DOCSLIB.ORG

Sequenced Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sequenced Genes UvA-DARE (Digital Academic Repository) Mutational profiling of glioblastoma Bleeker, F.E. Publication date 2009 Document Version Final published version Link to publication Citation for published version (APA): Bleeker, F. E. (2009). Mutational profiling of glioblastoma. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:28 Sep 2021 Sequenced genes Gene Gene Name Cytoband Ch ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 9q31.1 4 ADAM12 A disintegrin and metalloproteinase domain 12 10q26.3 5 ADAMTS18 A disintegrin and metalloproteinase with thrombospondin 16q23 5 motifs 18 ADAMTSL3 ADAMTS-like 3 15q25.2 4 AIM1 Absent in melanoma 1 protein 5p13.3 5 AKT1 V-akt murine thymoma viral oncogene homolog 1 14q32.32 6,7 AKT2 V-akt murine thymoma viral oncogene homolog 2 19q13.1-q13.2 3 ALK Anaplastic lymphoma kinase 2p23 5 ATM Ataxia telangiectasia mutated 11q22-q23 3 ATP8B1 ATPase, Class I, type 8B, member 1 18q21.31 4 ATR Ataxia telangiectasia and Rad3 related 3q22-q24 3 BRAF V-raf murine sarcoma viral oncogene homolog B1 7q34 3 BRD2 Bromodomain containing 2 6p21.3 3 CUBN Cubilin (intrinsic factor-cobalamin receptor) 10p12.31 4 DDR1 Discoidin domain receptor tyrosine kinase 1 6p21.3 3 DIP2C DIP2 disco-interacting protein 2 homolog C (Drosophila) 10p15.3 4 DYRK2 Dual-specificity tyrosine-(Y)-phosphorylation regulated 12q15 3 kinase 2 EDD1 Hyperplastic discs protein homolog 8q22 5 EGFL6 EGF-like-domain, multiple 6 Xp22 4 EGFR Epidermal growth factor receptor (erythroblastic leukemia 7p12 3 viral (v-erb-b) oncogene homolog, avian) EPHA3 EPH receptor A3 3p11.2 4 EPHA3 EPH receptor A3 3p11.2 3 EPHA5 EPH receptor A5 4q13.1 3 EPHA6 EPH receptor A6 3q11.2 3 EPHB2 EPH receptor B2 1p36.1-p35 3 EPHB6 EPH receptor B6 7q33-q35 4 ERBB2 V-erb-b2 erythroblastic leukemia viral oncogene homolog 17q21.1 3 2 neuro/glioblastoma derived oncogene homolog (avian) ERBB4 V-erb-a erythroblastic leukemia viral oncogene homolog 2q33.3-q34 3 4 (avian) FBXW7 F-box and WD-40 domain protein 7 (archipelago homolog 4q31.3 4 Drosophila) FGFR1 Fibroblast growth factor receptor 1 8p11.2-p11.1 3 FGFR2 Fibroblast growth factor receptor 2 10q26 3 FGFR3 Fibroblast growth factor receptor 3 4p16.3 3 FGFR4 Fibroblast growth factor receptor 4 5q35.1-qter 3 FLNB Filamin B, beta (actin binding protein 278) 3p14.3 4 FLT1 Fms-related tyrosine kinase 1 (vascular endothelial 13q12 3 growth factor/vascular permeability factor receptor) FLT3 Fms-related tyrosine kinase 3 13q12 3 FRAP1 FK506 binding protein 12-rapamycin associated protein 1 1p36.2 3 GAB1 GRB2-associated-binding protein 1 4q31.21 5 GNAS GNAS complex locus 20q13.3 4 GUCY1A2 Guanylate cyclase soluble subunit alpha-2 11q21-q22 5 IDH1 Isocitrate dehydrogenase 1 (NADP+), soluble 2q33.3 9,10 IRS4 Insulin receptor substrate 4 Xq22.3 5 KDR Kinase insert domain receptor (a type III receptor tyrosine 4q11-q12 3 kinase) 164 Proefschrift Bleeker.indd 164 21-5-2009 15:04:38 Sequenced genes Gene Gene Name Cytoband Ch KIAA0999 Serine/threonine-protein kinase QSK 11q23.3 5 KIT V-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene 4q11-q12 3 homolog MACF1 Microtubule-actin crosslinking factor 1 1p32-p31 4 MAP2K4 Mitogen-activated protein kinase kinase 4 17p11.2 3 MAP2K7 Dual specificity mitogen-activated protein kinase kinase 7 19p13.3-p13.2 5 MET Met proto-oncogene (hepatocyte growth factor receptor) 7q31 3 MLL3 Myeloid/lymphoid or mixed-lineage leukemia 3 7q36.1 4 MMP2 Matrix metalloproteinase-2 16q13-q21 5 MYLK4 MYLK4 myosin light chain kinase family, member 4 6p25.2 5 MYO18B Myosin-XVIIIb 22q11.2-q12.1 5 NAV3 Neuron navigator 3 12q14.3 5 NOTCH1 Neurogenic locus notch homolog protein 1 9q34.3 5 NRAS Neuroblastoma RAS viral (v-ras) oncogene homolog 1p13.2 3 NTRK2 Neurotrophic tyrosine kinase, receptor, type 2 9q22.1 3 NTRK3 Neurotrophic