DOCSLIB.ORG

Knockdown of Mir-21 As a Novel Approach for Leukemia Therapy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Knockdown of Mir-21 As a Novel Approach for Leukemia Therapy View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector J Formos Med Assoc 2010;109(9):621–623 Contents lists available at ScienceDirect Volume 109 Number 9 September 2010 ISSN 0929 6646 Journal of the Journal of the Formosan Medical Association Formosan Medical Association Knockdown of miR-21 as a novel approach for leukemia therapy Fluoroquinolone prophylaxis—an Asian perspective Downregulation of S100A13 blocks FGF-1 release Application of head-up tilt table testing in children Formosan Medical Association Journal homepage: http://www.jfma-online.com Taipei, Taiwan News and Perspectives Knockdown of miR-21 as a Novel Approach for Leukemia Therapy Yimei Feng, Xinghua Chen,* Lei Gao MicroRNAs have remained in the spotlight since hematopoietic stem cells into hematopoietic their discovery. More and more studies have shown progenitor cells, giving rise to different lineages and that miRNAs play important roles in pathologic mature blood cells. Accordingly, the hematopoi- processes in solid tumors. Among them, micro- etic system becomes a good model for microRNA RNA-21 (miR-21) is one of the most prominent research. Hematopoiesis is governed by the con- miRNAs implicated in the genesis and progression comitant alteration in expression of several genes. of human cancer. Few studies, however, have fo- Given the ability of a single miRNA to control the cused on the mechanism of gene regulation by expression of several genes, it is proposed that miR-21 and its roles in hematopoiesis and leuke- miRNAs regulate the process of hematopoiesis.2 mogenesis. Because miR-21 is highly expressed in leukemic cells, here we present a hypothesis that knockdown of miR-21 may be a novel approach MiR-21 Fingerprints During for leukemia therapy. MiR-21 may also be a new Tumorigenesis, Including Leukemia diagnostic marker and therapeutic target for leukemia. MiR-21 is one of the most prominent miRNAs implicated in the genesis and progression of human cancer.3 MiR-21 is known by a number of MicroRNAs Regulate Hematopoiesis synonyms including hsa-mir-21, MIR21, miR-21, MIRN21 and miRNA21. In Homo sapiens, the MicroRNAs are a class of small (19–21 nucleotides) MIRN21 gene (DNA of premiR-21) is located on non-coding RNA molecules that have important chromosome 17q23.2 and is highly expressed in roles in many cellular pathways and whose different tumor types. MIRN21 has been involved aberrant expression appears to be a common fea- in promoting tumor growth, proliferation, anti- ture of malignancy.1 Hematopoiesis is sustained apoptosis, migration and response to gemcitabine- by continuous differentiation of multipotent based chemotherapy. The potential targets of ©2010 Elsevier & Formosan Medical Association ................................................... Department of Hematology, Xinqiao Hospital, The Third Military Medical University, Chongqing, China. *Correspondence to: Professor Xinghua Chen, Department of Hematology, Xinqiao Hospital, The Third Military Medical University, Chongqing 400037, China. E-mail: [email protected] J Formos Med Assoc | 2010 • Vol 109 • No 9 621 Y. Feng, et al miR-21 include the programmed cell death protein Knockdown of MiR-21 as a Novel 4, reversion-inducing cysteine-rich protein with Approach for Leukemia Therapy kazal motifs, tropomyosin 1, sprouty 2, phospha- tase and tensin (PTEN) homolog and Nuclear We have raised a hypothesis that knockdown of factor IB (NFIB). More in-depth functional stud- miR-21 in leukemic cells can suppress the occur- ies with miR-21 are demonstrating that miR-21 rence and aggravation of leukemia. The main cause displays oncogenic activities and can be classed of residual leukemia and recurrence of leukemia as an oncomir in solid tumors. In contrast, the is the existence of leukemic stem cells. Therefore, role of miR-21 in the proliferation and differenti- a