DOCSLIB.ORG

Identification of a Novel Cancer-Germline Transcript Within the Mirna Harboring GABRA3 Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of a Novel Cancer-Germline Transcript Within the Mirna Harboring GABRA3 Gene Identification of a novel cancer-germline transcript within the miRNA harboring GABRA3 gene. Epigenetic alterations of the locus in tumors. Aurélie VAN TONGELEN Mai 2017 Thèse présentée en vue de l’obtention du grade de docteur en sciences biomédicales et pharmaceutiques Secteur des sciences de la santé President of the jury Professor Frederic Lemaigre de Duve institute Université catholique de Louvain Jury members Doctor Paola Arimodo ETaC – Unité de pharmacochimie de la régulation épigénétique du cancer CNRS - Laboratoires Pierre Fabre Centre de recherche & développement Doctor Philippe Arnaud GReD – Génétique Reproduction et Développement CNRS - Clermont Université – INSERM Professor Anabelle Decottignies de Duve institute Université catholique de Louvain Professor Patrick Jacquemin de Duve institute Université catholique de Louvain Professor Guido Bommer de Duve institute Université catholique de Louvain Doctor Axelle Loriot de Duve institute Université catholique de Louvain Promoter Professor Charles De Smet de Duve institute Université catholique de Louvain This thesis was supported by PhD fellowship from F.R.S – FNRS Télévie and UCL – FSR Après avoir passé presque six années dans le laboratoire de Charles De Smet, j’en sors grandie d’expérience, d’ouverture d’esprit, de connaissance, d’organisation et d’indépendance. Mais ces six années n’ont pas seulement été faites de sciences, c’est aussi une grande expérience de vie. Je remercie toutes les personnes qui m’ont permis d’arriver où je suis aujourd’hui. Je tiens tout d’abord et tout particulièrement à remercier le professeur Charles De Smet, sans qui cette thèse n’aurait pu voir le jour. En tant que promoteur de thèse, il m’a constamment guidée dans mes recherches et m’a sans cesse aidée à trouver des solutions pour avancer. J’ai énormément de gratitude à son égard pour tous ses efforts à garantir la continuité et l’aboutissement de ma thèse. Je le remercie pour tout ce temps et toute sa patience qu’il m’a consacré pour garantir la qualité de mon travail. Plusieurs pages auraient été nécessaires pour lister tout ce qu’il a fait pour que j’atteigne mon objectif. Malgré son désordre inégalable, Axelle Loriot m’a apporté un enseignement pratique de grande qualité et très riche en trucs et astuces. Je la remercie pour sa générosité extraordinaire et son efficacité à toute épreuve. Je la remercie également pour tous ces moments privilégiés que nous avons partagés, pour toutes ces discussion très matinales, pour nos weekends relais qPCR durant la période de Noel, pour tous ces breaks « mentos » qui suivaient les expériences fructueuses (une chance qu’on a eu beaucoup) et pour son énergie phénoménale qui fait vivre le laboratoire. Je remercie Florian Poulain, mon compagnon qui m’a encouragée et soutenue tout au long de ma thèse. Je le remercie très fortement pour son aide précieuse apportée lors des nuits blanches passées à la rédaction de ce manuscrit. Je le remercie également pour son écoute attentive, son réconfort et ses idées pertinentes. Sans lui, je ne serais pas là aujourd’hui. Je remercie Julie Cannuyer pour sa gentillesse, pour notre complicité tissée durant près de cinq années et pour sa disciplinee olympienne. Je souhaite remercier Jean Fain pour sa fabuleuse motivation qui m’a donné l’énergie d’approfondir mon dernier sujet de thèse. Sa présence a permis de rendre les journées plus atypiques et plus cocasses. Rien de tel que de subtiles petites blagues pour égailler les journées. Je remercie Anna Diacofotakis, pour sa profonde gentillesse et toute sa sincérité. Je la remercie également pour son aide à la relecture et à la correction de ce manuscrit, pour ses délicieux gâteaux agrémentés de « cocoa » et pour le petit grain de Grèce qu’elle a apporté au laboratoire. Enfin, je souhaite remercier ma famille et mes parents pour leur soutien et leur amour constant. Ce sont eux qui m’ont encouragée et permis d’entreprendre mes études et cette fabuleuse aventure qu’aura été le doctorat. « Je dédie cette thèse à mon compagnon ainsi qu’à mes parents » TABLE OF CONTENTS INTRODUCTION ............................................................................................................................. 13 DNA IS NOT DESTINY: THE NEW SCIENCE OF EPIGENETICS ......................................................................... 15 DNA METHYLATION: A FORM OF EPIGENETIC CONTROL OF GENE EXPRESSION .......................................... 16 1 Genomic distribution of modified cytosines ...................................................................................... 16 2 DNA METHYLATION : A trAnscriptionAl regulAtion mechAnism .......................................................... 17 3 GlobAl DNA methylAtion level is dynAmic during the mAmmAliAn life cycle ...................................... 22 4 Histone mArks AssociAted with DNA methylAtion .............................................................................. 23 5 RegulAtion of DNA methylAtion ......................................................................................................... 27 5.1 Writing DNA methylation ....................................................................................................................................... 27 5.2 Erasing DNA methylation ....................................................................................................................................... 32 ROLE OF DNA METHYLATION IN CANCER ................................................................................................... 