Research Article Mir-31 Functions As an Oncomir Which Promotes Epithelial-Mesenchymal Transition Via Regulating BAP1 in Cervical Cancer

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Hindawi BioMed Research International Volume 2017, Article ID 6361420, 12 pages https://doi.org/10.1155/2017/6361420 Research Article miR-31 Functions as an Oncomir Which Promotes Epithelial-Mesenchymal Transition via Regulating BAP1 in Cervical Cancer Nan Wang,1 Yong Li,2 andJianhongZhou1 1 Laboratory of Molecular Biology, College of Life Science, Jiaying University, Meizhou 514015, China 2Key Laboratory of Molecular Biophysics of the Ministry of Education, College of Life Science and Technology, Center for Human Genome Research, Huazhong University of Science and Technology, Wuhan 430074, China Correspondence should be addressed to Nan Wang; [email protected] Received 16 May 2017; Accepted 29 August 2017; Published 11 October 2017 Academic Editor: Stephen H. Safe Copyright © 2017 Nan Wang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MicroRNA-31 (miR-31) functions as tumor suppressors or oncogenes that are involved in tumor behavior. However, the function of miR-31 in cervical carcinogenesis remains unclear. The aim of this study was to validate the potential role of miR-31 and BRCA1- associated protein-1 (BAP1) on regulating epithelial-mesenchymal transition (EMT) in cervical cancer. In the present study, qRT- PCR assay revealed that the expression of miR-31 was upregulated in human cervical cancer cells and clinical tissues. Results of wound healing and cell migration assay revealed that knockdown of miR-31 inhibited cell metastasis and migration. Bioinformatic and dual-luciferase reporter gene assay showed that BAP1 was the direct target of miR-31. Furthermore, the results revealed that miR-31 promoted proliferation and EMT in cervical cancer cells and accelerated the development of tumor growth in vivo xenograft experiment by inhibiting BAP1 expression. Overall, these results highlight an important role of miR-31 functioning as an oncomir which could promote EMT in cervical cancer via downregulating BAP1 expression. Thus, downregulation of miR-31 could bea novel approach for the molecular treatment of cervical cancers and other malignancies. 1. Introduction MicroRNAs (miRNAs) are a class of single-stranded, noncoding RNAs (∼22 nucleotides in length), which binds to Cervical cancer, a common malignancy in gynecology, is the 3 untranslated region (3 UTR) of target gene, leading to thefourthleadingcauseofcancer-relateddeathsinfemale mRNA degradation or translational repression [3, 4]. Recent worldwide [1]. Although the major risk factor causing cervical evidences recognized that aberrant miRNAs expression is cancer is persistent infection with high-risk human papillo- associated with cell malignant transformation, especially in maviruses (HPVs), accumulating evidences have shown that tumorigenesis and tumor development [5, 6]. The specific HPVs infection alone is insufficient to cause the malignant expressionofmiRNAsineachcancertypemayserveasa transformation and there may be other genetic alterations in biomarker for cancer diagnosis and prognosis or even as cervical carcinogenesis [2]. Even though the overall survival therapeutic target. miRNAs function as oncogenes or tumor rate of cervical cancer cases was increased owing to surgery, suppressors that can suppress multiple tumor suppressor chemotherapy, and/or radiotherapy, the prognosis of cervical genes or oncogenes during carcinogenesis [7]. Among these cancer patients remains poor. Metastasis and invasion are the miRNAs, miR-31 may function as an oncogene or a tumor main causes of death in cervical cancer cases; however, the suppressor depending on the cellular contexts [8–11]. To date, molecular mechanisms of metastasis and invasion in cer- miR-31 has been reported as upregulated in cervical cancer, vical carcinogenesis are still poorly understood. Finding which implies that miR-31 may serve as an onco-miRNA novel metastases-related genes and exploring their molecular participating in the development of cervical cancer [12]. mechanismareofgreatsignificance. Mounting investigations have indicated the essential role of 2 BioMed Research International epithelial-mesenchymal transition (EMT) in the progression Table 1: Correlation of miR-31 expression level and clinicopatholog- of human cancers [13–15]. EMT is under the control of ical data. miRNAs network [16]. Whether miR-31 can induce EMT or Clinicopathological miR-31 expression value other malignant transformation in cervical cancer remains parameters =31 =31 unknown. Low ( )High( ) BRCA1-associated protein-1 (BAP1) is a deubiquitinating Age (years) enzyme, which has been reported to correlate with numerous ≤40 13 16 cellular processes. Overexpression of BAP1 can