DOCSLIB.ORG

Distribution of the Vang-Like Gene Cluster in Clostridium Difficile Clinical Isolates

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Distribution of the Vang-Like Gene Cluster in Clostridium Difficile Clinical Isolates 547 NOTE / NOTE Distribution of the vanG-like gene cluster in Clostridium difficile clinical isolates Fariza Ammam, Jean-Christophe Marvaud, and Thierry Lambert Abstract: Treatment of Clostridium difficile infections generally requires cessation of their causative antibiotic and subse- quent administration of metronidazole or vancomycin. Intriguingly, the genome of C. difficile 630 contains a cryptic gene cluster homologous to the vanG-type operon of Enterococcus faecalis BM4518. We detected this cluster by PCR in 35 out of 41 clinical isolates, confirming its large prevalence in this species. The cluster was found to be located in a unique locus. Comparison of this locus with that of strains devoid of the vanG-like cluster indicated that acquisition of the gene cluster occurred in a perfect 19-bp inverted repeat, in the absence of a detectable mobile structure. Key words: vanG-like, Clostridium difficile, cryptic genes. Résumé : Le traitement des infections liées à Clostridium difficile requiert en général l’arrêt de l’antibiothérapie responsable de l’implantation du microorganisme et l’administration du métronidazole ou de la vancomycine. Le génome de la souche C. difficile 630 héberge un groupe de gènes cryptiques homologue à l’opéron vanG de Enterococcus faecalis BM4518. Nous avons détecté ce groupe de gènes désigné vanG-like par PCR chez 35 parmi 41 isolats cliniques. Ce résultat reflète la forte prévalence de ce groupe de gènes chez C. difficile. Par ailleurs, vanG-like a été retrouvé localisé dans un même locus. La comparaison de ce locus avec celui des souches dépourvues de vanG-like indique que l’acquisition de ce dernier s’opère au niveau d’une séquence inversée répétée de 19 pb en l’absence d’une structure d’élément mobile identifiable. Mots‐clés : vanG-like, Clostridium difficile, gènes cryptiques. [Traduit par la Rédaction] For personal use only. Clostridium difficile is the cause of 15%–20% of cases of are the most prevalent vancomycin resistance determinants in antibiotic-associated diarrhea and of most cases of pseudo- enterococci (Arthur and Courvalin 1993; Evers et al. 1996). membranous colitis. Metronidazole and vancomycin are the The VanG-type is characterized by a low-level resistance to major antibiotics for treatment of C. difficile infections vancomycin (minimum inhibitory concentration 16 µg/mL) (Kachrimanidou and Malisiovas 2011). In silico analysis of and susceptibility to teicoplanin (Depardieu et al. 2003). The the C. difficile 630 genome revealed the presence of a gene vanG-like cluster of C. difficile includes five open reading cluster homologous to the vanG operon, which confers van- frames for putative proteins that share identity with VanRG comycin resistance in Enterococcus faecalis BM4518 (82%); VanSD and VanSG (59% and 50%, respectively); (Depardieu et al. 2003; Sebaihia et al. 2006). Glycopeptide VanG (66%); VanXYG (58%); and VanTG (62%), correspond- resistance in enterococci is due to a double mechanism that ing, respectively, to the regulator, sensor, D-Ala-D-Ser ligase, combines synthesis of modified