatase domain containing0.38654 1 7.59821 5.0449529 0.0081751 0.37775067 6810717 NM_018859 Akr1e1 aldo-keto reductase family 1, member E1 0.3871917 7.59821 6.3831992 0.0018896 2.53170125 6951440 NM_015829 Slc25a13 solute carrier family 25 (mitochondrial carrier,0.387415 adenine nucleotide7.59821 translocator),4.3966926 0.0173988 member 13 -0.7536047 6908800 NM_008991 Abcd3 ATP-binding cassette, sub-family D (ALD), member0.3874533 3 7.59821 5.3052886 0.0060984 0.81675386 6768065 NM_008297 Hsf2 heat shock factor 2 0.38754 7.59821 4.076837 0.0257506 -1.3291089 6911805 NM_173746 Gm11818 predicted gene 11818 0.387635 7.59821 3.8533264 0.0339434 -1.7364151 6748605 NM_015818 Hs6st1 heparan sulfate 6-O-sulfotransferase 1 0.3883283 7.59821 4.5778717 0.0139989 -0.4322987 6860929 NM_029394 Snx24 sorting nexing 24 0.3890267 7.59821 4.5068882 0.0152702 -0.557743 6880621 NM_030234 Wdr76 WD repeat domain 76 0.38923 7.59821 4.7360323 0.0114945 -0.1549321 6951453 NM_009169 Shfm1 split hand/foot malformation (ectrodactyly) type0.38931 1 7.59821 6.2317721 0.0022028 2.30093311 6926116 NM_026383 Pnrc2 proline-rich nuclear receptor coactivator 20.3898983 7.59821 5.8432306 0.0033328 1.69360707 6909310 NM_025779 Ccdc109b coiled-coil domain containing 109B 0.3901 7.59821 3.592142 0.046786 -2.2160831 6790774 NM_028011 Tom1l1 target of myb1-like 1 (chicken) 0.39121 7.59821 5.1774719 0.0070464 0.60238125 6763132 NM_010683 Lamc1 laminin, gamma 1 0.3916317 7.59821 6.7506037 0.0013024 3.0779172 6771995 NM_177387 Ust uronyl-2-sulfotransferase 0.3918417 7.59821 6.2033171 0.0022352 2.25719874 6807192 NM_028841 Tspan17 tetraspanin 17 0.392555 7.59821 6.1427894 0.0023832 2.16377945 6889219 NM_178886 Ldlrad3 low density lipoprotein receptor class A domain0.3927933 containing7.59821 3 3.7396013 0.0391363 -1.944889 6949797 NM_145130 Lpcat3 lysophosphatidylcholine acyltransferase 3 0.392985 7.59821 5.9890726 0.0028491 1.92414113 6951525 NM_012055 Asns asparagine synthetase 0.3932733 7.59821 3.8240353 0.0352121 -1.7900417 6955025 NM_008638 Mthfd2 methylenetetrahydrofolate dehydrogenase0.3936833 (NAD+ dependent),7.59821 methenyltetrahydrofolate4.3860747 0.0175897 cyclohydrolase-0.7725465 6899626 NM_017395 Rfx5 regulatory factor X, 5 (influences HLA class0.3939217 II expression) 7.59821 7.4437811 0.0006535 4.05689204 6758027 NM_018775 Tbc1d8 TBC1 domain family, member 8 0.3941517 7.59821 5.6869143 0.0039521 1.44309259 6917125 NM_172701 Oscp1 organic solute carrier partner 1 0.39428 7.59821 6.4063042 0.0018478 2.56662111 6985399 NM_009954 Bcar1 breast cancer anti-estrogen resistance 1 0.3943767 7.59821 6.3672723 0.0019166 2.50758512 6838417 NM_011653 Tuba1a tubulin, alpha 1A 0.3949783 7.59821 5.0919227 0.0077703 0.45764128 6796024 NM_008612 Mnat1 menage a trois 1 0.3949817 7.59821 4.3107387 0.0192312 -0.9072809 6989732 NM_009672 Anp32a acidic (leucine-rich) nuclear phosphoprotein0.395135 32 family, member7.59821 A 6.2202721 0.002205 2.2832722 6953171 NM_013861 Tpk1 thiamine pyrophosphokinase 0.3957883 7.59821 6.2243716 0.002205 2.28957013 6795279 NM_001037756 Brms1l breast cancer metastasis-suppressor 1-like0.3958483 7.59821 7.3427548 0.0007253 3.9183095 6904297 NM_009673 Anxa5 annexin A5 0.3959133 7.59821 5.1752024 0.0070614 0.59855443 6819177 NM_021437 1700123O20Rik RIKEN cDNA 1700123O20 gene 0.3959683 7.59821 4.2154198 0.0217393 -1.0785702 7017578 NM_028633 Haus7 HAUS augmin-like complex, subunit 7 0.3965233 7.59821 4.3117909 0.0192271 -0.9053951 6873167 NM_198108 Morn4 MORN repeat containing 4 0.3968667 7.59821 4.3757909 0.0177129 -0.7909038 6849316 NM_013759 Sepx1 selenoprotein X 1 0.3977883 7.59821 4.8203742 0.0105696 -0.0082781 6953762 NM_027268 Scrn1 secernin 1 0.40069 7.59821 4.0763108 0.0257562 -1.3300633 6850177 NM_001008424 Cdsn corneodesmosin 0.4010483 7.59821 4.7267917 0.011626 -0.1710538 6968728 NM_011068 Pex11a peroxisomal biogenesis factor 11 alpha 0.4017667 7.59821 4.6838472 0.0122773 -0.2461149 6966145 NM_011756 Zfp36 zinc finger protein 36 0.4017967 7.59821 3.8023871 0.0359637 -1.8297073 6786262 NM_025443 Pno1 partner of NOB1 homolog (S. cerevisiae) 0.40269 7.59821 6.2944227 0.0020594 2.39681169 6842436 NM_198302 Rbm11 RNA binding motif protein 11 0.40301 7.59821 5.8040937 0.0034261 1.63121775 6943195 NM_007513 Slc7a1 solute carrier family 7 (cationic amino acid0.4032083 transporter, y+7.59821 system), 6.1742052member 1 0.002316 2.21233342 6771620 NM_008921 Prim1 DNA primase, p49 subunit 0.4036567 7.59821 6.7514901 0.0013024 3.07921172 6988291 NM_172767 Vwa5a von Willebrand factor A domain containing0.4041067 5A 7.59821 5.910666 0.0030885 1.80058674 6977648 NM_001111304 Tbc1d9 TBC1 domain family, member 9 0.4045133 7.59821 8.3911336 0.0002724 5.29178474 6771533 NM_010792 Mettl1 methyltransferase like 1 0.4049517 7.59821 3.6765682 0.0424787 -2.060712 6865926 NM_008306 Ndst1 N-deacetylase/N-sulfotransferase (heparan0.4052333 glucosaminyl)7.59821 1 5.3581033 0.0057851 0.9046685 6947381 NM_013586 Loxl3 lysyl oxidase-like 3 0.4055667 7.59821 5.5825912 0.0044456 1.27394027 7020156 NM_030700 Maged2 melanoma antigen, family D, 2 0.4060017 7.59821 5.6641699 0.0040556 1.40634788 6783137 NM_025414 Myo19 myosin XIX 0.4060317 7.59821 4.8908555 0.0097845 0.11358173 6766110 NM_010437 Hivep2 human immunodeficiency virus type I enhancer0.40605 binding protein7.59821 2 6.2815224 0.0020949 2.37711592 6953929 NM_146168 Vopp1 vesicular, overexpressed in cancer, prosurvival0.4062817 protein 1 7.59821 3.6826132 0.0422529 -2.0495971 6784348 NM_020510 Fzd2 frizzled homolog 2 (Drosophila) 0.4064067 7.59821 5.7367033 0.0037229 1.52326879 6844549 NM_183029 Igf2bp2 insulin-like growth factor 2 mRNA binding 0.4065083protein 2 7.59821 5.6572553 0.0040866 1.39516211 6854579 ENSMUST00000056274C230013L11Rik RIKEN cDNA C230013L11 gene 0.4071567 7.59821 4.8793017 0.00991 0.09364936 6942492 NM_025774 Prkrip1 Prkr interacting protein 1 (IL11 inducible) 0.40762 7.59821 4.1194084 0.0244795 -1.2519664 6875728 NM_021519 Edf1 endothelial differentiation-related factor 10.4081917 7.59821 3.6560522 0.0433123 -2.0984453 6855625 NM_198167 Tmem63b transmembrane protein 63b 0.408805 7.59821 9.6767955 0.000108 6.79591756 7016078 NM_026167 Klhl13 kelch-like 13 (Drosophila) 0.409525 7.59821 3.5997441 0.0464424 -2.2020835 6825683 NM_145978 Pdlim2 PDZ and LIM domain 2 0.40979 7.59821 6.7134865 0.0013474 3.02360937 6775288 NM_001004362 2610008E11Rik RIKEN cDNA 2610008E11 gene 0.410545 7.59821 6.3361601 0.0019705 2.46037045 6991264 NM_007801 Ctsh cathepsin H 0.410585 7.59821 4.4685724 0.0159596 -0.6256938 6980032 NM_010578 Itgb1 integrin beta 1 (fibronectin receptor beta) 0.41198 7.59821 7.8182164 0.0004606 4.55871289 6945775 NM_029555 Gstk1 glutathione S-transferase kappa 1 0.4124167 7.59821 4.9112282 0.0095401 0.14868584 6871496 NM_028411 Tmem138 transmembrane protein 138 0.4125883 7.59821 5.1363235 0.0073507 0.53288737 6944372 NM_007616 Cav1 caveolin 1, caveolae protein 0.4139117 7.59821 4.2748122 0.0201306 -0.9717369 6900193 NM_007484 Rhoc ras homolog gene family, member C 0.4147433 7.59821 5.3909854 0.005613 0.95920527 6836805 NM_001164203 Plec plectin 0.4148567 7.59821 9.4320839 0.0001249 6.52371967 7019833 NM_053185 Col4a6 collagen, type IV, alpha 6 0.4148833 7.59821 7.8068872 0.0004635 4.54379824 6845914 NM_007508 Atp6v1a ATPase, H+ transporting, lysosomal V1 subunit0.415185 A 7.59821 5.8782404 0.0032177 1.74922913 7011952 NM_019684 Srpk3 serine/arginine-rich protein specific kinase0.4152067 3 7.59821 4.9969826 0.008614 0.29585239 6796711 BC038915 1700019E19Rik RIKEN cDNA 1700019E19 gene 0.415325 7.59821 5.9350247 0.0030082 1.83906711 6841399 NM_028680 Ift57 intraflagellar transport 57 homolog (Chlamydomonas)0.4165233 7.59821 6.0217614 0.0027559 1.97538885 6838809 NM_010577 Itga5 integrin alpha 5 (fibronectin receptor alpha)0.4166367 7.59821 6.6764748 0.0013984 2.96926132 6963744 NM_001130479 Nucb2 nucleobindin 2 0.4166483 7.59821 4.9815517 0.0087981 0.26944252 6918127 NM_023374 Sdhb succinate dehydrogenase complex, subunit B,0.41697 iron sulfur 7.59821(Ip) 4.3462973 0.0185016 -0.8436132 6761687 NM_019432 Tmem37 transmembrane protein 37 0.4171883 7.59821 3.7287594 0.0396591 -1.9647985 6816317 NM_001081009 Parp8 poly (ADP-ribose) polymerase family, member0.4174667 8 7.59821 5.8456826 0.003329 1.69750852 6940878 NM_026062 Fam69a family with sequence similarity 69, member0.4176333 A 7.59821 4.620178 0.013211 -0.357812 6917909 NM_009523 Wnt4 