suppress >40 18 15 0.475 tumor growth in mouse xenografts [17]. In NSCLC, high Tumor size BAP1 expression was associated with a lack of lymph node ≤5cm 17 15 metastasis [18]. Yu et al. found that BAP1 was a target of miR- > 31 and inhibited lung cancer progression [19]. However, there 5 cm 14 16 0.753 has very little research on the role of BAP1 in cervical cancer Lymph node metastasis and the relationship between miR-31-BAP1 and EMT has not No 19 10 ∗ yet been reported. Yes 12 21 0.007 In this study, we first identified that miR-31 expression is FIGO stage inversely correlated to the expression of BAP1. BAP1 was a IB 22 8 direct target of miR-31; downregulation of BAP1 by miR-31- 0∗ induced EMT in cervical cancer. Therefore, our study clari- IIA 9 23 0.00 fied previously unidentified prometastatic roles of miR-31 in Vascular invasion cervical cancer and miR-31-BAP1 pathway might be a new No 24 14 ∗ potential target for therapy in cervical metastasis. Yes 7 17 0.000 Stromal invasion 2. Materials and Methods ≤2/3 25 5 > 0∗ 2.1. Patient Samples and Cell Culture. Cervical cancer sam- 2/3 6 26 0.00 ples were collected from Medical College of Jiaying Uni- Differentiation versity, China. Both of the carcinomas and normal adjacent Well 15 12 tissues were collected. The clinicopathologic information of Poor 16 19 0.174 thepatientsislistedinTable1.Thisstudywasapprovedby Peritoneal metastasis local institutional review boards on human subject research No 18 10 and in accordance with the Declaration of Helsinki. Written informed consent was obtained from all study participants. Yes 13 21 0.128 ThehumancervicalcancercelllinesHeLa,HaCaT,and Histological type C33A were obtained from Chinese Center for Type Culture Serous 14 23 ∗ Collection (Shanghai, China) and grown in Dulbecco’s mod- Others 17 8 0.027 ified Eagle’s medium supplemented with 10% fetal bovine ∗ <0.05 ∘ . serum (FBS; Gibco Life Technologies) at 37 Cinahumidified 5% CO2/95% air atmosphere. miR-31-p-R GCCCAAGCTTCAGTTCCAAGTTAC- 2.2. MicroRNA Transfection. The human cervical cancer cells AGGAGAATACTATGA. were seeded at 6-well plate and transfected with miR-31, miR- 31 negative control (miR-NC), miR-31 inhibitor (anti-miR- 2.3. RNA Extraction and RT-PCR. Total RNA was extracted 31), or miR-31 inhibitor negative control (anti-miR-NC) using from cells using Trizol reagent (Invitrogen Life Technologies). Lipofectamine 2000 (Invitrogen) on the following day when The concentrations of RNA were determined using a Nan- the cells were approximately 60–70% confluent, following oDrop ND-1000 instrument (ThermoFisher, Waltham, MA, ∘ the manufacturer’s instructions. The miRNAs were purchased USA) and aliquots of the samples were stored at −80 C. The from RiboBio (RiboBio Co., Guangzhou, China). The full real-time PCR was performed as reported previously [12]. lengthhumanBAP1plasmidandemptyplasmidwhich served as the negative control were purchased from Invit- 2.4.ProteinExtractionandWesternBlotAnalysis. All cells rogen. The cells were harvested 48 h after transfection and were rinsed with PBS and lysed with RIPA Lysis buffer subjected to analysis by quantitative RT-PCR or West- (Beyotime, China) supplemented with a Protease and Phos- ern blot. The sequences of BAP1 used were listed as fol- phatase Inhibitor Cocktail (Thermo Scientific 78440) on ice lows: (si-BAP1#1: 5 -CCGUGAUUGAUGAUGAUAUTT- for 30 min. Cell lysates were centrifuged for 10 min (12000, ∘ 3 (sense); si- BAP1#2: 5 -CGGCCUUUCUAGACAAUC- 4 C), the precipitation was collected, and then total protein ATT-3 (sense); and si-BAP1#3: 5 -GGCUGAGAUUGC- concentration was determined using BCA Protein Assay AAACUAUTT-3 (sense). Primer sequences of miR-31 were Kit (Beyotime, China). Proteins were separated by 12% as follows: miR-31-p-F CCGGACGCGTGCACAAAAGTT- SDS-PAGE and then transferred to polyvinylidene fluoride ATACATAATGTCATTATTCTTATG (PVDF) membrane (Millipore, Boston, MA, USA). The BioMed Research International 3 membranes were blocked in 5% nonfat milk for 2 h at room Solution (Fisher Scientific, USA). Images were captured using temperature and incubated with the primary anti-BAP1, anti- microscope and average migrating cells from six independent E-cadherin, anti-N-cadherin, anti-vimentin antibody, and fields were counted. anti-GAPDH antibody. The membranes were washed for threetimesandthenincubatedwithsecondaryantibody 2.10. In Vivo Xenografts. Four-week-old female BALB/c nude for 2 h at room temperature. The signals were detected with mice were purchased from Shanghai SLAC Laboratory Ani- ECL Western Blotting Substrate (ThermoFisher, Waltham, mal, Co., Ltd. Mice were divided into two groups (=5); 5 × 6 MA,USA)andproteinbandintensitywasmeasuredusing 10 HeLa cells in which BAP1
Recommended publications
  • Non-Coding Rnas As Cancer Hallmarks in Chronic Lymphocytic Leukemia

