DOCSLIB.ORG

Archaeal DNA Replication and DNA Repair

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Archaeal DNA Replication and DNA Repair RADAR-seq: Utilizing PacBio SMRT Sequencing to Detect and Quantitate DNA Damage on a Genome-Wide Scale Kelly M. Zatopek Research Scientist New England Biolabs Ipswich, MA Archaeal DNA Replication and DNA Repair Leading Strand 3’ 5’ PCNA polD GAN RFC clamp loader MCM helicase Lagging Strand GINS 5’ 3’ DNA primase Okazaki fragment maturation Fen1 polB gap RPA DNA ligase Performed in Thermococcus kodakarensis (Tko) Archaeal DNA Replication and DNA Repair Leading Strand 3’ 5’ PCNA DNA Glycosylase polD AP polB GAN Endonuclease Fen1 RFC clamp loader MCM helicase DNA ligase Lagging Strand GINS 5’ 3’ DNA primase Okazaki fragment maturation Fen1 polB gap RPA DNA ligase Performed in Thermococcus kodakarensis (Tko) Archaeal DNA Replication and DNA Repair Leading Strand 3’ 5’ PCNA Experimental Techniques DNA Glycosylase polD AP polB GAN Endonuclease Fen1 RFC clamp loader 1. Protein Expression & MCM helicase Purification DNA ligase Lagging Strand GINSGOAL 5’ 2. Enzyme Kinetics 3’ Utilize next generation sequencingDNA primase to understand3. CE Assay Okazaki fragment maturation DNA replication and repair in Tko4. Gel Filtration Fen1 5. Site Directed Mutagenesis polB gap 6. Genetics RPA DNA ligase 7. NGS Performed in Thermococcus kodakarensis (Tko) Next Generation Sequencing PacBio Single Molecule Real-Time SMRT-Cell PacBio Genomic DNA Library Prep Sequencing Wells Instruments Isolate genomic DNA RSII 150,000 wells Sequel Sheer into 100 bp – 20 kb fragments 1,000,000 wells Ligation of SMRT-bell adapters Sequel II 8,000,000 wells Bind primer and polymerase doi:10.1126/science.1079700 Next Generation Sequencing PacBio Single Molecule Real-Time SMRT-Cell Detection of Non-Canonical Bases Sequencing Wells SMRT-seq can detect presence of certain modified nucleotides, by slower polymerase translocation (IPD) 6mA & 4mC Two Major Hurdles 1. Detection of a wide variety of DNA modifications C T TGG T A CG AG T T A C CG AT C GG TGG T A C GGC T TG G T G A ACC A T G CTC A AT G GC T AG CC ACC A T G CCGA AC C A 2. Stochastic DNA modification detection IPD Ratio Experimental IPD IPD Ratio = Expected IPD doi:10.1126/science.1079700 doi:10.1186/2041-9414-2-10 RADAR-seq RAre Damage and Repair - Seq × DNA damage site nick site Patch of high IPDs produced by RADAR-seq Isolation of genomic DNA × × × patch (38 nt) × 10 PacBio library preparation 8 6 top × 4 strand IPD ratio 2 SMRTbell Repair SMRTbell 0 adapter adapter C T GG C GGG C A T T G C C A G A A A C C T T G C C A T C T C A G A C A GG T A T A G A G A C G C T T A T C T enzyme(s) 551,600 — | | | | | | — 551,650 G A C C G C C C G T A A C GG T C T T T GG A A C GG T A G A G T C T G T C C A T A T C T C T G C G A A T A G A × 0 2 Bst FL DNA polymerase 4 bottom dTTP, dGTP d6mATP, d4mCTP 6 RADAR-seq strand IPD ratio 8 single-molecule patch detection 10 Taq ligase NAD+ Identifying a patch of high IPDs at single-molecule level provides us with confidence