DOCSLIB.ORG

Interactome Rewiring Following Pharmacological Targeting of BET Bromodomains

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Interactome Rewiring Following Pharmacological Targeting of BET Bromodomains Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2019 Interactome Rewiring Following Pharmacological Targeting of BET Bromodomains Lambert, Jean-Philippe ; Picaud, Sarah ; Fujisawa, Takao ; Hou, Huayun ; Savitsky, Pavel ; Uusküla-Reimand, Liis ; Gupta, Gagan D ; Abdouni, Hala ; Lin, Zhen-Yuan ; Tucholska, Monika ; Knight, James D R ; Gonzalez-Badillo, Beatriz ; St-Denis, Nicole ; Newman, Joseph A ; Stucki, Manuel ; Pelletier, Laurence ; Bandeira, Nuno ; Wilson, Michael D ; Filippakopoulos, Panagis ; Gingras, Anne-Claude Abstract: Targeting bromodomains (BRDs) of the bromo-and-extra-terminal (BET) family offers oppor- tunities for therapeutic intervention in cancer and other diseases. Here, we profile the interactomes of BRD2, BRD3, BRD4, and BRDT following treatment with the pan-BET BRD inhibitor JQ1, revealing broad rewiring of the interaction landscape, with three distinct classes of behavior for the 603 unique interactors identified. A group of proteins associate in a JQ1-sensitive manner with BET BRDs through canonical and new binding modes, while two classes of extra-terminal (ET)-domain binding motifs medi- ate acetylation-independent interactions. Last, we identify an unexpected increase in several interactions following JQ1 treatment that define negative functions for BRD3 in the regulation of rRNA synthesis and potentially RNAPII-dependent gene expression that result in decreased cell proliferation. Together, our data highlight the contributions of BET protein modules to their interactomes allowing for a better understanding of pharmacological rewiring in response to JQ1. DOI: https://doi.org/10.1016/j.molcel.2018.11.006 Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-160765 Journal Article Accepted Version Originally published at: Lambert, Jean-Philippe; Picaud, Sarah; Fujisawa, Takao; Hou, Huayun; Savitsky, Pavel; Uusküla- Reimand, Liis; Gupta, Gagan D; Abdouni, Hala; Lin, Zhen-Yuan; Tucholska, Monika; Knight, James D R; Gonzalez-Badillo, Beatriz; St-Denis, Nicole; Newman, Joseph A; Stucki, Manuel; Pelletier, Lau- rence; Bandeira, Nuno; Wilson, Michael D; Filippakopoulos, Panagis; Gingras, Anne-Claude (2019). Interactome Rewiring Following Pharmacological Targeting of BET Bromodomains. Molecular Cell, 73(3):621-638.e17. DOI: https://doi.org/10.1016/j.molcel.2018.11.006 Interactome rewiring following pharmacological targeting of BET bromodomains Jean-Philippe Lambert1,12,‡, Sarah Picaud2,12, Takao Fujisawa3, Huayun Hou4,5, Pavel Savitsky2, Liis Uusküla-Reimand5,6, Gagan D. Gupta1¨, Hala Abdouni1, Zhen-Yuan Lin1, Monika Tucholska1, James D.R. Knight1, Beatriz Gonzalez-Badillo1, Nicole St-Denis1, Joseph A. Newman2, Manuel Stucki7, Laurence Pelletier1,4, Nuno Bandeira8,9,10, Michael D. Wilson1,4,11, Panagis Filippakopoulos2,3,*, Anne-Claude Gingras1,4,* 1 Lunenfeld-Tanenbaum Research Institute at Mount Sinai Hospital, Toronto, ON, M5G 1X5, Canada. 2 Structural Genomics Consortium, Nuffield Department of Clinical Medicine, University of Oxford, Oxford, OX3 7DQ, UK. 3 Ludwig Institute for Cancer Research, Nuffield Department of Clinical Medicine, University of Oxford, Oxford, OX3 7DQ, UK. 4 Department of Molecular Genetics, University of Toronto, Toronto, ON, Canada. 5 Genetics and Genome Biology Program, SickKids Research Institute, Toronto, ON, Canada 6 Department of Gene Technology, Tallinn University of Technology, Tallinn, Estonia. 7 Department of Gynecology, University of Zurich, Wagistrasse 14, CH-8952 Schlieren, Switzerland 8 Center for Computational Mass Spectrometry, University of California, San Diego, La Jolla, California, 92093. 