    Non-Coding Rnas As Cancer Hallmarks in Chronic Lymphocytic Leukemia

    International Journal of Molecular Sciences Review Non-Coding RNAs as Cancer Hallmarks in Chronic Lymphocytic Leukemia Linda Fabris 1, Jaroslav Juracek 2 and George Calin 1,* 1 Department of Translational Molecular Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA; [email protected] 2 Department of Experimental Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA; [email protected] * Correspondence: [email protected] Received: 24 July 2020; Accepted: 10 September 2020; Published: 14 September 2020 Abstract: The discovery of non-coding RNAs (ncRNAs) and their role in tumor onset and progression has revolutionized the way scientists and clinicians study cancers. This discovery opened new layers of complexity in understanding the fine-tuned regulation of cellular processes leading to cancer. NcRNAs represent a heterogeneous group of transcripts, ranging from a few base pairs to several kilobases, that are able to regulate gene networks and intracellular pathways by interacting with DNA, transcripts or proteins. Deregulation of ncRNAs impinge on several cellular responses and can play a major role in each single hallmark of cancer. This review will focus on the most important short and long non-coding RNAs in chronic lymphocytic leukemia (CLL), highlighting their implications as potential biomarkers and therapeutic targets as they relate to the well-established hallmarks of cancer. The key molecular events in the onset of CLL will be contextualized, taking into account the role of the “dark matter” of the genome. Keywords: chronic lymphocytic leukemia; lncRNA; miRNA; hallmarks 1. Introduction: Current Status of Chronic Lymphocytic Leukemia Research Chronic lymphocytic leukemia (CLL) is the most common leukemia in adults in the Western world, representing more than 30% of all leukemia cases [1].
  • Micrornas Mediated Regulation of the Ribosomal Proteins and Its Consequences on the Global Translation of Proteins

