DOCSLIB.ORG

Enzyme-Specific Inhibition of Human Glutathione Transferases by Dinitronaphthalene Derivatives

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Enzyme-Specific Inhibition of Human Glutathione Transferases by Dinitronaphthalene Derivatives Enzyme-specific Inhibition of human Glutathione transferases by Dinitronaphthalene derivatives by Hilary Groom A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Molecular and Cellular Biology Guelph, Ontario, Canada © Hilary Groom, August, 2014 Abstract Enzyme-Specific Inhibition of Human Glutathione Transferases by Dinitronaphthalene Derivatives M. Hilary Groom Advisor: University of Guelph, 2014 Dr. P. David Josephy The enzyme glutathione transferase (GST) superfamily catalyzes the detoxication of many xenobiotics and byproducts of aerobic metabolism. GSTs catalyze the conjugation of glutathione with reactive functional groups of xenobiotics. Overexpression of GSTs can contribute to drug and apoptosis resistance in cancer cells and this has motivated research to develop GST inhibitors as adjuvants to chemotherapies. 1-Chloro-2,4-dinitrobenzene (CDNB) is one of the most commonly used substrates for GST activity assays. This project focuses on the interactions of naphthalene congeners of CDNB with recombinant human GST enzymes (Alpha, Mu, and Pi classes). Several dinitronaphthalene derivatives were found to be GST inhibitors. 1-Chloro-2,4-dinitronaphthalene was not a GST substrate, but inhibited the CDNB conjugation activity of GST enzymes. The mechanism of inhibition occurs by formation of a dead-end intermediate Meisenheimer complex in the enzyme active site. Significant mutagenic and toxic effects of these dinitronaphthalene derivatives were observedby conducting Salmonella Ames assays. iii Acknowledgements I would like to thank the many supporters who have assisted me with my project and offered me personal support while at the University of Guelph. First of all, I would like to thank my advisor, Dr. Josephy. He has provided excellent knowledge and guidance during my research project, and has greatly enriched my experience as a graduate student by his participation with the lab group. I am grateful for all the experiences and conferences I had the fortune to attend during my MSc. I would like to thank my fellow lab mates. Leah McGurn, who was invaluable for helping me adapt to an unfamiliar school and Minah Hwang, who mentored me on unfamiliar lab equipment. As well as current lab mates, Kaja and Reema, I thank for their moral support. I appreciate my parents, for their moral support and for being proud of my work and my sister and pet dogs, I would like to thank for reminding me to have fun. Lastly I would like to acknowledge the great mentors I encountered during my undergrad at UOIT. These professors and T.A. include Dr. Strap, Dr. Desaulniers, Dr. Bardin, and PhD- graduate, Tim. They have provided a great foundation of knowledge that has assisted me during my graduate work and they have helped me build my confidence to pursue graduate studies. iv Table of contents Acknowledgements ........................................................................................................................ iii i. List of Tables ...................................................................................................................... vi ii. List of Figures .................................................................................................................... vii A. Introduction ............................................................................................................................. 1 i. Glutathione transferases ....................................................................................................... 1 a. Glutathione ....................................................................................................................... 3 b. GST conjugation and the mercapturic acid pathway ....................................................... 4 c. Human glutathione transferase ......................................................................................... 5 d. Catalytic mechanism of cytosolic GSTs .......................................................................... 6 e. Human cytosolic glutathione transferases ........................................................................... 7 f. Model substrates of human glutathione transferases ..................................................... 10 g. Substrate specificity of human glutathione transferases ................................................ 13 ii. Inhibitors of glutathione transferase .................................................................................. 14 a. Applications of glutathione transferase inhibitors ......................................................... 16 iii. Nitronaphthalenes .............................................................................................................. 20 a. Genotoxicity of nitroarenes ............................................................................................ 21 b. Salmonella Ames test ..................................................................................................... 23 c. Genotoxicityof nitronaphthalenes .................................................................................. 25 d. Metabolism of 1-nitronaphthalene in mammals ............................................................ 25 B. Study Summary ..................................................................................................................... 