peptidoglycan precursors D-D, peptidase, and serine racemase encoded by the vanG ending in D-alanyl-D-lactate (VanA, VanB, VanD, and operon. Despite the presence of genes homologous to the Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20 VanM) or D-alanyl-D-serine (VanC, VanE, VanG, VanL, and vanG operon, C. difficile remains susceptible to vancomycin. VanN) of low affinity for glycopeptide and elimination of This observation raises the question of the origin of these natural D-alanyl-D-alanine precursors (Boyd et al. 2008; genes and of their ability to generate vancomycin resistance. Courvalin 1990; Lebreton et al. 2011; Reynolds and Whole-genome microarray analysis of diverse C. difficile Courvalin 2005; Xu et al. 2010). This mechanism involves strains has shown large genome variability and the absence enzymatic activities encoded by genes organized in operons. of the vanG-like cluster in several strains (Sebaihia et al. Resistance to glycopeptide, first described in enterococci, has 2006). Thus we analyze here the distribution of this element now spread to other Gram-positive bacteria. VanA and VanB in C. difficile clinical isolates from various origins. Received 18 November 2011. Revision received 15 December 2011. Accepted 16 December 2011. Published at www.nrcresearchpress.com/cjm on 12 March 2012. F. Ammam, J.-C. Marvaud, and T. Lambert. EA 4043, USC INRA, Département de Microbiologie, Faculté de Pharmacie, Université Paris Sud, Châtenay-Malabry, France. Corresponding author: Jean-Christophe Marvaud (e-mail: [email protected]). Can. J. Microbiol. 58: 547–551 (2012) doi:10.1139/W2012-002 Published by NRC Research Press 548 Can. J. Microbiol. Vol. 58, 2012 Table 1. Characteristics of Clostridium difficile strains. Clinical vanG-like Strain TcdA TcdB PCR ribotypea Source country datab Year clusterc 630 A+B+ 012 Switzerland AAD 1982 + CD196 A+B+ 027 France PMC 1985 + 7241 A+B+ X France D 2000 + 89-638 A+B+ 014/020 France AC + 79-658 A+B+ ND France PMC + 3048 A+B+ X France D – 3751 A+B+ X France D 2003 + 1409 A+B+ 015 France U 2003 + 96-1827 A+B+ ND France U + FM 16 A+B+ X France PMC 1999 + FM 15 A–B+ 015 France PMC 1999 + 5445 A+B+ X France D 2000 + 94-416 A+B+ 031/053/057 France U + 4602 A+B+ 078/126 France U 2001 – 2348 A+B+ 014/020/077 France D + 4583 A–B+ 023 France D 2003 + 90-204 A+B+ ND France AC + 95-938 A+B+ ND France U + TL 1143 A–B+ 017 USA U – 4406 A+B+ 001 France D 2003 + 3457 A+B+ ND France D 2003 + 3290 A+B+ 015 France D + CD1 A+B+ ND Italia AAD 1999 + CD3 A+B+ X Italia AAD 1999 – CD20 A+B+ ND Italia AAD 1998 + C-253 A+B+ 012 Italia U + MI65 A+B+ ND Italia AAD 1992 + ATCC 43596 A+B+ 012 Belgium U + ATCC 43597 A–B– 010 Belgium U + ATCC 43598 A–B+ 017 Belgium AAD – For personal use only. ATCC 43599 A+B+ 001/115 Belgium U + ATCC 43600 A+B+ 014/020 Belgium U + ATCC 43601 A–B– ND Belgium U + ATCC 43602 A–B– 031/053/057 Belgium U + 4641 A+B+ ND France U + 56026 A–B– ND Belgium U + 95-1011 A+B+ ND France U + GAI 97482 A+B+ ND Japan AC 1998 + FM 12 A+B+ ND Canada PMC + FM 13 A+B+ 013 Canada PMC – FM 43 A+B+ ND Canada U + B1 A+B+ ND England PMC 1988 + aX, different than 001, 002, 003, 012, 014/020/077, 015, 017, 023, 027, 029, 046, 053, 056, 070, 075, 078/126, 081, 087, 095, 106, Can. J. Microbiol. Downloaded from www.nrcresearchpress.com by Health Canada on 01/22/20 