A Loss-Of-Function Genetic Screening Identifies Novel Mediators of Thyroid Cancer Cell Viability

Total Page:16

File Type:pdf, Size:1020Kb

Load more

www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 19 A loss-of-function genetic screening identifies novel mediators of thyroid cancer cell viability Maria Carmela Cantisani1, Alessia Parascandolo2, Merja Perälä3,4, Chiara Allocca2, Vidal Fey3,4, Niko Sahlberg3,4, Francesco Merolla5, Fulvio Basolo6, Mikko O. Laukkanen1, Olli Pekka Kallioniemi7, Massimo Santoro2,8, Maria Domenica Castellone8 1IRCCS SDN, Naples, Italy 2Dipartimento di Medicina Molecolare e Biotecnologie Mediche, Universita’ Federico II, Naples, Italy 3Medical Biotechnology, VTT Technical Research Centre of Finland, Turku, Finland 4Center for Biotechnology, University of Turku, Turku, Finland 5Dipartimento di Scienze Biomediche Avanzate, Università Federico II, Naples, Italy 6Division of Pathology, Department of Surgery, University of Pisa, Pisa, Italy 7FIMM-Institute for Molecular Medicine Finland, University of Helsinki, Helsinki, Finland 8Istituto di Endocrinologia ed Oncologia Sperimentale “G. Salvatore” (IEOS), C.N.R., Naples, Italy Correspondence to: Maria Domenica Castellone, e-mail: [email protected] Keywords: kinases, screening, siRNA, thyroid carcinoma Received: October 01, 2015 Accepted: March 02, 2016 Published: April 4, 2016 ABSTRACT RET, BRAF and other protein kinases have been identified as major molecular players in thyroid cancer. To identify novel kinases required for the viability of thyroid carcinoma cells, we performed a RNA interference screening in the RET/PTC1(CCDC6- RET)-positive papillary thyroid cancer cell line TPC1 using a library of synthetic small interfering RNAs (siRNAs) targeting the human kinome and related proteins. We identified 14 hits whose silencing was able to significantly reduce the viability and the proliferation of TPC1 cells; most of them were active also in BRAF-mutant BCPAP (papillary thyroid cancer) and 8505C (anaplastic thyroid cancer) and in RAS-mutant CAL62 (anaplastic thyroid cancer) cells. These included members of EPH receptor tyrosine kinase family as well as SRC and MAPK (mitogen activated protein kinases) families. Importantly, silencing of the identified hits did not affect significantly the viability of Nthy-ori 3-1 (hereafter referred to as NTHY) cells derived from normal thyroid tissue, suggesting cancer cell specificity. The identified proteins are worth exploring as potential novel druggable thyroid cancer targets. INTRODUCTION occurs in thyroid cancer [1–4]. Accordingly, point mutations of the BRAF serine/threonine kinase as well Thyroid cancer is the most common endocrine as rearrangements (RET/PTC) of RET receptor tyrosine malignancy, whose incidence has been steadily increasing kinase (RTK) or of other RTKs are found in the majority over the past 30 years [1–3]. Most common thyroid cancer of PTC cases [1–6]. Mutations of RAS, an upstream types arise from follicular epithelial cells and are classified activator of both MAPK and PI3K, are common in FTC in well-differentiated papillary (PTC) and follicular and in follicular-variant PTC [5–7]. Mutations or copy (FTC), poorly differentiated (PDC), and anaplastic number alterations of PI3K and AKT are found in ATC (undifferentiated) (ATC) carcinoma; PTC accounts for the and radioiodine-refractory thyroid cancer [3, 8–10]. vast majority of thyroid cancer cases [1–3]. Unbiased RNA interference (RNAi) screenings, Oncogenic conversion of kinases involved in the based on the use of siRNAs collections targeting the entire MAPK (mitogen activated protein kinases) and PI3K genome or relevant gene families, are being exploited to (phosphatidyl-inositol-3-kinase)/AKT signaling cascades identify novel molecular mediators of tumorigenesis and www.impactjournals.com/oncotarget 28510 Oncotarget therapeutic targets [11]. Here, through a siRNA-based Supplemental Information, Figure S1 and raw data are kinome screen, we identified a set of kinases and related available in Supplemental Information, Table S1. Overall, proteins as novel drivers of thyroid cancer cells viability. silencing of 50 genes reduced TPC1 cell viability. This list included a pseudogene LOC392265 and a Ser/Thr-like RESULTS kinase MGC44796 (later identified as STK40) that were excluded from further studies (Supplemental Information, High-throughput siRNA-based screening in Table S2). TPC1 thyroid cancer cells Though TPC1 cells depend on RET/PTC1 for their viability [12], RET was not present among the hits because We designed a functional screening using the the two RET targeting siRNAs included in our library did human papillary carcinoma cell line, TPC1, harboring not efficiently knock-down the RET/PTC1 expression at the endogenous level the RET/PTC1 (CCDC6-RET) (data not shown). rearrangement [12] and a commercially available