26 C. Materials and Methods .......................................................................................................... 27 i. Chemicals ........................................................................................................................... 27 ii.Media and Agar ......................................................................................................................... 27 iii. Synthesis of dinitronaphthalene derivatives and GSH-CDNN conjugate ......................... 28 a. Analytical analysis of DNNSG conjugate ...................................................................... 30 iv. Recombinant human GST expressing strains .................................................................... 30 a. Recombinant GST purification ...................................................................................... 30 v. Enzyme kinetics instrumentation ....................................................................................... 33 vi. Inhibitor IC50 measurement ................................................................................................ 33 vii.Characterization of inhibition mechanism (kinetics) ........................................................... 34 v viii. Characterization of Meisenheimer complexes ............................................................... 34 a. Reversibility of Meisenheimer complex formation ....................................................... 35 ix. Mutagenicity and Genotoxicity: Salmonella Ames Assay ................................................ 35 b. Salmonella YG1024 ....................................................................................................... 36 c. Salmonella mutagenicity assay protocol ........................................................................ 36 d. NICE automated colony counting .................................................................................. 36 D. Results and Discussion .......................................................................................................... 37 i. Synthesis of CDNN-GSH adduct....................................................................................... 37 ii. Protein purification ............................................................................................................ 38 iii. Identification of GST inhibitors ..................................................................................... 39 iv. Potency of GST inhibition by dinitronaphthalene derivatives ....................................... 41 a. Inhibition of GSTMu class enzymes by dinitronaphthalene derivatives ....................... 44 b. Inhibition of GST Alpha class enzymes by dinitronaphthalene derivatives .................. 46 c. Inhibition of GST Pi class enzyme by dinitronaphthalene derivatives .......................... 48 d. Other GST enzyme specific inhibitors ........................................................................... 49 v. Inhibition mechanism of DNN inhibitors .......................................................................... 52 vi. Meisenheimer complex formation in the GSTM2 active site ........................................ 53 a. Meisenheimer complex stability in the GST active site ................................................. 55 b. Meisenheimer complex formation by other GST inhibitors .......................................... 57 c. Possible intramolecular Meisenheimer complex formation of DNNSG ........................... 59 vii. Salmonella Mutagenicity Assay ..................................................................................... 60 viii. Biological functions of GSTM2-2.................................................................................. 63 E. Conclusions ........................................................................................................................... 66 F. References ............................................................................................................................. 69 G. Appendices ...........................................................................................................................
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • GSTK1 Rabbit Pab
    Leader in Biomolecular Solutions for Life Science GSTK1 Rabbit pAb Catalog No.: A5226 1 Publications Basic Information Background Catalog No. This gene encodes a member of the kappa class of the glutathione transferase A5226 superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide Observed MW range of hydrophobic substates facilitating the removal of these compounds from cells. 25KDa Alternative splicing results in multiple transcript variants. Calculated MW 20kDa/24kDa/25kDa/31kDa Category Primary antibody Applications WB, IHC, IF Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 373156 Q9Y2Q3 IHC 1:50 - 1:100 Immunogen 1:50 - 1:100 IF Recombinant fusion protein containing a sequence corresponding to amino acids 1-226 of human GSTK1 (NP_057001.1). Synonyms GSTK1;GST;GST 13-13;GST13;GST13-13;GSTK1-1;hGSTK1 Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using GSTK1 antibody (A5226) at 1:1000 dilution. Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution. Lysates/proteins: 25ug per lane. Blocking buffer: 3% nonfat dry milk in TBST. Detection: ECL Basic Kit (RM00020). Exposure time: 60s. Immunohistochemistry of paraffin- Immunohistochemistry of paraffin- Immunohistochemistry of paraffin- embedded human lung cancer using embedded human liver cancer using embedded human thyroid cancer using GSTK1 Rabbit pAb (A5226) at dilution of GSTK1 Rabbit pAb (A5226) at dilution of GSTK1 Rabbit pAb (A5226) at dilution of 1:25 (40x lens).