that we are PacBio correctly calling a DNA damage site SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Detectable DNA Lesions × DNA damage site nick site Detectable DNA Lesions Isolation of genomic DNA × × × × PacBio DNA Lesions Repair Enzyme library preparation alkylated purines Alkyl Adenine DNA Glycosylase1 × TwoAP Major site Hurdles Endonuclease IV2 1,2 SMRTbell Repair SMRTbell CPD T4 Pyrimidine DNA Glycosylase adapter adapter 1.enzyme(s)Detection of a widedamaged variety pyrimidines of DNA Endonuclease modifications VIII1,2 ✔ × deoxyinosine Endonuclease V 1,2 Bst FL DNA polymerase2. Stochastic DNAdeoxyuridine modification Uracil detection DNA Glycosylase dTTP, dGTP 1 d6mATP, d4mCTP oxidized pyrimidines NEIL1 oxidized purines (8oxoG) Fpg DNA Glycosylase1,2 Taq ligase rN embedded in DNA RNaseH2 NAD+ T:G mismatch Thymine DNA Glycosylase1 1. Must be used in conjunction with Endonuclease IV for nick translation 2. Component of PreCR PacBio SMRT sequencing RADAR-seq patch detection doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Stochastic Modification Detection × DNA damage site nick site Non-stochastic Versus Stochastic Isolation of genomic DNA Base Detection × × × × PacBio library preparation × ● SMRTbell Repair SMRTbell ● adapter adapter enzyme(s) ● ● × ● Bst FL DNA polymerase 6mA dTTP, dGTP 0 2,000,000 d6mATP, d4mCTP 1.7 1.9 1.0 7.0 1.5 Average IPD Ratio at each Genomic Position Taq ligase NAD+ PacBio SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Stochastic Modification Detection × DNA damage site nick site Non-stochastic Versus Stochastic Isolation of genomic DNA Base Detection × × × × PacBio library preparation × vi v iv ● SMRTbell Repair SMRTbell ● adapter adapter enzyme(s) iii ● ii ● × i ● Bst FL DNA polymerase 6mA dTTP, dGTP 0 d6mATP, d4mCTP 2,000,000 Average IPD Ratio at each Genomic Position Taq ligase NAD+ PacBio SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Stochastic Modification Detection × DNA damage site nick site Non-stochastic Versus Stochastic Isolation of genomic DNA Base Detection × × × × PacBio library preparation × SMRTbell Repair SMRTbell adapter adapter Two Major Hurdles enzyme(s) ×1. Detection of a widei variety of DNA modifications● ✔ Bst FL DNA polymerase 6mA dTTP, dGTP 0 2,000,000 d6mATP, d4mCTP2. Stochastic DNA 7.0modification1.0 detection7.0 ✔ IPD Ratio at each Genomic Position in every DNA fragment Taq ligase NAD+ PacBio SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 Method Validation Site-Specific Nicking Enzyme Genome-wide Tko & A’s and C’s at Nb.BsrDI sites E. coli 2000 0 100 1900 7 PacBio 200 library preparation 6 A atio 1800 r 5 GGCATTGCCAGAAACCTTGC 300 CCGTAACGGTCTTTGGAACG 4 SMRTbell SMRTbell 3 adapter Nb.BsrDI adapter 1700 400 2 GGCATTGCCAGAAACCTTGC Mean IPD 1 CCGTAACGGTCTTTGGAACG 0 1600 WT Tko −100 0 100 200 300 400 500 Bst FL DNA polymerase 500 mdNTPs treated with Relative Position GGCATTGCCAGAACCTTGCC CCGTAACGGTCTTTGGAACG 1500 Nb.BsrDI 600 4 Taq ligase atio r 3 NAD+ C 1400 700 GGCATTGCCAGAACCTTGCC 2 CCGTAACGGTCTTTGGAACG 