    Micrornas Mediated Regulation of the Ribosomal Proteins and Its Consequences on the Global Translation of Proteins

    cells Review microRNAs Mediated Regulation of the Ribosomal Proteins and Its Consequences on the Global Translation of Proteins Abu Musa Md Talimur Reza 1,2 and Yu-Guo Yuan 1,3,* 1 Jiangsu Co-Innovation Center of Prevention and Control of Important Animal Infectious Diseases and Zoonoses, College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China; [email protected] 2 Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawi´nskiego5a, 02-106 Warsaw, Poland 3 Jiangsu Key Laboratory of Zoonosis/Joint International Research Laboratory of Agriculture and Agri-Product Safety, The Ministry of Education of China, Yangzhou University, Yangzhou 225009, China * Correspondence: [email protected]; Tel.: +86-514-8797-9228 Abstract: Ribosomal proteins (RPs) are mostly derived from the energy-consuming enzyme families such as ATP-dependent RNA helicases, AAA-ATPases, GTPases and kinases, and are important structural components of the ribosome, which is a supramolecular ribonucleoprotein complex, composed of Ribosomal RNA (rRNA) and RPs, coordinates the translation and synthesis of proteins with the help of transfer RNA (tRNA) and other factors. Not all RPs are indispensable; in other words, the ribosome could be functional and could continue the translation of proteins instead of lacking in some of the RPs. However, the lack of many RPs could result in severe defects in the biogenesis of ribosomes, which could directly influence the overall translation processes and global expression of the proteins leading to the emergence of different diseases including cancer. While microRNAs (miRNAs) are small non-coding RNAs and one of the potent regulators of the post-transcriptional 0 gene expression, miRNAs regulate gene expression by targeting the 3 untranslated region and/or coding region of the messenger RNAs (mRNAs), and by interacting with the 50 untranslated region, Citation: Reza, A.M.M.T.; Yuan, Y.-G.
  • Oncomir Mir-125B Regulates Hematopoiesis by Targeting the Gene Lin28a

    Oncomir Mir-125B Regulates Hematopoiesis by Targeting the Gene Lin28a

    Oncomir miR-125b regulates hematopoiesis by targeting the gene Lin28A Aadel A. Chaudhuria,1, Alex Yick-Lun Soa,1, Arnav Mehtaa, Aarathi Minisandrama, Nikita Sinhaa, Vanessa D. Jonssonb, Dinesh S. Raoc, Ryan M. O’Connelld, and David Baltimorea,2 Departments of aBiology and bComputing and Mathematical Sciences, California Institute of Technology, Pasadena, CA 91125; cDepartment of Pathology and Laboratory Medicine, David Geffen School of Medicine, University of California, Los Angeles, CA 90095; and dDepartment of Pathology, University of Utah, Salt Lake City, UT 84112 Contributed by David Baltimore, January 23, 2012 (sent for review October 29, 2011) MicroRNA-125b (miR-125b) is up-regulated in patients with leukemia. regulation of miR-125b has profound effects on normal hema- Overexpression of miR-125b alone in mice causes a very aggressive, topoiesis, and Lin28A overexpression mimics those effects. transplantable myeloid leukemia. Before leukemia, these mice do not display elevation of white blood cells in the spleen or bone marrow; Results rather, the hematopoietic compartment shows lineage-skewing, with miR-125b Ectopic Expression Favors Myeloid Differentiation and myeloid cell numbers dramatically increased and B-cell numbers Causes a Highly Invasive Myeloid Leukemia. Previously, we showed severely diminished. miR-125b exerts this effect by up-regulating the that overexpression of miR-125b in bone marrow-transplanted number of common myeloid progenitors while inhibiting develop- recipient mice causes a myeloid leukemia 4–6 mo after bone ment of pre-B cells. We applied a miR-125b sponge loss of function marrow reconstitution (5). Here, we found that the neoplastic system in vivo to show that miR-125b physiologically regulates myeloid cells infiltrate nonhematopoietic organs, including the hematopoietic development.
  • The Oncogenic Role of Mir-155 in Breast Cancer