117, 131; ND, not documented. Ribotypes in bold are from Eidhin et al. (2006). bAAD, antibiotic-associated diarrhea; PMC, pseudo-membranous colitis; D, diarrhea; AC, asymptomatic carriage; U, unknown. c+, present; –, absent. A total of 41 C. difficile strains were collected from various 6 strains devoid of the vanG-like cluster belonged to at least 4 geographical sources (France, Canada, Belgium, USA, Eng- different ribotypes. These data minimize a risk of redundancy. land, Switzerland, and Japan) and different clinical issues, in- Bacteria were grown overnight at 37 °C in an anaerobic cluding toxigenic (TcdA+ TcdB+ or TcdA– TcdB+) or atmosphere, on Brain Heart Infusion agar supplemented with nontoxigenic strains (Table 1). To avoid impacting sampling 5% defibrillated horse blood (BioMérieux, France). Genomic by strains’ clonality, French isolates, which represented 22 DNA was obtained using genomic DNA extraction kit (GFX out of 41 isolates of the study, were screened on the basis of Genomic Blood DNA Purification Kit, GE Healthcare) ac- a putative epidemiological link for PCR ribotyping analysis cording to the instructions of the supplier. Primers used for according to a procedure described elsewhere (Bidet et al. PCR mapping or sequencing are listed in Table 2. Briefly, 2000). Accordingly, 12 isolates analyzed were found to be dis- the presence of the vanG-like cluster in different strains was tributed in at least 7 PCR ribotypes (Table 1). In addition, the tested with primers vanTF and vanTR specific for the vanTG- Published by NRC Research Press Ammam et al. 549 Table 2. Oligonucleotide primers used in this study. Primer Primer sequence (5′—3′) Positiona vanRF CAAAGCCATTTAACCCTTTGGA +1882210, +1882231 vanRR TCTCCCCATACAGCTTCAAACA –1882458, –1882480 vanSF TGGATAAGGCAGAGCGTCTTG +1883198, +1883218 vanSR CGCTCAAGTTTTTCCTCTGGA –1883544, –1883564 vanYF TCGTACTGCAGAAGAACAACAAG +1885360, +1885382 vanYR TGCGGATATCCCACATAACG –1885646, –1885666 vanTF TCGAGCTAGGTTATTGCGAACA +1886721, +1886742 vanTR GCCATCAATTCACAATCTTCTGG –1887022, –1887042 vanGF GTTTCGCAGAACCGTGTCAA +1884228, +1884247 vanGR ACCAAATGATGAACCTGCAC –1884610, –1884629 N630 GATGGTTCATTAGTTGGAGCTATAC +1881359, +1881383 S630 CAAGTGGTAAGGCTGGTATAAAGC –1888465, –1888487 vanTF2 CTATTGGCTATGCCGATGGT +1887782, +1887801 vanR630 CTAGAGCTTCCTTACCTGTATAAAAC –1882001, –1882026 a+, sense primer; –, antisense primer. Nucleotide numbering is according to GenBank acc. No. AM180355.1. Fig. 1. Schematic representation of the vanG-like cluster from Clostridium difficile 630. vanTG-like positive strains (A) and vanTG-like negative strains (B) were further analyzed for PCR mapping with the primers indicated by arrowheads. The size of amplified regions is in- dicated in bp. For personal use only. like gene, which yielded a 324 bp amplicon. In the absence California) and Applied Biosystems ABI-PRISM-DNA ana- of a PCR product, primer pairs vanSF and vanSR, vanRF lyzer with N630 and S630 primers. Pairwise alignments of and vanRR, vanGF and vanGR, vanYF and vanYR were DNA sequences and identification of repeat motifs in DNA used to detect the vanSG-like, vanRG-like, vanG-like, and sequences were carried out using the program ClustalW2 vanXYG-like genes, respectively (Fig. 1B). In the vanTG-like (Larkin et al. 2007) and the program REPuter (Kurtz et al.