siRNA library containing synthetic siRNAs targeting the 518 Validation of antiproliferative hits in TPC1 cells human protein kinases as well as kinase-related and -associated proteins. The library included two independent To confirm the results of the screening, we measured siRNAs targeting each transcript and negative controls TPC1 cell viability upon transfection with the same 2 consisting of siRNAs targeting green fluorescent protein siRNAs from the library (siRNA1 and 2) as well as with 2 (GFP), eight non targeting scrambled sequences, as well independent siRNAs (siRNA3 and 4) targeting a distinct as buffer alone. The screening was performed in duplicate. mRNA region of the 48 hits (Supplemental Information, Seventy-two hours after transfection, viable cells were Table S2); average results are reported in Figure 1 and stained and antiproliferative hits were identified as genes raw data are shown in Supplemental Information, Table whose knock-down, by at least one of the two siRNAs, S3. Nine out of 48 genes were not confirmed to reduce cell reduced (by at least 30%; loess-log ≤-0.5) cell viability viability and were therefore excluded from further tests. in both replicates upon normalization to the median value Among the remaining ones, silencing of 27 genes reduced of negative controls. A plot of the results is shown in dye incorporation by at least 30% (loess-log ≤-0.5) Figure 1: Identification of genes essential for TPC1 cell viability. TPC1 cells were transfected in duplicate with 4 independent siRNAs (Supplemental Information, Table S2) targeting different regions of the 48 antiproliferative hits. Seventy-two hours after transfection, cell viability was measured by CellTiter-Blue assay and expressed as log2 (loess-log normalization). The reported values are the average results of the transfection of 4 siRNAs for each gene in duplicate normalized by negative controls (average results of Non specific siRNA Control and AllStars Negative siRNA Control). The bars represent 95% confidence intervals. Dotted line represents an arbitrary cut-off value (loess-log ≤-0.5) applied to select the down hits. www.impactjournals.com/oncotarget 28511 Oncotarget Table 1: List of the 14 antiproliferative hits identified in TPC1 cells Symbol Gene name Genbank ID AGC: cAMP-dependent, cGMP-dependent and protein kinase C AKT2 v-akt murine thymoma viral oncogene homolog 2 NM_001626 PKN1 protein kinase N1 NM_002741 PRKACB protein kinase cAMP dependent, catalitic, beta NM_182948 CMGC group AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 NM_005751 mitogen-activated protein kinase kinase kinase 7 interacting MAP3K7IP1 NM_006116 protein 1 GPCR coupled kinases GRK4 G protein-coupled receptor kinase 4 NM_182982 STE: serine/threonine kinase family MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 NM_004759 TK: tyrosine kinases EPHA2 EPH receptor A2 NM_004431 EPHA7 EPH receptor A7 NM_004440 EPHB2 EPH receptor B2 NM_017449 EPHB6 EPH receptor B6 NM_004445 FYN FYN oncogene NM_002037 HCK hemopoietic cell kinase NM_002110 TKL: tyrosine kinase like LIMK1 LIM domain kinase 1 NM_002314 (average value of the 4 different siRNAs) as compared different from RET. To this aim, we selected 3 additional to the negative controls (siRNAs with no homology thyroid cancer cell lines (BCPAP, 8505C and CAL62) of to any known mammalian gene: Non specific siRNA different histotypes and featuring different complements Control, catalogue no. 1022079 and AllStars Negative of genetic lesions. BCPAP and 8505C cells bear a BRAF siRNA Control, catalogue no. SI03650318, Qiagen); V600E and CAL62 bears a KRAS G12R mutation, in particular, in the case of 20 genes the reduction was respectively (Supplemental Information, Table S4) [13]. significant (p <0.05) with each one of the four different The 14 hits were individually silenced by siRNA1 and 2 used siRNAs. We therefore restricted our analysis to these in the three cancer cell lines, compared to NTHY cells. 20 hits and tested effects of their silencing in a control Silencing of most of them (14/14 genes for BCPAP, cell line (NTHY) obtained from normal thyroid tissue and 11/14 for CAL62 and 14/14 for 8505C cells) significantly immortalized by SV40 Large T. Silencing of six (CIB3, (p <0.01) reduced viability of cancer (Figure 3) but not ITPKA, MAPK7, MARCKS, PAK2, STK33) genes NTHY (Figure 4) cells. Exceptions were represented by affected the viability also of control cells (data not shown) FYN and PRKACB that reduced CAL62 cell viability and therefore they were excluded from further tests, thus only when silenced with siRNA1 and LIMK1 that did not finally resulting in 14 selected hits (Table 1 and Figure 2). reduce dye incorporation with either siRNA. To confirm gene knock-down, we performed Validation of antiproliferative hits in a panel of quantitative
Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”