    The Oncogenic Role of Mir-155 in Breast Cancer

    Published OnlineFirst June 26, 2012; DOI: 10.1158/1055-9965.EPI-12-0173 Cancer Epidemiology, MiniReview Biomarkers & Prevention The Oncogenic Role of miR-155 in Breast Cancer Sam Mattiske, Rachel J. Suetani, Paul M. Neilsen, and David F. Callen Abstract miR-155isanoncogenicmiRNAwithwelldescribedrolesinleukemia.However,additionalrolesof miR-155 in breast cancer progression have recently been described. A thorough literature search was conducted to review all published data to date, examining the role of miR-155 in breast cancer. Data on all validated miR-155 target genes was collated to identify biologic pathways relevant to miR-155 and breast cancer progression. Publications describing the clinical relevance, functional characterization, and regu- lation of expression of miR-155 in the context of breast cancer are reviewed. A total of 147 validated miR- 155 target genes were identified from the literature. Pathway analysis of these genes identified likely roles in apoptosis, differentiation, angiogenesis, proliferation, and epithelial–mesenchymal transition. The large number of validated miR-155 targets presented here provide many avenues of interest as to the clinical potential of miR-155. Further investigation of these target genes will be required to elucidate the specific mechanisms and functions of miR-155 in breast cancer. This is the first review examining the role of miR- 155 in breast cancer progression. The collated data of target genes and biologic pathways of miR-155 identified in this review suggest new avenues of research for this oncogenic miRNA. Cancer Epidemiol Biomarkers Prev; 21(8); 1236–43. Ó2012 AACR. Introduction found to regulate levels of LIN-14 protein (7, 8). Since this miRNAs are small noncoding RNAs that control discovery, there have been over 500 miRNAs described, expression of target genes by either inhibiting protein regulating a wide range of genes and cellular processes, translation or directly targeting mRNA transcripts of although the total predicted number of unique miRNAs target genes for degradation (1).
  • Development of Novel Therapeutic Agents by Inhibition of Oncogenic Micrornas

    Development of Novel Therapeutic Agents by Inhibition of Oncogenic Micrornas

    International Journal of Molecular Sciences Review Development of Novel Therapeutic Agents by Inhibition of Oncogenic MicroRNAs Dinh-Duc Nguyen and Suhwan Chang * ID Department of Biomedical Sciences, University of Ulsan College of Medicine, Asan Medical Center, Seoul 05505, Korea; [email protected] * Correspondence: [email protected] Received: 21 November 2017; Accepted: 22 December 2017; Published: 27 December 2017 Abstract: MicroRNAs (miRs, miRNAs) are regulatory small noncoding RNAs, with their roles already confirmed to be important for post-transcriptional regulation of gene expression affecting cell physiology and disease development. Upregulation of a cancer-causing miRNA, known as oncogenic miRNA, has been found in many types of cancers and, therefore, represents a potential new class of targets for therapeutic inhibition. Several strategies have been developed in recent years to inhibit oncogenic miRNAs. Among them is a direct approach that targets mature oncogenic miRNA with an antisense sequence known as antimiR, which could be an oligonucleotide or miRNA sponge. In contrast, an indirect approach is to block the biogenesis of miRNA by genome editing using the CRISPR/Cas9 system or a small molecule inhibitor. The development of these inhibitors is straightforward but involves significant scientific and therapeutic challenges that need to be resolved. In this review, we summarize recent relevant studies on the development of miRNA inhibitors against cancer. Keywords: antimiR; antagomiR; miRNA-sponge; oncomiR; CRISPR/Cas9; cancer therapeutics 1. Introduction Cancer has been the leading cause of death and a major health problem worldwide for many years; basically, it results from out-of-control cell proliferation. Traditionally, several key proteins have been identified and found to affect signaling pathways regulating cell cycle progression, apoptosis, and gene transcription in various types of cancers [1,2].
  • Microrna-155-3P Promotes Hepatocellular Carcinoma Formation

