RADAR-seq: Utilizing PacBio SMRT Sequencing to Detect and Quantitate DNA Damage on a Genome-Wide Scale Kelly M. Zatopek Research Scientist New England Biolabs Ipswich, MA Archaeal DNA Replication and DNA Repair Leading Strand 3’ 5’ PCNA polD GAN RFC clamp loader MCM helicase Lagging Strand GINS 5’ 3’ DNA primase Okazaki fragment maturation Fen1 polB gap RPA DNA ligase Performed in Thermococcus kodakarensis (Tko) Archaeal DNA Replication and DNA Repair Leading Strand 3’ 5’ PCNA DNA Glycosylase polD AP polB GAN Endonuclease Fen1 RFC clamp loader MCM helicase DNA ligase Lagging Strand GINS 5’ 3’ DNA primase Okazaki fragment maturation Fen1 polB gap RPA DNA ligase Performed in Thermococcus kodakarensis (Tko) Archaeal DNA Replication and DNA Repair Leading Strand 3’ 5’ PCNA Experimental Techniques DNA Glycosylase polD AP polB GAN Endonuclease Fen1 RFC clamp loader 1. Protein Expression & MCM helicase Purification DNA ligase Lagging Strand GINSGOAL 5’ 2. Enzyme Kinetics 3’ Utilize next generation sequencingDNA primase to understand3. CE Assay Okazaki fragment maturation DNA replication and repair in Tko4. Gel Filtration Fen1 5. Site Directed Mutagenesis polB gap 6. Genetics RPA DNA ligase 7. NGS Performed in Thermococcus kodakarensis (Tko) Next Generation Sequencing PacBio Single Molecule Real-Time SMRT-Cell PacBio Genomic DNA Library Prep Sequencing Wells Instruments Isolate genomic DNA RSII 150,000 wells Sequel Sheer into 100 bp – 20 kb fragments 1,000,000 wells Ligation of SMRT-bell adapters Sequel II 8,000,000 wells Bind primer and polymerase doi:10.1126/science.1079700 Next Generation Sequencing PacBio Single Molecule Real-Time SMRT-Cell Detection of Non-Canonical Bases Sequencing Wells SMRT-seq can detect presence of certain modified nucleotides, by slower polymerase translocation (IPD) 6mA & 4mC Two Major Hurdles 1. Detection of a wide variety of DNA modifications C T TGG T A CG AG T T A C CG AT C GG TGG T A C GGC T TG G T G A ACC A T G CTC A AT G GC T AG CC ACC A T G CCGA AC C A 2. Stochastic DNA modification detection IPD Ratio Experimental IPD IPD Ratio = Expected IPD doi:10.1126/science.1079700 doi:10.1186/2041-9414-2-10 RADAR-seq RAre Damage and Repair - Seq × DNA damage site nick site Patch of high IPDs produced by RADAR-seq Isolation of genomic DNA × × × patch (38 nt) × 10 PacBio library preparation 8 6 top × 4 strand IPD ratio 2 SMRTbell Repair SMRTbell 0 adapter adapter C T GG C GGG C A T T G C C A G A A A C C T T G C C A T C T C A G A C A GG T A T A G A G A C G C T T A T C T enzyme(s) 551,600 — | | | | | | — 551,650 G A C C G C C C G T A A C GG T C T T T GG A A C GG T A G A G T C T G T C C A T A T C T C T G C G A A T A G A × 0 2 Bst FL DNA polymerase 4 bottom dTTP, dGTP d6mATP, d4mCTP 6 RADAR-seq strand IPD ratio 8 single-molecule patch detection 10 Taq ligase NAD+ Identifying a patch of high IPDs at single-molecule level provides us with confidence that we are PacBio correctly calling a DNA damage site SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Detectable