tyrosine kinase, receptor, type 3 15q25 3 OBSCN Obscurin, cytoskeletal calmodulin and titin-interacting 1q42.13 4 RhoGEF OR51E1 Olfactory receptor 51E1 11p15.4 5 PAK4 P21 protein (Cdc42/Rac)-activated kinase 4 19q13.2 3 PDGFRA Platelet-derived growth factor receptor, alpha polypeptide 4q11-q13 3 PDPK1 3-Phosphoinositide dependent protein kinase-1 16p13.3 3 PI3KCA Phosphoinositide-3-kinase, catalytic, alpha polypeptide 3q26.3 3 PKHD1 Polycystic kidney and hepatic disease 1 (autosomal 6p12.2 4 recessive) PRKD1 Serine/threonine-protein kinase D1 14q11 5 PRPF4B Serine/threonine-protein kinase PRP4 homolog 6p25.2 5 PTEN Phosphatase and tensin homolog 10q23.3 3 RASGRF2 Ras protein-specific guanine nucleotide-releasing factor 2 5q13 5 RET Proto-oncogene tyrosine-protein kinase receptor ret 10q11.2 5 precursor RPS6KC1 Ribosomal protein S6 kinase, 52kDa, polypeptide 1 1q41 3 SIX4 Sine oculis homeobox homolog 4 14q23 5 SMAD2 Mothers against decapentaplegic homolog 2 18q21.1 5 SMAD4 Mothers against decapentaplegic homolog 4 18q21.1 5 SORL1 Sortilin-related receptor precursor 11q23.2-q24.2 5 SPTAN1 Spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) 9q33-q34 4 STK11 Serine/threonine kinase 11 19p13.3 3 SYNE1 Spectrin repeat containing, nuclear envelope 1 6q25 4 TAF1 Transcription initiation factor TFIID subunit 1 Xq13.1 5 TCF7L2 Transcription factor 7-like 2 10q25.3 5 TECTA Tectorin alpha 11q22-q24 4 TGFBR2 Transforming growth factor, beta receptor II (70/80kDa) 3p22 3 TGM3 Transglutaminase-3 20q11.2 5 TP53 Tumor protein p53 17p13.1 3 ZNF668 Zinc finger protein 668 16p11.2 4 Table 1. Genes sequenced in this thesis Sequenced genes are listed alongside their full names, chromosomal locations, Entrez gene ID and the chapter in which they have been sequenced. Abbreviation: Ch, chapter. 165 Proefschrift Bleeker.indd 165 21-5-2009 15:04:38.
Load more

Recommended publications
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Epha3 Inhibits Migration and Invasion of Esophageal Cancer Cells by Activating the Mesenchymal‑Epithelial Transition Process
    722 INTERNATIONAL JOURNAL OF ONCOLOGY 54: 722-732, 2019 EphA3 inhibits migration and invasion of esophageal cancer cells by activating the mesenchymal‑epithelial transition process XIA CHEN1,2, BIN LU2,3, QIAN MA2, CHENG-DONG JI4 and JIAN-ZHONG LI3 1Key Laboratory, Yangpu Hospital, Tongji University School of Medicine, Shanghai 200090; 2International Joint Cancer Institute; 3Department of Biochemical Pharmacy, Second Military Medical University, Shanghai 200433; 4Department of Scientific Research Management, Yangpu Hospital, Tongji University School of Medicine, Shanghai 200090, P.R. China Received June 13, 2018; Accepted November 2, 2018 DOI: 10.3892/ijo.2018.4639 Abstract. Eph receptor tyrosine kinases are critical for cell-cell Introduction communication during normal and oncogenic development. Eph receptor A3 (EphA3) expression is associated with Esophageal cancer is the eighth most prevalent type of tumor promotion in certain types of cancer; however, it acts cancer worldwide (1,2), of which, esophageal squamous cell as a tumor suppressor in others. The expression levels of carcinoma (ESCC) is a predominant histological type (3). EphA3 and its effects on tumor progression in esophageal Despite advances in diagnostic tools, surgical techniques and squamous cell carcinoma (ESCC) cell lines were determined chemotherapy over the past few decades, the 5-year survival using reverse transcription-quantitative polymerase chain rate for patients with esophageal cancer ranges between reaction analysis and a Transwell invasion assay. The present 15 and 20% (4). Therefore, novel diagnostic tools, therapeutic study demonstrated that EphA3 expression was decreased strategies and molecular prognostic markers are urgently in ESCC tissues and cell lines. Treatment with the DNA required for this disease.