wingless-related MMTV integration site 4 0.4181217 7.59821 3.9548809 0.0298495 -1.5509068 6792534 NM_172572 Rhbdf2 rhomboid 5 homolog 2 (Drosophila) 0.4182967 7.59821 6.7675387 0.0012892 3.10263084 4645464 NA NA NA 0.4187 7.59821 4.8280581 0.010455 0.00503791 6959780 NM_008820 Pepd peptidase D 0.4197867 7.59821 7.3212079 0.000739 3.88857466 6798399 NM_028731 Esyt2 extended synaptotagmin-like protein 2 0.4197883 7.59821 7.433124 0.0006581 4.04233789 6913020 NM_173788 Npr2 natriuretic peptide receptor 2 0.42004 7.59821 8.5856292 0.0002334 5.53147717 6946759 NM_027547 Prdm5 PR domain containing 5 0.42016 7.59821 6.9413548 0.0010869 3.35395022 4469939 NA NA NA 0.420245 7.59821 5.242831 0.0065349 0.712284 6903753 NM_007900 Ect2 ect2 oncogene 0.4203017 7.59821 4.0724174 0.0258432 -1.3371262 6872916 NM_031156 Ide insulin degrading enzyme 0.4212633 7.59821 6.5508303 0.0015888 2.78331025 6768150 NM_026937 Ascc1 activating signal cointegrator 1 complex subunit0.4215267 1 7.59821 5.0231243 0.0083663 0.34052154 6989360 NM_019651 Ptpn9 protein tyrosine phosphatase, non-receptor type0.42168 9 7.59821 4.7130381 0.0118431 -0.1950686 6930361 NM_172274 Cc2d2a coiled-coil and C2 domain containing 2A 0.4217167 7.59821 6.949551 0.0010869 3.36569653 6929852 NM_019497 Grk4 G protein-coupled receptor kinase 4 0.4219767 7.59821 5.5802437 0.004455 1.27011586 6807687 NM_019986 Habp4 hyaluronic acid binding protein 4 0.4221667 7.59821 5.9845974 0.0028576 1.91711299 6782680 NM_033475 Rab34 RAB34, member of RAS oncogene family 0.4221717 7.59821 6.0406004 0.0026959 2.00485316 6963418 NM_009516 Wee1 WEE 1 homolog 1 (S. pombe) 0.4223933 7.59821 5.3790725 0.0056851 0.93946463 6835104 NM_001102458 Azin1 antizyme inhibitor 1 0.422955 7.59821 6.0585168 0.0026367 2.03282666 5029464 NA NA NA 0.4233533 7.59821 4.0892561 0.0254042 -1.3065889 6899372 NM_011311 S100a4 S100 calcium binding protein A4 0.4233567 7.59821 3.5403052 0.0497206 -2.311583 6969800 NM_028292 Ppme1 protein phosphatase methylesterase 1 0.42387 7.59821 6.322021 0.0019941 2.43886719 6999404 NM_019676 Plcd1 phospholipase C, delta 1 0.4239617 7.59821 5.9158708 0.0030694 1.80881621 6960328 NM_009101 Rras Harvey rat sarcoma oncogene, subgroup R0.4242767 7.59821 7.1926848 0.0008399 3.70990255 6777915 NM_177615 Slc26a10 solute carrier family 26, member 10 0.4246067 7.59821 4.1092282 0.0247274 -1.2703996 4695876 NA NA NA 0.42554 7.59821 3.5870812 0.0470953 -2.2254036 4765023 NA NA NA 0.4255533 7.59821 4.0271831 0.0272269 -1.4192741 5398495 NA NA NA 0.42581 7.59821 7.0799408 0.0009502 3.551306 6936760 NM_145401 Prkag2 protein kinase, AMP-activated, gamma 2 non-catalytic0.4262717 subunit7.59821 5.4093289 0.0055074 0.98956259 6946138 NM_001164734 Mpp6 membrane protein, palmitoylated 6 (MAGUK0.4266183 p55 subfamily7.59821 member3.987632 6) 0.0287161 -1.4912323 7018687 NM_175358 Zdhhc15 zinc finger, DHHC domain containing 15 0.42682 7.59821 5.9456077 0.0029822 1.85575873 6779714 NM_176841 Ccdc88a coiled coil domain containing 88A 0.4268733 7.59821 5.62429 0.0042352 1.34173965 6998094 NM_153420 Acpl2 acid phosphatase-like 2 0.427245 7.59821 5.0629735 0.0080196 0.40843703 4395595 NA NA NA 0.4275417 7.59821 4.3258921 0.0190132 -0.880133 6852751 NM_172256 Dync2li1 dynein cytoplasmic 2 light intermediate chain0.4279617 1 7.59821 5.8698203 0.0032358 1.73586788 6790508 NM_029478 Tmem49 transmembrane protein 49 0.428705 7.59821 5.7211068 0.0037959 1.49819196 7009941 NM_019634 Tspan7 tetraspanin 7 0.429105 7.59821 3.5849585 0.0472025 -2.2293133 6892723 NM_177263 Zhx3 zinc fingers and homeoboxes 3 0.4292983 7.59821 4.6711407 0.0124737 -0.2683673 7014702 NM_019736 Acot9 acyl-CoA thioesterase 9 0.4294333 7.59821 5.9413448 0.0029952 1.84903719 6942192 NM_010368 Gusb glucuronidase, beta 0.4297933 7.59821 7.9843674 0.0003915 4.77555623 6979421 NM_028131 Cenpn centromere protein N 0.4298483 7.59821 4.3666542 0.0179489 -0.8072228 6930335 NM_175937 Cpeb2 cytoplasmic polyadenylation element binding0.4299917 protein 2 7.59821 6.7241564 0.0013379 3.0392409 6964734 NM_025392 Bccip BRCA2 and CDKN1A interacting protein 0.4303733 7.59821 4.191328 0.0224114 -1.1220012 6824893 NM_001014996 Cenpj centromere protein J 0.43066 7.59821 3.9101381 0.031445 -1.632554 6858868 NM_001081223 Rbbp8 retinoblastoma binding protein 8 0.4307167 7.59821 3.7080982 0.0408187 -2.0027543 6786049 NM_172496 Cobl cordon-bleu 0.4309117 7.59821 4.2325737 0.0212533 -1.0476794 6996935 NM_015806 Mapk6 mitogen-activated protein kinase 6 0.4310033 7.59821 7.032536 0.0009993 3.48409838 6849303 NM_013630 Pkd1 polycystic kidney disease 1 homolog 0.4311183 7.59821 6.5550969 0.001583 2.78966176 6945548 NM_153600 Ttc26 tetratricopeptide repeat domain 26 0.4312183 7.59821 7.1273781 0.0008983 3.61824899 6912989 NM_019874 Dnajb5 DnaJ (Hsp40) homolog, subfamily B, member0.4313183 5 7.59821 8.1914537 0.000321 5.04093311 7012080 NM_026126 Fundc2 FUN14 domain containing 2 0.431465 7.59821 4.1628728 0.0230776 -1.173367 6967969 NM_146191 Lrrk1 leucine-rich repeat kinase 1 0.4317283 7.59821 6.9326177 0.0010937 3.34141837 6983898 NM_019652 Asna1 arsA arsenite transporter, ATP-binding, homolog0.4318033 1 (bacterial)7.59821 7.9271261 0.000414 4.70124893 6926882 NM_173401 Fbxo44 F-box protein 44 0.43288 7.59821 5.2112728 0.0067719 0.65929188 6800082 NM_025840 Bzw2 basic leucine zipper and W2 domains 2 0.4334733 7.59821 5.3587268 0.0057851 0.90570392 6974832 NM_054044 Gpr124 G protein-coupled receptor 124 0.433905 7.59821 6.5009445 0.0016752 2.7088549 6993846 NM_178577 Tmem205 transmembrane protein 205 0.4345183 7.59821 4.8836827 0.0098703 0.10120941 6953331 NM_007971 Ezh2 enhancer of zeste homolog 2 (Drosophila) 0.435015 7.59821 4.8007872 0.0107632 -0.0422561 6998584 NM_001110271 Abhd14a abhydrolase domain containing 14A 0.435615 7.59821 3.9589612 0.0297103 -1.543468 6764050 NM_153064 Ndufs2 NADH dehydrogenase (ubiquinone) Fe-S protein0.4358633 2 7.59821 5.6348807 0.0042062 1.35891976 6888898 NM_007656 Cd82 CD82 antigen 0.4360333 7.59821 5.3651103 0.0057735 0.91630268 6990525 NM_001113283 BC031353 cDNA sequence BC031353 0.4362033 7.59821 5.3554203 0.0058019 0.90021181 7014200 NM_172782 Nxt2 nuclear transport factor 2-like export factor0.437065 2 7.59821 5.8753599 0.0032248 1.74465938 6885872 NM_198001 1110008P14Rik RIKEN cDNA 1110008P14 gene 0.437325 7.59821 4.9489907 0.0091406 0.21361102 6929713 NM_025796 Mrpl33 mitochondrial ribosomal protein L33 0.4376 7.59821 5.1847713 0.0069992 0.61468451 6876380 NM_146120 Gsn gelsolin 0.4380433 7.59821 5.4296959 0.005388 1.02321291 6764694 NM_010135 Enah enabled homolog (Drosophila) 0.4381667 7.59821 6.5964623 0.0015174 2.85110504 6871879 NM_001163144 Pcsk5 proprotein convertase subtilisin/kexin type0.4382583 5 7.59821 6.8683686 0.001149 3.24893675 6915504 NM_026319 Ift74 intraflagellar transport 74 homolog (Chlamydomonas)0.438295 7.59821 5.0193253 0.0083969 0.3340357 6980944 NM_001004140 Ckap2 cytoskeleton associated protein 2 0.4383117 7.59821 3.5386011 0.0497206 -2.3147235 6822959 NM_144839 Ube2e2 ubiquitin-conjugating enzyme E2E 2 (UBC4/50.4391083 homolog, yeast)7.59821 6.5606004 0.0015784 2.79785057 6942854 NM_007393 Actb actin, beta 0.4398633 7.59821 5.7383058 0.00372 1.52584333 6854468 NM_207217 Itfg3 integrin alpha FG-GAP repeat containing 3 0.440135 7.59821 7.718354 0.0004854 4.42667348 7013252 NM_019989 Sh3bgrl SH3-binding domain glutamic acid-rich protein0.4401533 like 7.59821 5.5498133 0.0046101 1.22047021 7015530 NM_025975 Dynlt3 dynein light chain Tctex-type 3 0.4406317 7.59821 6.2764148 0.0020979 2.3693111 4438977 NA NA NA 0.441395 7.59821 5.0169674 0.008411 0.33000933 6861350 NM_177407 Camk2a calcium/calmodulin-dependent protein kinase0.4428883 II alpha 7.59821 7.2088682 0.0008262 3.73252455 6812212 NM_001164118 Serpinb6a serine (or cysteine) peptidase inhibitor, clade0.4429667 B, member 7.598216a 6.6233325 0.0014707 2.89088648 6867849 NM_010119 Ehd1 EH-domain containing 1 0.4430567 7.59821 5.632766 0.0042063 1.3554905 5024146 NA NA NA 0.4430717 7.59821 3.6471209 0.043795 -2.1148767 6800228 NM_001039515 Arl4a ADP-ribosylation factor-like 4A 0.4439783 7.59821 6.349852 0.0019441 2.48116592 6994935 NM_172769 Sc5d sterol-C5-desaturase (fungal ERG3, delta-5-desaturase)0.4447233 homolog7.59821 (S.3.8394074 cerevisae) 0.0345881 -1.7618919 6819573 NM_027436 Mipep mitochondrial intermediate peptidase 0.445185 7.59821 7.7748605 0.0004681 4.50154582 6981530 NM_178591 Nrg1 neuregulin 1 