38 6 Local DNA hypermethylation ............................................................................................................. 39 7 GlobAl DNA hypomethylAtion ............................................................................................................. 40 8 Oncogenic roles of DNA hypomethylAtion through the activAtion of cAncer-germline genes (Review Article; CAncer letters; 2017) ........................................................................................................... 43 8.1 Introduction45 8.2 Insight into the definition of cAncer-germline genes ............................................................................................. 46 8.3 A significant subset of CG genes are regulated by DNA methylation .................................................................... 47 8.4 Methylation-dependent CG genes Are involved in multiple cAncer pathwAys ...................................................... 49 8.5 CONCLUSION58 8.6 REFERENCES61 OBJECTIVES ................................................................................................................................... 67 CHAPTER I ...................................................................................................................................... 71 A novel cancer-germline transcript carrying pro-metastatic miR-105 and TET-targeting miR-767 induced by DNA hypomethylation in tumors (Research article; Epigenetics; 2014) .......................................................................................................... 73 1 Introduction ....................................................................................................................................... 75 2 Results ................................................................................................................................................ 76 2.1 Aberrant activation of GABRA3 and hosted miR-105 and miR-767 in tumors ....................................................... 76 2.2 Tumors express a cancer-testis variant of GABRA3: CT-GABRA3 ........................................................................... 77 2.3 CT-GABRA3 ActivAtion in tumors is dependent on DNA demethylAtion ................................................................ 78 2.4 TET1 and TET3 are targets of miR-767 ................................................................................................................... 79 3 Discussion ........................................................................................................................................... 84 4 MateriAl And methods ........................................................................................................................ 87 5 References .......................................................................................................................................... 94 6 Supplemental datA ............................................................................................................................. 97 CHAPTER II ................................................................................................................................... 103 Potential mechanistic link between DNA hypomethylation and hypermethylation of alternative GABRA3 promoters in tumors ................................................................................................................................. 105 1 Introduction ..................................................................................................................................... 106 2 Results .............................................................................................................................................. 107 2.1 CT-GABRA3 is ActivAted in tumors ....................................................................................................................... 107 2.2 CT-GABRA3 promoter hypomethylAtion correlAtes with BT-GABRA3
Load more

Recommended publications
  • Biochemical Characterization of DDX43 (HAGE) Helicase
    Biochemical Characterization of DDX43 (HAGE) Helicase A Thesis Submitted to the College of Graduate Studies and Research In Fulfillment of the Requirements For the Degree of Master of Science In the Department of Biochemistry University of Saskatchewan Saskatoon By Tanu Talwar © Copyright Tanu Talwar, March, 2017. All rights reserved PERMISSION OF USE STATEMENT I hereby present this thesis in partial fulfilment of the requirements for a postgraduate degree from the University of Saskatchewan and agree that the Libraries of this University may make it freely available for inspection. I further agree that permission for copying of this thesis in any manner, either in whole or in part, for scholarly purposes may be granted by the professor or professors who supervised this thesis or, in their absence, by the Head of the Department or the Dean of the College in which my thesis work was done. It is understood that any copying or publication or use of this thesis or parts of it for any financial gain will not be allowed without my written permission. It is also understood that due recognition shall be given to me and to the University of Saskatchewan in any scholarly use which may be made of any material in my thesis. Requests for permission to copy or to make other use of material in this thesis in whole or part should be addressed to: Head of the Department of Biochemistry University of Saskatchewan 107 Wiggins Road Saskatoon, Saskatchewan, Canada S7N 5E5 i ABSTRACT DDX43, DEAD-box polypeptide 43, also known as HAGE (helicase antigen gene), is a member of the DEAD-box family of RNA helicases.