    [Show full text]
  • Functional Analysis of Somatic Mutations Affecting Receptor Tyrosine Kinase Family in Metastatic Colorectal Cancer
    Author Manuscript Published OnlineFirst on March 29, 2019; DOI: 10.1158/1535-7163.MCT-18-0582 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Functional analysis of somatic mutations affecting receptor tyrosine kinase family in metastatic colorectal cancer Leslie Duplaquet1, Martin Figeac2, Frédéric Leprêtre2, Charline Frandemiche3,4, Céline Villenet2, Shéhérazade Sebda2, Nasrin Sarafan-Vasseur5, Mélanie Bénozène1, Audrey Vinchent1, Gautier Goormachtigh1, Laurence Wicquart6, Nathalie Rousseau3, Ludivine Beaussire5, Stéphanie Truant7, Pierre Michel8, Jean-Christophe Sabourin9, Françoise Galateau-Sallé10, Marie-Christine Copin1,6, Gérard Zalcman11, Yvan De Launoit1, Véronique Fafeur1 and David Tulasne1 1 Univ. Lille, CNRS, Institut Pasteur de Lille, UMR 8161 - M3T – Mechanisms of Tumorigenesis and Target Therapies, F-59000 Lille, France. 2 Univ. Lille, Plateau de génomique fonctionnelle et structurale, CHU Lille, F-59000 Lille, France 3 TCBN - Tumorothèque Caen Basse-Normandie, F-14000 Caen, France. 4 Réseau Régional de Cancérologie – OncoBasseNormandie – F14000 Caen – France. 5 Normandie Univ, UNIROUEN, Inserm U1245, IRON group, Rouen University Hospital, Normandy Centre for Genomic and Personalized Medicine, F-76000 Rouen, France. 6 Tumorothèque du C2RC de Lille, F-59037 Lille, France. 7 Department of Digestive Surgery and Transplantation, CHU Lille, Univ Lille, 2 Avenue Oscar Lambret, 59037, Lille Cedex, France. 8 Department of hepato-gastroenterology, Rouen University Hospital, Normandie Univ, UNIROUEN, Inserm U1245, IRON group, F-76000 Rouen, France. 9 Department of Pathology, Normandy University, INSERM 1245, Rouen University Hospital, F 76 000 Rouen, France. 10 Department of Pathology, MESOPATH-MESOBANK, Centre León Bérard, Lyon, France. 11 Thoracic Oncology Department, CIC1425/CLIP2 Paris-Nord, Hôpital Bichat-Claude Bernard, Paris, France.