lentivirus vector of anti-miR-21 could be con- ation of hematologic neoplasm cells has at- structed and then transfected into leukemic stem tracted little attention. cells. In that way, after transfection with the anti- Chronic lymphocytic leukemia (CLL) is the miR-21 oligonucleotide, the expression of anti- most common leukemia among adults in Western apoptotic protein Bcl-2 in leukemia cells in the countries, and accounts for about 30% of all patient is decreased, while simultaneously tumor leukemia patients.4 Currently, little is known re- suppressor levels, such as PTEN, tropomyosin 1 garding the pathogenic factors initiating and ag- and programmed cell death protein 4, are in- gravating this disease. creased. Furthermore, the level of miR-21 could be CLL patients have been characterized by sig- used as a diagnostic marker. More information nificant overexpression of miR-21. Expression concerning the genesis, progression and progno- of miR-21 in patients with CLL is dramatically sis of leukemia could be gathered by monitoring higher (up to 10-fold) than that in CD19+ lym- the expression of miR-21. phocytes of normal people.5 Overexpression of miR-21 may, therefore, be one of the initiating events occurring in CLL. Gazon et al found that Knockdown of MiR-21 Inhibits the miR-21 was upregulated in acute myeloid Development of Cancer Cells leukemia (AML) patients with t (6;11).6 Jongen- Lavrencic et al reported that miR-21 is consistently Accumulating data is beginning to support the upregulated in AML, regardless of cytogenetic and attractive notion that sequence-specific inhibition molecular subtype.7 Ectopically raising miR-21 of a single oncomir, miR-21, can provide a novel expression in myeloma cells significantly re- therapeutic approach to modulate deregulated duced apoptosis levels. Loffler et al reasoned that proteins in cancer. For example, knockdown of miR-21 might contribute to the Stat3-dependent miR-21 in cultured glioblastoma cells triggered survival of myeloma cells.8 MiR-21, measured activation of caspases and lead to increased ap- by quantitative RT-PCR (reverse transcription- optotic cell death.11 Furthermore, knockdown of polymerase chain reaction), was also upregulated miR-21 in metastatic breast cancer MDA-MB-231 in T-cell leukemic (T-ALL) and T-cell lymphoma cells significantly reduced invasion and lung (ALCL) cell lines.9 There are two distinct molecu- metastasis.12 Knockdown of miR-21 in breast lar subtypes of diffuse large B cell lymphomas: cancer MCF-7 cells also lead to suppression of germinal center B cell-like and activated B cell- cell growth in vitro and tumor growth in a mouse like. Lawrie et al identified that miR-21 was more model.13 Additionally, knockdown of miR-21 in highly expressed in activated B cell-like cell lines hepatic cells increased expression of the PTEN compared with the germinal center B cell-like cell homolog tumor suppressor, and decreased tumor lines.10 Moreover, through multivariate analysis, cell proliferation, migration and invasion.14 In the expression of miR-21 was shown to be an in- short, these studies suggest that deletion or down- dependent prognostic indicator in diffuse large B regulation of miR-21 inhibits the development cell lymphomas.10 of cancer cells, thus leading to interference with 622 J Formos Med Assoc | 2010 • Vol 109 • No 9 MiR-21 and leukemia cancer initiation and progression. Given the pre- China (No. 30800496 and 30670890), and the vious findings demonstrating the result of miR- Chongqing Natural Science Foundation (No. 21 knockdown, similar outcomes could be seen 2008BB5293 and CSTC2009BA5011). following the knockdown of miR-21 in leukemic stem cells. References Conclusions 1. Lawrie CH. MicroRNAs and haematology: small molecules, big function. Br J Haematol 2007;137:503–12. Improving life quality and expectancy following 2. Yendamuri S, Calin GA. The role of microRNA in human diagnosis with leukemia has always been difficult leukemia: a review. Leukemia 2009;23:1257–63. 