Distribution of the Vang-Like Gene Cluster in Clostridium Difficile Clinical Isolates

Home , Enterococcus faecalis, Enterococcus faecium

547

NOTE / NOTE

Distribution of the vanG-like gene cluster in Clostridium difficile clinical isolates

Fariza Ammam, Jean-Christophe Marvaud, and Thierry Lambert

Abstract: Treatment of Clostridium difficile infections generally requires cessation of their causative antibiotic and subse- quent administration of metronidazole or vancomycin. Intriguingly, the genome of C. difficile 630 contains a cryptic gene cluster homologous to the vanG-type operon of Enterococcus faecalis BM4518. We detected this cluster by PCR in 35 out of 41 clinical isolates, confirming its large prevalence in this species. The cluster was found to be located in a unique locus. Comparison of this locus with that of strains devoid of the vanG-like cluster indicated that acquisition of the gene cluster occurred in a perfect 19-bp inverted repeat, in the absence of a detectable mobile structure. Key words: vanG-like, Clostridium difficile, cryptic genes. Résumé : Le traitement des infections liées à Clostridium difficile requiert en général l’arrêt de l’antibiothérapie responsable de l’implantation du microorganisme et l’administration du métronidazole ou de la vancomycine. Le génome de la souche C. difficile 630 héberge un groupe de gènes cryptiques homologue à l’opéron vanG de Enterococcus faecalis BM4518. Nous avons détecté ce groupe de gènes désigné vanG-like par PCR chez 35 parmi 41 isolats cliniques. Ce résultat reflète la forte prévalence de ce groupe de gènes chez C. difficile. Par ailleurs, vanG-like a été retrouvé localisé dans un même locus. La comparaison de ce locus avec celui des souches dépourvues de vanG-like indique que l’acquisition de ce dernier s’opère au niveau d’une séquence inversée répétée de 19 pb en l’absence d’une structure d’élément mobile identifiable. Mots‐clés : vanG-like, Clostridium difficile, gènes cryptiques. [Traduit par la Rédaction] For personal use only. Clostridium difficile is the cause of 15%–20% of cases of are the most prevalent vancomycin resistance determinants in antibiotic-associated diarrhea and of most cases of pseudo- enterococci (Arthur and Courvalin 1993; Evers et al. 1996). membranous colitis. Metronidazole and vancomycin are the The VanG-type is characterized by a low-level resistance to major antibiotics for treatment of C. difficile infections vancomycin (minimum inhibitory concentration 16 µg/mL) (Kachrimanidou and Malisiovas 2011). In silico analysis of and susceptibility to teicoplanin (Depardieu et al. 2003). The the C. difficile 630 genome revealed the presence of a gene vanG-like cluster of C. difficile includes five open reading cluster homologous to the vanG operon, which confers van- frames for putative proteins that share identity with VanRG comycin resistance in Enterococcus faecalis BM4518 (82%); VanSD and VanSG (59% and 50%, respectively); (Depardieu et al. 2003; Sebaihia et al. 2006). Glycopeptide VanG (66%); VanXYG (58%); and VanTG (62%), correspond- resistance in enterococci is due to a double mechanism that ing, respectively, to the regulator, sensor, D-Ala-D-Ser ligase, combines synthesis of modified peptidoglycan precursors D-D, peptidase, and serine racemase encoded by the vanG ending in D-alanyl-D-lactate (VanA, VanB, VanD, and operon. Despite the presence of genes homologous to the

Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20 VanM) or D-alanyl-D-serine (VanC, VanE, VanG, VanL, and vanG operon, C. difficile remains susceptible to vancomycin. VanN) of low affinity for glycopeptide and elimination of This observation raises the question of the origin of these natural D-alanyl-D-alanine precursors (Boyd et al. 2008; genes and of their ability to generate vancomycin resistance. Courvalin 1990; Lebreton et al. 2011; Reynolds and Whole-genome microarray analysis of diverse C. difficile Courvalin 2005; Xu et al. 2010). This mechanism involves strains has shown large genome variability and the absence enzymatic activities encoded by genes organized in operons. of the vanG-like cluster in several strains (Sebaihia et al. Resistance to glycopeptide, first described in enterococci, has 2006). Thus we analyze here the distribution of this element now spread to other Gram-positive bacteria. VanA and VanB in C. difficile clinical isolates from various origins.