    [Show full text]
  • HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
    HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal
    [Show full text]
  • Supplementary Table 1. in Vitro Side Effect Profiling Study for LDN/OSU-0212320. Neurotransmitter Related Steroids
    Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Percent Inhibition Receptor 10 µM Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective -20.94% Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site -16.15% GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1 -5.54% Histamine, H2 16.54% Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal (-BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1 Percent Inhibition Receptor 10 µM Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (hERG) (h) -6.44% Sodium, Site 2 -0.39% Second Messengers Nitric Oxide, NOS (Neuronal-Binding) -17.09% Prostaglandins Leukotriene,
    [Show full text]
  • Eph Receptor A3 (EPHA3) (NM 005233) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC323494 Eph receptor A3 (EPHA3) (NM_005233) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Eph receptor A3 (EPHA3) (NM_005233) Human Untagged Clone Tag: Tag Free Symbol: EPHA3 Synonyms: EK4; ETK; ETK1; HEK; HEK4; TYRO4 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC323494 sequence for NM_005233 edited (data generated by NextGen Sequencing) ATGGATTGTCAGCTCTCCATCCTCCTCCTTCTCAGCTGCTCTGTTCTCGACAGCTTCGGG GAACTGATTCCGCAGCCTTCCAATGAAGTCAATCTACTGGATTCAAAAACAATTCAAGGG GAGCTGGGCTGGATCTCTTATCCATCACATGGGTGGGAAGAGATCAGTGGTGTGGATGAA CATTACACACCCATCAGGACTTACCAGGTGTGCAATGTCATGGACCACAGTCAAAACAAT TGGCTGAGAACAAACTGGGTCCCCAGGAACTCAGCTCAGAAGATTTATGTGGAGCTCAAG TTCACTCTACGAGACTGCAATAGCATTCCATTGGTTTTAGGAACTTGCAAGGAGACATTC AACCTGTACTACATGGAGTCTGATGATGATCATGGGGTGAAATTTCGAGAGCATCAGTTT ACAAAGATTGACACCATTGCAGCTGATGAAAGTTTCACTCAAATGGATCTTGGGGACCGT ATTCTGAAGCTCAACACTGAGATTAGAGAAGTAGGTCCTGTCAACAAGAAGGGATTTTAT TTGGCATTTCAAGATGTTGGTGCTTGTGTTGCCTTGGTGTCTGTGAGAGTATACTTCAAA AAGTGCCCATTTACAGTGAAGAATCTGGCTATGTTTCCAGACACGGTACCCATGGACTCC CAGTCCCTGGTGGAGGTTAGAGGGTCTTGTGTCAACAATTCTAAGGAGGAAGATCCTCCA AGGATGTACTGCAGTACAGAAGGCGAATGGCTTGTACCCATTGGCAAGTGTTCCTGCAAT GCTGGCTATGAAGAAAGAGGTTTTATGTGCCAAGCTTGTCGACCAGGTTTCTACAAGGCA TTGGATGGTAATATGAAGTGTGCTAAGTGCCCGCCTCACAGTTCTACTCAGGAAGATGGT
    [Show full text]
  • Eph Receptor A3 (EPHA3) Human Sirna Oligo Duplex (Locus ID 2042) Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SR301423 Eph receptor A3 (EPHA3) Human siRNA Oligo Duplex (Locus ID 2042) Product data: Product Type: siRNA Oligo Duplexes Purity: HPLC purified Quality Control: Tested by ESI-MS Sequences: Available with shipment Stability: One year from date of shipment when stored at -20°C. # of transfections: Approximately 330 transfections/2nmol in 24-well plate under optimized conditions (final conc. 10 nM). Note: Single siRNA duplex (10nmol) can be ordered. RefSeq: NM_005233, NM_182644 Synonyms: EK4; ETK; ETK1; HEK; HEK4; TYRO4 Components: EPHA3 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each (Locus ID 2042) Included - SR30004, Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol Included - SR30005, RNAse free siRNA Duplex Resuspension Buffer - 2 ml Summary: This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene encodes a protein that binds ephrin-A ligands. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only.
    [Show full text]
  • Rabbit Anti-Ephrin-A1 Rabbit Anti-Ephrin-A1
    Qty: 100 µg/400 µl Rabbit anti-ephrin-A1 Catalog No. 34-3300 Lot No. See product label Rabbit anti-ephrin-A1 FORM This polyclonal antibody is supplied as a 400 µl aliquot at a concentration of 0.25 mg/ml in phosphate buffered saline (pH 7.4) containing 0.1% sodium azide. The antibody is epitope-affinity-purified from rabbit antiserum. PAD: ZMD.39 IMMUNOGEN Synthetic peptide derived from the C-terminal end of mouse ephrin-A1 protein. SPECIFICITY This antibody is specific for the ephrin-A1 protein. REACTIVITY Reactivity is confirmed with a chimeric protein consisting of the extracellular domain of mouse ephrin-A1 and the Fc region of human IgG1. Cross-reactivity with human ephrin-A1 is confirmed with IHC experiments on human tissue sections and this reactivity was expected because of the 85% shared amino acid identity in the extracellular domain. Sample Western Immunoprecipitation Immunohistochemistry Blotting (FFPE) Mouse +++ +++ NT Human NT NT ++ (Excellent +++, Good++, Poor +, No reactivity 0, Not tested NT) USAGE Working concentrations for specific applications should be determined by the investigator. Appropriate concentrations will be affected by several factors, including secondary antibody affinity, antigen concentration, sensitivity of detection method, temperature and length of incubations, etc. The suitability of this antibody for applications other than those listed below has not been determined. The following concentration ranges are recommended starting points for this product. Western Blotting: 1-5 µg/mL Immunoprecipitation: 5-10 µg/ IP reaction Immunohistochemistry: 4-10 µg/mL Please note that immunohistochemical assays were optimized on formalin-fixed, paraffin-embedded tissue sections and Heat Induced Epitope Retrieval (HIER) with EDTA, pH 8.0 was required for optimal staining.