3. Selcuklu SD, Donoghue MTA, Spillane C. miR-21 as a key for oncologists, as the majority of chemothera- regulator of oncogenic processes. Biochem Soc Trans 2009; peutic regimens have significant side effects and 37:918–25. limited efficacy. Hematopoietic stem cell trans- 4. Calin GA, Pekarsky Y, Croce CM. The role of microRNA plantation may be considered in the treatment of and other non-coding RNA in the pathogenesis of chronic leukemia, but is costly in developing countries and lymphocytic leukemia. Best Pract Res Clin Haematol may lead to serious graft-versus-host disease and 2007;20:425–37. immunological rejection. Alternative approaches, 5. Fulci V, Chiaretti S, Goldoni M, et al. Quantitative tech- nologies establish a novel microRNA profile of chronic such as using antibodies or vaccines, are currently, lymphocytic leukemia. Blood 2007;109:4944–51. for the most part, experimental and in the early 6. Garzon R, Volinia S, Liu CG, et al. MicroRNA signatures as- stages of clinical use. The discovery that miR-21 sociated with cytogenetics and prognosis in acute myeloid is a key miRNA (oncomir) that is dysregulated leukemia. Blood 2008;111:3183–9. in many cancers indicates an important role of 7. Jongen-Lavrencic M, Sun SM, Dijkstra MK, et al. miRNAs in cancer. This finding starts a new era MicroRNA expression profiling in relation to the genetic of cancer investigations. heterogeneity of acute myeloid leukemia. Blood 2008; Determining how miR-21 is regulated and how 111:5078–85. 8. Loffler D, Brocke-Heidrich K, Pfeifer G, et al. Interleukin-6 it regulates downstream target genes will be a pre- dependent survival of multiple myeloma cells involves the requisite for rational design of cancer therapeutic Stat3-mediated induction of microRNA-21 through a highly strategies. Modulation of miR-21 expression can conserved enhancer. Blood 2007;110:1330–3. also be used as a diagnostic and prognostic marker 9. Lawrie CH, Saunders NJ, Soneji S, et al. MicroRNA ex- for cancer sufferers, leukemia patients in particular. pression in lymphocyte development and malignancy. Previously, little knowledge about the role of Leukemia 2008;22:1440–6.
Load more

Recommended publications
  • Non-Coding Rnas As Cancer Hallmarks in Chronic Lymphocytic Leukemia
    International Journal of Molecular Sciences Review Non-Coding RNAs as Cancer Hallmarks in Chronic Lymphocytic Leukemia Linda Fabris 1, Jaroslav Juracek 2 and George Calin 1,* 1 Department of Translational Molecular Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA; [email protected] 2 Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA; [email protected] * Correspondence: [email protected] Received: 24 July 2020; Accepted: 10 September 2020; Published: 14 September 2020 Abstract: The discovery of non-coding RNAs (ncRNAs) and their role in tumor onset and progression has revolutionized the way scientists and clinicians study cancers. This discovery opened new layers of complexity in understanding the fine-tuned regulation of cellular processes leading to cancer. NcRNAs represent a heterogeneous group of transcripts, ranging from a few base pairs to several kilobases, that are able to regulate gene networks and intracellular pathways by interacting with DNA, transcripts or proteins. Deregulation of ncRNAs impinge on several cellular responses and can play a major role in each single hallmark of cancer. This review will focus on the most important short and long non-coding RNAs in chronic lymphocytic leukemia (CLL), highlighting their implications as potential biomarkers and therapeutic targets as they relate to the well-established hallmarks of cancer. The key molecular events in the onset of CLL will be contextualized, taking into account the role of the “dark matter” of the genome. Keywords: chronic lymphocytic leukemia; lncRNA; miRNA; hallmarks 1. Introduction: Current Status of Chronic Lymphocytic Leukemia Research Chronic lymphocytic leukemia (CLL) is the most common leukemia in adults in the Western world, representing more than 30% of all leukemia cases [1].