Received 18 November 2011. Revision received 15 December 2011. Accepted 16 December 2011. Published at www.nrcresearchpress.com/cjm on 12 March 2012. F. Ammam, J.-C. Marvaud, and T. Lambert. EA 4043, USC INRA, Département de Microbiologie, Faculté de Pharmacie, Université Paris Sud, Châtenay-Malabry, France. Corresponding author: Jean-Christophe Marvaud (e-mail: [email protected]).

Can. J. Microbiol. 58: 547–551 (2012) doi:10.1139/W2012-002 Published by NRC Research Press 548 Can. J. Microbiol. Vol. 58, 2012

Table 1. Characteristics of Clostridium difficile strains.

Clinical vanG-like Strain TcdA TcdB PCR ribotypea Source country datab Year clusterc 630 A+B+ 012 Switzerland AAD 1982 + CD196 A+B+ 027 France PMC 1985 + 7241 A+B+ X France D 2000 + 89-638 A+B+ 014/020 France AC + 79-658 A+B+ ND France PMC + 3048 A+B+ X France D – 3751 A+B+ X France D 2003 + 1409 A+B+ 015 France U 2003 + 96-1827 A+B+ ND France U + FM 16 A+B+ X France PMC 1999 + FM 15 A–B+ 015 France PMC 1999 + 5445 A+B+ X France D 2000 + 94-416 A+B+ 031/053/057 France U + 4602 A+B+ 078/126 France U 2001 – 2348 A+B+ 014/020/077 France D + 4583 A–B+ 023 France D 2003 + 90-204 A+B+ ND France AC + 95-938 A+B+ ND France U + TL 1143 A–B+ 017 USA U – 4406 A+B+ 001 France D 2003 + 3457 A+B+ ND France D 2003 + 3290 A+B+ 015 France D + CD1 A+B+ ND Italia AAD 1999 + CD3 A+B+ X Italia AAD 1999 – CD20 A+B+ ND Italia AAD 1998 + C-253 A+B+ 012 Italia U + MI65 A+B+ ND Italia AAD 1992 + ATCC 43596 A+B+ 012 Belgium U + ATCC 43597 A–B– 010 Belgium U + ATCC 43598 A–B+ 017 Belgium AAD – For personal use only. ATCC 43599 A+B+ 001/115 Belgium U + ATCC 43600 A+B+ 014/020 Belgium U + ATCC 43601 A–B– ND Belgium U + ATCC 43602 A–B– 031/053/057 Belgium U + 4641 A+B+ ND France U + 56026 A–B– ND Belgium U + 95-1011 A+B+ ND France U + GAI 97482 A+B+ ND Japan AC 1998 + FM 12 A+B+ ND Canada PMC + FM 13 A+B+ 013 Canada PMC – FM 43 A+B+ ND Canada U + B1 A+B+ ND England PMC 1988 + aX, different than 001, 002, 003, 012, 014/020/077, 015, 017, 023, 027, 029, 046, 053, 056, 070, 075, 078/126, 081, 087, 095, 106,

Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20 117, 131; ND, not documented. Ribotypes in bold are from Eidhin et al. (2006). bAAD, antibiotic-associated diarrhea; PMC, pseudo-membranous colitis; D, diarrhea; AC, asymptomatic carriage; U, unknown. c+, present; –, absent.