Load more

Recommended publications
  • Probiotic Properties of Enterococcus Faecium CE5-1 Producing A
    Czech J. Anim. Sci., 57, 2012 (11): 529–539 Original Paper Probiotic properties of Enterococcus faecium CE5-1 producing a bacteriocin-like substance and its antagonistic effect against antibiotic-resistant enterococci in vitro K. Saelim1, N. Sohsomboon1, S. Kaewsuwan2, S. Maneerat1 1Department of Industrial Biotechnology, Faculty of Agro-Industry, Prince of Songkla University, Hat Yai, Thailand 2Department of Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical Sciences, Prince of Songkla University, Hat Yai, Thailand ABSTRACT: A bacteriocin-like substance (BLS) producing Enterococcus faecium CE5-1 was isolated from the gastrointestinal tract (GIT) of Thai indigenous chickens. Investigations of its probiotic potential were carried out. The competition between the BLS probiotic strain and antibiotic-resistant enterococci was also studied. Ent. faecium CE5-1 exhibited a good tolerance to pH 3.0 after 2 h and in 7% fresh chicken bile after 6 h, but the viability of Ent. faecium CE5-1 decreased by about 2–3 log CFU/ml after 2 h incubation in pH 2.5. It was susceptible to the antibiotics tested (tetracycline, erythromycin, penicillin G, and vancomycin). The maximum BLS production from Ent. faecium CE5-1 was observed at 15 h of cultivation. It showed activity against Listeria monocytogenes DMST17303, Pediococcus pentosaceus 3CE27, Lactobacillus sakei subsp. sakei JCM1157, and antibiotic-resistant enterococci. The detection by polymerase chain reaction (PCR) in the enterocin structural gene determined the presence of enterocin A gene in Ent. faecium CE5-1 only. Ent. faecium CE5-1 showed the highest inhibitory activity against two antibiotic-resistant Ent. faecalis VanB (from 6.68 to 4.29 log CFU/ml) and Ent.
    [Show full text]
  • Detection of ESKAPE Pathogens and Clostridioides Difficile in Simulated
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.04.433847; this version posted March 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Detection of ESKAPE pathogens and Clostridioides difficile in 2 Simulated Skin Transmission Events with Metagenomic and 3 Metatranscriptomic Sequencing 4 5 Krista L. Ternusa#, Nicolette C. Keplingera, Anthony D. Kappella, Gene D. Godboldb, Veena 6 Palsikara, Carlos A. Acevedoa, Katharina L. Webera, Danielle S. LeSassiera, Kathleen Q. 7 Schultea, Nicole M. Westfalla, and F. Curtis Hewitta 8 9 aSignature Science, LLC, 8329 North Mopac Expressway, Austin, Texas, USA 10 bSignature Science, LLC, 1670 Discovery Drive, Charlottesville, VA, USA 11 12 #Address correspondence to Krista L. Ternus, [email protected] 13 14 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.04.433847; this version posted March 4, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 15 1 Abstract 16 Background: Antimicrobial resistance is a significant global threat, posing major public health 17 risks and economic costs to healthcare systems. Bacterial cultures are typically used to diagnose 18 healthcare-acquired infections (HAI); however, culture-dependent methods provide limited 19 presence/absence information and are not applicable to all pathogens.
    [Show full text]
  • Current Trends of Enterococci in Dairy Products: a Comprehensive Review of Their Multiple Roles
    foods Review Current Trends of Enterococci in Dairy Products: A Comprehensive Review of Their Multiple Roles Maria de Lurdes Enes Dapkevicius 1,2,* , Bruna Sgardioli 1,2 , Sandra P. A. Câmara 1,2, Patrícia Poeta 3,4 and Francisco Xavier Malcata 5,6,* 1 Faculty of Agricultural and Environmental Sciences, University of the Azores, 9700-042 Angra do Heroísmo, Portugal; [email protected] (B.S.); [email protected] (S.P.A.C.) 2 Institute of Agricultural and Environmental Research and Technology (IITAA), University of the Azores, 9700-042 Angra do Heroísmo, Portugal 3 Microbiology and Antibiotic Resistance Team (MicroART), Department of Veterinary Sciences, University of Trás-os-Montes and Alto Douro (UTAD), 5001-801 Vila Real, Portugal; [email protected] 4 Associated Laboratory for Green Chemistry (LAQV-REQUIMTE), University NOVA of Lisboa, 2829-516 Lisboa, Portugal 5 LEPABE—Laboratory for Process Engineering, Environment, Biotechnology and Energy, Faculty of Engineering, University of Porto, 420-465 Porto, Portugal 6 FEUP—Faculty of Engineering, University of Porto, 4200-465 Porto, Portugal * Correspondence: [email protected] (M.d.L.E.D.); [email protected] (F.X.M.) Abstract: As a genus that has evolved for resistance against adverse environmental factors and that readily exchanges genetic elements, enterococci are well adapted to the cheese environment and may reach high numbers in artisanal cheeses. Their metabolites impact cheese flavor, texture, Citation: Dapkevicius, M.d.L.E.; and rheological properties, thus contributing to the development of its typical sensorial properties. Sgardioli, B.; Câmara, S.P.A.; Poeta, P.; Due to their antimicrobial activity, enterococci modulate the cheese microbiota, stimulate autoly- Malcata, F.X.