9 Dept. of Computer Science and Engineering, University of California, San Diego, La Jolla, California, 92093 10 Skaggs School of Pharmacy and Pharmaceutical Sciences, University of California, San Diego, La Jolla, California, 92093 11 Heart & Stroke Richard Lewar Centre of Excellence in Cardiovascular Research, Toronto, Canada 12 These authors have contributed equally ‡ Present address: Department of Molecular Medicine and Cancer Research Centre, Université Laval, Quebec, Canada; CHU de Québec Research Center, Quebec, G1V 4G2, Canada. ¨ Present address: Department of Chemistry and Biology, Ryerson University, Toronto, ON, M5B 2K3, Canada. Data deposition: The crystal structures reported in this paper have been deposited in the Protein Data Bank, http://www.pdb.org. Small-angle scattering data and models have been deposited to the SASBDB (http://www.sasbdb.org). Mass spectrometry data have been deposited in the ProteomeXchange partner Mass spectrometry Interactive Virtual Environment (MassIVE, http://massive.ucsd.edu). ChIP-seq data generated in this paper can be found online at ArrayExpress (http://www.ebi.ac.uk/arrayexpress; accession E-MTAB-5670). * Correspondance: E-mail : [email protected], Phone: (416) 586-5027, Fax: (416) 586-8869 E-mail : [email protected], Phone : +44 1865 617759, Fax : +44 1865 617575 Lead contact: Anne-Claude Gingras 1 Abstract Targeting bromodomains (BRDs) of the bromo-and extra-terminal (BET) family has offered opportunities for the therapeutic intervention of cancer and other diseases. However, there has not been a systematic study of the consequences of BET BRD inhibition on the interactions established by members of this important protein scaffolding family. Here, we profile the interactomes of BRD2, BRD3, BRD4 and BRDT during a time course of treatment with the pan-BET BRD inhibitor JQ1, revealing broad rewiring of the interaction landscape, with three distinct classes of behaviour for the 603 unique interactors identified. We report a group of proteins that associate with BET BRDs through canonical and new binding modes that dissociate upon inhibitor treatment. We further establish two classes of extra-terminal (ET)-domain binding motifs that mediate acetylation- independent interactions, offering attractive possibilities for specific therapeutic modulation. Lastly, we identify an unexpected increase in several interactions following JQ1 treatment. These increased interactions allow us to define new negative functions for BRD3 in the regulation of rRNA synthesis and potentially Pol II-dependent gene expression that result in decreased cell proliferation. Together, our data outline the contributions of BET protein modules to their interactomes and allow for a better understanding of pharmacological rewiring in response to JQ1. 2 Introduction Transcription is a tightly regulated process in eukaryotic cells, which depends on the spatial and transient formation of non-covalent protein complexes and modulation of post-translational modifications (PTMs) to facilitate the organization of the transcription machinery {Schreiber, 2002 #145;Bernstein, 2007 #146}. Bromo and extra-terminal (BET) proteins provide a recruitment platform that helps aggregate large transcriptional complexes on active chromatin. They accomplish this by mediating interactions via their evolutionarily conserved bromodomain (BRD) modules, which recognize acetylated lysine (Kac) {Dhalluin, 1999 #100;Owen, 2000 #102;Jacobson, 2000 #111}. BETs, like all of the 42 human BRD-containing proteins, are also characterized by the presence of additional modular protein interaction domains that can help recruit other proteins to the acetylated protein target, forming complex assemblies that contribute to processes such as chromatin remodelling and transcription {reviewed in \Fujisawa, 2017 #112}. The BET sub-family comprises four proteins in humans (BRD2, BRD3, BRD4 and the testis-specific BRDT) that harbour at their amino-termini BRD modules with distinct specificity for Kac found on histones as well as a growing list of non-histone targets {reviewed in \Fujisawa, 2017 #112}, followed by an extra-terminal (ET) recruitment domain that mediates protein-protein interactions {Rahman, 2011 #37;Zhang, 2016 #127;Konuma, 2017 #136;Wai, 2018 #159} (Figure 1A). BRD4 and BRDT also contain a C-terminal motif (CTM) that binds to and facilitates the recruitment to acetylated chromatin of transcriptional regulators, including the positive transcription elongation factor b (P- TEFb), which phosphorylates RNA polymerase II (RNAPII; Figure 1B). BETs, and in particular BRD4, have been implicated in human disease, especially cancer {reviewed in \Fujisawa, 2017 #112}. Translocations of BRD4 (and more rarely BRD3) to the NUTM1 (NUT midline