800 PacBio 1300 1 SMRT sequencing 900 Mean IPD RADAR-seq algorithm optimization 1200 1000 0 1100 −100 0 100 200 300 400 500 Relative Position doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq RAre Damage and Repair - Seq Workflow Detectable DNA Lesions × DNA damage site nick site Isolation of genomic DNA DNA Lesions Repair Enzyme × × × 1 × alkylated purines Alkyl Adenine DNA Glycosylase 2 PacBio AP site Endonuclease IV library preparation CPD T4 Pyrimidine DNA Glycosylase1,2 × damaged pyrimidines Endonuclease VIII1,2 SMRTbell Repair SMRTbell adapter adapter enzyme(s) deoxyinosine Endonuclease V × deoxyuridine Uracil DNA Glycosylase1,2 1 Bst FL DNA polymerase oxidized pyrimidines NEIL1 dTTP, dGTP 1,2 d6mATP, d4mCTP oxidized purines (8oxoG) Fpg DNA Glycosylase rN embedded in DNA RNaseH2 1 Taq ligase T:G mismatch Thymine DNA Glycosylase NAD+ 1. Must be used in conjunction with Endonuclease IV for nick translation 2. Component of PreCR PacBio SMRT sequencing RADAR-seq patch detection doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Ribonucleotide Detection RNaseH2 Workflow Results Tko E.coli 500 25 rN Ribonucleotide nick site 400 20 rN 300 15 SMRTbell SMRTbell RNaseH2 200 10 adapter adapter rN 100 5 Ribonucleotides (per million bases) Ribonucleotides (per million bases) 0 0 Bst FL DNA polymerase WT∆RNaseH2 WT∆RNaseH2 m dNTPs 50-fold 6.5-fold 2000 2000 0 0 100 1900 100 1900 200 200 1800 1800 300 Taq ligase 300 1700 NAD+ 1700 400 400 WT 1600 1600 DRnaseH2 500 500 1500 Tko 600 1500 Tko 600 PacBio 700 1400 1400 700 SMRT sequencing 800 800 1300 1300 900 900 1200 1000 1200 1000 RADAR-seq patch detection 1100 1100 doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Utilization RADAR-seq enables detection of a wide variety of stochastic DNA modifications on a genome-wide scale 4400 0 200 4200 400 400 0 0 Current RADAR-seq Projects 60 3800 1. Track lagging strand DNA polymerase synthesis 800 3600 2. Understand DNA deamination formation and repair in Tko 1000 E. coli 3400 PolI I709A/ΔRNaseH2 3. Look for off-target nicking activity of Cas12a 1200 4. Determine formation of DNA secondary structure 3200 1400 1600 5. Determine DNA damaging affects of DNA in space 3000 1800 2800 2000 2200 2600 2400 RADAR-seq Version 2.0 Room for Improvement 1. Single-base resolution : Modified T & G 2. Detecting closely spaced lesions 3. RADAR-seq on large genomes RADAR-seq Version 2.0 Modified A’s & C’s Modified T’s & G’s 2-thio-TTP N2-methyl-dGTP 7 7 6 6 5 5 7 4 4 6 3 3 atio r 2 6mA 2 Mean IPD ratio 5 Mean IPD ratio 1 4 1 0 0 3 0 100 0 100 2 Relative Position Relative Position Mean IPD 1 0 −100 0 100 200 300 400 500 Relative Position 5-aminoallyl-dUTP 6-thio-dGTP 4 7 7 atio r 3 6 4mC 6 5 5 2 4 4 3 3 1 2 Mean IPD ratio 2 Mean IPD ratio Mean IPD 1 1 0 0 −100 0 100 200 300 400 500 0 100 0 0 100 Relative Position Relative Position Relative Position RADAR-seq: Utilizing PacBio SMRT Sequencing to Detect and Quantitate DNA Damage on a Genome-Wide Scale NEB RADAR-Seq NEB PacBio Group Vladimir Potapov Alexey Fomenkov Andrew F.