DNA Lesions × DNA damage site nick site Detectable DNA Lesions Isolation of genomic DNA × × × × PacBio DNA Lesions Repair Enzyme library preparation alkylated purines Alkyl Adenine DNA Glycosylase1 × TwoAP Major site Hurdles Endonuclease IV2 1,2 SMRTbell Repair SMRTbell CPD T4 Pyrimidine DNA Glycosylase adapter adapter 1.enzyme(s)Detection of a widedamaged variety pyrimidines of DNA Endonuclease modifications VIII1,2 ✔ × deoxyinosine Endonuclease V 1,2 Bst FL DNA polymerase2. Stochastic DNAdeoxyuridine modification Uracil detection DNA Glycosylase dTTP, dGTP 1 d6mATP, d4mCTP oxidized pyrimidines NEIL1 oxidized purines (8oxoG) Fpg DNA Glycosylase1,2 Taq ligase rN embedded in DNA RNaseH2 NAD+ T:G mismatch Thymine DNA Glycosylase1 1. Must be used in conjunction with Endonuclease IV for nick translation 2. Component of PreCR PacBio SMRT sequencing RADAR-seq patch detection doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Stochastic Modification Detection × DNA damage site nick site Non-stochastic Versus Stochastic Isolation of genomic DNA Base Detection × × × × PacBio library preparation × ● SMRTbell Repair SMRTbell ● adapter adapter enzyme(s) ● ● × ● Bst FL DNA polymerase 6mA dTTP, dGTP 0 2,000,000 d6mATP, d4mCTP 1.7 1.9 1.0 7.0 1.5 Average IPD Ratio at each Genomic Position Taq ligase NAD+ PacBio SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Stochastic Modification Detection × DNA damage site nick site Non-stochastic Versus Stochastic Isolation of genomic DNA Base Detection × × × × PacBio library preparation × vi v iv ● SMRTbell Repair SMRTbell ● adapter adapter enzyme(s) iii ● ii ● × i ● Bst FL DNA polymerase 6mA dTTP, dGTP 0 d6mATP, d4mCTP 2,000,000 Average IPD Ratio at each Genomic Position Taq ligase NAD+ PacBio SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Stochastic Modification Detection × DNA damage site nick site Non-stochastic Versus Stochastic Isolation of genomic DNA Base Detection × × × × PacBio library preparation × SMRTbell Repair SMRTbell adapter adapter Two Major Hurdles enzyme(s) ×1. Detection of a widei variety of DNA modifications● ✔ Bst FL DNA polymerase 6mA dTTP, dGTP 0 2,000,000 d6mATP, d4mCTP2. Stochastic DNA 7.0modification1.0 detection7.0 ✔ IPD Ratio at each Genomic Position in every DNA fragment Taq ligase NAD+ PacBio SMRT sequencing RADAR-seq patch detection Analysis by Vladimir Potapov doi: 10.1016/j.dnarep.2019.06.007 Method Validation Site-Specific Nicking Enzyme Genome-wide Tko & A’s and C’s at Nb.BsrDI sites E. coli 2000 0 100 1900 7 PacBio 200 library preparation 6 A atio 1800 r 5 GGCATTGCCAGAAACCTTGC 300 CCGTAACGGTCTTTGGAACG 4 SMRTbell SMRTbell 3 adapter Nb.BsrDI adapter 1700 400 2 GGCATTGCCAGAAACCTTGC Mean IPD 1 CCGTAACGGTCTTTGGAACG 0 1600 WT Tko −100 0 100 200 300 400 500 Bst FL DNA polymerase 500 mdNTPs treated with Relative Position GGCATTGCCAGAACCTTGCC CCGTAACGGTCTTTGGAACG 1500 Nb.BsrDI 600 4 Taq ligase atio r 3 NAD+ C 1400 700 GGCATTGCCAGAACCTTGCC 2 CCGTAACGGTCTTTGGAACG 800 PacBio 1300 1 SMRT