A total of 41 C. difficile strains were collected from various 6 strains devoid of the vanG-like cluster belonged to at least 4 geographical sources (France, Canada, Belgium, USA, Eng- different ribotypes. These data minimize a risk of redundancy. land, Switzerland, and Japan) and different clinical issues, in- Bacteria were grown overnight at 37 °C in an anaerobic cluding toxigenic (TcdA+ TcdB+ or TcdA– TcdB+) or atmosphere, on Brain Heart Infusion agar supplemented with nontoxigenic strains (Table 1). To avoid impacting sampling 5% defibrillated horse blood (BioMérieux, France). Genomic by strains’ clonality, French isolates, which represented 22 DNA was obtained using genomic DNA extraction kit (GFX out of 41 isolates of the study, were screened on the basis of Genomic Blood DNA Purification Kit, GE Healthcare) ac- a putative epidemiological link for PCR ribotyping analysis cording to the instructions of the supplier. Primers used for according to a procedure described elsewhere (Bidet et al. PCR mapping or sequencing are listed in Table 2. Briefly, 2000). Accordingly, 12 isolates analyzed were found to be dis- the presence of the vanG-like cluster in different strains was tributed in at least 7 PCR ribotypes (Table 1). In addition, the tested with primers vanTF and vanTR specific for the vanTG-

Published by NRC Research Press Ammam et al. 549

Table 2. Oligonucleotide primers used in this study.

Primer Primer sequence (5′—3′) Positiona vanRF CAAAGCCATTTAACCCTTTGGA +1882210, +1882231 vanRR TCTCCCCATACAGCTTCAAACA –1882458, –1882480 vanSF TGGATAAGGCAGAGCGTCTTG +1883198, +1883218 vanSR CGCTCAAGTTTTTCCTCTGGA –1883544, –1883564 vanYF TCGTACTGCAGAAGAACAACAAG +1885360, +1885382 vanYR TGCGGATATCCCACATAACG –1885646, –1885666 vanTF TCGAGCTAGGTTATTGCGAACA +1886721, +1886742 vanTR GCCATCAATTCACAATCTTCTGG –1887022, –1887042 vanGF GTTTCGCAGAACCGTGTCAA +1884228, +1884247 vanGR ACCAAATGATGAACCTGCAC –1884610, –1884629 N630 GATGGTTCATTAGTTGGAGCTATAC +1881359, +1881383 S630 CAAGTGGTAAGGCTGGTATAAAGC –1888465, –1888487 vanTF2 CTATTGGCTATGCCGATGGT +1887782, +1887801 vanR630 CTAGAGCTTCCTTACCTGTATAAAAC –1882001, –1882026 a+, sense primer; –, antisense primer. Nucleotide numbering is according to GenBank acc. No. AM180355.1.

Fig. 1. Schematic representation of the vanG-like cluster from Clostridium difficile 630. vanTG-like positive strains (A) and vanTG-like negative strains (B) were further analyzed for PCR mapping with the primers indicated by arrowheads. The size of amplified regions is indicated in bp. For personal use only.

like gene, which yielded a 324 bp amplicon. In the absence California) and Applied Biosystems ABI-PRISM-DNA ana- of a PCR product, primer pairs vanSF and vanSR, vanRF lyzer with N630 and S630 primers. Pairwise alignments of and vanRR, vanGF and vanGR, vanYF and vanYR were DNA sequences and identification of repeat motifs in DNA used to detect the vanSG-like, vanRG-like, vanG-like, and sequences were carried out using the program ClustalW2 vanXYG-like genes, respectively (Fig. 1B). In the vanTG-like (Larkin et al. 2007) and the program REPuter (Kurtz et al.

Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20 positive strains, detection of other genes of the vanG-like 2001), respectively. cluster was carried out with primer pairs located on neigh- The vanTG-like gene was detected in 35 out of 41 strains boring genes as shown in Fig. 1A. To check if the vanG-like by amplifying a 324 bp intragenic fragment by PCR using cluster was located in a unique locus, we used primer pairs vanTF and vanTR primers. Lack of PCR product observed vanR630 and N630 and vanTF2 and S630 (Fig. 1A). The re- in 6 out of 41 C. difficile strains (3048, CD3, ATCC 43598, action mixture consisted of buffer (final concentrations of FM13, 4602, and TL1143) suggested the absence of the 1.5 mmol/L MgCl2 and 10 mmol/L Tris–HCl at pH 8.0); vanG-like cluster (Table 1). As expected, the vanSG-like, 200 µmol/L (each) dATP, dCTP, dTTP, and dGTP; 40 pmol vanRG-like, vanG-like, and vanXYG-like genes were not de- of each primer; 1 U of Taq DNA polymerase (Invitrogen); tected in these vanTG-like negative strains. In contrast, in the and 100 ng of C. difficile genomic DNA in a total volume vanTG-like positive strains, the other genes of the vanG-like of 50 µL. DNA amplification was carried out in a Biometra cluster were detected by PCR (Table 1). These results indi- PCR thermocycler. The PCR amplicons were purified with cated that 85% of our isolates harbored the vanG-like cluster, High Pure PCR Product Purification kit (Roche, Applied Sci- reflecting its large distribution in C. difficile. This was in ence) and sequenced using the BigDye Terminator version agreement with in silico analysis, which showed the vanG- 1.1 cycle sequencing kit (Applied Biosystems, Foster City, like cluster in 15 out of 20 C. difficile genomes.

Published by NRC Research Press 550 Can. J. Microbiol. Vol. 58, 2012

Fig. 2. Comparison of the flanking regions of the vanG-like cluster from Clostridium difficile strains (1) 6466; (2) M68, FM 13, ATCC 43598, TL 1143; (3) M120, NAP07 and NAP08, 4602, 3048, CD3; (4) 630; (5) BI9; (6) BI1, ATCC 43255, 2007855, CD196, QCD- 76w55, QCD-97b34, R20291, QCD-66c26, CIP 107932, QCD-37 × 79, QCD-32g58, QCD-63q42; and (7) CF5. The 19 bp inverted repeats (IRL and IRR) are indicated in bold characters and underlined by a discontinuous arrow. The direct repeats (DR) are underlined by a full arrow.

Sequence analysis of the PCR products obtained with tablished that vanZ gene contributes to a low-level resistance N630 and S630 to amplify the flanking regions of vanG-like to teicoplanin in Enterococcus faecium BM4147 (Arthur et indicated that this cluster was borne in a unique locus of al. 1995). C. difficile. Sequence alignment of C. difficile CD3 and 630 In absence of demonstration of the capacity of the vanG- differed at Guanine1881498 of strain 630 (GenBank accession like cluster to confer vancomycin resistance in C. difficile, No. AM180355.1) by substitution of the vanG-like cluster in the role of this operon will remain unclear. This study is place of a 30 bp sequence (Fig. 2). Integration of the vanG- under investigation, and we expect to obtain informative pre- For personal use only. like cluster occurred in a 19 bp inverted repeat of CD3, diction on the potential risk for emergence of glycopeptide meanwhile the vanG-like cluster of C. difficile 630 was resistance in C. difficile. flanked by 17 bp direct repeats (Fig. 2). Alignment of the cognate region from strains published in databases also Acknowledgements showed a highly conservation of this structure except in We are grateful to Frédéric Barbut, Paola Mastrantonio, strain 6466, differing by a 4 bp deletion in an inverted repeat Michel Delmée, Eric Frost, and Haru Kato for supplying copy (Fig. 2). Analysis of this locus and of its neighboring C. difficile strains and to Catherine Eckert for PCR ribotyp- environment revealed neither the presence of a mobile ele- ing. Fariza Ammam has a doctoral grant from the French ment nor the signature of a transposition event in favor of an Ministère de l’enseignement et de la recherche. acquisition or a loss of the vanG-like cluster by certain mem- bers of the species. This study indicated that the vanG-like References cluster is largely spread in C. difficile. Intriguingly, this element did not confer vancomycin resistance in all tested iso- Arthur, M., and Courvalin, P. 1993. Genetics and mechanisms of ≤ glycopeptide resistance in enterococci. Antimicrob. Agents Che- Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20 lates (minimum inhibitory concentration 2 mg/L). Cryptic – resistance genes in bacterial chromosomes have largely been mother. 37(8): 1563 1571. PMID:8215264. reported. These genes constitute a reservoir of antibiotic re- Arthur, M., Depardieu, F., Molinas, C., Reynolds, P., and Courvalin, P. 1995. The vanZ gene of Tn1546 from Enterococcus faecium sistance, as exemplified by (i) cfiA from Bacteroides fragilis, BM4147 confers resistance to teicoplanin. Gene, 154(1): 87–92. which confers resistance to carbapenems when governed by a doi:10.1016/0378-1119(94)00851-I. PMID:7867956. promoter brought by an insertion sequence (Podglajen et al. ′ Bidet, P., Lalande, V., Salauze, B., Burghoffer, B., Avesani, V., 1992); (ii) aac(6 )-Iy from Salmonella enterica, which con- Delmee, M., et al. 2000. Comparison of PCR-ribotyping, fers aminoglycoside resistance when placed under the control arbitrarily primed PCR, and pulsed-field gel electrophoresis for of the nmpC promoter following a transcriptional fusion due typing Clostridium difficile. J. Clin. Microbiol. 38(7): 2484–2487. to a large chromosomal deletion (Magnet et al. 1999). The PMID:10878030. presence of other van determinants in the C. difficile genome Boyd, D.A., Willey, B.M., Fawcett, D., Gillani, N., and Mulvey, M.R. remains unknown except for two genes closely related to 2008. Molecular characterization of Enterococcus faecalis N06- vanW and vanZ previously described in vanG, vanB, vanA, 0364 with low-level vancomycin resistance harboring a novel D- and vanF operons (Courvalin 2006; Sebaihia et al. 2006). Ala-D-Ser gene cluster, vanL. Antimicrob. Agents Chemother. The functions of vanW and vanZ are unknown, but it was es- 52(7): 2667–2672. doi:10.1128/AAC.01516-07. PMID:18458129.