Load more

Recommended publications
  • Evolutionary Origins of DNA Repair Pathways: Role of Oxygen Catastrophe in the Emergence of DNA Glycosylases
    cells Review Evolutionary Origins of DNA Repair Pathways: Role of Oxygen Catastrophe in the Emergence of DNA Glycosylases Paulina Prorok 1 , Inga R. Grin 2,3, Bakhyt T. Matkarimov 4, Alexander A. Ishchenko 5 , Jacques Laval 5, Dmitry O. Zharkov 2,3,* and Murat Saparbaev 5,* 1 Department of Biology, Technical University of Darmstadt, 64287 Darmstadt, Germany; [email protected] 2 SB RAS Institute of Chemical Biology and Fundamental Medicine, 8 Lavrentieva Ave., 630090 Novosibirsk, Russia; [email protected] 3 Center for Advanced Biomedical Research, Department of Natural Sciences, Novosibirsk State University, 2 Pirogova St., 630090 Novosibirsk, Russia 4 National Laboratory Astana, Nazarbayev University, Nur-Sultan 010000, Kazakhstan; [email protected] 5 Groupe «Mechanisms of DNA Repair and Carcinogenesis», Equipe Labellisée LIGUE 2016, CNRS UMR9019, Université Paris-Saclay, Gustave Roussy Cancer Campus, F-94805 Villejuif, France; [email protected] (A.A.I.); [email protected] (J.L.) * Correspondence: [email protected] (D.O.Z.); [email protected] (M.S.); Tel.: +7-(383)-3635187 (D.O.Z.); +33-(1)-42115404 (M.S.) Abstract: It was proposed that the last universal common ancestor (LUCA) evolved under high temperatures in an oxygen-free environment, similar to those found in deep-sea vents and on volcanic slopes. Therefore, spontaneous DNA decay, such as base loss and cytosine deamination, was the Citation: Prorok, P.; Grin, I.R.; major factor affecting LUCA’s genome integrity. Cosmic radiation due to Earth’s weak magnetic field Matkarimov, B.T.; Ishchenko, A.A.; and alkylating metabolic radicals added to these threats.
    [Show full text]
  • Mechanism and Regulation of DNA Damage Recognition in Nucleotide Excision Repair
    Kusakabe et al. Genes and Environment (2019) 41:2 https://doi.org/10.1186/s41021-019-0119-6 REVIEW Open Access Mechanism and regulation of DNA damage recognition in nucleotide excision repair Masayuki Kusakabe1, Yuki Onishi1,2, Haruto Tada1,2, Fumika Kurihara1,2, Kanako Kusao1,3, Mari Furukawa1, Shigenori Iwai4, Masayuki Yokoi1,2,3, Wataru Sakai1,2,3 and Kaoru Sugasawa1,2,3* Abstract Nucleotide excision repair (NER) is a versatile DNA repair pathway, which can remove an extremely broad range of base lesions from the genome. In mammalian global genomic NER, the XPC protein complex initiates the repair reaction by recognizing sites of DNA damage, and this depends on detection of disrupted/destabilized base pairs within the DNA duplex. A model has been proposed that XPC first interacts with unpaired bases and then the XPD ATPase/helicase in concert with XPA verifies the presence of a relevant lesion by scanning a DNA strand in 5′-3′ direction. Such multi-step strategy for damage recognition would contribute to achieve both versatility and accuracy of the NER system at substantially high levels. In addition, recognition of ultraviolet light (UV)-induced DNA photolesions is facilitated by the UV-damaged DNA-binding protein complex (UV-DDB), which not only promotes recruitment of XPC to the damage sites, but also may contribute to remodeling of chromatin structures such that the DNA lesions gain access to XPC and the following repair proteins. Even in the absence of UV-DDB, however, certain types of histone modifications and/or chromatin remodeling could occur, which eventually enable XPC to find sites with DNA lesions.