    [Show full text]
  • Network Assessment of Demethylation Treatment in Melanoma: Differential Transcriptome-Methylome and Antigen Profile Signatures
    RESEARCH ARTICLE Network assessment of demethylation treatment in melanoma: Differential transcriptome-methylome and antigen profile signatures Zhijie Jiang1☯, Caterina Cinti2☯, Monia Taranta2, Elisabetta Mattioli3,4, Elisa Schena3,5, Sakshi Singh2, Rimpi Khurana1, Giovanna Lattanzi3,4, Nicholas F. Tsinoremas1,6, 1 Enrico CapobiancoID * a1111111111 1 Center for Computational Science, University of Miami, Miami, FL, United States of America, 2 Institute of Clinical Physiology, CNR, Siena, Italy, 3 CNR Institute of Molecular Genetics, Bologna, Italy, 4 IRCCS Rizzoli a1111111111 Orthopedic Institute, Bologna, Italy, 5 Endocrinology Unit, Department of Medical & Surgical Sciences, Alma a1111111111 Mater Studiorum University of Bologna, S Orsola-Malpighi Hospital, Bologna, Italy, 6 Department of a1111111111 Medicine, University of Miami, Miami, FL, United States of America a1111111111 ☯ These authors contributed equally to this work. * [email protected] OPEN ACCESS Abstract Citation: Jiang Z, Cinti C, Taranta M, Mattioli E, Schena E, Singh S, et al. (2018) Network assessment of demethylation treatment in Background melanoma: Differential transcriptome-methylome and antigen profile signatures. PLoS ONE 13(11): In melanoma, like in other cancers, both genetic alterations and epigenetic underlie the met- e0206686. https://doi.org/10.1371/journal. astatic process. These effects are usually measured by changes in both methylome and pone.0206686 transcriptome profiles, whose cross-correlation remains uncertain. We aimed to assess at Editor: Roger Chammas, Universidade de Sao systems scale the significance of epigenetic treatment in melanoma cells with different met- Paulo, BRAZIL astatic potential. Received: June 20, 2018 Accepted: October 17, 2018 Methods and findings Published: November 28, 2018 Treatment by DAC demethylation with 5-Aza-2'-deoxycytidine of two melanoma cell lines Copyright: © 2018 Jiang et al.
    [Show full text]
  • Environmental and Genetic Factors in Autism Spectrum Disorders: Special Emphasis on Data from Arabian Studies
    International Journal of Environmental Research and Public Health Review Environmental and Genetic Factors in Autism Spectrum Disorders: Special Emphasis on Data from Arabian Studies Noor B. Almandil 1,† , Deem N. Alkuroud 2,†, Sayed AbdulAzeez 2, Abdulla AlSulaiman 3, Abdelhamid Elaissari 4 and J. Francis Borgio 2,* 1 Department of Clinical Pharmacy Research, Institute for Research and Medical Consultation (IRMC), Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia; [email protected] 2 Department of Genetic Research, Institute for Research and Medical Consultation (IRMC), Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia; [email protected] (D.N.A.); [email protected] (S.A.) 3 Department of Neurology, College of Medicine, Imam Abdulrahman Bin Faisal University, Dammam 31441, Saudi Arabia; [email protected] or [email protected] 4 Univ Lyon, University Claude Bernard Lyon-1, CNRS, LAGEP-UMR 5007, F-69622 Lyon, France; [email protected] * Correspondence: [email protected] or [email protected]; Tel.: +966-13-333-0864 † These authors contributed equally to this work. Received: 26 January 2019; Accepted: 19 February 2019; Published: 23 February 2019 Abstract: One of the most common neurodevelopmental disorders worldwide is autism spectrum disorder (ASD), which is characterized by language delay, impaired communication interactions, and repetitive patterns of behavior caused by environmental and genetic factors. This review aims to provide a comprehensive survey of recently published literature on ASD and especially novel insights into excitatory synaptic transmission. Even though numerous genes have been discovered that play roles in ASD, a good understanding of the pathophysiologic process of ASD is still lacking.