sequencing 900 Mean IPD RADAR-seq algorithm optimization 1200 1000 0 1100 −100 0 100 200 300 400 500 Relative Position doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq RAre Damage and Repair - Seq Workflow Detectable DNA Lesions × DNA damage site nick site Isolation of genomic DNA DNA Lesions Repair Enzyme × × × 1 × alkylated purines Alkyl Adenine DNA Glycosylase 2 PacBio AP site Endonuclease IV library preparation CPD T4 Pyrimidine DNA Glycosylase1,2 × damaged pyrimidines Endonuclease VIII1,2 SMRTbell Repair SMRTbell adapter adapter enzyme(s) deoxyinosine Endonuclease V × deoxyuridine Uracil DNA Glycosylase1,2 1 Bst FL DNA polymerase oxidized pyrimidines NEIL1 dTTP, dGTP 1,2 d6mATP, d4mCTP oxidized purines (8oxoG) Fpg DNA Glycosylase rN embedded in DNA RNaseH2 1 Taq ligase T:G mismatch Thymine DNA Glycosylase NAD+ 1. Must be used in conjunction with Endonuclease IV for nick translation 2. Component of PreCR PacBio SMRT sequencing RADAR-seq patch detection doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Ribonucleotide Detection RNaseH2 Workflow Results Tko E.coli 500 25 rN Ribonucleotide nick site 400 20 rN 300 15 SMRTbell SMRTbell RNaseH2 200 10 adapter adapter rN 100 5 Ribonucleotides (per million bases) Ribonucleotides (per million bases) 0 0 Bst FL DNA polymerase WT∆RNaseH2 WT∆RNaseH2 m dNTPs 50-fold 6.5-fold 2000 2000 0 0 100 1900 100 1900 200 200 1800 1800 300 Taq ligase 300 1700 NAD+ 1700 400 400 WT 1600 1600 DRnaseH2 500 500 1500 Tko 600 1500 Tko 600 PacBio 700 1400 1400 700 SMRT sequencing 800 800 1300 1300 900 900 1200 1000 1200 1000 RADAR-seq patch detection 1100 1100 doi: 10.1016/j.dnarep.2019.06.007 RADAR-seq Utilization RADAR-seq enables detection of a wide variety of stochastic DNA modifications on a genome-wide scale 4400 0 200 4200 400 400 0 0 Current RADAR-seq Projects 60 3800 1. Track lagging strand DNA polymerase synthesis 800 3600 2. Understand DNA deamination formation and repair in Tko 1000 E. coli 3400 PolI I709A/ΔRNaseH2 3. Look for off-target nicking activity of Cas12a 1200 4. Determine formation of DNA secondary structure 3200 1400 1600 5. Determine DNA damaging affects of DNA in space 3000 1800 2800 2000 2200 2600 2400 RADAR-seq Version 2.0 Room for Improvement 1. Single-base resolution : Modified T & G 2. Detecting closely spaced lesions 3. RADAR-seq on large genomes RADAR-seq Version 2.0 Modified A’s & C’s Modified T’s & G’s 2-thio-TTP N2-methyl-dGTP 7 7 6 6 5 5 7 4 4 6 3 3 atio r 2 6mA 2 Mean IPD ratio 5 Mean IPD ratio 1 4 1 0 0 3 0 100 0 100 2 Relative Position Relative Position Mean IPD 1 0 −100 0 100 200 300 400 500 Relative Position 5-aminoallyl-dUTP 6-thio-dGTP 4 7 7 atio r 3 6 4mC 6 5 5 2 4 4 3 3 1 2 Mean IPD ratio 2 Mean IPD ratio Mean IPD 1 1 0 0 −100 0 100 200 300 400 500 0 100 0 0 100 Relative Position Relative Position Relative Position RADAR-seq: Utilizing PacBio SMRT Sequencing to Detect and Quantitate DNA Damage on a Genome-Wide Scale NEB RADAR-Seq NEB PacBio Group Vladimir Potapov Alexey Fomenkov Andrew F.