    [Show full text]
  • Characterization of Visceral and Subcutaneous Adipose Tissue
    J. Perinat. Med. 2016; 44(7): 813–835 Shali Mazaki-Tovi*, Adi L. Tarca, Edi Vaisbuch, Juan Pedro Kusanovic, Nandor Gabor Than, Tinnakorn Chaiworapongsa, Zhong Dong, Sonia S. Hassan and Roberto Romero* Characterization of visceral and subcutaneous adipose tissue transcriptome in pregnant women with and without spontaneous labor at term: implication of alternative splicing in the metabolic adaptations of adipose tissue to parturition DOI 10.1515/jpm-2015-0259 groups (unpaired analyses) and adipose tissue regions Received July 27, 2015. Accepted October 26, 2015. Previously (paired analyses). Selected genes were tested by quantita- published online March 19, 2016. tive reverse transcription-polymerase chain reaction. Abstract Results: Four hundred and eighty-two genes were differ- entially expressed between visceral and subcutaneous Objective: The aim of this study was to determine gene fat of pregnant women with spontaneous labor at term expression and splicing changes associated with par- (q-value < 0.1; fold change > 1.5). Biological processes turition and regions (visceral vs. subcutaneous) of the enriched in this comparison included tissue and vascu- adipose tissue of pregnant women. lature development as well as inflammatory and meta- Study design: The transcriptome of visceral and abdomi- bolic pathways. Differential splicing was found for 42 nal subcutaneous adipose tissue from pregnant women at genes [q-value < 0.1; differences in Finding Isoforms using term with (n = 15) and without (n = 25) spontaneous labor Robust Multichip Analysis scores > 2] between adipose was profiled with the Affymetrix GeneChip Human Exon tissue regions of women not in labor. Differential exon 1.0 ST array. Overall gene expression changes and the dif- usage associated with parturition was found for three ferential exon usage rate were compared between patient genes (LIMS1, HSPA5, and GSTK1) in subcutaneous tissues.
    [Show full text]
  • Whole Egg Consumption Increases Gene Expression Within the Glutathione Pathway in the Liver of Zucker Diabetic Fatty Rats
    Food Science and Human Nutrition Publications Food Science and Human Nutrition 11-3-2020 Whole egg consumption increases gene expression within the glutathione pathway in the liver of Zucker Diabetic Fatty rats Joe L. Webb Iowa State University Amanda E. Bries Iowa State University, [email protected] Brooke Vogel Iowa State University Claudia Carrillo Iowa State University, [email protected] Lily Harvison Iowa State University, [email protected] See next page for additional authors Follow this and additional works at: https://lib.dr.iastate.edu/fshn_hs_pubs Part of the Dietetics and Clinical Nutrition Commons, Endocrinology, Diabetes, and Metabolism Commons, Exercise Science Commons, Food Chemistry Commons, Human and Clinical Nutrition Commons, and the Molecular, Genetic, and Biochemical Nutrition Commons The complete bibliographic information for this item can be found at https://lib.dr.iastate.edu/ fshn_hs_pubs/38. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html. This Article is brought to you for free and open access by the Food Science and Human Nutrition at Iowa State University Digital Repository. It has been accepted for inclusion in Food Science and Human Nutrition Publications by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Whole egg consumption increases gene expression within the glutathione pathway in the liver of Zucker Diabetic Fatty rats Abstract Nutrigenomic evidence supports the idea that Type 2 Diabetes Mellitus (T2DM) arises due to the interactions between the transcriptome, individual genetic profiles, lifestyle, and diet. Since eggs are a nutrient dense food containing bioactive ingredients that modify gene expression, our goal was to examine the role of whole egg consumption on the transcriptome during T2DM.
    [Show full text]
  • GSTA4 (NM 001512) Human Tagged ORF Clone – RC202130 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC202130 GSTA4 (NM_001512) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: GSTA4 (NM_001512) Human Tagged ORF Clone Tag: Myc-DDK Symbol: GSTA4 Synonyms: GSTA4-4; GTA4 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC202130 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCAAGGCCCAAGCTCCACTATCCCAACGGAAGAGGCCGGATGGAGTCCGTGAGATGGGTTTTAG CTGCCGCCGGAGTCGAGTTTGATGAAGAATTTCTGGAAACAAAAGAACAGTTGTACAAGTTGCAGGATGG TAACCACCTGCTGTTCCAACAAGTGCCCATGGTTGAAATTGACGGGATGAAGTTGGTACAGACCCGAAGC ATTCTCCACTACATAGCAGACAAGCACAATCTCTTTGGCAAGAACCTCAAGGAGAGAACCCTGATTGACA TGTACGTGGAGGGGACACTGGATCTGCTGGAACTGCTTATCATGCATCCTTTCTTAAAACCAGATGATCA GCAAAAGGAAGTGGTTAACATGGCCCAGAAGGCTATAATTAGATACTTTCCTGTGTTTGAAAAGATTTTA AGGGGTCACGGACAAAGCTTTCTTGTTGGTAATCAGCTGAGCCTTGCAGATGTGATTTTACTCCAAACCA TTTTAGCTCTAGAAGAGAAAATTCCTAATATCCTGTCTGCATTTCCTTTCCTCCAGGAATACACAGTGAA ACTAAGTAATATCCCTACAATTAAGAGATTCCTTGAACCTGGCAGCAAGAAGAAGCCTCCCCCTGATGAA ATTTATGTGAGAACCGTCTACAACATCTTTAGGCCA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene
    [Show full text]
  • 9 Glutathione S-Transferases