    [Show full text]
  • EPH/Ephrin Profile and EPHB2 Expression Predicts Patient Survival in Breast Cancer
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 16 EPH/ephrin profile and EPHB2 expression predicts patient survival in breast cancer Anna-Maria Husa1,2, Željana Magić1, Malin Larsson3, Tommy Fornander4, Gizeh Pérez-Tenorio1 1Department of Clinical and Experimental Medicine, Division of Oncology, Linköping University, Linköping, Sweden 2Current address: CCRI, Children’s Cancer Research Institute, St. Anna Kinderkrebsforschung e.V., Vienna, Austria 3Bioinformatics Infrastructure for Life Sciences (BILS) and Department of Physics, Chemistry and Biology, Linköping University, Linköping, Sweden 4Department of Oncology, Karolinska University Hospital and Karolinska Institute, Stockholm, Sweden Correspondence to: Gizeh Pérez-Tenorio, e-mail: [email protected] Keywords: EPHB2, EPH family, TaqMan array, gene expression, protein expression Received: July 03, 2015 Accepted: January 23, 2016 Published: February 8, 2016 ABSTRACT The EPH and ephrins function as both receptor and ligands and the output on their complex signaling is currently investigated in cancer. Previous work shows that some EPH family members have clinical value in breast cancer, suggesting that this family could be a source of novel clinical targets. Here we quantified the mRNA expression levels of EPH receptors and their ligands, ephrins, in 65 node positive breast cancer samples by RT-PCR with TaqMan® Micro Fluidics Cards Microarray. Upon hierarchical clustering of the mRNA expression levels, we identified a subgroup of patients with high expression, and poor clinical outcome. EPHA2, EPHA4, EFNB1, EFNB2, EPHB2 and EPHB6 were significantly correlated with the cluster groups and particularly EPHB2 was an independent prognostic factor in multivariate analysis and in four public databases. The EPHB2 protein expression was also analyzed by immunohistochemistry in paraffin embedded material (cohort 2).
    [Show full text]
  • Beyond Traditional Morphological Characterization of Lung
    Cancers 2020 S1 of S15 Beyond Traditional Morphological Characterization of Lung Neuroendocrine Neoplasms: In Silico Study of Next-Generation Sequencing Mutations Analysis across the Four World Health Organization Defined Groups Giovanni Centonze, Davide Biganzoli, Natalie Prinzi, Sara Pusceddu, Alessandro Mangogna, Elena Tamborini, Federica Perrone, Adele Busico, Vincenzo Lagano, Laura Cattaneo, Gabriella Sozzi, Luca Roz, Elia Biganzoli and Massimo Milione Table S1. Genes Frequently mutated in Typical Carcinoids (TCs). Mutation Original Entrez Gene Gene Rate % eukaryotic translation initiation factor 1A X-linked [Source: HGNC 4.84 EIF1AX 1964 EIF1AX Symbol; Acc: HGNC: 3250] AT-rich interaction domain 1A [Source: HGNC Symbol;Acc: HGNC: 4.71 ARID1A 8289 ARID1A 11110] LDL receptor related protein 1B [Source: HGNC Symbol; Acc: 4.35 LRP1B 53353 LRP1B HGNC: 6693] 3.53 NF1 4763 NF1 neurofibromin 1 [Source: HGNC Symbol;Acc: HGNC: 7765] DS cell adhesion molecule like 1 [Source: HGNC Symbol; Acc: 2.90 DSCAML1 57453 DSCAML1 HGNC: 14656] 2.90 DST 667 DST dystonin [Source: HGNC Symbol;Acc: HGNC: 1090] FA complementation group D2 [Source: HGNC Symbol; Acc: 2.90 FANCD2 2177 FANCD2 HGNC: 3585] piccolo presynaptic cytomatrix protein [Source: HGNC Symbol; Acc: 2.90 PCLO 27445 PCLO HGNC: 13406] erb-b2 receptor tyrosine kinase 2 [Source: HGNC Symbol; Acc: 2.44 ERBB2 2064 ERBB2 HGNC: 3430] BRCA1 associated protein 1 [Source: HGNC Symbol; Acc: HGNC: 2.35 BAP1 8314 BAP1 950] capicua transcriptional repressor [Source: HGNC Symbol; Acc: 2.35 CIC 23152 CIC HGNC:
    [Show full text]
  • Cancer Research