    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
  • Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer

    Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer

    diagnostics Review Tumour-Agnostic Therapy for Pancreatic Cancer and Biliary Tract Cancer Shunsuke Kato Department of Clinical Oncology, Juntendo University Graduate School of Medicine, 2-1-1, Hongo, Bunkyo-ku, Tokyo 113-8421, Japan; [email protected]; Tel.: +81-3-5802-1543 Abstract: The prognosis of patients with solid tumours has remarkably improved with the develop- ment of molecular-targeted drugs and immune checkpoint inhibitors. However, the improvements in the prognosis of pancreatic cancer and biliary tract cancer is delayed compared to other carcinomas, and the 5-year survival rates of distal-stage disease are approximately 10 and 20%, respectively. How- ever, a comprehensive analysis of tumour cells using The Cancer Genome Atlas (TCGA) project has led to the identification of various driver mutations. Evidently, few mutations exist across organs, and basket trials targeting driver mutations regardless of the primary organ are being actively conducted. Such basket trials not only focus on the gate keeper-type oncogene mutations, such as HER2 and BRAF, but also focus on the caretaker-type tumour suppressor genes, such as BRCA1/2, mismatch repair-related genes, which cause hereditary cancer syndrome. As oncogene panel testing is a vital approach in routine practice, clinicians should devise a strategy for improved understanding of the cancer genome. Here, the gene mutation profiles of pancreatic cancer and biliary tract cancer have been outlined and the current status of tumour-agnostic therapy in these cancers has been reported. Keywords: pancreatic cancer; biliary tract cancer; targeted therapy; solid tumours; driver mutations; agonist therapy Citation: Kato, S. Tumour-Agnostic Therapy for Pancreatic Cancer and 1.
  • Screening for Copy Number Variation in Genes Associated with the Long QT Syndrome Clinical Relevance

    Screening for Copy Number Variation in Genes Associated with the Long QT Syndrome Clinical Relevance