    Enzyme Systems that Metabolise Drugs and Other Xenobiotics. Edited by Costas Ioannides Copyright # 2001 John Wiley & Sons Ltd ISBNs: 0-471-894-66-4 %Hardback); 0-470-84630-5 %Electronic) 9 Glutathione S-transferases Philip J. Sherratt and John D. Hayes University of Dundee, UK Introduction Glutathione S-transferase GST; EC 2.5.1.18) isoenzymes are ubiquitously distributed in nature, being found in organisms as diverse as microbes, insects, plants, ®sh, birds andmammals Hayes andPulford1995). The transferases possess various activities andparticipate in several differenttypes of reaction. Most of these enzymes can catalyse the conjugation of reduced glutathione GSH) with compounds that contain an electrophilic centre through the formation of a thioether bondbetween the sulphur atom of GSH and the substrate Chasseaud 1979; Mannervik 1985). In addition to conjugation reactions, a number of GST isoenzymes exhibit other GSH-dependent catalytic activities including the reduction of organic hydroperoxides Ketterer et al. 1990) andisomerisation of various unsaturatedcompoundsBenson et al. 1977; Jakoby andHabig 1980). These enzymes also have several non-catalytic functions that relate to the sequestering of carcinogens, intracellular transport of a wide spectrum of hydrophobic ligands, and modulation of signal transduction pathways Listowsky 1993; Adler et al. 1999; Cho et al. 2001). Glutathione S-transferases represent a complex grouping of proteins. Two entirely distinct superfamilies of enzyme have evolved that possess transferase activity Hayes andStrange 2000). The ®rst enzymes to be characterisedwere the cytosolic, or soluble, GSTs BoylandandChasseaud1969; Mannervik 1985). To dateat least 16 members of this superfamily have been identi®ed in humans Board et al. 1997, 2000; Hayes and Strange 2000).
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Resolution of Conflict Between Parental Genomes in a Hybrid Species
    bioRxiv preprint doi: https://doi.org/10.1101/102970; this version posted January 25, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Resolution of conflict between parental genomes in a hybrid species 2 3 4 5 6 7 8 9 10 11 Fabrice Eroukhmanoff1†, Richard I. Bailey1,2†, Tore O. Elgvin1, Jo S. Hermansen1, Anna R. 12 Runemark1, Cassandra N. Trier1, Glenn-Peter Sætre1 13 1Department of Biosciences, Centre for Evolutionary and Ecological Synthesis, University of 14 Oslo, Norway. 2Division of Animal Evolutionary Biology, Department of Zoology, Faculty of 15 Science, Charles University in Prague, Viničná 7, 128 44 Praha, Czech Republic. 16 17 Corresponding author: [email protected] 18 19 †These authors contributed equally to the manuscript 20 21 22 23 24 25 26 1 bioRxiv preprint doi: https://doi.org/10.1101/102970; this version posted January 25, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 27 Abstract: 28 The development of reproductive barriers against parent species is crucial during hybrid 29 speciation, and post-zygotic isolation can be important in this process. Genetic 30 incompatibilities that normally isolate the parent species can become sorted in hybrids to form 31 reproductive barriers towards either parent. However, the extent to which this sorting process 32 is systematically biased and therefore predictable in which loci are involved and which alleles 33 are favored is largely unknown.
    [Show full text]
  • GSTK1 Antibody
    Efficient Professional Protein and Antibody Platforms GSTK1 Antibody Basic information: Catalog No.: UPA63766 Source: Rabbit Size: 50ul/100ul Clonality: monoclonal Concentration: 1mg/ml Isotype: Rabbit IgG Purification: Protein A purified. Useful Information: WB:1:1000-1:2000 ICC:1:50 Applications: IHC:1:50-1:200 FC:1:50-1:100 Reactivity: Human Specificity: This antibody recognizes GSTK1 protein. Immunogen: Synthetic peptide within N terminal human GSTK1. Glutathione S-transferase kappa 1 (GSTK1) is an enzyme that in humans is encoded by the GSTK1 gene which is located on chromosome seven. It be- longs to the superfamily of enzymes known as glutathione S-transferase (GST), which are mainly known for cellular detoxification. The GSTK1 gene consists of eight exons and seven introns and although it is a member of the GST family, its structure has been found to be similar to bacterial HCCA (2-hydroxychromene-2-carboxylate) isomerases and bacterial disul- phide-bond-forming DsbA oxidoreductase. Research has also suggested that Description: several variations of the GSTK1 gene can be responsible for metabolic dis- eases and certain types of cancer. The amount of expression of adiponectin has been observed to be related to diseases such as insulin resistance, obe- sity, and type 2 diabetes. GSTK1 can also be a potential tool to help investi- gate cancer. Tyrosine phosphorylated proteins are responsible for many of the cell functions such as the cell’s growth, division, adhesion, and motility. These activities are also very related to cancer and thus studying this pro- tein could allow access to information which could classify tumors for prognosis and prediction.