0.4453383 7.59821 5.0859736 0.0078278 0.44753899 6855123 NM_007584 Ddr1 discoidin domain receptor family, member0.4466467 1 7.59821 7.7719981 0.0004681 4.49776315 6857022 NM_001164075 Tgif1 TGFB-induced factor homeobox 1 0.44686 7.59821 3.9453645 0.030225 -1.5682609 6835972 NM_175212 Tmem65 transmembrane protein 65 0.4478117 7.59821 8.1964414 0.0003206 5.04725867 6792442 NM_008258 Hn1 hematological and neurological expressed sequence0.449575 1 7.59821 6.0626802 0.0026275 2.03932052 6788672 NM_144521 Snap47 synaptosomal-associated protein, 47 0.4496633 7.59821 6.5460304 0.0015918 2.7761619 6985924 NM_007806 Cyba cytochrome b-245, alpha polypeptide 0.4499417 7.59821 4.0535969 0.0262949 -1.3712853 6993465 NM_028013 Endod1 endonuclease domain containing 1 0.450835 7.59821 6.0210334 0.0027559 1.9742492 6977997 NM_001128169 Cyld cylindromatosis (turban tumor syndrome) 0.4512017 7.59821 5.9481354 0.0029773 1.85974294 6783694 NM_146025 Samd14 sterile alpha motif domain containing 14 0.4519067 7.59821 5.386335 0.0056417 0.9515016 6788674 NM_178417 Zfp867 zinc finger protein 867 0.4529667 7.59821 4.2674204 0.0203307 -0.9850146 6778037 NM_011843 Esyt1 extended synaptotagmin-like protein 1 0.454215 7.59821 8.568699 0.000235 5.51079239 6901316 NM_130450 Elovl6 ELOVL family member 6, elongation of long0.4542917 chain fatty acids7.59821 (yeast) 3.66763 0.0428743 -2.0771492 5480840 NA NA NA 0.454655 7.59821 3.9833224 0.028918 -1.4990802 6850552 NM_032003 Enpp5 ectonucleotide pyrophosphatase/phosphodiesterase0.45472 5 7.59821 7.6053057 0.000555 4.27563059 6922004 NM_010336 Lpar1 lysophosphatidic acid receptor 1 0.45593 7.59821 4.9144748 0.0095098 0.1542751 6935534 NM_145155 Wasf3 WAS protein family, member 3 0.4560067 7.59821 4.9630699 0.0090113 0.23776935 6883114 NM_026785 Ube2c ubiquitin-conjugating enzyme E2C 0.4564667 7.59821 3.9073474 0.0315318 -1.6376509 6970131 NM_028444 Prkcdbp protein kinase C, delta binding protein 0.4565917 7.59821 4.3770147 0.017706 -0.7887187 6965982 NM_009465 Axl AXL receptor tyrosine kinase 0.4567917 7.59821 6.4622948 0.0017342 2.65092423 6786473 NM_018861 Slc1a4 solute carrier family 1 (glutamate/neutral 0.4569533amino acid transporter),7.59821 3.5748323member 4 0.0477017 -2.2479656 6899741 NM_181409 Mtmr11 myotubularin related protein 11 0.4570767 7.59821 5.3397924 0.0058839 0.87423276 6765307 NM_198247 Sertad4 SERTA domain containing 4 0.4574317 7.59821 4.4907415 0.0155633 -0.5863582 6749115 NM_028450 Gulp1 GULP, engulfment adaptor PTB domain containing0.4581483 1 7.59821 4.4148001 0.0170909 -0.7213294 6992332 NM_008160 Gpx1 glutathione peroxidase 1 0.459435 7.59821 4.8080996 0.0106643 -0.0295655 6873520 NM_001001738 Itprip inositol 1,4,5-triphosphate receptor interacting0.4596567 protein 7.59821 5.2267234 0.0066556 0.68525357 6788662 NM_009522 Wnt3a wingless-related MMTV integration site 3A 0.459785 7.59821 4.3340802 0.0188735 -0.8654733 6876567 NM_172854 Olfml2a olfactomedin-like 2A 0.4599633 7.59821 4.6905962 0.0121891 -0.2343036 6775160 NM_008606 Mmp11 matrix metallopeptidase 11 0.46086 7.59821 6.6707966 0.001406 2.96090626 6990527 NM_010864 Myo5a myosin VA 0.46123 7.59821 4.3842265 0.0175998 -0.7758448 6925562 NM_153541 Zbtb8b zinc finger and BTB domain containing 8b 0.462275 7.59821 3.631317 0.0447059 -2.1439588 4372089 NA NA NA 0.4631767 7.59821 3.8817289 0.0325424 -1.6844649 6872010 NM_010730 Anxa1 annexin A1 0.4637267 7.59821 5.1214435 0.0074931 0.50770016 6982921 NM_025436 Sc4mol sterol-C4-methyl oxidase-like 0.4640283 7.59821 3.8690472 0.0331727 -1.7076545 6913012 NM_013497 Creb3 cAMP responsive element binding protein 3 0.46491 7.59821 6.0577381 0.0026367 2.03161185 6798269 NM_198411 Inf2 inverted formin, FH2 and WH2 domain containing0.4650017 7.59821 6.183802 0.0022923 2.22713699 6946038 NM_001098271 Tmem176a transmembrane protein 176A 0.4656683 7.59821 5.0732128 0.0079379 0.42585355 6977139 NM_001001491 Tpm4 tropomyosin 4 0.4663267 7.59821 8.4624149 0.0002604 5.38015721 6990067 NM_026467 Rps27l ribosomal protein S27-like 0.466475 7.59821 5.562754 0.0045519 1.24159865 6771476 NM_177152 Lrig3 leucine-rich repeats and immunoglobulin-like0.4669283 domains 3 7.59821 6.4866374 0.0016896 2.6874355 6849891 NM_001101588 Cyp4f40 cytochrome P450, family 4, subfamily f, polypeptide0.4670117 40 7.59821 4.9254862 0.0094328 0.17322164 6953144 BC011487 Fam115c family with sequence similarity 115, member0.4679033 C 7.59821 6.0656299 0.0026226 2.04391974 5329320 NA NA NA 0.4681933 7.59821 3.6025145 0.0463063 -2.196982 6753391 NM_007791 Csrp1 cysteine and glycine-rich protein 1 0.46857 7.59821 6.185626 0.0022909 2.22994901 6902880 NM_026582 Wls wntless homolog (Drosophila) 0.469395 7.59821 10.40057 5.95E-05 7.56522921 6868021 NM_146094 Fads1 fatty acid desaturase 1 0.4695667 7.59821 5.0977668 0.0077345 0.46756064 6843923 NM_019980 Litaf LPS-induced TN factor 0.4697733 7.59821 7.2420329 0.0007954 3.77877198 6992174 NM_009082 Rpl29 ribosomal protein L29 0.469995 7.59821 3.8234359 0.0352169 -1.7911396 6983223 NM_023065 Ifi30 interferon gamma inducible protein 30 0.47191 7.59821 6.573722 0.0015605 2.81735725 6958269 NM_019923 Itpr2 inositol 1,4,5-triphosphate receptor 2 0.47321 7.59821 4.2834095 0.0199227 -0.9563007 6966302 NM_025628 Cox6b1 cytochrome c oxidase, subunit VIb polypeptide0.4736933 1 7.59821 5.3437398 0.0058705 0.8807979 6788388 NM_013472 Anxa6 annexin A6 0.4737383 7.59821 7.3290422 0.0007363 3.89939329 6996438 NM_026674 Aph1c anterior pharynx defective 1c homolog (C.0.4740267 elegans) 7.59821 5.8619275 0.0032698 1.72333401 6833480 NM_175730 Hoxc5 homeobox C5 0.4744383 7.59821 7.0171766 0.0010111 3.46225593 6864518 NM_080637 Nme5 non-metastatic cells 5, protein expressed in0.4744683 (nucleoside-diphosphate7.59821 4.3475368 kinase) 0.0184767 -0.8413962 4602129 NA NA NA 0.474515 7.59821 3.9771653 0.0290238 -1.5102948 6824850 NM_001082975 Sdr39u1 short chain dehydrogenase/reductase family0.4745883 39U, member7.59821 1 4.8630912 0.0101175 0.06565442 6966991 NM_008654 Ppp1r15a protein phosphatase 1, regulatory (inhibitor)0.4745933 subunit 15A7.59821 6.4385152 0.0017875 2.6151752 6836973 NM_022410 Myh9 myosin, heavy polypeptide 9, non-muscle 0.47591 7.59821 8.8332898 0.0001925 5.83021356 6996440 NM_173413 Rab8b RAB8B, member RAS oncogene family 0.4762483 7.59821 7.5473057 0.0005859 4.19748475 6818029 NM_025295 Btd biotinidase 0.4767617 7.59821 6.653447 0.0014142 2.93534907 4488869 NA NA NA 0.476965 7.59821 3.7020361 0.0411343 -2.0138942 6997349 NM_026122 Hmgn3 high mobility group nucleosomal binding domain0.4771 3 7.59821 5.3131532 0.0060412 0.82986987 6892180 NM_009743 Bcl2l1 BCL2-like 1 0.4775733 7.59821 4.1064967 0.0248305 -1.2753472 6908075 NM_008184 Gstm6 glutathione S-transferase, mu 6 0.4776317 7.59821 5.7532048 0.0036528 1.54976243 6769212 NM_139292 Reep6 receptor accessory protein 6 0.47802 7.59821 4.824067 0.0105148 -0.0018775 6755242 NM_027972 Ccdc19 coiled-coil domain containing 19 0.4781317 7.59821 7.4921965 0.0006214 4.12282072 6985328 NM_029646 Il34 interleukin 34 0.4781683 7.59821 5.8362502 0.003351 1.68249566 6945324 NM_007563 Bpgm 2,3-bisphosphoglycerate mutase 0.4786617 7.59821 5.1440587 0.0073067 0.54596875 6999416 NM_010851 Myd88 myeloid differentiation primary response gene0.478875 88 7.59821 8.4142129 0.000268 5.32046491 6796674 NM_172414 Fam164c family with sequence similarity 164, member0.47928 C 7.59821 4.2438175 0.020959 -1.0274469 6869979 NM_053197 Sfxn3 sideroflexin 3 0.4793983 7.59821 6.2760353 0.0020979 2.36873104 6749701 NM_199007 Sgol2 shugoshin-like 2 (S. pombe) 0.4794917 7.59821 4.6370554 0.0129825 -0.3281561 6755240 NM_029612 Slamf9 SLAM family member 9 0.4795383 7.59821 3.5450581 0.049403 -2.302824 6995120 NM_153537 Phldb1 pleckstrin homology-like domain, family B, member0.480355 1 7.59821 7.3523499 0.0007184 3.93153056 6936981 NM_021288 Tyms thymidylate synthase 0.4805367 7.59821 5.5176956 0.0047927 1.16792812 6772217 NM_181470 Ltv1 LTV1 homolog (S. cerevisiae) 0.4834433 7.59821 6.7190429 0.0013404 3.0317516 6871627 NM_172442 Dtx4 deltex 4 homolog (Drosophila) 0.4838467 7.59821 6.3853063 0.0018881 2.53488894 6771927 NM_027391 Iyd iodotyrosine deiodinase 0.484515 7.59821 5.7681194 0.0035826 1.57367434 6764953 NM_009367 Tgfb2 transforming growth factor, beta 2 0.4855217 7.59821 3.7340245 0.0394668 -1.9551293 6838257 NM_175121 Slc38a2 solute carrier family 38, member 2 0.487445 7.59821 7.5761197 0.0005703 4.23636254 