    Journal of the American College of Cardiology Vol. 57, No. 1, 2011 © 2011 by the American College of Cardiology Foundation ISSN 0735-1097/$36.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2010.08.621 Heart Rhythm Disorders Screening for Copy Number Variation in Genes Associated With the Long QT Syndrome Clinical Relevance Julien Barc, PHD,*‡§ François Briec, MD,*†‡§ Sébastien Schmitt, MD,ʈ Florence Kyndt, PharmD, PHD,*‡§ʈ Martine Le Cunff, BS,*‡§ Estelle Baron, BS,*‡§ Claude Vieyres, MD,¶ Frédéric Sacher, MD,# Richard Redon, PHD,*‡§ Cédric Le Caignec, MD, PHD,*‡§ʈ Hervé Le Marec, MD, PHD,*†‡§ Vincent Probst, MD, PHD,*†‡§ Jean-Jacques Schott, PHD*†‡§ Nantes, Angoulême, and Bordeaux, France Objectives The aim of this study was to investigate, in a set of 93 mutation-negative long QT syndrome (LQTS) probands, the frequency of copy number variants (CNVs) in LQTS genes. Background LQTS is an inherited cardiac arrhythmia characterized by a prolonged heart rate–corrected QT (QTc) interval as- sociated with sudden cardiac death. Recent studies suggested the involvement of duplications or deletions in the occurrence of LQTS. However, their frequency remains unknown in LQTS patients. Methods Point mutations in KCNQ1, KCNH2, and SCN5A genes were excluded by denaturing high-performance liquid chromatography or direct sequencing. We applied Multiplex Ligation-dependent Probe Amplification (MLPA) to detect CNVs in exons of these 3 genes. Abnormal exon copy numbers were confirmed by quantitative multiplex PCR of short fluorescent fragment (QMPSF). Array-based comparative genomic hybridization (array CGH) analysis was performed using Agilent Human Genome 244K Microarrays to further map the genomic rearrangements.
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions

    Defining Functional Interactions During Biogenesis of Epithelial Junctions

    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    Transcriptomic Analysis of Native Versus Cultured Human and Mouse Dorsal Root Ganglia Focused on Pharmacological Targets Short

    bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Transcriptomic analysis of native versus cultured human and mouse dorsal root ganglia focused on pharmacological targets Short title: Comparative transcriptomics of acutely dissected versus cultured DRGs Andi Wangzhou1, Lisa A. McIlvried2, Candler Paige1, Paulino Barragan-Iglesias1, Carolyn A. Guzman1, Gregory Dussor1, Pradipta R. Ray1,#, Robert W. Gereau IV2, # and Theodore J. Price1, # 1The University of Texas at Dallas, School of Behavioral and Brain Sciences and Center for Advanced Pain Studies, 800 W Campbell Rd. Richardson, TX, 75080, USA 2Washington University Pain Center and Department of Anesthesiology, Washington University School of Medicine # corresponding authors [email protected], [email protected] and [email protected] Funding: NIH grants T32DA007261 (LM); NS065926 and NS102161 (TJP); NS106953 and NS042595 (RWG). The authors declare no conflicts of interest Author Contributions Conceived of the Project: PRR, RWG IV and TJP Performed Experiments: AW, LAM, CP, PB-I Supervised Experiments: GD, RWG IV, TJP Analyzed Data: AW, LAM, CP, CAG, PRR Supervised Bioinformatics Analysis: PRR Drew Figures: AW, PRR Wrote and Edited Manuscript: AW, LAM, CP, GD, PRR, RWG IV, TJP All authors approved the final version of the manuscript. 1 bioRxiv preprint doi: https://doi.org/10.1101/766865; this version posted September 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
  • Active Recombinant MAPKAPK3