Published by NRC Research Press Ammam et al. 551

Courvalin, P. 1990. Resistance of enterococci to glycopeptides. Lebreton, F., Depardieu, F., Bourdon, N., Fines-Guyon, M., Berger, Antimicrob. Agents Chemother. 34(12): 2291–2296. PMID: P., Camiade, S., et al. 2011. D-Ala-D-Ser VanN-type transferable 2088183. vancomycin resistance in Enterococcus faecium. Antimicrob. Courvalin, P. 2006. Vancomycin resistance in gram-positive cocci. Agents Chemother. 55(10): 4606–4612. doi:10.1128/AAC. Clin. Infect. Dis. 42(Suppl. 1): S25–S34. doi:10.1086/491711. 00714-11. PMID:21807981. PMID:16323116. Magnet, S., Courvalin, P., and Lambert, T. 1999. Activation of the Depardieu, F., Bonora, M.G., Reynolds, P.E., and Courvalin, P. 2003. cryptic aac(6′)-Iy aminoglycoside resistance gene of Salmonella The vanG glycopeptide resistance operon from Enterococcus by a chromosomal deletion generating a transcriptional fusion. J. faecalis revisited. Mol. Microbiol. 50(3): 931–948. doi:10.1046/j. Bacteriol. 181(21): 6650–6655. PMID:10542165. 1365-2958.2003.03737.x. PMID:14617152. Podglajen, I., Breuil, J., Bordon, F., Gutmann, L., and Collatz, E. Eidhin, D.N., Ryan, A.W., Doyle, R.M., Walsh, J.B., and Kelleher, D. 1992. A silent carbapenemase gene in strains of Bacteroides 2006. Sequence and phylogenetic analysis of the gene for surface fragilis can be expressed after a one-step mutation. FEMS layer protein, slpA, from 14 PCR ribotypes of Clostridium difficile. Microbiol. Lett. 70(1): 21–29. doi:10.1111/j.1574-6968.1992. J. Med. Microbiol. 55(1): 69–83. doi:10.1099/jmm.0.46204-0. tb05178.x. PMID:1577251. PMID:16388033. Reynolds, P.E., and Courvalin, P. 2005. Vancomycin resistance in Evers, S., Quintiliani, R.J., Jr, and Courvalin, P. 1996. Genetics of enterococci due to synthesis of precursors terminating in D-alanyl- glycopeptide resistance in enterococci. Microb. Drug Resist. 2(2): D-serine. Antimicrob. Agents Chemother. 49(1): 21–25. doi:10. 219–223. doi:10.1089/mdr.1996.2.219. PMID:9158763. 1128/AAC.49.1.21-25.2005. PMID:15616270. Kachrimanidou, M., and Malisiovas, N. 2011. Clostridium difficile Sebaihia, M., Wren, B.W., Mullany, P., Fairweather, N.F., Minton, infection: a comprehensive review. Crit. Rev. Microbiol. 37(3): N., Stabler, R., et al. 2006. The multidrug-resistant human 178–187. doi:10.3109/1040841X.2011.556598. PMID:21609252. pathogen Clostridium difficile has a highly mobile, mosaic Kurtz, S., Choudhuri, J.V., Ohlebusch, E., Schleiermacher, C., Stoye, genome. Nat. Genet. 38(7): 779–786. doi:10.1038/ng1830. J., and Giegerich, R. 2001. REPuter: the manifold applications of PMID:16804543. repeat analysis on a genomic scale. Nucleic Acids Res. 29(22): Xu, X., Lin, D., Yan, G., Ye, X., Wu, S., Guo, Y., et al. 2010. vanM,a 4633–4642. doi:10.1093/nar/29.22.4633. PMID:11713313. new glycopeptide resistance gene cluster found in Enterococcus Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGetti- faecium. Antimicrob. Agents Chemother. 54(11): 4643–4647. gan, P.A., McWilliam, H., et al. 2007. Clustal W and Clustal X doi:10.1128/AAC.01710-09. PMID:20733041. version 2.0. Bioinformatics, 23(21): 2947–2948. doi:10.1093/ bioinformatics/btm404. PMID:17846036. For personal use only. Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20