    [Show full text]
  • Effects of Lactobacillus Rhamnosus and Enterococcus Faecalis Supplementation As Direct-Fed Microbials on Rumen Microbiota of Boer and Speckled Goat Breeds
    veterinary sciences Article Effects of Lactobacillus rhamnosus and Enterococcus faecalis Supplementation as Direct-Fed Microbials on Rumen Microbiota of Boer and Speckled Goat Breeds Takalani Whitney Maake 1,2, Olayinka Ayobami Aiyegoro 2,3,* and Matthew Adekunle Adeleke 1 1 Discipline of Genetics, School of Life Sciences, College of Agricultural, Engineering and Science, University of Kwazulu-Natal, Westville Campus, Private Bag X 54001, Durban 4000, South Africa; [email protected] (T.W.M.); [email protected] (M.A.A.) 2 Gastrointestinal Microbiology and Biotechnology, Agricultural Research Council-Animal Production, Private Bag X 02, Irene 0062, South Africa 3 Research Unit for Environmental Sciences and Management, North-West University, Potchefstroom Campus, Private Bag X 1290, Potchefstroom 2520, South Africa * Correspondence: [email protected] or [email protected]; Tel.: +27-126-729-368 Abstract: The effects on rumen microbial communities of direct-fed probiotics, Lactobacillus rhamnosus and Enterococcus faecalis, singly and in combination as feed supplements to both the Boer and Speckled goats were studied using the Illumina Miseq platform targeting the V3-V4 region of the 16S rRNA microbial genes from sampled rumen fluid. Thirty-six goats of both the Boer and Speckled were divided into five experimental groups: (T1) = diet + Lactobacillus rhamnosus; (T2) = diet + Enterococcus faecalis; (T3) = diet + Lactobacillus rhamnosus + Enterococcus faecalis; (T4, positive control) = diet + antibiotic and (T5, negative control) = diet without antibiotics and without probiotics. Our results revealed that Bacteroidetes, Firmicutes, TM7, Proteobacteria, and Euryarchaeota dominate Citation: Maake, T.W.; Aiyegoro, O.A.; Adeleke, M.A. Effects of the bacterial communities. In our observations, Lactobacillus rhamnosus and Enterococcus faecalis Lactobacillus rhamnosus and supplements reduced the archaeal population of Methanomassiliicocca in the T1, T2 and T3 groups, Enterococcus faecalis Supplementation and caused an increase in the T4 group.