    Active Recombinant MAPKAPK3

    RESEARCH USE ONLY Active Recombinant MAPKAPK3 CATALOG NO.: JM-7755-5 AMOUNT: 5 μg BACKGROUND: MAPKAPK3 has a single potential SH3-binding site in the proline-rich N terminus, a putative ATP- binding site, 2 MAP kinase phosphorylation site motifs, and a putative nuclear localization signal. It shares 72% nucleotide and 75% amino acid identity with MAPKAPK2 (1). MAPKAPK3 was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses (2). This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation (3). MAPKAPK3 is uniquely poised to support luteal maturation through the phosphorylation and activation of the nuclear transcription factor CREB (4). DESCRIPTION: Recombinant full length human MAPKAPK3 containing N-terminal GST tag was expressed by baculovirus in Sf 9 insect cells. The gene accession number is NM_004635. PURITY: 1.5 μg of MAPKAPK3 protein was subjected to SDS-PAGE and Coomassie blue staining. The scan of the blue gel showed >90% purity of the MAPKAPK3 protein product, and the band was at ~69 kDa (Fig. 2). FORMULATION: Recombinant proteins in storage buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.25 mM DTT, 0.1 mM EGTA, 0.1 mM EDTA, 0.1 mM PMSF, 25% glycerol).
  • Pancancer Progression Human Vjune2017

    Pancancer Progression Human Vjune2017

    Gene Symbol Accession Alias/Prev Symbol Official Full Name AAMP NM_001087.3 - angio-associated, migratory cell protein ABI3BP NM_015429.3 NESHBP|TARSH ABI family, member 3 (NESH) binding protein ACHE NM_000665.3 ACEE|ARACHE|N-ACHE|YT acetylcholinesterase ACTG2 NM_001615.3 ACT|ACTA3|ACTE|ACTL3|ACTSG actin, gamma 2, smooth muscle, enteric ACVR1 NM_001105.2 ACTRI|ACVR1A|ACVRLK2|ALK2|FOP|SKR1|TSRI activin A receptor, type I ACVR1C NM_145259.2 ACVRLK7|ALK7 activin A receptor, type IC ACVRL1 NM_000020.1 ACVRLK1|ALK-1|ALK1|HHT|HHT2|ORW2|SKR3|TSR-I activin A receptor type II-like 1 ADAM15 NM_207195.1 MDC15 ADAM metallopeptidase domain 15 ADAM17 NM_003183.4 ADAM18|CD156B|CSVP|NISBD|TACE ADAM metallopeptidase domain 17 ADAM28 NM_014265.4 ADAM 28|ADAM23|MDC-L|MDC-Lm|MDC-Ls|MDCL|eMDC II|eMDCII ADAM metallopeptidase domain 28 ADAM8 NM_001109.4 CD156|MS2 ADAM metallopeptidase domain 8 ADAM9 NM_001005845.1 CORD9|MCMP|MDC9|Mltng ADAM metallopeptidase domain 9 ADAMTS1 NM_006988.3 C3-C5|METH1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 ADAMTS12 NM_030955.2 PRO4389 ADAM metallopeptidase with thrombospondin type 1 motif, 12 ADAMTS8 NM_007037.4 ADAM-TS8|METH2 ADAM metallopeptidase with thrombospondin type 1 motif, 8 ADAP1 NM_006869.2 CENTA1|GCS1L|p42IP4 ArfGAP with dual PH domains 1 ADD1 NM_001119.4 ADDA adducin 1 (alpha) ADM2 NM_001253845.1 AM2|dJ579N16.4 adrenomedullin 2 ADRA2B NM_000682.4 ADRA2L1|ADRA2RL1|ADRARL1|ALPHA2BAR|alpha-2BAR adrenoceptor alpha 2B AEBP1 NM_001129.3 ACLP AE binding protein 1 AGGF1 NM_018046.3 GPATC7|GPATCH7|HSU84971|HUS84971|VG5Q
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
  • Autophagy Processes Are Dependent on EGF Receptor Signaling