    [Show full text]
  • Gene Section Review
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Review MIRN21 (microRNA 21) Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey Published in Atlas Database: March 2007 Online updated version: http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html DOI: 10.4267/2042/38450 This work is licensed under a Creative Commons Attribution-Non-commercial-No Derivative Works 2.0 France Licence. © 2007 Atlas of Genetics and Cytogenetics in Oncology and Haematology sequences of MIRN21 showed enrichment for Pol II Identity but not Pol III. Hugo: MIRN21 MIRN21 gene was shown to harbor a 5' promoter Other names: hsa-mir-21; miR-21 element. 1008 bp DNA fragment for MIRN21 gene Location: 17q23.1 was cloned (-959 to +49 relative to T1 transcription Location base pair: MIRN21 is located on chr17: site, see Figure 1; A). Analysis of the sequence showed 55273409-55273480 (+). a candidate 'CCAAT' box transcription control element Local order: Based on Mapviewer, genes flanking located approximately about 200 nt upstream of the T1 MIRN21 oriented from centromere to telomere on site. T1 transcription site was found to be located in a 17q23 are: sequence similar to 'TATA' box - TMEM49, transmembrane protein 49, 17q23.1. (ATAAACCAAGGCTCTTACCATAGCTG). To test - MIRN21, microRNA 21, 17q23.1. the activity of the element, about 1kb DNA fragment - TUBD1, tubulin, delta 1, 17q23.1. was inserted into the 5' end of firefly luciferase - LOC729565, similar to NADH dehydrogenase indicator gene and transfected into 293T cells. The (ubiquinone) 1 beta subcomplex, 8, 19 kDa, 17q23.1.
    [Show full text]
  • Micrornas Mediated Regulation of the Ribosomal Proteins and Its Consequences on the Global Translation of Proteins
    cells Review microRNAs Mediated Regulation of the Ribosomal Proteins and Its Consequences on the Global Translation of Proteins Abu Musa Md Talimur Reza 1,2 and Yu-Guo Yuan 1,3,* 1 Jiangsu Co-Innovation Center of Prevention and Control of Important Animal Infectious Diseases and Zoonoses, College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China; [email protected] 2 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawi´nskiego5a, 02-106 Warsaw, Poland 3 Jiangsu Key Laboratory of Zoonosis/Joint International Research Laboratory of Agriculture and Agri-Product Safety, The Ministry of Education of China, Yangzhou University, Yangzhou 225009, China * Correspondence: [email protected]; Tel.: +86-514-8797-9228 Abstract: Ribosomal proteins (RPs) are mostly derived from the energy-consuming enzyme families such as ATP-dependent RNA helicases, AAA-ATPases, GTPases and kinases, and are important structural components of the ribosome, which is a supramolecular ribonucleoprotein complex, composed of Ribosomal RNA (rRNA) and RPs, coordinates the translation and synthesis of proteins with the help of transfer RNA (tRNA) and other factors. Not all RPs are indispensable; in other words, the ribosome could be functional and could continue the translation of proteins instead of lacking in some of the RPs. However, the lack of many RPs could result in severe defects in the biogenesis of ribosomes, which could directly influence the overall translation processes and global expression of the proteins leading to the emergence of different diseases including cancer. While microRNAs (miRNAs) are small non-coding RNAs and one of the potent regulators of the post-transcriptional 0 gene expression, miRNAs regulate gene expression by targeting the 3 untranslated region and/or coding region of the messenger RNAs (mRNAs), and by interacting with the 50 untranslated region, Citation: Reza, A.M.M.T.; Yuan, Y.-G.