    [Show full text]
  • Contribution of Enterococcus Faecalis to Urinary Tract Infection
    Western University Scholarship@Western Electronic Thesis and Dissertation Repository 3-29-2018 3:00 PM Contribution of Enterococcus faecalis to urinary tract infection Samantha Ann Whiteside The University of Western Ontario Supervisor Reid, Gregor The University of Western Ontario Co-Supervisor Burton, Jeremy P. The University of Western Ontario Graduate Program in Microbiology and Immunology A thesis submitted in partial fulfillment of the equirr ements for the degree in Doctor of Philosophy © Samantha Ann Whiteside 2018 Follow this and additional works at: https://ir.lib.uwo.ca/etd Part of the Bacterial Infections and Mycoses Commons Recommended Citation Whiteside, Samantha Ann, "Contribution of Enterococcus faecalis to urinary tract infection" (2018). Electronic Thesis and Dissertation Repository. 5270. https://ir.lib.uwo.ca/etd/5270 This Dissertation/Thesis is brought to you for free and open access by Scholarship@Western. It has been accepted for inclusion in Electronic Thesis and Dissertation Repository by an authorized administrator of Scholarship@Western. For more information, please contact [email protected]. Abstract The purpose of this thesis was to increase understanding of enterococcal urinary tract infection (UTI), in particular, the response of Enterococcus to antibiotic prophylaxis in vitro and in vivo and enterococcal communication with the bladder. We studied the in vitro effects of trimethoprim-sulfamethoxazole (TMP/SMX) and nitrofurantoin, two of the most commonly used antibiotic treatments for the management of both UTI and recurrent UTI (RUTI), on Enterococcus faecalis attachment to urothelial cells. In doing so, we documented increases in bacterial attachment at growth inhibitory concentrations of nitrofurantoin, but not TMP/SMX. This increased virulence did not correlate with increased expression of virulence factors but was correlated with increased expression of three putative genes.
    [Show full text]
  • Methicillin-Resistant Staphylococcus Aureus (MRSA)
    Methicillin-Resistant Staphylococcus Aureus (MRSA) Over the past several decades, the incidence of resistant gram-positive organisms has risen in the United States. MRSA strains, first identified in the 1960s in England, were first observed in the U.S. in the mid 1980s.1 Resistance quickly developed, increasing from 2.4% in 1979 to 29% in 1991.2 The current prevalence for MRSA in hospitals and other facilities ranges from <10% to 65%. In 1999, MRSA accounted for more than 50% of all Staphylococcus aureus isolates within U.S. intensive care units.3, 4 The past years, however, outbreaks of MRSA have also been seen in the community setting, particularly among preschool-age children, some of whom have attended day-care centers.5, 6, 7 MRSA does not appear to be more virulent than methicillin-sensitive Staphylococcus aureus, but certainly poses a greater treatment challenge. MRSA also has been associated with higher hospital costs and mortality.8 Within a decade of its development, methicillin resistance to Staphylococcus aureus emerged.9 MRSA strains generally are now resistant to other antimicrobial classes including aminoglycosides, beta-lactams, carbapenems, cephalosporins, fluoroquinolones and macrolides.10,11 Most of the resistance was secondary to production of beta-lactamase enzymes or intrinsic resistance with alterations in penicillin-binding proteins. Staphylococcus aureus is the most frequent cause of nosocomial pneumonia and surgical- wound infections and the second most common cause of nosocomial bloodstream infections.12 Long-term care facilities (LTCFs) have developed rates of MRSA ranging from 25%-35%. MRSA rates may be higher in LTCFs if they are associated with hospitals that have higher rates.13 Transmission of MRSA generally occurs through direct or indirect contact with a reservoir.
    [Show full text]
  • Characterization of Enterocin 1146, a Bacteriocin from Enterococcus Faecium Inhibitory to Listeria Monocytogenes
    497 Journal of Food Protection, Vol. 55, No. 7, Pages 497-502 (July 1992) Copyright©, International Association of Milk, Food and Environmental Sanitarians Characterization of Enterocin 1146, a Bacteriocin from Enterococcus faecium Inhibitory to Listeria monocytogenes EUGENIO PARENTE1 and COLIN HILL* The National Dairy Products Research Centre, Moorepark, Fermoy, Co. Cork, The Irish Republic Downloaded from http://meridian.allenpress.com/jfp/article-pdf/55/7/497/1661676/0362-028x-55_7_497.pdf by guest on 25 September 2021 (Received for publication November 12, 1991) ABSTRACT cultures has been proposed for Cheddar cheese (37), Fontina cheese (6), and water-buffalo Mozzarella cheese (57). Enterococcus faecium DPC 1146 produces a bacteriocin, In this report we describe the characterization of enterocin 1146, which is inhibitory to Listeria monocytogenes. Enterocin 1146 was produced in GM17 and in milk. The bacterio­ enterocin 1146, a bacteriocin produced by E. faecium cin was partially purified by ammonium sulfate precipitation. Its DPC1146, which is relatively specific to Listeria spp. molecular weight, estimated by SDS-PAGE, was 3.0 kDa. It could be stored at -20°C without loss of activity, but pH had a marked MATERIALS AND METHODS effect on enterocin 1146, which was more stable at both high (up to 120°C) and low temperatures (4°C) at pH 5 than at pH 7 and Strains and media 9. The sensitivity of 57 strains belonging to 35 different species Enterocin 1146 is produced by E. faecium DPC1146. Unless was studied using a critical dilution assay. L. monocytogenes and otherwise noted L. innocua DPC 1770 was used as the indicator L.