    [Show full text]
  • 1 a Search for Novel Cancer/Testis Antigens in Lung Cancer Identifies
    Author Manuscript Published OnlineFirst on June 26, 2014; DOI: 10.1158/0008-5472.CAN-13-3725 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. A search for novel cancer/testis antigens in lung cancer identifies VCX/Y genes expanding the repertoire of potential immunotherapeutic targets Ayumu Taguchi1*, Allen D. Taylor2, Jaime Rodriguez1, Müge Çeliktaş3, Hui Liu1, Xiaotu Ma4, Qing Zhang2, Chee-Hong Wong2, Alice Chin2, Luc Girard5,6, Carmen Behrens7, Wan L. Lam8, Stephen Lam8, John D. Minna5,6,9, Ignacio I. Wistuba1, Adi F. Gazdar5,10, and Samir M. Hanash3 1Departments of Translational Molecular Pathology, 3Clinical Cancer Prevention, and 7Thoracic/Head and Neck Medical Oncology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030, USA 2Fred Hutchinson Cancer Research Center, 1100 Fairview Avenue N., Seattle, WA 98109, USA 4Department of Molecular and Cell Biology, Center for Systems Biology, The University of Texas Southwestern Medical Center at Dallas, 800 W. Campbell Road, Dallas, TX 75080, USA 5Hamon Center for Therapeutic Oncology Research and Departments of 6Pharmacology, 9Internal Medicine, and 10Pathology, The University of Texas Southwestern Medical Center at Dallas, 5323 Harry Hines Blvd., Dallas, TX 75390, USA 8Department of Integrative Oncology, British Columbia Cancer Research Centre, 675 West 10th Avenue, Vancouver, BC V521L3, Canada Corresponding Author: *Correspondence should be addressed to Ayumu Taguchi, Department of Translational and Molecular Pathology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030, USA; email: [email protected]; fax: 713-563-5746; phone: 713-563-8069. 1 Downloaded from cancerres.aacrjournals.org on September 24, 2021.
    [Show full text]
  • MAGEB2 (NM 002364) Human Tagged ORF Clone – RG205338
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG205338 MAGEB2 (NM_002364) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MAGEB2 (NM_002364) Human Tagged ORF Clone Tag: TurboGFP Symbol: MAGEB2 Synonyms: CT3.2; DAM6; MAGE-XP-2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG205338 representing NM_002364 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTCGTGGTCAGAAGAGTAAGCTCCGTGCCCGTGAGAAACGCCGCAAGGCCCGAGATGAGACCCGGG GTCTCAATGTTCCTCAGGTCACTGAAGCAGAGGAAGAAGAGGCCCCCTGCTGTTCCTCTTCTGTTTCTGG GGGTGCTGCTTCAAGCTCTCCTGCTGCTGGCATTCCCCAGAAGCCTCAGAGAGCCCCAACCACTGCCGCT GCTGCAGCTGCGGGTGTTTCATCCACAAAATCTAAAAAAGGTGCCAAGAGCCACCAAGGTGAGAAAAATG CAAGTTCCTCCCAGGCCTCAACATCTACTAAGAGCCCAAGCGAAGATCCTCTAACCAGGAAGTCAGGGTC GTTGGTGCAGTTCCTGTTGTACAAGTATAAAATAAAAAAGTCCGTTACAAAGGGAGAAATGCTGAAAATT GTTGGCAAAAGGTTCAGGGAGCACTTCCCTGAGATCCTCAAGAAAGCCTCTGAGGGCCTCAGTGTTGTCT TTGGCCTTGAGCTGAATAAAGTCAACCCCAACGGCCACACTTACACCTTCATCGACAAGGTAGACCTCAC TGATGAGGAATCCCTGCTCAGTTCCTGGGACTTTCCCAGGAGAAAGCTTCTGATGCCTCTCCTGGGTGTG ATCTTCTTAAATGGCAACTCAGCTACTGAGGAAGAGATCTGGGAATTCCTGAATATGTTGGGAGTCTATG ATGGAGAGGAGCACTCAGTCTTTGGGGAACCCTGGAAGCTCATCACCAAAGATCTGGTGCAGGAAAAATA TCTGGAGTACAAGCAGGTGCCCAGCAGTGATCCCCCACGCTTTCAATTCCTGTGGGGTCCGAGAGCCTAT GCTGAAACCAGCAAGATGAAAGTCCTGGAGTTTTTGGCCAAGGTAAATGGTACCACCCCCTGTGCCTTCC
    [Show full text]
  • Changing Nucleotide Specificity of the DEAD-Box Helicase Hera Abrogates Communication Between the Q-Motif and the P-Loop