    [Show full text]
  • Oncomir Mir-125B Regulates Hematopoiesis by Targeting the Gene Lin28a
    Oncomir miR-125b regulates hematopoiesis by targeting the gene Lin28A Aadel A. Chaudhuria,1, Alex Yick-Lun Soa,1, Arnav Mehtaa, Aarathi Minisandrama, Nikita Sinhaa, Vanessa D. Jonssonb, Dinesh S. Raoc, Ryan M. O’Connelld, and David Baltimorea,2 Departments of aBiology and bComputing and Mathematical Sciences, California Institute of Technology, Pasadena, CA 91125; cDepartment of Pathology and Laboratory Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095; and dDepartment of Pathology, University of Utah, Salt Lake City, UT 84112 Contributed by David Baltimore, January 23, 2012 (sent for review October 29, 2011) MicroRNA-125b (miR-125b) is up-regulated in patients with leukemia. regulation of miR-125b has profound effects on normal hema- Overexpression of miR-125b alone in mice causes a very aggressive, topoiesis, and Lin28A overexpression mimics those effects. transplantable myeloid leukemia. Before leukemia, these mice do not display elevation of white blood cells in the spleen or bone marrow; Results rather, the hematopoietic compartment shows lineage-skewing, with miR-125b Ectopic Expression Favors Myeloid Differentiation and myeloid cell numbers dramatically increased and B-cell numbers Causes a Highly Invasive Myeloid Leukemia. Previously, we showed severely diminished. miR-125b exerts this effect by up-regulating the that overexpression of miR-125b in bone marrow-transplanted number of common myeloid progenitors while inhibiting develop- recipient mice causes a myeloid leukemia 4–6 mo after bone ment of pre-B cells. We applied a miR-125b sponge loss of function marrow reconstitution (5). Here, we found that the neoplastic system in vivo to show that miR-125b physiologically regulates myeloid cells infiltrate nonhematopoietic organs, including the hematopoietic development.
    [Show full text]
  • The Oncogenic Role of Mir-155 in Breast Cancer
    Published OnlineFirst June 26, 2012; DOI: 10.1158/1055-9965.EPI-12-0173 Cancer Epidemiology, MiniReview Biomarkers & Prevention The Oncogenic Role of miR-155 in Breast Cancer Sam Mattiske, Rachel J. Suetani, Paul M. Neilsen, and David F. Callen Abstract miR-155isanoncogenicmiRNAwithwelldescribedrolesinleukemia.However,additionalrolesof miR-155 in breast cancer progression have recently been described. A thorough literature search was conducted to review all published data to date, examining the role of miR-155 in breast cancer. Data on all validated miR-155 target genes was collated to identify biologic pathways relevant to miR-155 and breast cancer progression. Publications describing the clinical relevance, functional characterization, and regu- lation of expression of miR-155 in the context of breast cancer are reviewed. A total of 147 validated miR- 155 target genes were identified from the literature. Pathway analysis of these genes identified likely roles in apoptosis, differentiation, angiogenesis, proliferation, and epithelial–mesenchymal transition. The large number of validated miR-155 targets presented here provide many avenues of interest as to the clinical potential of miR-155. Further investigation of these target genes will be required to elucidate the specific mechanisms and functions of miR-155 in breast cancer. This is the first review examining the role of miR- 155 in breast cancer progression. The collated data of target genes and biologic pathways of miR-155 identified in this review suggest new avenues of research for this oncogenic miRNA. Cancer Epidemiol Biomarkers Prev; 21(8); 1236–43. Ó2012 AACR. Introduction found to regulate levels of LIN-14 protein (7, 8). Since this miRNAs are small noncoding RNAs that control discovery, there have been over 500 miRNAs described, expression of target genes by either inhibiting protein regulating a wide range of genes and cellular processes, translation or directly targeting mRNA transcripts of although the total predicted number of unique miRNAs target genes for degradation (1).