    [Show full text]
  • Transfer of Streptococcus Faecalis and Streptococcus Faecium to the Genus Enterococcus Norn
    INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, Jan. 1984, p. 31-34 Vol. 34, No. 1 OO20-7713/84/010031-04$02.00/0 Copyright 0 1984, International Union of Microbiological Societies Transfer of Streptococcus faecalis and Streptococcus faecium to the Genus Enterococcus norn. rev. as Enterococcus faecalis comb. nov. and Enterococcus faecium comb. nov. KARL H. SCHLEIFER* AND RENATE KILPPER-BALZ Lehrstuhl fur Mikrobiologie, Technische Universitat Miinchen, D-8000 Miinchen 2, Federal Republic of Germany The results of deoxyribonucleic acid-deoxyribonucleic acid and deoxyribonucleic acid-ribosomal ribonu- cleic acid hybridization studies demonstrated that Streptococcus faecalis and Streptococcus faecium are distantly related to the non-enterococcal streptococci (Streptococcus hovis and Streptococcus equinus) of serological group D and to other streptococci. On the basis of our results and those of previous studies, we propose that S. faecalis and S. faecium be transferred to the genus Enterococcus (ex Thiercelin and Jouhaud) nom. rev. as Enterococcus faecalis (Andrewes and Horder) comb. nov. and Enterococcus faecium (Orla-Jensen) comb. nov., respectively. A description of the genus Enterococcus nom. rev. and emended descriptions of E. faecalis and E. faecium are given. The streptococci belonging to serological group D can be De Ley (4) and were corrected to the value for the reference divided into two physiologically different groups. Strepto- Escherichia coli K-12 DNA. coccus faecalis and Streptococcus faecium were placed in the enterococcus division of the streptococci, whereas RESULTS AND DISCUSSION Streptococcus bovis and Streptococcus equinus were placed in the viridans division by Sherman (21). Kalina proposed (9) The DNA base compositions, serological groups, and that Streptococcus faecalis and Streptococcus faecium peptidoglycan types of the test strains are shown in Table 1.
    [Show full text]
  • Identification, Properties, and Application of Enterocins Produced by Enterococcal Isolates from Foods
    IDENTIFICATION, PROPERTIES, AND APPLICATION OF ENTEROCINS PRODUCED BY ENTEROCOCCAL ISOLATES FROM FOODS THESIS Presented in Partial Fulfillment of the Requirement for the Degree Master of Science in the Graduate School of The Ohio State University By Xueying Zhang, B.S. ***** The Ohio State University 2008 Master Committee: Approved by Professor Ahmed E. Yousef, Advisor Professor Hua Wang __________________________ Professor Luis Rodriguez-Saona Advisor Food Science and Nutrition ABSTRACT Bacteriocins produced by lactic acid bacteria have gained great attention because they have potentials for use as natural preservatives to improve food safety and stability. The objectives of the present study were to (1) screen foods and food products for lactic acid bacteria with antimicrobial activity against Gram-positive bacteria, (2) investigate virulence factors and antibiotic resistance among bacteriocin-producing enterooccal isolates, (3) characterize the antimicrobial agents and their structural gene, and (4) explore the feasibility of using these bacteriocins as food preservatives. In search for food-grade bacteriocin-producing bacteria that are active against spoilage and pathogenic microorganisms, various commercial food products were screened and fifty-one promising Gram-positive isolates were studied. Among them, fourteen food isolates with antimicrobial activity against food-borne pathogenic bacteria, Listeria monocytogenes and Bacillus cereus, were chosen for further study. Based on 16S ribosomal RNA gene sequence analysis, fourteen food isolates were identified as Enterococcus faecalis, and these enterococcal isolates were investigated for the presence of virulence factors and antibiotic resistance through genotypic and phenotypic screening. Results indicated that isolates encoded some combination of virulence factors. The esp gene, encoding extracellular surface protein, was not detected in any of the isolates.