    Article in press - uncorrected proof Biol. Chem., Vol. 392, pp. 357–369, April 2011 • Copyright ᮊ by Walter de Gruyter • Berlin • New York. DOI 10.1515/BC.2011.034 Changing nucleotide specificity of the DEAD-box helicase Hera abrogates communication between the Q-motif and the P-loop Julian Strohmeier1, Ines Hertel2, Ulf Diederichsen1, complexes. As such they touch upon virtually all processes Markus G. Rudolph3 and Dagmar Klostermeier2,a,* of RNA metabolism including transcription, translation, 1 Institute for Organic and Biomolecular Chemistry, RNA editing, viral replication, and ribosome biogenesis University of Go¨ttingen, D-37077 Go¨ttingen, Germany (Cordin et al., 2006). DEAD-box proteins form the largest 2 Division of Biophysical Chemistry, Biozentrum, RNA helicase family (Hilbert et al., 2009). They are named University of Basel, CH-4056 Basel, Switzerland according to the characteristic sequence of their Walker B 3 F. Hoffmann-La Roche, CH-4070 Basel, Switzerland motif, which is implicated in ATP binding. DEAD-box pro- teins share a common modular architecture (Figure 1A): a * Corresponding author helicase core of two flexibly connected RecA-like domains e-mail: [email protected] (RecA_N and RecA_C), which are sometimes flanked by additional domains that confer substrate binding specificity, Abstract mediate protein/protein interactions or may contribute to duplex separation (Tsu et al., 2001; Kossen et al., 2002; DEAD-box proteins disrupt or remodel RNA and protein/ Grohman et al., 2007; Linden et al., 2008; Mohr et al., 2008; RNA complexes at the expense of ATP. The catalytic core Del Campo et al., 2009). In addition, DEAD-box helicases is composed of two flexibly connected RecA-like domains.
    [Show full text]
  • Hippo and Sonic Hedgehog Signalling Pathway Modulation of Human Urothelial Tissue Homeostasis
    Hippo and Sonic Hedgehog signalling pathway modulation of human urothelial tissue homeostasis Thomas Crighton PhD University of York Department of Biology November 2020 Abstract The urinary tract is lined by a barrier-forming, mitotically-quiescent urothelium, which retains the ability to regenerate following injury. Regulation of tissue homeostasis by Hippo and Sonic Hedgehog signalling has previously been implicated in various mammalian epithelia, but limited evidence exists as to their role in adult human urothelial physiology. Focussing on the Hippo pathway, the aims of this thesis were to characterise expression of said pathways in urothelium, determine what role the pathways have in regulating urothelial phenotype, and investigate whether the pathways are implicated in muscle-invasive bladder cancer (MIBC). These aims were assessed using a cell culture paradigm of Normal Human Urothelial (NHU) cells that can be manipulated in vitro to represent different differentiated phenotypes, alongside MIBC cell lines and The Cancer Genome Atlas resource. Transcriptomic analysis of NHU cells identified a significant induction of VGLL1, a poorly understood regulator of Hippo signalling, in differentiated cells. Activation of upstream transcription factors PPARγ and GATA3 and/or blockade of active EGFR/RAS/RAF/MEK/ERK signalling were identified as mechanisms which induce VGLL1 expression in NHU cells. Ectopic overexpression of VGLL1 in undifferentiated NHU cells and MIBC cell line T24 resulted in significantly reduced proliferation. Conversely, knockdown of VGLL1 in differentiated NHU cells significantly reduced barrier tightness in an unwounded state, while inhibiting regeneration and increasing cell cycle activation in scratch-wounded cultures. A signalling pathway previously observed to be inhibited by VGLL1 function, YAP/TAZ, was unaffected by VGLL1 manipulation.