Published by NRC Research Press This article has been cited by:

1. Yanguang Cong, Sijin Yang, Xiancai Rao. 2020. Vancomycin resistant Staphylococcus aureus infections: A review of case updating and clinical features. Journal of Advanced Research 21, 169-176. [Crossref] 2. Wan-Jou Shen, Aditi Deshpande, Kirk E Hevener, Bradley T Endres, Kevin W Garey, Kelli L Palmer, Julian G Hurdle. 2019. Constitutive expression of the cryptic vanGCd operon promotes vancomycin resistance in Clostridioides difficile clinical isolates. Journal of Antimicrobial Chemotherapy 55. . [Crossref] 3. Fanshu Du, Xi Lv, Duan Duan, Liping Wang, Jinhu Huang. 2019. Characterization of a Linezolid- and Vancomycin-Resistant Streptococcus suis Isolate That Harbors optrA and vanG Operons. Frontiers in Microbiology 10. . [Crossref] 4. Miguel R. Lugo, A. Rod Merrill. 2019. An In-Silico Sequence-Structure-Function Analysis of the N-Terminal Lobe in CT Group Bacterial ADP-Ribosyltransferase Toxins. Toxins 11:6, 365. [Crossref] 5. Emily C. Woods, Daniela Wetzel, Monjori Mukerjee, Shonna M. McBride. 2018. Examination of the Clostridioides (Clostridium) difficile VanZ ortholog, CD1240. Anaerobe 53, 108-115. [Crossref] 6. Jinhu Huang, Li Chen, Daiwei Li, Mengli Wang, Fanshu Du, Yi Gao, Zuowei Wu, Liping Wang. 2018. Emergence of a vanG- carrying and multidrug resistant ICE in zoonotic pathogen Streptococccus suis. Veterinary Microbiology 222, 109-113. [Crossref] 7. Patrizia Spigaglia, Paola Mastrantonio, Fabrizio Barbanti. Antibiotic Resistances of Clostridium difficile 137-159. [Crossref] 8. Gabriel Ramírez-Vargas, Carlos Quesada-Gómez, Luis Acuña-Amador, Diana López-Ureña, Tatiana Murillo, María del Mar Gamboa-Coronado, Esteban Chaves-Olarte, Nicholas Thomson, Evelyn Rodríguez-Cavallini, César Rodríguez. 2017. A Clostridium difficile Lineage Endemic to Costa Rican Hospitals Is Multidrug Resistant by Acquisition of Chromosomal Mutations and Novel Mobile Genetic Elements. Antimicrobial Agents and Chemotherapy 61:4. . [Crossref] 9. Joseph A. Kirk, Oishik Banerji, Robert P. Fagan. 2017. Characteristics of the Clostridium difficile cell envelope and its importance in therapeutics. Microbial Biotechnology 10:1, 76-90. [Crossref] 10. Florence Depardieu, Patrice M. Courvalin. Glycopeptide-Resistance in Enterococci 289-305. [Crossref] 11. Daniel R. Knight, Grace O. Androga, Susan A. Ballard, Benjamin P. Howden, Thomas V. Riley. 2016. A Phenotypically Silent vanB2 Operon Carried on a Tn 1549 -Like Element in Clostridium difficile. mSphere 1:4. . [Crossref] 12. Sara B. Hernández, Felipe Cava. 2016. Environmental roles of microbial amino acid racemases. Environmental Microbiology 18:6, 1673-1685. [Crossref] 13. P. Spigaglia. 2016. Recent advances in the understanding of antibiotic resistance in Clostridium difficile infection. Therapeutic