    Autophagy Processes Are Dependent on EGF Receptor Signaling

    www.oncotarget.com Oncotarget, 2018, Vol. 9, (No. 54), pp: 30289-30303 Research Paper Autophagy processes are dependent on EGF receptor signaling Vincenzo De Iuliis1, Antonio Marino1, Marika Caruso1, Sabrina Capodifoglio1, Vincenzo Flati2, Anna Marynuk3, Valeria Marricareda3, Sebastiano Ursi1, Paola Lanuti4, Claudio Talora5, Pio Conti6, Stefano Martinotti1,7 and Elena Toniato7 1Unit of Predictive Medicine, SS Annunziata University Hospital of Chieti, Chieti, Italy 2Department of Biotechnological and Applied Clinical Sciences, University of L’Aquila, L’Aquila, Italy 3Odessa National Medical University, Odesa, Odessa Oblsat, Ucraina 4Department of Medicine and Aging Sciences, University G. d’Annunzio of Chieti, Chieti, Italy 5Department of Molecular Medicine, University of Rome “La Sapienza”, Rome, Italy 6Postgraduate Medical School, University of Chieti, Chieti, Italy 7Department of Medical, Oral and Biotechnological Sciences, University G. d’Annunzio of Chieti, Chieti, Italy Correspondence to: Elena Toniato, email: [email protected] Keywords: apoptosis; autophagy; Beclin 1; EGF receptor; MAPK pathway Received: May 03, 2018 Accepted: June 13, 2018 Published: July 13, 2018 Copyright: De Iuliis et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Autophagy is a not well-understood conserved mechanism activated during nutritional deprivation in order to maintain cellular homeostasis. In the present study, we investigated the correlations between autophagy, apoptosis and the MAPK pathways in melanoma cell lines. We demonstrated that during starvation the EGF receptor mediated signaling activates many proteins involved in the MAPK pathway.
  • Comprehensive Assessment of the Association of WNK4

    Comprehensive Assessment of the Association of WNK4

    OPEN Comprehensive Assessment of the SUBJECT AREAS: Association of WNK4 Polymorphisms GENETICS RESEARCH RENOVASCULAR HYPERTENSION with Hypertension: Evidence from a EPIDEMIOLOGY Meta-Analysis Received Xiao-gang Guo1, Jie Ding1, Hui Xu1,2, Tian-ming Xuan1, Wei-quan Jin1, Xiang Yin1, Yun-peng Shang1, 22 April 2014 Fu-rong Zhang1, Jian-hua Zhu1 & Liang-rong Zheng1 Accepted 15 September 2014 1Department of Cardiology, the First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China, Published 2Xiuzhou District, Gaozhao Street Community Health Service Center, Jiaxing 314031, China. 30 September 2014 The relationship between with-no-lysine [K] kinase 4 (WNK4) gene polymorphisms and hypertension has been widely investigated, However, the studies yielded contradictory results. To evaluate these inconclusive Correspondence and findings comprehensively, we therefore performed a meta-analysis. Ten articles encompassing 16 requests for materials independent case-control studies with 6089 hypertensive cases and 4881 normotensive controls were should be addressed to selected for this meta-analysis. Four WNK4 gene polymorphisms were identified (G1155942T, G1156666A, X.-G.G. (gxg22222@ T1155547C, and C6749T). The results showed statistically significant associations of G1155942T polymorphism (allelic genetic model: odds ration or OR51.62, 95% confidence interval or CI: 1.11–2.38, zju.edu.cn) P50.01; dominant model: OR51.85, 95% CI: 1.07–3.19, P50.03) and C6749T polymorphism (allele contrast: OR52.04, 95% CI: 1.60–2.59, P,0.01; dominant model: OR52.04, 95%CI: 1.59–2.62, P,0.01; and homozygous model: OR55.01, 95% CI: 1.29–19.54, P50.02) with hypertension risk. However, neither C1155547T nor G1156666A was associated significantly with hypertension susceptibility.