    Microrna-155-3P Promotes Hepatocellular Carcinoma Formation

    Tang et al. Journal of Experimental & Clinical Cancer Research (2016) 35:93 DOI 10.1186/s13046-016-0371-6 RESEARCH Open Access MicroRNA-155-3p promotes hepatocellular carcinoma formation by suppressing FBXW7 expression Bo Tang1,2†, Biao Lei1,2†, Guangying Qi3†, Xingsi Liang1,2, Fang Tang1,2, Shengguang Yuan1,2, Zhenran Wang1,2, Shuiping Yu1,2 and Songqing He1,2* Abstract Background: MicroRNAs (miRNAs) are small non-coding RNAs frequently dysregulated in human malignant tumors. In the present study, we analyzed the role miR-155-3p plays in Hepatocellular carcinoma (HCC), which has been reported participation in some other types of cancer. Methods: qRT-PCR was used to measure the levels of miR-155-3p in HCC specimens and HCC cell lines. Overexpression of miR-155-3p and miR-155-3p inhibitor were transfected into HCC cell lines to investigate its role in HCC. Colony formation assay and 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) assays were used to analyses cell proliferation in vitro. In vivo tumor formation assays were performed in BALB/c nude mice. Luciferase reporter assay was carried out to measure the translation of F-Box and WD repeat romain containing 7 (FBXW7). Results: We found that miR-155-3p was remarkably upregulated both in HCC tissue and cell lines. Overexpression of miR-155-3p enhanced HCC cell proliferation in vitro and tumorigenesis in vivo. In addition, overexpression of miR-155-3p is correlated with decreased levels FBXW7 mainly through inhibiting the expression of FBXW7. Conclusions: Our studies suggest that miR-155-3p plays an important role in the pathogenesis of HCC and implicates its potential applications in the treatment of HCC cancer.
  • Integrative Genome Analysis Reveals an Oncomir/ Oncogene Cluster Regulating Glioblastoma Survivorship

    Integrative Genome Analysis Reveals an Oncomir/ Oncogene Cluster Regulating Glioblastoma Survivorship

    Integrative genome analysis reveals an oncomir/ oncogene cluster regulating glioblastoma survivorship Hyunsoo Kima,1, Wei Huangb,1, Xiuli Jiangb, Brenton Pennicookeb, Peter J. Parka,2, and Mark D. Johnsonb,3 aHarvard Partners Center for Genetics and Genomics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; and bDepartment of Neurological Surgery, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115 Edited by Jonathan G. Seidman, Harvard Medical School, Boston, MA, and approved December 4, 2009 (received for review September 1, 2009) Using a multidimensional genomic data set on glioblastoma from cooperates with CDK4 and CENTG1 to increase GBM growth. The Cancer Genome Atlas, we identified hsa-miR-26a as a cooper- Amplification of this oncomir/oncogene cluster correlates with ating component of a frequently occurring amplicon that also shortened survival in GBM patients. contains CDK4 and CENTG1, two oncogenes that regulate the RB1 and PI3 kinase/AKT pathways, respectively. By integrating DNA Results copy number, mRNA, microRNA, and DNA methylation data, we miR-26a Is a Frequent Target of the 12q13.3–14.1 Amplicon. Analysis identified functionally relevant targets of miR-26a in glioblastoma, of TCGA data from GBM revealed numerous genomic alter- including PTEN, RB1, and MAP3K2/MEKK2. We demonstrate that ations (3). To identify microRNAs that are likely to play a key miR-26a alone can transform cells and it promotes glioblastoma role in GBM, we searched for microRNAs whose expression is cell growth in vitro and in the mouse brain by decreasing PTEN, driven by copy number.
  • Pancreatic Cancer and Its Microenvironment—Recent Advances and Current Controversies

    Pancreatic Cancer and Its Microenvironment—Recent Advances and Current Controversies