carcinoma family member 1) gene cause NUT midline carcinoma, a rare but aggressive form of squamous cell carcinoma {French, 2004 #133}. Furthermore, BRD4 levels are up-regulated in a variety of tumours, leading to aberrant expression of anti-apoptotic, cell cycle progression-related, and growth- promoting genes, including the MYC oncogene {Mertz, 2011 #138;Delmore, 2011 #110;Zuber, 2011 #137} and other transcription factors such as ERG, c-Myb, E2F1 and NF-κB. 3 The importance of BET proteins in cancer, together with the recognition that BRD-Kac interactions are druggable, has made them attractive targets for pharmaceutical intervention {Filippakopoulos, 2010 #16;Nicodeme, 2010 #106}. Indeed, direct targeting of BET BRDs by small molecule compounds such as the high affinity and specificity thienodiazepine (+)-JQ1 (hereafter referred to as JQ1), enables their displacement from Kac (Figure 1B). JQ1 (but not an inactive enantiomer) also displays anticancer activity in cell culture models, patient-derived xenograft models
Load more

Recommended publications
  • DEDD (NM 001039712) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC310813 DEDD (NM_001039712) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: DEDD (NM_001039712) Human Untagged Clone Tag: Tag Free Symbol: DEDD Synonyms: CASP8IP1; DEDD1; DEFT; FLDED1; KE05 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001039712, the custom clone sequence may differ by one or more nucleotides ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTGT ACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCTTT CCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTGGCA CTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATCACTC GCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGACAAGTA TCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCTCCCCAG CCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATGTGTAGCA AGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACACCAGATCC CAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAGACTGCTCTG CAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAACCAGGCCAACA CCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTCACCTACCTCGA TGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTCATCACAGACTCC CTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAGGACTATGAGCTGG
    [Show full text]
  • Function of Bromodomain and Extra-Terminal Motif Proteins (Bets) in Gata1-Mediated Transcription
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2015 Function of Bromodomain and Extra-Terminal Motif Proteins (bets) in Gata1-Mediated Transcription Aaron James Stonestrom University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Molecular Biology Commons, and the Pharmacology Commons Recommended Citation Stonestrom, Aaron James, "Function of Bromodomain and Extra-Terminal Motif Proteins (bets) in Gata1-Mediated Transcription" (2015). Publicly Accessible Penn Dissertations. 1148. https://repository.upenn.edu/edissertations/1148 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1148 For more information, please contact [email protected]. Function of Bromodomain and Extra-Terminal Motif Proteins (bets) in Gata1-Mediated Transcription Abstract Bromodomain and Extra-Terminal motif proteins (BETs) associate with acetylated histones and transcription factors. While pharmacologic inhibition of this ubiquitous protein family is an emerging therapeutic approach for neoplastic and inflammatory disease, the mechanisms through which BETs act remain largely uncharacterized. Here we explore the role of BETs in the physiologically relevant context of erythropoiesis driven by the transcription factor GATA1. First, we characterize functions of the BET family as a whole using a pharmacologic approach. We find that BETs are broadly required for GATA1-mediated transcriptional activation, but that repression is largely BET-independent. BETs support activation by facilitating both GATA1 occupancy and transcription downstream of its binding. Second, we test the specific olesr of BETs BRD2, BRD3, and BRD4 in GATA1-activated transcription. BRD2 and BRD4 are required for efficient anscriptionaltr activation by GATA1. Despite co-localizing with the great majority of GATA1 binding sites, we find that BRD3 is not equirr ed for GATA1-mediated transcriptional activation.