    [Show full text]
  • Identification of Mirnas and Their Targets Through High-Throughput
    Chen et al. BMC Plant Biology (2016) 16:80 DOI 10.1186/s12870-016-0770-z RESEARCH ARTICLE Open Access Identification of miRNAs and their targets through high-throughput sequencing and degradome analysis in male and female Asparagus officinalis Jingli Chen1†, Yi Zheng2†, Li Qin1†, Yan Wang1, Lifei Chen1, Yanjun He1, Zhangjun Fei2,3 and Gang Lu1* Abstract Background: MicroRNAs (miRNAs), a class of non-coding small RNAs (sRNAs), regulate various biological processes. Although miRNAs have been identified and characterized in several plant species, miRNAs in Asparagus officinalis have not been reported. As a dioecious plant with homomorphic sex chromosomes, asparagus is regarded as an important model system for studying mechanisms of plant sex determination. Results: Two independent sRNA libraries from male and female asparagus plants were sequenced with Illumina sequencing, thereby generating 4.13 and 5.88 million final clean reads, respectively. Both libraries predominantly contained 24-nt sRNAs, followed by 21-nt sRNAs. Further analysis identified 154 conserved miRNAs, which belong to 26 families, and 39 novel miRNA candidates seemed to be specific to asparagus. Comparative profiling revealed that 63 miRNAs exhibited significant differential expression between male and female plants, which was confirmed by real-time quantitative PCR analysis. Among them, 37 miRNAs were significantly up-regulated in the female library, whereas the others were preferentially expressed in the male library. Furthermore, 40 target mRNAs representing 44 conserved and seven novel miRNAs were identified in asparagus through high-throughput degradome sequencing. Functional annotation showed that these target mRNAs were involved in a wide range of developmental and metabolic processes.
    [Show full text]
  • Development of Novel Therapeutic Agents by Inhibition of Oncogenic Micrornas
    International Journal of Molecular Sciences Review Development of Novel Therapeutic Agents by Inhibition of Oncogenic MicroRNAs Dinh-Duc Nguyen and Suhwan Chang * ID Department of Biomedical Sciences, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505, Korea; [email protected] * Correspondence: [email protected] Received: 21 November 2017; Accepted: 22 December 2017; Published: 27 December 2017 Abstract: MicroRNAs (miRs, miRNAs) are regulatory small noncoding RNAs, with their roles already confirmed to be important for post-transcriptional regulation of gene expression affecting cell physiology and disease development. Upregulation of a cancer-causing miRNA, known as oncogenic miRNA, has been found in many types of cancers and, therefore, represents a potential new class of targets for therapeutic inhibition. Several strategies have been developed in recent years to inhibit oncogenic miRNAs. Among them is a direct approach that targets mature oncogenic miRNA with an antisense sequence known as antimiR, which could be an oligonucleotide or miRNA sponge. In contrast, an indirect approach is to block the biogenesis of miRNA by genome editing using the CRISPR/Cas9 system or a small molecule inhibitor. The development of these inhibitors is straightforward but involves significant scientific and therapeutic challenges that need to be resolved. In this review, we summarize recent relevant studies on the development of miRNA inhibitors against cancer. Keywords: antimiR; antagomiR; miRNA-sponge; oncomiR; CRISPR/Cas9; cancer therapeutics 1. Introduction Cancer has been the leading cause of death and a major health problem worldwide for many years; basically, it results from out-of-control cell proliferation. Traditionally, several key proteins have been identified and found to affect signaling pathways regulating cell cycle progression, apoptosis, and gene transcription in various types of cancers [1,2].
    [Show full text]
  • Wo 2008/070082 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date PCT (10) International Publication Number 12 June 2008 (12.06.2008) WO 2008/070082 A2 (51) International Patent Classification: (74) Agents: CLAUSS, Isabelle, M. et al.; Patent Group, FO A6IK 48/00 (2006.01) LEY HOAG LLP, 155 Seaport Blvd., Boston, MA 02210- 2600 (US). (21) International Application Number: PCT/US2007/024845 (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM, (22) International Filing Date: AT,AU, AZ, BA, BB, BG, BH, BR, BW, BY,BZ, CA, CH, 4 December 2007 (04.12.2007) CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, (25) Filing Language: English IN, IS, JP, KE, KG, KM, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY,MA, MD, ME, MG, MK, MN, MW, (26) Publication Language: English MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PG, PH, PL, (30) Priority Data: PT, RO, RS, RU, SC, SD, SE, SG, SK, SL, SM, SV, SY, 60/872,764 4 December 2006 (04. 12.2006) US TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW (71) Applicants (for all designated States except US): THE JOHNS HOPKINS UNIVERSITY [US/US]; 3400 North (84) Designated States (unless otherwise indicated, for every Charles Street, Baltimore, MD 21218 (US). OHIO STATE kind of regional protection available): ARIPO (BW, GH, UNIVERSITY [US/US]; 1320 Kinnear Road, Columbus, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, OH 43212 (US).