    [Show full text]
  • Role of Apurinic/Apyrimidinic Nucleases in the Regulation of Homologous Recombination in Myeloma: Mechanisms and Translational S
    Kumar et al. Blood Cancer Journal (2018) 8:92 DOI 10.1038/s41408-018-0129-9 Blood Cancer Journal ARTICLE Open Access Role of apurinic/apyrimidinic nucleases in the regulation of homologous recombination in myeloma: mechanisms and translational significance Subodh Kumar1,2, Srikanth Talluri1,2, Jagannath Pal1,2,3,XiaoliYuan1,2, Renquan Lu1,2,PuruNanjappa1,2, Mehmet K. Samur1,4,NikhilC.Munshi1,2,4 and Masood A. Shammas1,2 Abstract We have previously reported that homologous recombination (HR) is dysregulated in multiple myeloma (MM) and contributes to genomic instability and development of drug resistance. We now demonstrate that base excision repair (BER) associated apurinic/apyrimidinic (AP) nucleases (APEX1 and APEX2) contribute to regulation of HR in MM cells. Transgenic as well as chemical inhibition of APEX1 and/or APEX2 inhibits HR activity in MM cells, whereas the overexpression of either nuclease in normal human cells, increases HR activity. Regulation of HR by AP nucleases could be attributed, at least in part, to their ability to regulate recombinase (RAD51) expression. We also show that both nucleases interact with major HR regulators and that APEX1 is involved in P73-mediated regulation of RAD51 expression in MM cells. Consistent with the role in HR, we also show that AP-knockdown or treatment with inhibitor of AP nuclease activity increases sensitivity of MM cells to melphalan and PARP inhibitor. Importantly, although inhibition 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; of AP nuclease activity increases cytotoxicity, it reduces genomic instability caused by melphalan. In summary, we show that APEX1 and APEX2, major BER proteins, also contribute to regulation of HR in MM.
    [Show full text]
  • DNA Repair with Its Consequences (E.G
    Cell Science at a Glance 515 DNA repair with its consequences (e.g. tolerance and pathways each require a number of apoptosis) as well as direct correction of proteins. By contrast, O-alkylated bases, Oliver Fleck* and Olaf Nielsen* the damage by DNA repair mechanisms, such as O6-methylguanine can be Department of Genetics, Institute of Molecular which may require activation of repaired by the action of a single protein, Biology, University of Copenhagen, Øster checkpoint pathways. There are various O6-methylguanine-DNA Farimagsgade 2A, DK-1353 Copenhagen K, Denmark forms of DNA damage, such as base methyltransferase (MGMT). MGMT *Authors for correspondence (e-mail: modifications, strand breaks, crosslinks removes the alkyl group in a suicide fl[email protected]; [email protected]) and mismatches. There are also reaction by transfer to one of its cysteine numerous DNA repair pathways. Each residues. Photolyases are able to split Journal of Cell Science 117, 515-517 repair pathway is directed to specific Published by The Company of Biologists 2004 covalent bonds of pyrimidine dimers doi:10.1242/jcs.00952 types of damage, and a given type of produced by UV radiation. They bind to damage can be targeted by several a UV lesion in a light-independent Organisms are permanently exposed to pathways. Major DNA repair pathways process, but require light (350-450 nm) endogenous and exogenous agents that are mismatch repair (MMR), nucleotide as an energy source for repair. Another damage DNA. If not repaired, such excision repair (NER), base excision NER-independent pathway that can damage can result in mutations, diseases repair (BER), homologous recombi- remove UV-induced damage, UVER, is and cell death.