    [Show full text]
  • Regulation of Oxidized Base Damage Repair by Chromatin Assembly Factor 1 Subunit a Chunying Yang1,*,†, Shiladitya Sengupta1,2,*,†, Pavana M
    Published online 27 October 2016 Nucleic Acids Research, 2017, Vol. 45, No. 2 739–748 doi: 10.1093/nar/gkw1024 Regulation of oxidized base damage repair by chromatin assembly factor 1 subunit A Chunying Yang1,*,†, Shiladitya Sengupta1,2,*,†, Pavana M. Hegde1,JoyMitra1, Shuai Jiang3, Brooke Holey3, Altaf H. Sarker3, Miaw-Sheue Tsai3, Muralidhar L. Hegde1,2,4 and Sankar Mitra1,2,* 1Department of Radiation Oncology, Houston Methodist Research Institute, Houston, TX 77030, USA, 2Weill Cornell Medical College, Cornell University, New York, NY 10065, USA, 3Biological Systems and Engineering Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA and 4Houston Methodist Neurological Institute, Houston, TX 77030, USA Received March 23, 2016; Revised October 13, 2016; Editorial Decision October 17, 2016; Accepted October 19, 2016 ABSTRACT INTRODUCTION Reactive oxygen species (ROS), generated both en- ROS, continuously generated in mammalian cells both en- dogenously and in response to exogenous stress, in- dogenously and by environmental genotoxicants, induce duce point mutations by mis-replication of oxidized various genomic lesions, including oxidized bases, abasic bases and other lesions in the genome. Repair of (AP) sites and single-strand breaks (SSBs). If unrepaired or these lesions via base excision repair (BER) pathway mis-repaired, DNA lesions would cause mutations which may lead to cytotoxicity and cell death and also carcino- maintains genomic fidelity. Regulation of the BER genic transformation (1). The base excision repair (BER) pathway for mutagenic oxidized bases, initiated by pathway, responsible for repair of oxidized base lesions NEIL1 and other DNA glycosylases at the chromatin which contribute to drug/radiation sensitivity is highly con- level remains unexplored.
    [Show full text]
  • Bromodomain Protein BRDT Directs ΔNp63 Function and Super
    Cell Death & Differentiation (2021) 28:2207–2220 https://doi.org/10.1038/s41418-021-00751-w ARTICLE Bromodomain protein BRDT directs ΔNp63 function and super-enhancer activity in a subset of esophageal squamous cell carcinomas 1 1 2 1 1 2 Xin Wang ● Ana P. Kutschat ● Moyuru Yamada ● Evangelos Prokakis ● Patricia Böttcher ● Koji Tanaka ● 2 3 1,3 Yuichiro Doki ● Feda H. Hamdan ● Steven A. Johnsen Received: 25 August 2020 / Revised: 3 February 2021 / Accepted: 4 February 2021 / Published online: 3 March 2021 © The Author(s) 2021. This article is published with open access Abstract Esophageal squamous cell carcinoma (ESCC) is the predominant subtype of esophageal cancer with a particularly high prevalence in certain geographical regions and a poor prognosis with a 5-year survival rate of 15–25%. Despite numerous studies characterizing the genetic and transcriptomic landscape of ESCC, there are currently no effective targeted therapies. In this study, we used an unbiased screening approach to uncover novel molecular precision oncology targets for ESCC and identified the bromodomain and extraterminal (BET) family member bromodomain testis-specific protein (BRDT) to be 1234567890();,: 1234567890();,: uniquely expressed in a subgroup of ESCC. Experimental studies revealed that BRDT expression promotes migration but is dispensable for cell proliferation. Further mechanistic insight was gained through transcriptome analyses, which revealed that BRDT controls the expression of a subset of ΔNp63 target genes. Epigenome and genome-wide occupancy studies, combined with genome-wide chromatin interaction studies, revealed that BRDT colocalizes and interacts with ΔNp63 to drive a unique transcriptional program and modulate cell phenotype. Our data demonstrate that these genomic regions are enriched for super-enhancers that loop to critical ΔNp63 target genes related to the squamous phenotype such as KRT14, FAT2, and PTHLH.