    [Show full text]
  • Microrna-155-3P Promotes Hepatocellular Carcinoma Formation
    Tang et al. Journal of Experimental & Clinical Cancer Research (2016) 35:93 DOI 10.1186/s13046-016-0371-6 RESEARCH Open Access MicroRNA-155-3p promotes hepatocellular carcinoma formation by suppressing FBXW7 expression Bo Tang1,2†, Biao Lei1,2†, Guangying Qi3†, Xingsi Liang1,2, Fang Tang1,2, Shengguang Yuan1,2, Zhenran Wang1,2, Shuiping Yu1,2 and Songqing He1,2* Abstract Background: MicroRNAs (miRNAs) are small non-coding RNAs frequently dysregulated in human malignant tumors. In the present study, we analyzed the role miR-155-3p plays in Hepatocellular carcinoma (HCC), which has been reported participation in some other types of cancer. Methods: qRT-PCR was used to measure the levels of miR-155-3p in HCC specimens and HCC cell lines. Overexpression of miR-155-3p and miR-155-3p inhibitor were transfected into HCC cell lines to investigate its role in HCC. Colony formation assay and 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assays were used to analyses cell proliferation in vitro. In vivo tumor formation assays were performed in BALB/c nude mice. Luciferase reporter assay was carried out to measure the translation of F-Box and WD repeat romain containing 7 (FBXW7). Results: We found that miR-155-3p was remarkably upregulated both in HCC tissue and cell lines. Overexpression of miR-155-3p enhanced HCC cell proliferation in vitro and tumorigenesis in vivo. In addition, overexpression of miR-155-3p is correlated with decreased levels FBXW7 mainly through inhibiting the expression of FBXW7. Conclusions: Our studies suggest that miR-155-3p plays an important role in the pathogenesis of HCC and implicates its potential applications in the treatment of HCC cancer.
    [Show full text]
  • Integrative Genome Analysis Reveals an Oncomir/ Oncogene Cluster Regulating Glioblastoma Survivorship
    Integrative genome analysis reveals an oncomir/ oncogene cluster regulating glioblastoma survivorship Hyunsoo Kima,1, Wei Huangb,1, Xiuli Jiangb, Brenton Pennicookeb, Peter J. Parka,2, and Mark D. Johnsonb,3 aHarvard Partners Center for Genetics and Genomics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; and bDepartment of Neurological Surgery, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Jonathan G. Seidman, Harvard Medical School, Boston, MA, and approved December 4, 2009 (received for review September 1, 2009) Using a multidimensional genomic data set on glioblastoma from cooperates with CDK4 and CENTG1 to increase GBM growth. The Cancer Genome Atlas, we identified hsa-miR-26a as a cooper- Amplification of this oncomir/oncogene cluster correlates with ating component of a frequently occurring amplicon that also shortened survival in GBM patients. contains CDK4 and CENTG1, two oncogenes that regulate the RB1 and PI3 kinase/AKT pathways, respectively. By integrating DNA Results copy number, mRNA, microRNA, and DNA methylation data, we miR-26a Is a Frequent Target of the 12q13.3–14.1 Amplicon. Analysis identified functionally relevant targets of miR-26a in glioblastoma, of TCGA data from GBM revealed numerous genomic alter- including PTEN, RB1, and MAP3K2/MEKK2. We demonstrate that ations (3). To identify microRNAs that are likely to play a key miR-26a alone can transform cells and it promotes glioblastoma role in GBM, we searched for microRNAs whose expression is cell growth in vitro and in the mouse brain by decreasing PTEN, driven by copy number.