6856676 NM_133685 Rab31 RAB31, member RAS oncogene family 0.4877783 7.59821 7.9231146 0.0004143 4.69602582 6998587 NM_145619 Parp3 poly (ADP-ribose) polymerase family, member0.48875 3 7.59821 4.1349526 0.0240223 -1.2238377 6833151 NM_139140 Spats2 spermatogenesis associated, serine-rich 2 0.4891583 7.59821 6.9154112 0.0011049 3.3167077 6849456 NM_026170 Ergic1 endoplasmic reticulum-golgi intermediate0.4893417 compartment (ERGIC)7.59821 1 9.9076124 8.70E-05 7.04694852 6759781 NM_029010 Glb1l galactosidase, beta 1-like 0.490005 7.59821 4.5033689 0.0153077 -0.5639775 4560036 NA NA NA 0.49001 7.59821 4.8472768 0.0102299 0.03831081 6878702 NM_001005342 Ypel4 yippee-like 4 (Drosophila) 0.4903433 7.59821 4.276937 0.0200711 -0.9679212 6857037 NM_026064 2900073G15Rik RIKEN cDNA 2900073G15 gene 0.49042 7.59821 5.3478057 0.0058572 0.88755805 6840613 NM_080557 Snx4 sorting nexin 4 0.4905783 7.59821 6.7651737 0.0012899 3.09918196 6946004 NM_133764 Atp6v0e2 ATPase, H+ transporting, lysosomal V0 subunit0.4918017 E2 7.59821 4.2443153 0.020959 -1.0265514 6792649 NM_011594 Timp2 tissue inhibitor of metalloproteinase 2 0.4918717 7.59821 8.3722753 0.000276 5.26830193 6912644 NM_199157 Ifnk interferon kappa 0.4920383 7.59821 4.4735393 0.0158788 -0.6168761 6996952 NM_016711 Tmod2 tropomodulin 2 0.492395 7.59821 6.8342526 0.0011956 3.19959402 6995968 NM_010729 Loxl1 lysyl oxidase-like 1 0.4924767 7.59821 3.7424874 0.0389915 -1.9395902 6993296 NM_007464 Birc3 baculoviral IAP repeat-containing 3 0.49305 7.59821 8.7216757 0.0002133 5.69646741 6898171 NM_025813 Mfsd1 major facilitator superfamily domain containing0.4932717 1 7.59821 9.8671698 9.00E-05 7.00335767 6784237 NM_013792 Naglu alpha-N-acetylglucosaminidase (Sanfilippo disease0.49368 IIIB) 7.59821 4.2528115 0.020752 -1.0112714 6948003 NM_028766 Tmem43 transmembrane protein 43 0.4944967 7.59821 8.14963 0.0003336 4.98776908 6778521 NM_009636 Aebp1 AE binding protein 1 0.4947583 7.59821 4.6475804 0.0128412 -0.3096794 4625480 NA NA NA 0.494785 7.59821 4.3141649 0.0191849 -0.9011407 6948015 NM_009320 Slc6a6 solute carrier family 6 (neurotransmitter transporter,0.4957883 taurine),7.59821 member6.3979042 6 0.0018665 2.55393452 6796158 NM_001005510 Syne2 synaptic nuclear envelope 2 0.4959533 7.59821 5.5932969 0.0044061 1.29137075 6925165 NM_009600 Macf1 microtubule-actin crosslinking factor 1 0.4982717 7.59821 10.073221 7.72E-05 7.22373262 6754263 NM_172843 Tor1aip2 torsin A interacting protein 2 0.4983683 7.59821 6.9433965 0.0010869 3.35687714 6791465 NM_008949 Psmc3ip proteasome (prosome, macropain) 26S subunit,0.4983983 ATPase 3,7.59821 interacting6.1602201 protein 0.0023457 2.19073672 6820216 NR_033185 Rcbtb2 regulator of chromosome condensation (RCC1)0.4984867 and BTB (POZ)7.59821 domain6.5200277 containing0.0016412 protein 2 2.73737903 6831891 NM_010755 Maff v-maf musculoaponeurotic fibrosarcoma oncogene0.49855 family,7.59821 protein 5.2727177F (avian) 0.006335 0.76234191 6923411 NM_010591 Jun Jun oncogene 0.499995 7.59821 5.9595613 0.0029355 1.87774151 6861135 NM_026240 Gramd3 GRAM domain containing 3 0.500235 7.59821 6.6690162 0.001406 2.95828551 6817287 NM_008695 Nid2 nidogen 2 0.5006883 7.59821 7.9294354 0.000414 4.70425484 6859304 NM_026301 Rnf125 ring finger protein 125 0.50099 7.59821 3.9462433 0.0301973 -1.5666581 6933677 NM_007475 Rplp0 ribosomal protein, large, P0 0.5013333 7.59821 3.6323954 0.0446424 -2.1419741 6885879 NM_001164358 Slc25a25 solute carrier family 25 (mitochondrial carrier,0.5017783 phosphate7.59821 carrier), member5.9312537 25 0.0030142 1.83311551 6780863 NM_026631 Nhp2 NHP2 ribonucleoprotein homolog (yeast) 0.5030833 7.59821 8.3078373 0.0002904 5.18773588 5297505 NA NA NA 0.5037167 7.59821 5.122705 0.0074871 0.50983671 5590375 NA NA NA 0.5049267 7.59821 3.6357618 0.0444247 -2.1357788 6849990 NM_001025313 Tapbp TAP binding protein 0.5056117 7.59821 4.0125598 0.0278175 -1.4458654 6774907 NM_031397 Bicc1 bicaudal C homolog 1 (Drosophila) 0.506395 7.59821 6.4147505 0.0018292 2.57936735 6828001 NM_145466 A2ld1 AIG2-like domain 1 0.50874 7.59821 5.1555972 0.0072208 0.5654669 6871199 NM_019722 Arl2 ADP-ribosylation factor-like 2 0.5092067 7.59821 7.7704737 0.0004681 4.49574809 6750413 NM_009533 Xrcc5 X-ray repair complementing defective repair0.5093983 in Chinese hamster7.59821 cells5.7437786 5 0.0036945 1.53463314 6876405 NM_001114124 Dab2ip disabled homolog 2 (Drosophila) interacting0.5094317 protein 7.59821 9.3995774 0.0001269 6.48708343 6971316 NM_080638 Mvp major vault protein 0.5104 7.59821 6.9276831 0.001098 3.33433591 5164825 NA NA NA 0.5107417 7.59821 5.5720634 0.0045064 1.25678322 6836728 NM_010738 Ly6a lymphocyte antigen 6 complex, locus A 0.51129 7.59821 3.8105782 0.0357144 -1.8146958 6815345 NM_010422 Hexb hexosaminidase B 0.51528 7.59821 5.0186919 0.0083969 0.33295419 6797274 NM_198311 Ttc8 tetratricopeptide repeat domain 8 0.515665 7.59821 9.6344601 0.0001101 6.74927779 6906830 NM_001037722 Adam15 a disintegrin and metallopeptidase domain 150.51638 (metargidin)7.59821 4.7780942 0.0110101 -0.081683 6877441 NM_198294 Tanc1 tetratricopeptide repeat, ankyrin repeat and0.5165417 coiled-coil containing7.59821 16.7363381 0.0013254 3.0570677 6788141 NM_199299 Phf15 PHD finger protein 15 0.5165967 7.59821 7.3119696 0.0007431 3.87580648 6901780 NM_019571 Tspan5 tetraspanin 5 0.5179733 7.59821 9.661315 0.0001088 6.77888472 6854487 NM_013642 Dusp1 dual specificity phosphatase 1 0.5193133 7.59821 5.6229913 0.0042369 1.33963182 6875132 NM_011701 Vim vimentin 0.5193317 7.59821 9.5724111 0.0001155 6.68058127 6978883 NM_133792 Pla2g15 phospholipase A2, group XV 0.5198033 7.59821 7.7536754 0.0004735 4.47352367 6849215 NM_181821 Hcfc1r1 host cell factor C1 regulator 1 (XPO1-dependent)0.52128 7.59821 7.9684949 0.000396 4.75499315 6814441 NM_028493 Rhobtb3 Rho-related BTB domain containing 3 0.522235 7.59821 7.2070642 0.0008262 3.73000464 6868582 NM_013467 Aldh1a1 aldehyde dehydrogenase family 1, subfamily0.52301 A1 7.59821 4.327851 0.0190024 -0.8766252 6938704 NM_009466 Ugdh UDP-glucose dehydrogenase 0.523495 7.59821 9.438897 0.0001249 6.53138406 6971277 NM_019738 Nupr1 nuclear protein 1 0.52408 7.59821 7.152651 0.0008789 3.65378724 6910597 NM_008966 Ptgfr prostaglandin F receptor 0.5248133 7.59821 4.203528 0.0220661 -1.1000012 6893147 NM_019835 B4galt5 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase,0.5248433 polypeptide7.59821 5 4.1592501 0.0231923 -1.1799118 6803161 NM_011175 Lgmn legumain 0.525045 7.59821 4.6345708 0.0129959 -0.3325197 6995757 NM_019686 Cib2 calcium and integrin binding family member0.5269733 2 7.59821 4.6757543 0.0124247 -0.2602854 6755896 NM_022019 Dusp10 dual specificity phosphatase 10 0.5281483 7.59821 5.3919705 0.005613 0.96083673 6850191 NM_133662 Ier3 immediate early response 3 0.5289417 7.59821 6.6840162 0.001387 2.9803508 6772232 NM_025446 Aig1 androgen-induced 1 0.5298317 7.59821 8.2544593 0.0003009 5.12061348 6982158 NM_007450 Slc25a4 solute carrier family 25 (mitochondrial carrier,0.5303733 adenine nucleotide7.59821 translocator),8.258102 0.0003009 member 4 5.12520529 6994958 NM_178644 Oaf OAF homolog (Drosophila) 0.5306083 7.59821 5.6252 0.0042352 1.34321659 6907100 NM_011656 Tuft1 tuftelin 1 0.53231 7.59821 5.8871221 0.0031893 1.76331168 6963608 NM_011055 Pde3b phosphodiesterase 3B, cGMP-inhibited 0.5330783 7.59821 9.3128159 0.0001341 6.3887413 6942458 NM_172541 Tmem120a transmembrane protein 120A 0.5335 7.59821 5.2070138 0.0068104 0.65212973 6995525 NM_024441 Hspb2 heat shock protein 2 0.5356517 7.59821 5.7838119 0.0035119 1.59879863 6885489 NM_026212 Agpat2 1-acylglycerol-3-phosphate O-acyltransferase 0.53592 (lysophosphatidic7.59821 acid10.039747 acyltransferase,7.87E-05 beta) 7.18822018 4798935 NA NA NA 0.535975 7.59821 5.2042866 0.0068319 0.64754219 6889258 NM_009851 Cd44 CD44 antigen 0.5366667 7.59821 3.7369105 0.0392907 -1.9498298 6875933 NM_019498 Olfm1 olfactomedin 1 0.5378483 7.59821 9.4693148 0.0001245 6.56554155 6755630 NM_178653 Sccpdh saccharopine dehydrogenase (putative) 0.5380917 7.59821 7.750887 0.0004735 4.46983104 6839231 NM_172961 Abat 4-aminobutyrate aminotransferase 0.53974 7.59821 5.0129425 0.0084577 0.32313438 6759800 NM_001110831 Dnpep aspartyl aminopeptidase 0.5408333 7.59821 11.292756 3.08E-05 8.44534907 6870181 NM_010362 Gsto1 glutathione S-transferase omega 1 0.5422333 7.59821 4.332095 0.0189191 -0.8690269 7019614 NM_001168578 Tceal8 transcription elongation