    [Show full text]
  • Gene Ontology Functional Annotations and Pleiotropy
    Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
    [Show full text]
  • A Discovery Resource of Rare Copy Number Variations in Individuals with Autism Spectrum Disorder
    INVESTIGATION A Discovery Resource of Rare Copy Number Variations in Individuals with Autism Spectrum Disorder Aparna Prasad,* Daniele Merico,* Bhooma Thiruvahindrapuram,* John Wei,* Anath C. Lionel,*,† Daisuke Sato,* Jessica Rickaby,* Chao Lu,* Peter Szatmari,‡ Wendy Roberts,§ Bridget A. Fernandez,** Christian R. Marshall,*,†† Eli Hatchwell,‡‡ Peggy S. Eis,‡‡ and Stephen W. Scherer*,†,††,1 *The Centre for Applied Genomics, Program in Genetics and Genome Biology, The Hospital for Sick Children, Toronto M5G 1L7, Canada, †Department of Molecular Genetics, University of Toronto, Toronto M5G 1L7, Canada, ‡Offord Centre for Child Studies, Department of Psychiatry and Behavioural Neurosciences, McMaster University, Hamilton L8P 3B6, § Canada, Autism Research Unit, The Hospital for Sick Children, Toronto M5G 1X8, Canada, **Disciplines of Genetics and Medicine, Memorial University of Newfoundland, St. John’s, Newfoundland A1B 3V6, Canada, ††McLaughlin Centre, University of Toronto, Toronto M5G 1L7, Canada, and ‡‡Population Diagnostics, Inc., Melville, New York 11747 ABSTRACT The identification of rare inherited and de novo copy number variations (CNVs) in human KEYWORDS subjects has proven a productive approach to highlight risk genes for autism spectrum disorder (ASD). A rare variants variety of microarrays are available to detect CNVs, including single-nucleotide polymorphism (SNP) arrays gene copy and comparative genomic hybridization (CGH) arrays. Here, we examine a cohort of 696 unrelated ASD number cases using a high-resolution one-million feature CGH microarray, the majority of which were previously chromosomal genotyped with SNP arrays. Our objective was to discover new CNVs in ASD cases that were not detected abnormalities by SNP microarray analysis and to delineate novel ASD risk loci via combined analysis of CGH and SNP array cytogenetics data sets on the ASD cohort and CGH data on an additional 1000 control samples.
    [Show full text]
  • THAT ARE NOT ALLOKULUNUTTUUS009816094B2 (12 ) United States Patent ( 10) Patent No
    THAT ARE NOT ALLOKULUNUTTUUS009816094B2 (12 ) United States Patent ( 10 ) Patent No. : US 9 ,816 , 094 B2 Lee et al. (45 ) Date of Patent: * Nov . 14 , 2017 ( 54 ) POLYCOMB- ASSOCIATED NON -CODING ( 2013 .01 ) ; C12Q 2600 / 136 (2013 . 01 ) ; C12Q RNAS 2600/ 158 ( 2013 . 01 ) ; C12Q 2600 /178 (2013 .01 ) (71 ) Applicant : The General Hospital Corporation , ( 58 ) Field of Classification Search Boston , MA (US ) None See application file for complete search history. (72 ) Inventors : Jeannie T . Lee , Cambridge, MA (US ) ; Jing Zhao , San Diego , CA (US ) ; (56 ) References Cited Kavitha Sarma, Waltham , MA (US ) ; Mark Borowsky , Needham , MA (US ) ; U . S . PATENT DOCUMENTS Toshiro Kendrick Ohsumi, Cambridge , 5 ,491 , 133 A 2 / 1996 Walder et al. MA (US ) 5 , 576 , 208 A 11 / 1996 Monia et al. 5 ,623 , 065 A 4 / 1997 Cook et al . ( 73 ) Assignee : The General Hospital Corporation , 5 ,652 , 355 A 7 / 1997 Metelev et al. 5 ,661 , 134 A 8 / 1997 Cook et al. Boston , MA (US ) 5 ,914 , 396 A 6 / 1999 Cook et al . 5 ,919 ,619 A 7 / 1999 Tullis ( * ) Notice : Subject to any disclaimer , the term of this 5 , 965 , 722 A 10 / 1999 Ecker et al. patent is extended or adjusted under 35 5 , 976 ,879 A 11/ 1999 Kole et al. U . S . C . 154 (b ) by 0 days. 6 ,015 , 710 A 1 / 2000 Shay et al . 6 ,040 , 142 A 3 / 2000 Melki et al. This patent is subject to a terminal dis 6 ,046 , 307 A 4 / 2000 Shay et al . claimer . 6 ,080 , 577 A 6 / 2000 Melki et al .