    International Journal of Molecular Sciences Review Pancreatic Cancer and Its Microenvironment—Recent Advances and Current Controversies 1, 2, 2 2, Kinga B. Stopa y , Agnieszka A. Kusiak y, Mateusz D. Szopa , Pawel E. Ferdek * and Monika A. Jakubowska 1,* 1 Malopolska Centre of Biotechnology, Jagiellonian University, ul. Gronostajowa 7A, 30-387 Krakow, Poland; [email protected] 2 Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, ul. Gronostajowa 7, 30-387 Krakow, Poland; [email protected] (A.A.K.); [email protected] (M.D.S.) * Correspondence: [email protected] (P.E.F.); [email protected] (M.A.J.) These authors contributed equally to this work. y Received: 9 April 2020; Accepted: 29 April 2020; Published: 1 May 2020 Abstract: Pancreatic ductal adenocarcinoma (PDAC) causes annually well over 400,000 deaths world-wide and remains one of the major unresolved health problems. This exocrine pancreatic cancer originates from the mutated epithelial cells: acinar and ductal cells. However, the epithelia-derived cancer component forms only a relatively small fraction of the tumor mass. The majority of the tumor consists of acellular fibrous stroma and diverse populations of the non-neoplastic cancer-associated cells. Importantly, the tumor microenvironment is maintained by dynamic cell-cell and cell-matrix interactions. In this article, we aim to review the most common drivers of PDAC. Then we summarize the current knowledge on PDAC microenvironment, particularly in relation to pancreatic cancer therapy. The focus is placed on the acellular stroma as well as cell populations that inhabit the matrix.
  • Tumor Penetrating Nanomedicine Targeting Both an Oncomir and an Oncogene in Pancreatic Cancer

    Tumor Penetrating Nanomedicine Targeting Both an Oncomir and an Oncogene in Pancreatic Cancer

    www.oncotarget.com Oncotarget, 2019, Vol. 10, (No. 51), pp: 5349-5358 Research Paper Tumor penetrating nanomedicine targeting both an oncomiR and an oncogene in pancreatic cancer Maud-Emmanuelle Gilles1, Liangliang Hao2,3, Kaelyn Brown1, Jihoon Lim1, Sangeeta N. Bhatia2,3,4,5,6,7 and Frank J. Slack1 1HMS Initiative for RNA Medicine, Department of Pathology, Cancer Center, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA 2Institute for Medical Engineering and Science, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA 3Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA 4Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, Massachusetts, USA 5Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, Massachusetts, USA 6Howard Hughes Medical Institute, Cambridge, Massachusetts, USA 7Marble Center for Cancer Nanomedicine, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA Correspondence to: Frank J. Slack, email: [email protected] Keywords: miRNAs; KRAS; RNA-based-therapy; PDAC; tumor-penetrating nanocomplexes Received: March 28, 2019 Accepted: July 28, 2019 Published: September 03, 2019 Copyright: Gilles et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Developing new targeted therapy for pancreatic cancer is one of the major current challenges in cancer research. KRAS mutations and miRNA dysregulation (e.g. miR-21-5p oncomiR) play key roles in Pancreatic Ductal Adenocarcinoma (PDAC), leading to rapid progression of the disease.
  • A Feedback Loop Between Mirna-155, Programmed Cell Death 4 and Activation Protein-1 Modulates the Expression of Mir-155 and Tumorigenesis in Tongue Cancer

    A Feedback Loop Between Mirna-155, Programmed Cell Death 4 and Activation Protein-1 Modulates the Expression of Mir-155 and Tumorigenesis in Tongue Cancer