    NOVUS BIOLOGICALS ANTIBODIES FOR CANCER RESEARCH NOVUS IRELAND Phone: +353 1 506 0361 Fax: +353 1 506 0362 Email: [email protected] Visit www.novusbio.com for complete product listings. www.novusbio.com • [email protected] Table of Contents Making Your Success Our Goal Epigenetic Research ............. 2-4 DNA Damage ..........................5 Novus offers primary antibodies for thousands of proteins Protein Tyrosine Phosphatases ....6 associated with cancer pathways. Our antibodies have been cited Cancer Stem Cells ............... 7-8 hundreds of times and reviewed by many of our customers. This Hypoxia (HIF)............................9 Heat Shock Proteins ............... 10 catalog represents a partial list of the antibodies we have Tumor Suppressors available for cancer research. We offer multiple antibodies that and Oncogenes ..............11-12 are suitable for a variety of species and applications, most often Metabolism .....................13-14 Angiogenesis ..................15-16 with a choice of monoclonal or polyclonal clonality to suit your Autophagy ............................. 17 particular experiments. Apoptosis .............................. 18 Breast Cancer ........................ 19 In addition to our primary antibody products, we offer related Lung Cancer .......................... 20 research tools including immunoprecipitation and labeling kits Colorectal Cancer .................. 21 Cervical Cancer ..................... 22 and a variety of secondary antibodies, lysates, peptides and Prostate Cancer ..................... 23 proteins for many genes of interest. For complete product Tumor Markers ...................... 24 information please visit www.novusbio.com. Support Products .................... 25 Cancer Pathway Posters .......... 26 Novus Quality Guarantee Application Key We stand behind our products 100%. If you cannot get a product to work in an application or species stated on our data sheet, our technical ChIP - Chromatin Immunoprecipitation DB - Dot Blot service team will troubleshoot with you to get it to work.
    [Show full text]
  • Molecular Profiling of the Residual Disease of Triple-Negative Breast Cancers After Neoadjuvant Chemotherapy Identifies Actionable Therapeutic Targets
    Published OnlineFirst December 19, 2013; DOI: 10.1158/2159-8290.CD-13-0286 RESEARCH ARTICLE Molecular Profi ling of the Residual Disease of Triple-Negative Breast Cancers after Neoadjuvant Chemotherapy Identifi es Actionable Therapeutic Targets Justin M. Balko1 , 5 , Jennifer M. Giltnane2 , 5 , Kai Wang 8 , Luis J. Schwarz1 , 9 , 10 , Christian D. Young1 , Rebecca S. Cook3 , 5 , Phillip Owens 3 , Melinda E. Sanders 2 , 5 , Maria G. Kuba 2 , Violeta Sánchez 1 , Richard Kurupi 1 , Preston D. Moore 1 , Joseph A. Pinto 9 , Franco D. Doimi 9 , Henry Gómez 10 , Dai Horiuchi 6 , 7 , Andrei Goga 6 , 7 , Brian D. Lehmann 4 , Joshua A. Bauer 4 , Jennifer A. Pietenpol 4 , 5 , Jeffrey S. Ross 8 , Gary A. Palmer 8 , Roman Yelensky 8 , Maureen Cronin8 , Vincent A. Miller 8 , Phillip J. Stephens 8 , and Carlos L. Arteaga 1 , 3 , 5 Downloaded from cancerdiscovery.aacrjournals.org on September 29, 2021. © 2014 American Association for Cancer Research. Published OnlineFirst December 19, 2013; DOI: 10.1158/2159-8290.CD-13-0286 ABSTRACT Neoadjuvant chemotherapy (NAC) induces a pathologic complete response (pCR) in approximately 30% of patients with triple-negative breast cancers (TNBC). In patients lacking a pCR, NAC selects a subpopulation of chemotherapy-resistant tumor cells. To under- stand the molecular underpinnings driving treatment-resistant TNBCs, we performed comprehensive molecular analyses on the residual disease of 74 clinically defi ned TNBCs after NAC, including next- generation sequencing (NGS) on 20 matched pretreatment biopsies. Combined NGS and digital RNA expression analysis identifi ed diverse molecular lesions and pathway activation in drug-resistant tumor cells.
    [Show full text]