    [Show full text]
  • Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
    [CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors.
    [Show full text]
  • FGFR1 Fusion and Amplification in a Solid Variant of Alveolar Rhabdomyosarcoma
    Modern Pathology (2011) 24, 1327–1335 & 2011 USCAP, Inc. All rights reserved 0893-3952/11 $32.00 1327 FOXO1–FGFR1 fusion and amplification in a solid variant of alveolar rhabdomyosarcoma Jinglan Liu1,2, Miguel A Guzman1,2, Donna Pezanowski1, Dilipkumar Patel1, John Hauptman1, Matthew Keisling3, Steve J Hou2,3, Peter R Papenhausen4, Judy M Pascasio1,2, Hope H Punnett1,5, Gregory E Halligan2,6 and Jean-Pierre de Chadare´vian1,2 1Department of Pathology and Laboratory Medicine, St Christopher’s Hospital for Children, Philadelphia, PA, USA; 2Drexel University College of Medicine, Philadelphia, PA, USA; 3Department of Pathology and Laboratory Medicine, Hahnneman University Hospital, Philadelphia, PA, USA; 4Laboratory Corporation of America, The Research Triangle Park, NC, USA; 5Department of Pathology and Laboratory Medicine, Temple University School of Medicine, Philadelphia, PA, USA and 6Department of Pediatrics, Section of Oncology, St Christopher’s Hospital for Children, Philadelphia, PA, USA Rhabdomyosarcoma is the most common pediatric soft tissue malignancy. Two major subtypes, alveolar rhabdomyosarcoma and embryonal rhabdomyosarcoma, constitute 20 and 60% of all cases, respectively. Approximately 80% of alveolar rhabdomyosarcoma carry two signature chromosomal translocations, t(2;13)(q35;q14) resulting in PAX3–FOXO1 fusion, and t(1;13)(p36;q14) resulting in PAX7–FOXO1 fusion. Whether the remaining cases are truly negative for gene fusion has been questioned. We are reporting the case of a 9-month-old girl with a metastatic neck mass diagnosed histologically as solid variant alveolar rhabdomyosarcoma. Chromosome analysis showed a t(8;13;9)(p11.2;q14;9q32) three-way translocation as the sole clonal aberration. Fluorescent in situ hybridization (FISH) demonstrated a rearrangement at the FOXO1 locus and an amplification of its centromeric region.
    [Show full text]
  • Rabbit Anti-TAF1C/FITC Conjugated Antibody
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-TAF1C/FITC Conjugated antibody SL24053R-FITC Product Name: Anti-TAF1C/FITC Chinese Name: FITC标记的TATA盒Binding protein相关因子TAF1C抗体 RNA polymerase I-specific TBP-associated factor 110 kDa; SL1; Taf1c; TAF1C_MOUSE; TAFI110; TAFI95; TATA box binding protein associated factor 1C; TATA box-binding protein-associated factor 1C; TATA box-binding protein-associated Alias: factor RNA polymerase I subunit C; TBP associated factor 1C; TBP associated factor RNA polymerase I 95 kDa; TBP associated factor, RNA polymerase I, 110-KD; TBP- associated factor 1C; Transcription initiation factor SL1/TIF-IB subunit C. Organism Species: Rabbit Clonality: Polyclonal React Species: ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 95kDa Form: Lyophilized or Liquid Concentration: 2mg/1ml immunogen: KLHwww.sunlongbiotech.com conjugated synthetic peptide derived from mouse TAF1C Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: Initiation of transcription by RNA polymerase I requires the formation of a complex Product Detail: composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I.