    bioRxiv preprint doi: https://doi.org/10.1101/394130; this version posted August 17, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A feedback loop between miRNA-155, Programmed cell death 4 and Activation Protein-1 modulates the expression of miR-155 and tumorigenesis in tongue cancer Shabir Zargar1, Vivek Tomar2, Vidyarani Shyamsundar 3, Ramshankar Vijayalakshmi4, Kumaravel Somasundaram2 and Devarajan Karunagaran1 1 Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences, Indian Institute of Technology Madras, Chennai, India 2 Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, India 3 Center for Oral Cancer Prevention Awareness and Research, Sree Balaji Dental College and Hospital, Bharath University, Chennai, India 4 Department of Preventive Oncology, Cancer Institute, Adyar, Chennai, India Correspondence: Dr D Karunagaran, E-mail: [email protected], +91-44-2257-4126 Department of Biotechnology, Bhupat and Jyoti Mehta School of Biosciences, Indian Institute of Technology Madras, Adyar, Chennai 600036, India Running title: miR-155/Pdcd4/AP-1 feedback loop in tongue cancer. Keywords: miR-155, Pdcd4, AP-1, NF-κB, BIC, miR-155 sponge, apoptosis, tumor xenografts. 1 bioRxiv preprint doi: https://doi.org/10.1101/394130; this version posted August 17, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT miR-155 is an oncomir, generated as a non-coding RNA from BIC gene whose promoter activity is mainly controlled via AP-1 and NF-κB transcription factors.
  • The E2F3-Oncomir-1 Axis Is Activated in Wilms' Tumor

    The E2F3-Oncomir-1 Axis Is Activated in Wilms' Tumor

    Priority Report The E2F3-Oncomir-1 Axis Is Activated in Wilms’ Tumor Eric J. Kort,1,2 Leslie Farber,2 Maria Tretiakova,5 David Petillo,2 Kyle A. Furge,3 Ximing J. Yang,6 Albert Cornelius,4 and Bin T. Teh2,7 Laboratories of 1Molecular Epidemiology, 2Cancer Genetics, and 3Computational Biology, Van Andel ResearchInstitute; 4Division of Pediatric Hematology/Oncology, De Vos Children’s Hospital, Grand Rapids, Michigan; 5Department of Pathology, University of Chicago; 6Department of Pathology, Northwestern University, Chicago, Illinois; and 7NCCS-VARI Translational ResearchLaboratory, National Cancer Centre, Singapore Abstract Our results indicated that the E2F3 signature is strongly Oncomir-1 is an oncogenic cluster of microRNAs (miRNA) activated in WT samples—a phenomenon not consistently located on chromosome 13. Previous in vitro studies showed observed in other renal tumors. E2F3 is an activator of that it is transcriptionally regulated by the transcription transcription that is amplified or overexpressed in several tumors, factor E2F3. In this report, we combine expression profiling of including those of the bladder (4), prostate (5), and lung (6). Interestingly, E2F3 has been shown to drive the expression of both mRNA and miRNAs in Wilms’ tumor (WT) samples to Oncomir-1 in vitro Oncomir-1 provide the first evidence that the E2F3-Oncomir-1 axis, (7). is an oncogenic cluster of previously identified in cell culture, is deregulated in primary miRNAs located on chromosome 13 that has been shown to play an important role in promoting tumor cell proliferation (8). Here, we human tumors. Analysis of RNA expression signatures showed Oncomir-1 in vivo that an E2F3 gene signature was activated in all WT samples show that both E2F3 and are overexpressed in analyzed, in contrast to other kidney tumors.
  • The Oncogenic Role of Mir-155

    The Oncogenic Role of Mir-155

    The Oncogenic Role of miR-155 Samuel Mattiske B. Medical and Pharmaceutical Biotechnology (Honours) Thesis submitted for the Degree of Masters of Philosophy (Medical Science) Cancer Therapeutics Laboratory, Faculty of Health Sciences, Discipline of Medicine, University of Adelaide, South Australia August 2013 Contents Declaration ............................................................................................................................... IV List of Publications ................................................................................................................... V Acknowledgements .................................................................................................................. VI Overview .................................................................................................................................... 1 References .............................................................................................................................. 3 Chapter 1 – The Oncogenic Role of miR-155 in Breast Cancer ................................................ 4 Statement of Authorship ........................................................................................................ 5 Abstract .................................................................................................................................. 6 Introduction ............................................................................................................................ 7 Clinical Relevance