For personal use only. Advances in Infectious Disease 3:1, 23-42. [Crossref] 14. Simon Baines, Mark Wilcox. 2015. Antimicrobial Resistance and Reduced Susceptibility in Clostridium difficile: Potential Consequences for Induction, Treatment, and Recurrence of C. difficile Infection. Antibiotics 4:3, 267-298. [Crossref] 15. Nicolas Berthet, Bruno Périchon, Christelle Mazuet, Diana Chapetón-Montes, Christiane Bouchier, Philippe Bouvet, Christine Legeay, Michel-Robert Popoff, Patrice Courvalin. 2015. A vanG-type locus in Clostridium argentinense. Journal of Antimicrobial Chemotherapy 70:7, 1942-1945. [Crossref] 16. Assaf Mizrahi, Anne Collignon, Séverine Péchiné. 2014. Passive and active immunization strategies against Clostridium difficile infections: State of the art. Anaerobe 30, 210-219. [Crossref] 17. Velusamy Srinivasan, Benjamin J. Metcalf, Kristen M. Knipe, Mahamoudou Ouattara, Lesley McGee, Patricia L. Shewmaker, Anita Glennen, Megin Nichols, Carol Harris, Mary Brimmage, Belinda Ostrowsky, Connie J. Park, Stephanie J. Schrag, Michael A. Frace, Scott A. Sammons, Bernard Beall. 2014. vanG Element Insertions within a Conserved Chromosomal Site Conferring Vancomycin Resistance to Streptococcus agalactiae and Streptococcus anginosus. mBio 5:4. . [Crossref] Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20 18. Fariza Ammam, Djalal Meziane-cherif, Dominique Mengin-Lecreulx, Didier Blanot, Delphine Patin, Ivo G. Boneca, Patrice Courvalin, Thierry Lambert, Thomas Candela. 2013. The functional vanG Cd cluster of Clostridium difficile does not confer vancomycin resistance. Molecular Microbiology 89:4, 612-625. [Crossref] 19. Johann Peltier, Pascal Courtin, Imane El Meouche, Manuella Catel-Ferreira, Marie-Pierre Chapot-Chartier, Ludovic Lemée, Jean-Louis Pons. 2013. Genomic and expression analysis of the vanG-like gene cluster of Clostridium difficile. Microbiology 159:Pt_7, 1510-1520. [Crossref]