factor A (SII)-like 80.5431583 7.59821 6.5257925 0.0016315 2.74598553 6785665 NM_197979 Uqcr10 ubiquinol-cytochrome c reductase, complex0.5439867 III subunit X 7.59821 4.2950937 0.0196582 -0.935334 6989209 NM_029573 Idh3a isocitrate dehydrogenase 3 (NAD+) alpha 0.545585 7.59821 7.7376217 0.0004751 4.4522502 6784245 NM_134028 Tubg2 tubulin, gamma 2 0.5462817 7.59821 8.4278936 0.0002673 5.33743519 6770160 NM_026268 Dusp6 dual specificity phosphatase 6 0.5467417 7.59821 5.0623986 0.0080196 0.40745877 6996254 NM_016769 Smad3 MAD homolog 3 (Drosophila) 0.5470967 7.59821 8.2721705 0.0002972 5.14292392 6844334 NM_001111062 Comt1 catechol-O-methyltransferase 1 0.547875 7.59821 6.4720706 0.0017178 2.66559702 5374844 NA NA NA 0.5482933 7.59821 4.920124 0.0094633 0.16399716 6778419 NM_008698 Nipsnap1 4-nitrophenylphosphatase domain and non-neuronal0.548795 SNAP25-like7.59821 protein5.3167097 homolog0.0060297 1 (C. elegans)0.83579834 6889413 NM_009037 Rcn1 reticulocalbin 1 0.5491883 7.59821 6.1545413 0.002361 2.18195905 6994371 NM_144936 Tmem45b transmembrane protein 45b 0.5492817 7.59821 4.5845406 0.0138642 -0.420543 6885336 NM_011040 Pax8 paired box gene 8 0.5499383 7.59821 5.2503941 0.0064854 0.72496348 6935041 NM_021719 Cldn15 claudin 15 0.55153 7.59821 4.4031623 0.017282 -0.742069 6946993 NM_007599 Capg capping protein (actin filament), gelsolin-like0.5522033 7.59821 5.2509929 0.0064854 0.72596691 6829598 NM_008304 Sdc2 syndecan 2 0.5522867 7.59821 7.4409708 0.0006535 4.05305549 6937812 NM_008009 Fgfbp1 fibroblast growth factor binding protein 1 0.55242 7.59821 4.9733355 0.0088993 0.25536754 6855669 NM_029338 Rsph9 radial spoke head 9 homolog (Chlamydomonas)0.5530017 7.59821 4.7529509 0.0113615 -0.1254426 6908569 NM_029655 Snx7 sorting nexin 7 0.55411 7.59821 6.6181562 0.0014779 2.88323103 6768232 NM_026438 Ppa1 pyrophosphatase (inorganic) 1 0.5544917 7.59821 5.6615858 0.0040654 1.40216833 6782701 NM_026740 Slc46a1 solute carrier family 46, member 1 0.554885 7.59821 5.5834939 0.0044456 1.27541058 6866238 NM_178793 Ccbe1 collagen and calcium binding EGF domains 1 0.55575 7.59821 3.9162342 0.0311912 -1.6214217 6926505 NM_144531 9030409G11Rik RIKEN cDNA 9030409G11 gene 0.55652 7.59821 8.6354377 0.000223 5.59213518 6963047 NM_009287 Stim1 stromal interaction molecule 1 0.5566583 7.59821 8.1765187 0.000324 5.02197346 6760917 NM_013626 Pam peptidylglycine alpha-amidating monooxygenase0.556685 7.59821 11.898734 2.16E-05 9.00390302 6869503 NM_010615 Kif11 kinesin family member 11 0.55864 7.59821 4.7815614 0.0109801 -0.075655 6850097 NM_033444 Clic1 chloride intracellular channel 1 0.5603917 7.59821 12.209733 1.86E-05 9.27910938 6791453 NM_008986 Ptrf polymerase I and transcript release factor 0.5611367 7.59821 8.9603816 0.0001744 5.98076105 6984824 NM_009866 Cdh11 cadherin 11 0.5645933 7.59821 5.0469794 0.0081575 0.3812037 6840841 NM_001081984 Popdc2 popeye domain containing 2 0.565695 7.59821 7.1040885 0.0009248 3.58542172 4719366 NA NA NA 0.5659283 7.59821 6.2218321 0.002205 2.28566896 6882730 NM_008489 Lbp lipopolysaccharide binding protein 0.5670417 7.59821 6.2415093 0.002185 2.31587187 6860635 NM_010120 Eif1a eukaryotic translation initiation factor 1A 0.56848 7.59821 6.164188 0.0023375 2.19686714 6781689 NM_178870 Hs3st3a1 heparan sulfate (glucosamine) 3-O-sulfotransferase0.5714983 3A1 7.59821 3.9807035 0.028918 -1.5038498 6769080 NM_007793 Cstb cystatin B 0.5722667 7.59821 7.9061935 0.000418 4.67397124 6988627 NM_010436 H2afx H2A histone family, member X 0.5755383 7.59821 5.3329473 0.0059314 0.862843 6923142 NM_025760 Ptplad2 protein tyrosine phosphatase-like A domain0.5782517 containing 2 7.59821 5.3309512 0.0059325 0.85952042 6990859 NM_022986 Irak1bp1 interleukin-1 receptor-associated kinase 1 0.5793633binding protein7.59821 1 6.1492276 0.0023701 2.17374159 6943818 NM_007743 Col1a2 collagen, type I, alpha 2 0.579645 7.59821 7.2523299 0.000787 3.79310052 6953429 NM_023056 Tmem176b transmembrane protein 176B 0.5810483 7.59821 7.411842 0.0006748 4.01322788 6871258 NM_012021 Prdx5 peroxiredoxin 5 0.5810633 7.59821 9.0417402 0.0001606 6.07617152 5042366 NA NA NA 0.581335 7.59821 4.5609729 0.0143201 -0.4621101 6984972 NM_026481 Tppp3 tubulin polymerization-promoting protein 0.5815667family member7.59821 3 5.7251456 0.0037783 1.50468919 6902661 NM_009968 Cryz crystallin, zeta 0.5821267 7.59821 4.3512928 0.0183857 -0.8346792 6764841 NM_145515 Mark1 MAP/microtubule affinity-regulating kinase0.583365 1 7.59821 5.7175425 0.0038107 1.49245614 6832259 NM_009775 Tspo translocator protein 0.5840933 7.59821 5.5377481 0.0046702 1.20074988 7018897 NM_016710 Hmgn5 high-mobility group nucleosome binding domain0.5841983 5 7.59821 4.2381968 0.0211079 -1.0375596 6902162 NM_026993 Ddah1 dimethylarginine dimethylaminohydrolase0.5846567 1 7.59821 5.71343 0.0038289 1.48583591 6988604 NM_198092 Usp2 ubiquitin specific peptidase 2 0.5853433 7.59821 3.6201752 0.0451997 -2.1644668 6966934 NM_026555 Rcn3 reticulocalbin 3, EF-hand calcium binding domain0.5856433 7.59821 6.1053645 0.0025023 2.10575154 6918699 NM_027985 Mad2l2 MAD2 mitotic arrest deficient-like 2 (yeast)0.5869617 7.59821 12.239914 1.86E-05 9.30541938 6806581 NM_198419 Phactr1 phosphatase and actin regulator 1 0.589245 7.59821 6.1497231 0.0023701 2.17450793 6765153 NM_026796 Smyd2 SET and MYND domain containing 2 0.5906583 7.59821 8.6380247 0.000223 5.59527765 6961396 BC116191 Zic4 zinc finger protein of the cerebellum 4 0.59231 7.59821 4.6473872 0.0128412 -0.3100184 6966058 NM_011116 Pld3 phospholipase D family, member 3 0.5923567 7.59821 9.3953574 0.0001269 6.48231889 5264759 NA NA NA 0.59413 7.59821 4.3830225 0.0175998 -0.7779938 6916218 NM_025334 Txndc12 thioredoxin domain containing 12 (endoplasmic0.59654 reticulum)7.59821 6.8682528 0.001149 3.24876955 6991979 NM_019764 Amotl2 angiomotin-like 2 0.596855 7.59821 6.6860964 0.0013866 2.98340831 4538495 NA NA NA 0.5985167 7.59821 3.8022485 0.0359637 -1.8299613 6932603 NM_013470 Anxa3 annexin A3 0.5992533 7.59821 11.509581 2.92E-05 8.64868936 6756419 NM_010600 Kcnh1 potassium voltage-gated channel, subfamily0.600315 H (eag-related),7.59821 member4.5389472 1 0.0147146 -0.5010157 6788301 NM_011396 Slc22a5 solute carrier family 22 (organic cation transporter),0.6003883 member7.59821 5 6.9331648 0.0010937 3.34220348 4818495 NA NA NA 0.6009783 7.59821 4.5038015 0.0153077 -0.5632111 6766046 NM_009538 Plagl1 pleiomorphic adenoma gene-like 1 0.601295 7.59821 8.5789227 0.0002334 5.52328744 6929817 NM_001163215 Fgfr3 fibroblast growth factor receptor 3 0.6019217 7.59821 4.8973248 0.0097214 0.12473472 6868386 NM_181348 Prune2 prune homolog 2 (Drosophila) 0.6019417 7.59821 5.6337846 0.0042063 1.35714237 6791626 NM_025918 Ccdc43 coiled-coil domain containing 43 0.6048917 7.59821 7.9693118 0.000396 4.75605229 4476579 NA NA NA 0.6050717 7.59821 5.6728374 0.0040275 1.42035947 6911884 NM_181401 Tmem64 transmembrane protein 64 0.606285 7.59821 12.176786 1.86E-05 9.25030991 6970857 NM_022420 Gprc5b G protein-coupled receptor, family C, group0.6069467 5, member B7.59821 4.4368934 0.0166158 -0.6819977 6838392 NM_172612 Rnd1 Rho family GTPase 1 0.6089683 7.59821 6.5622569 0.0015784 2.80031461 6967726 NM_001082962 Snrpn small nuclear ribonucleoprotein N 0.610685 7.59821 4.5007316 0.0153501 -0.5686504 6983894 NM_008416 Junb Jun-B oncogene 0.6122667 7.59821 4.8084049 0.0106643 -0.0290358 4826951 NA NA NA 0.6124033 7.59821 3.6758495 0.0424831 -2.0620335 6774264 NM_029083 Ddit4 DNA-damage-inducible transcript 4 0.61317 7.59821 3.8417312 0.0344859 -1.7576377 6825192 NM_013869 Tnfrsf19 tumor necrosis factor receptor superfamily,0.6148117 member 19 7.59821 5.6139742 0.0042912 1.32499011 6753068 NM_145509 5430435G22Rik RIKEN cDNA 5430435G22 gene 0.6178433 7.59821 10.920793 3.98E-05 8.08711254 6817396 NM_134079 Adk adenosine kinase 0.6180167 7.59821 8.1821889 0.0003232 5.0291749 6868017 NM_144538 Rab3il1 RAB3A interacting protein (rabin3)-like 1 0.61821 7.59821 7.2310008 0.0008049 3.76340461 5584435 NA NA NA 0.6196467 7.59821 3.5392354 0.0497206 -2.3135546 6869324 NM_008332 Ifit2 interferon-induced protein with tetratricopeptide0.6199817 repeats7.59821 2 8.0033737 0.0003838 4.80013714 6795881 NM_028127 Frmd6 FERM domain containing 6 0.6224167 7.59821 6.9018583 0.00111 3.29721481 6865902 NM_134133 2010002N04Rik RIKEN cDNA 2010002N04 gene 0.6235767 7.59821 5.0485473 0.0081564 0.38387489 6820282 NM_172812 Htr2a 5-hydroxytryptamine (serotonin) receptor 0.62370332A 7.59821 5.1957371 0.0069105 0.63315394 6996191 NM_033320 Glce glucuronyl C5-epimerase 0.6243917 7.59821 8.5056725 0.0002496 5.43348856 6835329 NM_175456 Abra actin-binding Rho activating protein 0.6247067 7.59821 3.6094731 0.0458689 -2.1841694 6975613 NM_178395 Zdhhc2 zinc finger, DHHC domain containing 2 0.6268367 7.59821 5.4919979 0.0049559 1.12578241 6893532 NM_007557 Bmp7 bone morphogenetic protein 7 0.6290433 7.59821 7.8002429 0.0004655 4.53504336 6859972 NM_007913 Egr1 early growth response 1 0.6290933 7.59821 5.4336095 0.0053622 1.02967229 4520354 NA NA NA 0.6294767 7.59821 5.094259 0.0077588 0.46160732 6769179 NM_007725 Cnn2 calponin 2 0.6296617 7.59821 8.6941663 0.0002152 5.66328074 6782859 NM_029537 Tmem98 transmembrane protein 98 0.631785 7.59821 9.3935203 0.0001269 6.48024424 6969818 NM_013746 Plekhb1 pleckstrin homology domain containing, family0.63187 B (evectins)7.59821 member10.289595 1 6.54E-05 7.4506216 6775298 NM_015817 Ppap2c phosphatidic acid phosphatase type 2C 0.6324983 7.59821 5.2565558 0.0064693 0.73528746 6968201 NM_183261 Nr2f2 nuclear receptor subfamily 2, group F, member0.63419 2 7.59821 5.7677652 0.0035826 1.57310686 6885412 BC029214 BC029214 cDNA sequence BC029214 0.6358383 7.59821 8.1249296 0.0003426 4.95626907 6968200 NM_009697 Nr2f2 nuclear receptor subfamily 2, group F, member0.63659 2 7.59821 9.331545 0.000134 6.41003925 6919012 NM_001146057 Acot7 acyl-CoA thioesterase 7 0.6369433 7.59821 9.1966386 0.0001458 6.25577406 6962467 NM_181407 Me3 malic enzyme 3, NADP(+)-dependent, mitochondrial0.637205 7.59821 6.7044959 0.0013613 3.01042536 6878265 NM_013554 Hoxd10 homeobox D10 0.6394067 7.59821 5.969219 0.0029033 1.89293994 6995956 NM_012043 Islr immunoglobulin superfamily containing leucine-rich0.64045 repeat7.59821 6.5020492 0.0016752 2.71050751 6865551 NM_008908 Ppic peptidylprolyl isomerase C 0.6404883 7.59821 6.4905177 0.001686 2.69324767 6769144 NM_031380 Fstl3 follistatin-like 3 0.6405117 7.59821 6.4930298 0.001686 2.69700932 6955698 NM_008377 Lrig1 leucine-rich repeats and immunoglobulin-like0.6410417 domains 1 7.59821 12.370296 1.86E-05 9.41828092 6764007 NM_010476 Hsd17b7 hydroxysteroid (17-beta) dehydrogenase 70.6413383 7.59821 6.5434407 0.0015938 2.77230372 6921994 NM_022814 Svep1 sushi, von Willebrand factor type A, EGF and0.6421433 pentraxin domain7.59821 containing6.9760796 1 0.0010645 3.40365139 6900450 NM_172685 Slc25a24 solute carrier family 25 (mitochondrial carrier,0.6493917 phosphate7.59821 carrier), member7.784209 24 0.0004681 4.51389298 6978314 NM_022331 Herpud1 homocysteine-inducible, endoplasmic reticulum0.6496283 stress-inducible,7.59821 ubiquitin-like5.1405345 domain0.0073349 member0.5400098 1 6989752 NM_176922 Itga11 integrin alpha 11 0.650495 7.59821 8.6878331 0.0002155 5.65562796 6870063 NM_019408 Nfkb2 nuclear factor of kappa light polypeptide gene0.651105 enhancer in7.59821 B-cells 2,12.012197 p49/p100 2.06E-05 9.10518182 4468293 NA NA NA 0.651615 7.59821 5.0251511 0.0083574 0.34398094 6849973 NM_023202 Ndufa7 NADH dehydrogenase (ubiquinone) 1 alpha0.6532767 subcomplex, 7.598217 (B14.5a)3.7416068 0.0390164 -1.941207 5399020 NA NA NA 0.65465 7.59821 4.6260591 0.0131283 -0.3474743 7013998 NM_009750 Ngfrap1 nerve growth factor receptor (TNFRSF16) associated0.656055 protein7.59821 1 7.8473428 0.0004453 4.59698132 6972405 NM_001161624 Cdkn1c cyclin-dependent kinase inhibitor 1C (P57) 0.65644 7.59821 8.673538 0.0002167 5.63833717 6846006 NM_153412 Phldb2 pleckstrin homology-like domain, family B, member0.656945 2 7.59821 15.636375 3.31E-06 11.8748684 6836797 NM_144847 Nrbp2 nuclear receptor binding protein 2 0.6581233 7.59821 9.5660031 0.0001155 6.67346371 6812770 NM_025935 Tbc1d7 TBC1 domain family, member 7 0.65913 7.59821 8.0475213 0.0003677 4.85705711 6985106 NM_008706 Nqo1 NAD(P)H dehydrogenase, quinone 1 0.66035 7.59821 4.3261518 0.0190132 -0.879668 6818956 NM_007447 Ang angiogenin, ribonuclease, RNase A family, 0.66068175 7.59821 4.6522178 0.0128005 -0.3015426 6852399 NM_027455 Qpct glutaminyl-peptide cyclotransferase (glutaminyl0.6614767 cyclase) 7.59821 6.2220823 0.002205 2.28605335 5246411 NA NA NA 0.6621333 7.59821 3.9270992 0.030719 -1.6015869 6779725 NM_194054 Rtn4 reticulon 4 0.6625 7.59821 10.170434 7.06E-05 7.32623672 4590122 NA NA NA 0.6635833 7.59821 3.8900758 0.0321919 -1.6692076 6842273 NM_028803 Gbe1 glucan (1,4-alpha-), branching enzyme 1 0.6639 7.59821 9.2831774 0.0001373 6.35495971 6813699 NM_008086 Gas1 growth arrest specific 1 0.6667217 7.59821 4.8099099 0.0106643 -0.0264248 6907810 NM_133853 Magi3 membrane associated guanylate kinase, WW0.6667933 and PDZ domain7.59821 containing8.5797076 3 0.0002334 5.5242462 6913774 NM_172868 Palm2 paralemmin 2 0.66761 7.59821 5.2491253 0.0064854 0.7228368 6861576 NM_031881 Nedd4l neural precursor cell expressed, developmentally0.6679283 down-regulated7.59821 gene9.216893 4-like 0.0001448 6.27906221 6970829 NM_138649 Syt17 synaptotagmin XVII 0.6688 7.59821 6.9078694 0.0011056 3.30586357 7016340 NM_019443 Ndufa1 NADH dehydrogenase (ubiquinone) 1 alpha0.669965 subcomplex, 7.598211 3.5937016 0.0466936 -2.2132108 6905746 NM_016753 Lxn latexin 0.6727917 7.59821 6.8178079 0.0012134 3.17575127 6880492 NM_029617 Casc5 cancer susceptibility candidate 5 0.673165 7.59821 3.9665978 0.0294425 -1.5295489 6774794 NM_007659 Cdk1 cyclin-dependent kinase 1 0.677645 7.59821 3.839892 0.0345795 -1.7610047 6915567 NM_030014 Hook1 hook homolog 1 (Drosophila) 0.6784017 7.59821 7.2737289 0.0007668 3.82283141 6996186 NM_024245 Kif23 kinesin family member 23 0.6833667 7.59821 5.6923026 0.0039319 1.45178674 6809030 NM_009712 Arsb arylsulfatase B 0.6856517 7.59821 10.597574 5.20E-05 7.76580528 6759732 NM_027154 Tmbim1 transmembrane BAX inhibitor motif containing0.6861483 1 7.59821 12.139452 1.86E-05 9.2175737 6790317 NM_019819 Dusp14 dual specificity phosphatase 14 0.6863567 7.59821 5.130837 0.0074057 0.52360405 6857223 XR_034625 Gm4708 predicted gene 4708 0.6866083 7.59821 3.6596176 0.0430941 -2.0918865 6766301 NM_022032 Perp PERP, TP53 apoptosis effector 0.6874233 7.59821 4.0308533 0.0270665 -1.4126027 6807041 NM_011817 Gadd45g growth arrest and DNA-damage-inducible 0.688446745 gamma 7.59821 5.8518475 0.0033032 1.70731372 6849766 NM_009593 Abcg1 ATP-binding cassette, sub-family G (WHITE), 0.68973member 1 7.59821 5.9479259 0.0029773 1.85941281 6998434 NM_207668 Acpp acid phosphatase, prostate 0.6909933 7.59821 7.2930427 0.0007546 3.84961167 5105715 NA NA NA 0.6914883 7.59821 3.7430333 0.0389848 -1.9385879 6868809 NM_183160 E030010A14Rik RIKEN cDNA E030010A14 gene 0.693355 7.59821 3.8911918 0.032154 -1.6671679 6988898 BC094249 Fam55d family with sequence similarity 55, member0.6956783 D 7.59821 4.6896051 0.0121931 -0.2360377 7010183 NM_173740 Maoa monoamine oxidase A 0.6989633 7.59821 7.3563027 0.0007172 3.93697349 4953598 NA NA NA 0.7012133 7.59821 3.8573561 0.0337337 -1.7290414 6806036 NM_009256 Serpinb9 serine (or cysteine) peptidase inhibitor, clade0.7026817 B, member 7.598219 4.0433631 0.0266509 -1.3898715 6956909 NM_172492 Lrtm2 leucine-rich repeats and transmembrane domains0.7036767 2 7.59821 8.0747225 0.0003585 4.89200573 6908073 NM_026672 Gstm7 glutathione S-transferase, mu 7 0.7049467 7.59821 6.5146702 0.00165 2.72937632 6945308 NM_008012 Akr1b8 aldo-keto reductase family 1, member B8 0.70622 7.59821 6.7626971 0.0012908 3.09556947 6952680 BC064033 Fam180a family with sequence similarity 180, member0.7072817 A 7.59821 3.5916101 0.0468062 -2.2170626 6808964 NM_172588 Serinc5 serine incorporator 5 0.7138717 7.59821 9.3564751 0.0001313 6.43832969 6747986 NM_028829 Paqr8 progestin and adipoQ receptor family member0.714575 VIII 7.59821 11.316038 3.08E-05 8.46737433 6806034 NM_011454 Serpinb6b serine (or cysteine) peptidase inhibitor, clade0.7174783 B, member 7.598216b 6.9562563 0.0010869 3.37529916 6840705 NM_001012765 Adcy5 adenylate cyclase 5 0.72253 7.59821 8.0374598 0.0003708 4.84410636 4658803 NA NA NA 0.7233283 7.59821 5.8051329 0.0034261 1.63287734 6932409 NM_145562 Parm1 prostate androgen-regulated mucin-like protein0.7279283 1 7.59821 9.1864341 0.0001458 6.24402399 6785752 NM_022879 Myl7 myosin, light polypeptide 7, regulatory 0.7283583 7.59821 4.7364732 0.0114945 -0.1541632 6978232 NM_173014 Lpcat2 lysophosphatidylcholine acyltransferase 2 0.7349317 7.59821 3.8842142 0.0324377 -1.6799216 6758435 NM_016917 Slc40a1 solute