    [Show full text]
  • Bidirectional Cooperation Between Ubtf1 and SL1 Determines RNA Polymerase I Promoter
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.07.447350; this version posted June 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Bidirectional cooperation between Ubtf1 and SL1 determines RNA Polymerase I promoter 2 recognition in cell and is negatively affected in the UBTF-E210K neuroregression syndrome. 3 4 Michel G. Tremblay1, Dany S. Sibai1,2, Melissa Valère1,2, Jean-Clément Mars1,2,+, Frédéric Lessard1, 5 Roderick T. Hori3, Mohammad M. Khan4, Victor Y. Stefanovsky1, Mark S. Ledoux5 and Tom Moss1,2*. 6 7 1Laboratory of Growth and Development, St-Patrick Research Group in Basic Oncology, Cancer 8 Division of the Quebec University Hospital Research Centre, Québec, Canada. 2Department of 9 Molecular Biology, Medical Biochemistry and Pathology, Faculty of Medicine, Laval University, 10 Québec, Canada. 3Departments of Microbiology, Immunology and Biochemistry and 4Departments of 11 Neurology and Anatomy & Neurobiology, University of Tennessee Health Science Center, Memphis, 12 TN, USA. 5Department of Psychology, University of Memphis, Memphis TN and Veracity 13 Neuroscience LLC, Memphis, TN 14 15 +Present address, IRIC, Université de Montréal, Montréal, Québec, Canada 16 17 Correspondence should be addressed to; 18 Tom Moss, PhD, 19 Edifice St Patrick, 9 rue McMahon, Québec, QC, G1R 3S3, Canada. 20 E-mail. [email protected] 21 Tel. 1 418 691 5281 22 FAX 1 418 691 5439 23 24 Short title: Ubtf1-SL1 cooperation and the Ubtf-E210K syndrome.
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY DATA A cyclin D1-dependent transcriptional program predicts clinical outcome in mantle cell lymphoma Santiago Demajo et al. 1 SUPPLEMENTARY DATA INDEX Supplementary Methods p. 3 Supplementary References p. 8 Supplementary Tables (S1 to S5) p. 9 Supplementary Figures (S1 to S15) p. 17 2 SUPPLEMENTARY METHODS Western blot, immunoprecipitation, and qRT-PCR Western blot (WB) analysis was performed as previously described (1), using cyclin D1 (Santa Cruz Biotechnology, sc-753, RRID:AB_2070433) and tubulin (Sigma-Aldrich, T5168, RRID:AB_477579) antibodies. Co-immunoprecipitation assays were performed as described before (2), using cyclin D1 antibody (Santa Cruz Biotechnology, sc-8396, RRID:AB_627344) or control IgG (Santa Cruz Biotechnology, sc-2025, RRID:AB_737182) followed by protein G- magnetic beads (Invitrogen) incubation and elution with Glycine 100mM pH=2.5. Co-IP experiments were performed within five weeks after cell thawing. Cyclin D1 (Santa Cruz Biotechnology, sc-753), E2F4 (Bethyl, A302-134A, RRID:AB_1720353), FOXM1 (Santa Cruz Biotechnology, sc-502, RRID:AB_631523), and CBP (Santa Cruz Biotechnology, sc-7300, RRID:AB_626817) antibodies were used for WB detection. In figure 1A and supplementary figure S2A, the same blot was probed with cyclin D1 and tubulin antibodies by cutting the membrane. In figure 2H, cyclin D1 and CBP blots correspond to the same membrane while E2F4 and FOXM1 blots correspond to an independent membrane. Image acquisition was performed with ImageQuant LAS 4000 mini (GE Healthcare). Image processing and quantification were performed with Multi Gauge software (Fujifilm). For qRT-PCR analysis, cDNA was generated from 1 µg RNA with qScript cDNA Synthesis kit (Quantabio). qRT–PCR reaction was performed using SYBR green (Roche).