    [Show full text]
  • DNA Replication, Repair and Recombination
    DNA replication, repair and recombination Asst. Prof. Dr. Altijana Hromic-Jahjefendic SS2020 DNA Genetic material Eukaryotes: in nucleus Prokaryotes: as plasmid Mitosis Division and duplication of somatic cells Production of two identical daughter cells from a single parent cell 4 stages: Prophase: The chromatin condenses into chromosomes. Each chromosome has duplicated to tow sister chromatids. The nuclear envelope breaks down. Metaphase: The chromosomes align at the equatorial plate and are held by microtubules attached to the mitotic spindle and to part of the centromere Anaphase: Centromeres divide and sister chromatids separate and move to corresponding poles Telophase: Daughter chromosomes arrive at the poles and the microtubules disappear. The nuclear envelope reappears DNA replication & recombination Reproduction (Replication) of a DNA-double helix - semiconservative fashion demonstrated by Meselson & Stahl by using 15N-labeled ammonium chloride in the growth medium heavy nitrogen label was incorporated in the DNA of the bacteria shifted to normal 14N-medium giving rise to density band between the “heavy” and the “light” band in the 1st generation In the 2nd generation, in addition to the hybrid band a light band appears which contains only 14N- DNA Synthesis of a new DNA strand nucleoside triphosphates are selected ability to form Watson-Crick base pairs to the corresponding position in the template strand DNA replication occurs at replication forks For replication - two parental DNA-strands must separate from
    [Show full text]
  • Distribution of DNA Repair-Related Ests in Sugarcane
    Genetics and Molecular Biology, 24 (1-4), 141-146 (2001) Distribution of DNA repair-related ESTs in sugarcane W.C. Lima, R. Medina-Silva, R.S. Galhardo and C.F.M. Menck* Abstract DNA repair pathways are necessary to maintain the proper genomic stability and ensure the survival of the organism, protecting it against the damaging effects of endogenous and exogenous agents. In this work, we made an analysis of the expression patterns of DNA repair-related genes in sugarcane, by determining the EST (expressed sequence tags) distribution in the different cDNA libraries of the SUCEST transcriptome project. Three different pathways - photoreactivation, base excision repair and nucleotide excision repair - were investigated by employing known DNA repair proteins as probes to identify homologous ESTs in sugarcane, by means of computer similarity search. The results showed that DNA repair genes may have differential expressions in tissues, depending on the pathway studied. These in silico data provide important clues on the potential variation of gene expression, to be confirmed by direct biochemical analysis. INTRODUCTION (The Arabidopsis Genome Initiative, 2000), have provided huge amounts of data that still need to be processed, in or- The genome of all living beings is constantly subject der to enable us to understand the physiological mecha- to damage generated by exogenous and endogenous fac- nisms of these organisms. This is the case of the DNA tors, reducing DNA stability and leading to an increase of repair pathways. Although repair and damage tolerance mutagenesis, cancer, cell death, senescence and other dele- mechanisms have been well described in bacteria, yeast, terious effects to organisms (de Laat et al., 1999).
    [Show full text]
  • Redox Regulation of DNA Repair: Implications for Human Health and Cancer Therapeutic Development
    ANTIOXIDANTS & REDOX SIGNALING Volume 12, Number 11, 2010 C OMPREHENSIVE INVITED REVIEW © Mary Ann Liebert, Inc. DOI: 10.1089/ ars.2009.2698 Redox Regulation of DNA Repair: Implications for Human Health and Cancer Therapeutic Development 2 2 Meihua Luo~ Hongzhen He, Mark R. Ke l ley ~ -3 and Millie M. Georgiadis .4 Abstract Red.ox reactions are known to regulate many important cellular processes. In this revievv, v.re focus on the role of redox regulation in DNA repair both in direct regulation of specific DNA repair proteins as well as indirect transcriptional regulation. A key player in the redox regulation of DNA repair is the base excision repair enzyme apurinic/apyrimidinic endonuclease 1 (APEl) in its role as a redox factor. APEl is reduced by the general redox factor thioredoxin, and in turn reduces several important transcription factors that regulate expression of DNA repair proteins. Finally, we consider the potential for chemotherapeutic development through the modulation of APEl's redox activity and its impact on DNA repair. Antioxid. Redox Signal. 12, 1247-1269. l. Introduction 1248 II. DNA-Repair Pathways 1248 A. Mammalian d irect repair: 0 6-alkylguanine-DNA methyltransferase or 0 6-methylguanine-DNA methyltransferase 1249 B. Base-excision repair 1249 C. Nucleotide-excision repair 1249 D. Mismatch repair 1250 E. Nonhomologous DNA end-joining and homologous recombiJ.1ation 1250 ITT. General Redox Systems 1251 A. The thioredoxin system 1251 B. The glutaredoxin/glutathione system 1252 C. l~oles of general redox systems 1252 N. The Redox Activity of APEl 1252 A. Evolution of the redox function of APEl 1252 B.