carrier family 40 (iron-regulated transporter),0.7353433 member7.59821 1 6.3171507 0.0020041 2.43145364 6798314 NM_007763 Crip1 cysteine-rich protein 1 (intestinal) 0.7361617 7.59821 8.3860302 0.0002727 5.28543414 6751546 NM_027551 Klhl30 kelch-like 30 (Drosophila) 0.7370867 7.59821 10.187103 7.06E-05 7.34371938 6772104 NM_026405 Rab32 RAB32, member RAS oncogene family 0.738895 7.59821 8.5642031 0.000235 5.50529368 6854844 NM_010831 Sik1 salt inducible kinase 1 0.739675 7.59821 5.2497381 0.0064854 0.72386404 4696431 NA NA NA 0.74098 7.59821 3.5975939 0.0465478 -2.2060429 6830761 NM_009270 Sqle squalene epoxidase 0.7410383 7.59821 4.5144067 0.015141 -0.5444288 6800859 NM_028133 Egln3 EGL nine homolog 3 (C. elegans) 0.7425067 7.59821 5.540264 0.0046663 1.2048638 6840818 NM_008047 Fstl1 follistatin-like 1 0.7426317 7.59821 11.342828 3.08E-05 8.49265971 6987137 NM_133214 BC017612 cDNA sequence BC017612 0.7433533 7.59821 8.9498031 0.0001754 5.96830044 6762423 NM_175259 Shisa4 shisa homolog 4 (Xenopus laevis) 0.7465367 7.59821 15.394534 3.46E-06 11.7146798 6880529 NM_133851 Nusap1 nucleolar and spindle associated protein 1 0.746575 7.59821 3.935436 0.0305268 -1.5863731 6756386 NM_001134829 Lpgat1 lysophosphatidylglycerol acyltransferase 10.7477767 7.59821 8.6955581 0.0002152 5.66496184 6788723 NM_009026 Rasd1 RAS, dexamethasone-induced 1 0.7491933 7.59821 4.4471825 0.0164062 -0.6636985 6947939 NM_027868 Slc41a3 solute carrier family 41, member 3 0.74936 7.59821 14.034898 7.21E-06 10.7534517 6993890 NM_028390 Anln anillin, actin binding protein 0.749965 7.59821 4.585945 0.0138438 -0.4180682 4857681 NA NA NA 0.7501517 7.59821 3.9582017 0.029731 -1.5448527 7011776 NM_008032 Aff2 AF4/FMR2 family, member 2 0.75247 7.59821 6.3907395 0.0018819 2.54310567 6856689 NM_023053 Twsg1 twisted gastrulation homolog 1 (Drosophila) 0.75586 7.59821 15.46924 3.46E-06 11.764493 6888324 NM_009776 Serping1 serine (or cysteine) peptidase inhibitor, clade0.76339 G, member 7.598211 7.7422944 0.0004751 4.45844565 6755237 NM_001039484 Kcnj10 potassium inwardly-rectifying channel, subfamily0.7701483 J, member7.59821 10 4.3863632 0.0175897 -0.7720318 6877608 NM_145523 Gca grancalcin 0.7729483 7.59821 4.9499422 0.0091403 0.21524441 6917790 NM_024243 Fuca1 fucosidase, alpha-L- 1, tissue 0.7754967 7.59821 12.642654 1.79E-05 9.64994903 6850540 NM_030598 Rcan2 regulator of calcineurin 2 0.775595 7.59821 8.9285137 0.0001764 5.94318482 5365162 NA NA NA 0.7813517 7.59821 4.7823843 0.0109801 -0.0742244 6909300 NM_010113 Egf epidermal growth factor 0.7825433 7.59821 6.3710341 0.0019104 2.51328447 6854522 BC030629 2900010M23Rik RIKEN cDNA 2900010M23 gene 0.7854517 7.59821 4.8967059 0.0097214 0.1236679 5511812 NA NA NA 0.7855433 7.59821 4.9557109 0.0090889 0.22514534 6892191 NM_010226 Foxs1 forkhead box S1 0.7871517 7.59821 4.3162953 0.0191694 -0.8973233 6890453 NM_011774 Slc30a4 solute carrier family 30 (zinc transporter), 0.7909533member 4 7.59821 7.7872221 0.0004681 4.5178701 6833232 NM_027334 Mettl7a1 methyltransferase like 7A1 0.7967933 7.59821 7.2786102 0.0007643 3.82960457 6809032 NM_009712 Arsb arylsulfatase B 0.7975283 7.59821 9.1402699 0.0001481 6.19072408 6775151 NM_008185 Gstt1 glutathione S-transferase, theta 1 0.79802 7.59821 7.0323354 0.0009993 3.48381337 6806959 NM_012050 Omd osteomodulin 0.798565 7.59821 11.373817 3.08E-05 8.52183274 6778052 NM_173733 Suox sulfite oxidase 0.80068 7.59821 10.253907 6.64E-05 7.41351299 6800233 NM_013562 Ifrd1 interferon-related developmental regulator0.8010067 1 7.59821 7.5227105 0.000601 4.16421207 6761916 NM_001081756 Nckap5 NCK-associated protein 5 0.8021217 7.59821 9.1981735 0.0001458 6.25754044 6931227 NM_026667 Fam114a1 family with sequence similarity 114, member0.8033767 A1 7.59821 15.612669 3.31E-06 11.8593025 6825443 NM_007940 Ephx2 epoxide hydrolase 2, cytoplasmic 0.8037333 7.59821 7.6549807 0.0005237 4.34220725 6985943 NM_016722 Galns galactosamine (N-acetyl)-6-sulfate sulfatase0.804795 7.59821 10.942997 3.98E-05 8.10883846 6827159 NM_007904 Ednrb endothelin receptor type B 0.805625 7.59821 4.7487912 0.0113912 -0.1326896 6963384 NM_020616 D930014E17Rik RIKEN cDNA D930014E17 gene 0.8064817 7.59821 20.661629 3.37E-07 14.6121945 6899578 NM_028307 Tdrkh tudor and KH domain containing protein 0.8148583 7.59821 7.3172182 0.0007404 3.88306197 6931229 NM_175174 Klhl5 kelch-like 5 (Drosophila) 0.815535 7.59821 17.106802 2.01E-06 12.7859107 6806791 NM_026056 Cap2 CAP, adenylate cyclase-associated protein,0.8168567 2 (yeast) 7.59821 8.8793816 0.0001834 5.88502539 4306475 NA NA NA 0.8199533 7.59821 4.4130568 0.0171282 -0.7244352 6890636 NM_008230 Hdc histidine decarboxylase 0.82602 7.59821 7.7942259 0.0004672 4.52711021 6904300 NM_009828 Ccna2 cyclin A2 0.826315 7.59821 3.8204671 0.0352557 -1.7965777 5152935 NA NA NA 0.8270767 7.59821 4.0207324 0.0274874 -1.4310021 7019640 NM_001168225 Morf4l2 mortality factor 4 like 2 0.828335 7.59821 5.8320911 0.0033547 1.6758719 6858773 NM_130449 Colec12 collectin sub-family member 12 0.8299433 7.59821 6.7262383 0.0013376 3.04228913 6802098 NM_134156 Actn1 actinin, alpha 1 0.8302133 7.59821 8.7866175 0.0002008 5.77446212 6946971 NM_144916 Tmem150a transmembrane protein 150A 0.83523 7.59821 8.5000601 0.00025 5.4265818 6772417 NM_001166402 Tnfaip3 tumor necrosis factor, alpha-induced protein0.835475 3 7.59821 11.420452 3.02E-05 8.56558238 6810688 NM_019671 Net1 neuroepithelial cell transforming gene 1 0.8376333 7.59821 9.6340023 0.0001101 6.74877243 6961010 NM_010882 Ndn necdin 0.8439167 7.59821 7.2946738 0.0007546 3.85187105 6763235 NM_001024945 Qsox1 quiescin Q6 sulfhydryl oxidase 1 0.8526967 7.59821 9.1641386 0.0001481 6.21831171 6820040 NM_033325 Loxl2 lysyl oxidase-like 2 0.8527517 7.59821 3.7854012 0.0366974 -1.8608482 6819887 NM_013492 Clu clusterin 0.8551883 7.59821 4.9928751 0.0086633 0.28882555 7016823 NM_008150 Gpc4 glypican 4 0.8603367 7.59821 9.4980817 0.0001216 6.59775447 6805380 NM_175664 Hist1h2bb histone cluster 1, H2bb 0.8654 7.59821 3.7661417 0.0376889 -1.8961757 6923520 NM_010008 Cyp2j6 cytochrome P450, family 2, subfamily j, polypeptide0.8663317 6 7.59821 5.5540144 0.0045865 1.22733199 7020676 NM_181315 Car5b carbonic anhydrase 5b, mitochondrial 0.872945 7.59821 10.97441 3.93E-05 8.13949982 6954425 NM_020047 Tacstd2 tumor-associated calcium signal transducer0.8743067 2 7.59821 6.2220298 0.002205 2.28597274 7013997 NM_011712 Wbp5 WW domain binding protein 5 0.878455 7.59821 11.174303 3.35E-05 8.3325752 6910621 NM_199465 Nexn nexilin 0.8860933 7.59821 9.3105019 0.0001341 6.38610734 6754027 NM_022018 Fam129a family with sequence similarity 129, member0.8869317 A 7.59821 4.7039157 0.0119936 -0.2110097 6982918 NM_013494 Cpe carboxypeptidase E 0.8871233 7.59821 4.2781515 0.0200442 -0.9657405 6803133 NM_011812 Fbln5 fibulin 5 0.889275 7.59821 5.0227168 0.0083663 0.33982601 5188163 NA NA NA 0.8926033 7.59821 3.6765382 0.0424787 -2.0607671 6950413 NM_010128 Emp1 epithelial membrane protein 1 0.89527 7.59821 4.161683 0.0231092 -1.1755162 6928457 NM_009873 Cdk6 cyclin-dependent kinase 6 0.8980433 7.59821 9.2331913 0.0001432 6.29776879 4928168 NA NA NA 0.9000967 7.59821 5.0730453 0.0079379 0.42556876 6751709 NM_016778 Bok BCL2-related ovarian killer protein 0.9012983 7.59821 10.311507 6.46E-05 7.47334427 6889893 NM_009162 Scg5 secretogranin V 0.905185 7.59821 12.20694 1.86E-05 9.27667145 6996448 NM_001164254 Tpm1 tropomyosin 1, alpha 0.9055683 7.59821 11.662818 2.61E-05 8.79003274 6917288 NM_023485 Sync syncoilin 0.90852 7.59821 12.345704 1.86E-05 9.3970921 6761915 NM_172484 Nckap5 NCK-associated protein 5 0.9206833 7.59821 12.449883 1.86E-05 9.48654576 5372100 NA NA NA 0.9214833 7.59821 4.6090454 0.0134291 -0.3773922 6977993 NM_027280 Nkd1 naked cuticle 1 homolog (Drosophila) 0.9303183 7.59821 13.106428 1.36E-05 10.0321173 6861707 NM_026473 Tubb6 tubulin, beta 6 0.9344383 7.59821 8.3317408 0.0002873 5.21768114 6828642 NM_198024 Ranbp3l RAN binding protein 3-like 0.939215 7.59821 5.1703204 0.007102 0.59031997 6950394 NM_181444 Gprc5a G protein-coupled receptor, family C, group0.946095 5, member A7.59821 6.6003515 0.0015128 2.85686935 6824266 NM_007554 Bmp4 bone morphogenetic protein 4 0.9517517 7.59821 7.7727622 0.0004681 4.49877293 6849091 NM_144515 Zfp52 zinc finger protein 52 0.9520233 7.59821 6.0694734 0.0026217 2.04991067 6926912 NM_001039554 Angptl7 angiopoietin-like 7 0.9528433 7.59821 5.8851868 0.0031893 1.76024403 6913042 