    [Show full text]
  • Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham a Thesis Submitted in Conformity
    Characterizing Genomic Duplication in Autism Spectrum Disorder by Edward James Higginbotham A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Molecular Genetics University of Toronto © Copyright by Edward James Higginbotham 2020 i Abstract Characterizing Genomic Duplication in Autism Spectrum Disorder Edward James Higginbotham Master of Science Graduate Department of Molecular Genetics University of Toronto 2020 Duplication, the gain of additional copies of genomic material relative to its ancestral diploid state is yet to achieve full appreciation for its role in human traits and disease. Challenges include accurately genotyping, annotating, and characterizing the properties of duplications, and resolving duplication mechanisms. Whole genome sequencing, in principle, should enable accurate detection of duplications in a single experiment. This thesis makes use of the technology to catalogue disease relevant duplications in the genomes of 2,739 individuals with Autism Spectrum Disorder (ASD) who enrolled in the Autism Speaks MSSNG Project. Fine-mapping the breakpoint junctions of 259 ASD-relevant duplications identified 34 (13.1%) variants with complex genomic structures as well as tandem (193/259, 74.5%) and NAHR- mediated (6/259, 2.3%) duplications. As whole genome sequencing-based studies expand in scale and reach, a continued focus on generating high-quality, standardized duplication data will be prerequisite to addressing their associated biological mechanisms. ii Acknowledgements I thank Dr. Stephen Scherer for his leadership par excellence, his generosity, and for giving me a chance. I am grateful for his investment and the opportunities afforded me, from which I have learned and benefited. I would next thank Drs.
    [Show full text]
  • MAGE Proteins and the Regulation of E2F Pathway
    Central JSM Clinical Oncology and Research Case Report *Corresponding author Martin Monte, Departamento de Química Bi¬ológica, Facultad de Ciencias Exac¬tas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, Pabellón 2, MAGE Proteins and the C1428EHA Ciudad de Buenos Aires, Argentina, Tel: 541145763300; Email: Regulation of E2F Pathway Submitted: 04 April 2017 Accepted: 06 April 2017 1,2 1,2 Ladelfa M Fatima and Monte Martin * Published: 08 April 2017 1 Departamento de Química Biológica, Universidad de Buenos Aires, Argentina Copyright 2CONICET – Universidad de Buenos Aires, Instituto de Química Biológica de la Facultad © 2017 Martin et al. de Ciencias Exactas y Naturales (IQUIBICEN), Argentina OPEN ACCESS Abstract Keywords Melanoma Antigens Genes (MAGE) constitutes a mutagenic family divided in two • MAGE subfamilies, MAGE-I and MAGE-II, according to its tissue pattern expression. While • Transcription factors MAGE-I in adult humans are only expressed in testis and tumors tissues, those belonging • E2F1 to MAGE-II subfamily are ubiquitously expressed. During the last decade, functional characterization of MAGE proteins points to a role in transcription regulation. E2F1 is a member of the E2F family and is among the transcription factors reported to be modulated by MAGE proteins. In this article we will focus on reported cases of E2F1 modulation by members of MAGE-I and MAGE-II subfamilies and the resulting biological consequences observed in normal and tumor cells. ABBREVIATIONS MAGE: Melanoma Antigens Genes; CDKs: Cyclin/Cyclin- proteins were, at the beginning, mainly studied as possible Dependent Kinases; AR: Androgen Receptor; E1A: Human antigens for cancer vaccines or as diagnostic and prognostic Adenoviral Early Region Protein E1A; HDM2: Human Double markers of cancer [4-6].
    [Show full text]