    [Show full text]
  • DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces Cerevisiae
    YEASTBOOK GENOME ORGANIZATION & INTEGRITY DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae Serge Boiteux* and Sue Jinks-Robertson†,1 *Centre National de la Recherche Scientifique UPR4301 Centre de Biophysique Moléculaire, 45071 Orléans cedex 02, France, and yDepartment of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina 27710 ABSTRACT DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mech- anisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion.
    [Show full text]
  • Architecture of the Human XPC DNA Repair and Stem Cell Coactivator Complex
    Architecture of the human XPC DNA repair and stem cell coactivator complex Elisa T. Zhanga,b,c, Yuan Hed,1, Patricia Groba,b, Yick W. Fonga,b,2, Eva Nogalesa,b,d, and Robert Tjiana,b,c,e,3 aDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; bHoward Hughes Medical Institute, Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720; cLi Ka Shing Center for Biomedical and Health Sciences, CIRM Center of Excellence, University of California Berkeley, CA 94720; dLife Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94710; and eHoward Hughes Medical Institute, Chevy Chase, MD 20815-6789 Contributed by Robert Tjian, October 16, 2015 (sent for review August 20, 2015; reviewed by Montserrat Samso and Ning Zheng) The Xeroderma pigmentosum complementation group C (XPC) involved in base excision repair (BER). BER is responsible for complex is a versatile factor involved in both nucleotide excision removing primarily non-helix-distorting lesions from the ge- repair and transcriptional coactivation as a critical component of nome (2). In BER, the XPC complex helps repair oxidative the NANOG, OCT4, and SOX2 pluripotency gene regulatory net- damage by stimulating the activities of DNA glycosylases such work. Here we present the structure of the human holo-XPC com- as OGG1 and TDG (3) to target lesions including 8-oxoguanine, plex determined by single-particle electron microscopy to reveal a independently of other downstream GG-NER factors (17). flexible, ear-shaped structure that undergoes localized loss of order More recently, the XPC complex has also been found to upon DNA binding.
    [Show full text]
  • The Dark Side of UV-Induced DNA Lesion Repair
    G C A T T A C G G C A T genes Review The Dark Side of UV-Induced DNA Lesion Repair Wojciech Strzałka 1, Piotr Zgłobicki 1, Ewa Kowalska 1, Aneta Ba˙zant 1, Dariusz Dziga 2 and Agnieszka Katarzyna Bana´s 1,* 1 Department of Plant Biotechnology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland; [email protected] (W.S.); [email protected] (P.Z.); [email protected] (E.K.); [email protected] (A.B.) 2 Department of Microbiology, Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, Gronostajowa 7, 30-387 Krakow, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-12-664-6410 Received: 27 October 2020; Accepted: 29 November 2020; Published: 2 December 2020 Abstract: In their life cycle, plants are exposed to various unfavorable environmental factors including ultraviolet (UV) radiation emitted by the Sun. UV-A and UV-B, which are partially absorbed by the ozone layer, reach the surface of the Earth causing harmful effects among the others on plant genetic material. The energy of UV light is sufficient to induce mutations in DNA. Some examples of DNA damage induced by UV are pyrimidine dimers, oxidized nucleotides as well as single and double-strand breaks. When exposed to light, plants can repair major UV-induced DNA lesions, i.e., pyrimidine dimers using photoreactivation. However, this highly efficient light-dependent DNA repair system is ineffective in dim light or at night. Moreover, it is helpless when it comes to the repair of DNA lesions other than pyrimidine dimers.