NM_027450 Glipr2 GLI pathogenesis-related 2 0.9532383 7.59821 9.1854035 0.0001458 6.24283667 6791298 NM_011623 Top2a topoisomerase (DNA) II alpha 0.9658217 7.59821 5.0076014 0.0085131 0.31400812 5106118 NA NA NA 0.9664267 7.59821 3.5555775 0.0486887 -2.2834399 6918892 NM_133753 Errfi1 ERBB receptor feedback inhibitor 1 0.97317 7.59821 6.0161581 0.0027711 1.96661533 6967017 NM_010129 Emp3 epithelial membrane protein 3 0.9737617 7.59821 17.251223 2.01E-06 12.8699217 6842800 NM_023844 Jam2 junction adhesion molecule 2 0.9819033 7.59821 4.2525756 0.020752 -1.0116957 6957766 NM_001164212 Rerg RAS-like, estrogen-regulated, growth-inhibitor0.9961567 7.59821 7.3047192 0.0007478 3.86577765 6806707 NM_025508 Gmpr guanosine monophosphate reductase 0.9974333 7.59821 8.4128308 0.000268 5.31874925 5348938 NA NA NA 1.0066033 7.59821 3.7305266 0.0395637 -1.961553 6872781 NM_009890 Ch25h cholesterol 25-hydroxylase 1.0135133 7.59821 5.6483663 0.0041308 1.38077234 6760518 NM_177305 Arl4c ADP-ribosylation factor-like 4C 1.01449 7.59821 10.020995 7.87E-05 7.16827774 6822477 NM_183187 Fam107a family with sequence similarity 107, member1.014655 A 7.59821 5.82671 0.0033547 1.66729819 6756572 NM_001011874 Xkr4 X Kell blood group precursor related family1.0185167 member 4 7.59821 10.03591 7.87E-05 7.18414329 6900348 NM_010360 Gstm5 glutathione S-transferase, mu 5 1.0337217 7.59821 6.6991913 0.001368 3.00264126 6989086 NM_175535 Arhgap20 Rho GTPase activating protein 20 1.034505 7.59821 5.7955041 0.0034664 1.61749509 6966198 NM_011464 Spint2 serine protease inhibitor, Kunitz type 2 1.0349367 7.59821 12.225189 1.86E-05 9.2925915 5605777 NA NA NA 1.0413 7.59821 4.442385 0.0165153 -0.6722294 6793861 NM_026037 Mboat2 membrane bound O-acyltransferase domain1.0440217 containing 27.59821 8.3065911 0.0002904 5.18617273 6925054 NM_016748 Ctps cytidine 5'-triphosphate synthase 1.054045 7.59821 9.1440158 0.0001481 6.19505788 6800934 NM_010907 Nfkbia nuclear factor of kappa light polypeptide gene1.0660333 enhancer in7.59821 B-cells inhibitor,10.01742 alpha7.87E-05 7.16447258 6765218 NM_007498 Atf3 activating transcription factor 3 1.0660917 7.59821 4.8941847 0.0097513 0.11932192 6901898 NM_009472 Unc5c unc-5 homolog C (C. elegans) 1.1115633 7.59821 12.853529 1.61E-05 9.82560618 6818696 NM_001145953 Lgals3 lectin, galactose binding, soluble 3 1.1205967 7.59821 8.4319339 0.0002673 5.34244276 6891879 NM_009378 Thbd thrombomodulin 1.12838 7.59821 6.8315825 0.0011967 3.19572528 6956509 NM_080448 Srgap3 SLIT-ROBO Rho GTPase activating protein 31.1291467 7.59821 6.6923763 0.0013778 2.99263491 6871768 NM_177420 Psat1 phosphoserine aminotransferase 1 1.1722517 7.59821 7.7494354 0.0004735 4.46790832 6881870 NM_053195 Slc24a3 solute carrier family 24 (sodium/potassium/calcium1.1792367 exchanger),7.59821 member11.123992 3 3.48E-05 8.28430857 6929828 NM_001001985 Nat8l N-acetyltransferase 8-like 1.1803933 7.59821 11.834657 2.25E-05 8.94625617 6768198 NM_025273 Pcbd1 pterin 4 alpha carbinolamine dehydratase/dimerization1.186755 cofactor7.59821 of 5.3904364hepatocyte nuclear0.005613 factor0.95829595 1 alpha (TCF1) 1 6844819 NM_016674 Cldn1 claudin 1 1.19676 7.59821 7.6903582 0.0005017 4.38942427 6922317 NM_177371 Tnfsf15 tumor necrosis factor (ligand) superfamily,1.2407883 member 15 7.59821 10.823228 4.34E-05 7.99112438 6942524 NM_008871 Serpine1 serine (or cysteine) peptidase inhibitor, clade1.249485 E, member 7.598211 5.96414 0.0029205 1.88494867 6871471 NM_019699 Fads2 fatty acid desaturase 2 1.252815 7.59821 7.808837 0.0004635 4.54636627 6892579 NM_009373 Tgm2 transglutaminase 2, C polypeptide 1.2531567 7.59821 13.744962 8.47E-06 10.5342072 6988855 NM_207675 Cadm1 cell adhesion molecule 1 1.3124383 7.59821 14.911886 4.50E-06 11.3855563 6956507 NM_080448 Srgap3 SLIT-ROBO Rho GTPase activating protein 3 1.31377 7.59821 4.6196084 0.0132112 -0.3588136 6959595 NM_001012401 Hspb6 heat shock protein, alpha-crystallin-related,1.3196517 B6 7.59821 12.325856 1.86E-05 9.37995724 6850645 NM_008690 Nfkbie nuclear factor of kappa light polypeptide gene1.352955 enhancer in7.59821 B-cells inhibitor,17.754372 epsilon1.70E-06 13.1554958 6806514 NM_177808 Gm5082 predicted gene 5082 1.35369 7.59821 9.4368243 0.0001249 6.52905288 6963442 NM_009627 Adm adrenomedullin 1.361785 7.59821 12.199527 1.86E-05 9.27019692 6961650 NM_001162532 Fam174b family with sequence similarity 174, member1.384565 B 7.59821 14.341276 6.12E-06 10.9794683 6874653 NM_028804 Ccdc3 coiled-coil domain containing 3 1.3898233 7.59821 10.266099 6.63E-05 7.42620467 4894565 NA NA NA 1.39954 7.59821 3.7328456 0.0394896 -1.9572942 6810063 NM_029001 Elovl7 ELOVL family member 7, elongation of long1.4045933 chain fatty acids7.59821 (yeast)6.9447394 0.0010869 3.35880199 6773169 NM_178908 Fam26e family with sequence similarity 26, member1.4229667 E 7.59821 14.683843 5.11E-06 11.2255286 4659118 NA NA NA 1.4390733 7.59821 3.6792851 0.042369 -2.0557162 6899374 NM_011313 S100a6 S100 calcium binding protein A6 (calcyclin)1.4759733 7.59821 8.5344955 0.0002423 5.46889951 6885022 NM_028317 2810030E01Rik RIKEN cDNA 2810030E01 gene 1.4900767 7.59821 16.185465 2.69E-06 12.2273713 6906967 NM_009264 Sprr1a small proline-rich protein 1A 1.5441 7.59821 6.1812956 0.0022961 2.223272 6889357 NM_178695 Prrg4 proline rich Gla (G-carboxyglutamic acid) 4 (transmembrane)1.559215 7.59821 15.313982 3.49E-06 11.6606338 7013837 NM_026838 Srpx2 sushi-repeat-containing protein, X-linked 21.5645983 7.59821 11.929399 2.14E-05 9.03137553 6857461 NM_026514 Cdc42ep3 CDC42 effector protein (Rho GTPase binding)1.5723433 3 7.59821 25.983168 5.91E-08 16.61805 6885414 NM_008963 Ptgds prostaglandin D2 synthase (brain) 1.5811983 7.59821 10.543159 5.37E-05 7.7107679 6951412 NM_013743 Pdk4 pyruvate dehydrogenase kinase, isoenzyme1.5906133 4 7.59821 4.8187561 0.010585 -0.0110833 6857483 NM_009994 Cyp1b1 cytochrome P450, family 1, subfamily b, polypeptide1.5932417 1 7.59821 10.9342 3.98E-05 8.10023569 6872834 NM_013468 Ankrd1 ankyrin repeat domain 1 (cardiac muscle) 1.594625 7.59821 8.70179 0.0002152 5.67248664 7016826 NM_016697 Gpc3 glypican 3 1.635615 7.59821 21.575105 2.43E-07 15.0104182 6949335 NM_001012477 Cxcl12 chemokine (C-X-C motif) ligand 12 1.67531 7.59821 25.383798 5.91E-08 16.4261578 6861278 NM_001167925 A730017C20Rik RIKEN cDNA A730017C20 gene 1.6873567 7.59821 9.5590945 0.0001155 6.66578517 6779672 NM_146015 Efemp1 epidermal growth factor-containing fibulin-like1.72598 extracellular7.59821 matrix 16.903381protein 1 2.01E-06 12.6659911 6969207 NM_029614 Prss23 protease, serine, 23 1.7283967 7.59821 5.8286224 0.0033547 1.67034571 7010355 NM_001044384 Timp1 tissue inhibitor of metalloproteinase 1 1.7568167 7.59821 10.614384 5.18E-05 7.78275189 6769255 NM_008655 Gadd45b growth arrest and DNA-damage-inducible 1.790871745 beta 7.59821 11.595244 2.73E-05 8.7279419 6781090 NM_001083929 Gpx3 glutathione peroxidase 3 1.79878 7.59821 11.444642 3.00E-05 8.58820427 6905408 NM_133200 P2ry14 purinergic receptor P2Y, G-protein coupled,1.8015767 14 7.59821 9.7903008 9.70E-05 6.92004603 6782288 NM_033321 P2rx5 purinergic receptor P2X, ligand-gated ion channel,1.8048533 5 7.59821 16.770535 2.01E-06 12.5866566 6910173 NM_010516 Cyr61 cysteine rich protein 61 1.8479617 7.59821 11.947048 2.14E-05 9.04715331 7016827 AK085028 A630012P03Rik RIKEN cDNA A630012P03 gene 1.8531017 7.59821 11.488047 2.93E-05 8.62867113 6854260 NM_013749 Tnfrsf12a tumor necrosis factor receptor superfamily, member1.87731 12a7.59821 22.805316 1.58E-07 15.5082053 6929119 NM_008013 Fgl2 fibrinogen-like protein 2 1.914345 7.59821 14.431643 5.95E-06 11.0450495 6939990 NM_021274 Cxcl10 chemokine (C-X-C motif) ligand 10 1.941145 7.59821 6.4775918 0.0017081 2.67387797 6879567 NM_173749 Pamr1 peptidase domain containing associated with1.9729683 muscle regeneration7.59821 9.62108221 0.0001107 6.73450083 6998125 NM_022319 Clstn2 calsyntenin 2 2.424295 7.59821 12.155902 1.86E-05 9.23201131 6995258 NM_011526 Tagln transgelin 2.4582583 7.59821 12.796013 1.61E-05 9.778012 6806960 NM_008760 Ogn osteoglycin 2.8494217 7.59821 13.103686 1.36E-05 10.0299024 6865238 NM_033037 Cdo1 cysteine dioxygenase 1, cytosolic 2.9185083 7.59821 14.186781 6.64E-06 10.8662123 6922890 NM_177863 Frem1 Fras1 related extracellular matrix protein 1 3.338925 7.59821 47.166581 1.08E-10 20.4085682 6907009 NM_028798 Crct1 cysteine-rich C-terminal 1 3.8436033 7.59821 12.159389 1.86E-05 9.23506854