    [Show full text]
  • Inhibition of Glutathione-S-Transferase As a Treatment Strategy for Multidrug Resistance in Childhood Rhabdomyosarcoma
    491-500.qxd 16/12/2009 02:21 ÌÌ Page 491 INTERNATIONAL JOURNAL OF ONCOLOGY 36: 491-500, 2010 491 Inhibition of glutathione-S-transferase as a treatment strategy for multidrug resistance in childhood rhabdomyosarcoma GUIDO SEITZ1*, MICHAEL BONIN2*, JÖRG FUCHS1, SVEN POTHS2, PETER RUCK3, STEVEN W. WARMANN1 and SORIN ARMEANU-EBINGER1 1Department of Pediatric Surgery, University Children's Hospital, Hoppe-Seyler-Strasse 3, 72076 Tübingen; 2Institute of Anthropology and Human Genetics, Microarray Facility, University Hospital, Calwer Strasse 7, 72076 Tübingen; 3Institute of Pathology, Rutesheimer Strasse 50/1, 71229 Leonberg, Germany Received July 20, 2009; Accepted September 8, 2009 DOI: 10.3892/ijo_00000523 Abstract. Multidrug resistance (MDR) is a common problem in part. The GST family represents a promising target for in the treatment of childhood rhabdomyosarcoma (RMS). A further treatment strategies in childhood RMS. complete reversal of MDR is currently not possible. The aim of this study was to investigate the role of glutathione-S- Introduction transferase (GST) as mechanism of MDR in childhood RMS and to analyze possible reversal strategies. Female athymic Rhabdomyosarcoma (RMS) is the most common pediatric mice underwent xenotransplantation with embryonal or soft tissue sarcoma. About two-thirds of all sarcomas and alveolar RMS cells and were treated with vincristine. Gene 7-8% of all solid malignant tumors in childhood are RMS expression analysis using Affymetrix HU-Gene 1.0 arrays (1). The two main histological subtypes are embryonal revealed 2314 differentially expressed genes between the (eRMS) and alveolar (aRMS) RMS (2). The prognosis of the groups in alveolar RMS and 1387 in embryonal RMS.
    [Show full text]
  • Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
    177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable.
    [Show full text]
  • A Thesis Entitled Identification and Characterization of a Zebrafish
    A Thesis Entitled Identification and Characterization of A Zebrafish Glutathione S-Transferase Pi By Maryam S Abunnaja Submitted to the Graduate Faculty as a Partial Fulfillment of the Requirement for the Master of Science Degree in Pharmacology and Toxicology Dr. Ming-Cheh Liu, Committee Chair Dr. Ezdihar Hassoun, Committee Member Dr. Zahoor Shah, Committee Member Dr. Patricia Komuniecki, Dean College Graduate Studies The University of Toledo May 2013 Copyright 2013, Maryam S Abunnaja This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of Identification and Characterization of A Zebrafish Glutathione S-Transferase Pi By Maryam S Abunnaja Submitted to the Graduate Faculty as a Partial Fulfillment of the Requirement for the Master of Science Degree in Pharmacology and Toxicology May 2013 Glutathione S-transferases (GSTs) are a major group of Phase II enzymes involved in the detoxification of certain endogenous compounds such as reactive oxygen species (ROS) generated during metabolism, as well as in the detoxification of xenobiotics including drugs. In recent years, the zebrafish has increasingly been used as a promising animal model for biomedical research. This study is part of an effort to establish the zebrafish as a model for studying GST-mediated glutathione conjugation of xenobiotics. By searching the GenBank database, we have identified sequences encoding fifteen zebrafish GSTs. Using a computer algorithm available at the Genebee website, a dendrogram of the fifteen zebrafish GSTs was generated. A zebrafish GST Pi was subsequently cloned, expressed, and purified. An enzymatic assay for purified GST Pi was established using 1- chloro-2, 4-dinitrobenzene (CDNB) as a substrate.
    [Show full text]