    [Show full text]
  • The Thymine Glycosylase MBD4 Can Bind to the Product of Deamination at Methylated Cpg Sites DNA-Bound Structures and Mutants
    letters to nature 13. Fuentes-Prior, P. et al. Structure of the thrombin complex with triabin, a lipocalin-like exosite-binding inhibits activation by the thrombomodulin-thrombin complex without affecting activation by free inhibitor derived from a triatomine bug. Proc. Natl Acad. Sci. USA 94, 11845±11850 (1997). thrombin. J. Biol. Chem. 271, 22285±22288 (1996). 14. Zushi, M. et al. Aspartic acid 349 in the fourth epidermal growth factor-like structure of human 28. Vincenot, A., Gaussem, P., Pittet, J. L., Debost, S. & Aiach, M. Amino acids 225-235** of the protein C thrombomodulin plays a role in its Ca2+-mediated binding to protein C. J. Biol. Chem. 266, 19886± serine-protease domain are important for the interaction with the thrombin-thrombomodulin 19889 (1991). complex. FEBS Lett. 367, 153±157 (1995). 15. Campbell, I. D. & Bork, P. Epidermal growth factor-like modules. Curr. Opin. Struct. Biol. 3, 385±392 29. Parry, M. A. et al. The ternary microplasmin-staphylokinase-microplasmin complex is a proteinase- (1993). cofactor-substrate complex in action. Nature Struct. Biol. 5, 917±923 (1998). 16. Downing, A. K. et al. Solution structure of a pair of calcium-binding epidermal growth factor-like 30. Leslie, A. in Crystal. Computing V (eds Moras, D., Podjarny, A. D. & Thierry, J. C.) 27±38 (Oxford domains: implications for the Marfan syndrome and other genetic disorders. Cell 85, 597±605 Univ. Press, Oxford, 1991). (1996). 31. Collaborative Computational Project No. 4. The CCP4 suite: programs for protein crystallography. 17. Knobe, K. E. et al. Probing the activation of protein C by the thrombin-thrombomodulin complex Acta Crystallogr.
    [Show full text]
  • Unraveling the Molecular Mechanisms of DNA Helicases Associated with Human Disease and Aging
    So Much to Do, So Little Time… Unraveling the Molecular Mechanisms of DNA Helicases Associated with Human Disease and Aging Robert M. Brosh Jr. Section on DNA Helicases Laboratory of Molecular Gerontology National Institute on Aging, NIH DNA DAMAGE AND REPAIR Intrinsic: Chemical agents: Radiations: Spontaneous base Endogenous Exogenous Ultraviolet Ionizing modification, (oxygen (chemical radiation radiation Replication errors radicals) mutagens) Gox U AP Site BASE EXCISION NUCLEOTIDE RECOMBINATIONAL REPLICATION REPAIR EXCISION REPAIR FORK REPAIR RESTORATION Genomic instability Cell survival Mutation Cell death Chromosomal aberrations Disease Aging Cancer LABORATORY OF MOLECULAR GERONTOLOGY Section on DNA Section on Base Helicases Excision Repair Section on DNA Repair Section on Antibody Diversity Unit on Telomeres Section on Gene Targeting NIH Biomedical Research Center Question: Why are there unique clinical and cellular phenotypes in the RecQ helicase disorders? HELICASE RQC HRDC RECQ1, H. sapiens 649 aa BLM, H. sapiens 1417aa EXO WRN, H. sapiens 1432 aa RECQ4, H. sapiens 1208 aa RECQ5, H. sapiens 991 aa Objective: To delineate and characterize unique roles of RecQ helicases in genomic stability maintenance Today: 1. RECQ1 cellular phenotypes 2. Model system to study WRN genetics 3. Novel functions of FANCJ helicase Roles for RecQ Helicases in DNA Metabolism “Damage” encountered during replication of the genome 1. Road Block Remover Resolution of Tetraplex - Resolve alternate DNA Secondary structures for proper Structure Resolution replication
    [Show full text]