    [Show full text]
  • Histone Chaperone CHAF1A Inhibits Differentiation and Promotes Aggressive Neuroblastoma
    Published OnlineFirst December 12, 2013; DOI: 10.1158/0008-5472.CAN-13-1315 Cancer Molecular and Cellular Pathobiology Research Histone Chaperone CHAF1A Inhibits Differentiation and Promotes Aggressive Neuroblastoma Eveline Barbieri1, Katleen De Preter3, Mario Capasso4, Zaowen Chen1, Danielle M. Hsu2, Gian Paolo Tonini5, Steve Lefever3, John Hicks1, Rogier Versteeg7, Andrea Pession6, Frank Speleman3, Eugene S. Kim2, and Jason M. Shohet1 Abstract Neuroblastoma arises from the embryonal neural crest secondary to a block in differentiation. Long-term patient survival correlates inversely with the extent of differentiation, and treatment with retinoic acid or other prodifferentiation agents improves survival modestly. In this study, we show the histone chaperone and epigenetic regulator CHAF1A functions in maintaining the highly dedifferentiated state of this aggressive malignancy. CHAF1A is a subunit of the chromatin modifier chromatin assembly factor 1 and it regulates H3K9 trimethylation of key target genes regulating proliferation, survival, and differentiation. Elevated CHAF1A expression strongly correlated with poor prognosis. Conversely, CHAF1A loss-of-function was sufficient to drive neuronal differentiation in vitro and in vivo. Transcriptome analysis of cells lacking CHAF1A revealed repression of oncogenic signaling pathways and a normalization of glycolytic metabolism. Our findings demonstrate that CHAF1A restricts neural crest differentiation and contributes to the pathogenesis of high-risk neuroblastoma. Cancer Res; 74(3); 1–10.
    [Show full text]
  • Download Product Insert (PDF)
    PRODUCT INFORMATION BRD3 bromodomains 1 and 2 (human, recombinant) Item No. 14864 Overview and Properties Synonyms: Bromodomain containing protein 3, ORFX, RING3L, RING3-like protein Source: Recombinant N-terminal GST-tagged protein expressed in E. coli Amino Acids: 2-434 Uniprot No.: Q15059 Molecular Weight: 75.0 kDa Storage: -80°C (as supplied) Stability: ≥2 years Purity: batch specific (≥85% estimated by SDS-PAGE) Supplied in: 50 mM Tris, pH 8.0, with 150 mM sodium chloride and 20% glycerol Protein Concentration: batch specific mg/ml Activity: batch specific U/ml Specific Activity: batch specific U/mg Information represents the product specifications. Batch specific analytical results are provided on each certificate of analysis. Image 1 2 3 4 · · · · · · ·250 kDa · · · · · · ·150 kDa · · · · · · ·100 kDa · · · · · · ·75 kDa · · · · · · ·50 kDa · · · · · · ·37 kDa · · · · · · ·25 kDa · · · · · · ·20 kDa · · · · · · ·15 kDa Lane 1: BRD3 (4 µg) Lane 2: BRD3 (6 µg) Lane 3: BRD3 (8 µg) Lane 4: MW Markers WARNING CAYMAN CHEMICAL THIS PRODUCT IS FOR RESEARCH ONLY - NOT FOR HUMAN OR VETERINARY DIAGNOSTIC OR THERAPEUTIC USE. 1180 EAST ELLSWORTH RD SAFETY DATA ANN ARBOR, MI 48108 · USA This material should be considered hazardous until further information becomes available. Do not ingest, inhale, get in eyes, on skin, or on clothing. Wash thoroughly after handling. Before use, the user must review the complete Safety Data Sheet, which has been sent via email to your institution. PHONE: [800] 364-9897 WARRANTY AND LIMITATION OF REMEDY [734] 971-3335 Buyer agrees to purchase the material subject to Cayman’s Terms and Conditions. Complete Terms and Conditions including Warranty and Limitation of Liability information can be found on our website.
    [Show full text]
  • The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons
    The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs.
    [Show full text]