    [Show full text]
  • Pancreatic Cancer and Its Microenvironment—Recent Advances and Current Controversies
    International Journal of Molecular Sciences Review Pancreatic Cancer and Its Microenvironment—Recent Advances and Current Controversies 1, 2, 2 2, Kinga B. Stopa y , Agnieszka A. Kusiak y, Mateusz D. Szopa , Pawel E. Ferdek * and Monika A. Jakubowska 1,* 1 Malopolska Centre of Biotechnology, Jagiellonian University, ul. Gronostajowa 7A, 30-387 Krakow, Poland; [email protected] 2 Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, ul. Gronostajowa 7, 30-387 Krakow, Poland; [email protected] (A.A.K.); [email protected] (M.D.S.) * Correspondence: [email protected] (P.E.F.); [email protected] (M.A.J.) These authors contributed equally to this work. y Received: 9 April 2020; Accepted: 29 April 2020; Published: 1 May 2020 Abstract: Pancreatic ductal adenocarcinoma (PDAC) causes annually well over 400,000 deaths world-wide and remains one of the major unresolved health problems. This exocrine pancreatic cancer originates from the mutated epithelial cells: acinar and ductal cells. However, the epithelia-derived cancer component forms only a relatively small fraction of the tumor mass. The majority of the tumor consists of acellular fibrous stroma and diverse populations of the non-neoplastic cancer-associated cells. Importantly, the tumor microenvironment is maintained by dynamic cell-cell and cell-matrix interactions. In this article, we aim to review the most common drivers of PDAC. Then we summarize the current knowledge on PDAC microenvironment, particularly in relation to pancreatic cancer therapy. The focus is placed on the acellular stroma as well as cell populations that inhabit the matrix.
    [Show full text]
  • The Role of Micrornas in Oral Squamous Cell Carcinoma Pathogenesis: a Literature Review
    Applied Cancer Research. 2013;33(4):198-205. REVIEW The role of microRNAS in oral squamous cell carcinoma pathogenesis: a literature review Anne Maria Guimarães Lessa1, Ludmila Faro Valverde2, Rosane Borges Dias2, Maria Cecília Mathias Machado1, Jean Nunes dos Santos3, Clarissa Araújo Gurgel Rocha3 ABSTRACT In this review, we summarize the main aspects related to the involvement of microRNAs (miRNAs) in oral carcinogenesis. miRNAs are small non-protein-coding RNAs that function such as regulators of gene expression. They regulate various biological processes such as growth, differentiation and apoptosis and have been widely studied in carcinogenesis. miRNAs may exhibit oncogenic or tumor suppressor activity in cancer, depending on the biological context and the cell type. The altered expression patterns of miRNA in cancer could serve as molecular biomarkers for tumor diagnosis, prognosis and disease-specific prediction of therapeutic responses. The literature indicates that up-regulation of miR-21, miR-221, miR-184 and under expression of miR-133a, miR-375 and let-7b are the principal profile in oral squamous cell carcinomas. Keywords: gene expression; microRNAS; MIRN133 microRNA, human; MIRN184 microRNA, human; MIRN21 microRNA, human; MIRN221 microRNA, human; MIRN375 microRNA, human; mirnlet7 microRNA, human; mouth mucosa; mouth neoplasms; tumor markers, biological. INTRODUCTION years later, Reinhart et al.12 observed that another C. elegans heterochronic gene, let-7, was also represented by a small Cells have developed several biological mechanisms to non-coding RNA capable of starting the temporal cascade of ensure that mitosis, differentiation and death occur in a coor- regulatory genes through an RNA-RNA interaction with the 3 dinated manner and disturbances in genes related with these untranslated region (UTR) of target genes.
    [Show full text]