    [Show full text]
  • Characterization of an Endolysin Targeting Clostridioides Difficile
    International Journal of Molecular Sciences Article Characterization of an Endolysin Targeting Clostridioides difficile That Affects Spore Outgrowth Shakhinur Islam Mondal 1,2 , Arzuba Akter 3, Lorraine A. Draper 1,4 , R. Paul Ross 1 and Colin Hill 1,4,* 1 APC Microbiome Ireland, University College Cork, T12 YT20 Cork, Ireland; [email protected] (S.I.M.); [email protected] (L.A.D.); [email protected] (R.P.R.) 2 Genetic Engineering and Biotechnology Department, Shahjalal University of Science and Technology, Sylhet 3114, Bangladesh 3 Biochemistry and Molecular Biology Department, Shahjalal University of Science and Technology, Sylhet 3114, Bangladesh; [email protected] 4 School of Microbiology, University College Cork, T12 K8AF Cork, Ireland * Correspondence: [email protected] Abstract: Clostridioides difficile is a spore-forming enteric pathogen causing life-threatening diarrhoea and colitis. Microbial disruption caused by antibiotics has been linked with susceptibility to, and transmission and relapse of, C. difficile infection. Therefore, there is an urgent need for novel therapeutics that are effective in preventing C. difficile growth, spore germination, and outgrowth. In recent years bacteriophage-derived endolysins and their derivatives show promise as a novel class of antibacterial agents. In this study, we recombinantly expressed and characterized a cell wall hydrolase (CWH) lysin from C. difficile phage, phiMMP01. The full-length CWH displayed lytic activity against selected C. difficile strains. However, removing the N-terminal cell wall binding domain, creating CWH351—656, resulted in increased and/or an expanded lytic spectrum of activity. C. difficile specificity was retained versus commensal clostridia and other bacterial species.
    [Show full text]
  • Enterococcus Faecium Bacteremia Does Vancomycin Resistance Make a Difference?
    ORIGINAL INVESTIGATION Enterococcus faecium Bacteremia Does Vancomycin Resistance Make a Difference? Valentina Stosor, MD; Lance R. Peterson, MD; Michael Postelnick, RPh; Gary A. Noskin, MD Background: Enterococcus faecium has received in- eters (P=.01). Fifty-nine percent of the patients with VSE creased attention, primarily due to the emergence of van- bacteremia survived vs 24% with VRE (P=.009), despite comycin resistance. The purpose of this investigation was similar severity-of-illness scores. In 62% of the patients to study the epidemiological characteristics of vancomy- with VRE sepsis, death was related to the bacteremia cin-resistant E faecium (VRE) bacteremia and to deter- (P=.01). Patients infected with VRE had longer hospi- mine the clinical impact of vancomycin resistance on the talizations than those with VSE (34.8 vs 16.7 days, re- outcome of patients with this infection. spectively) (P=.004), were more likely to be on the medi- cal service (P=.03), and on the average, had hospitalization Methods: We retrospectively analyzed the clinical features costs of more than $27 000 per episode than did pa- and outcome of 53 patients with E faecium bacteremia. tients with VSE bloodstream infection ($83 897 vs $56 707, respectively) (P=.04). Results: From January 1992 until December 1995, there were 32 episodes of bacteremia caused by vancomycin- Conclusions: Vancomycin-resistant E faecium bactere- susceptible E faecium (VSE) and 21 caused by VRE. An mia is a complication of prolonged hospitalization in de- intra-abdominal site was the most common source of bac- bilitated patients. Vancomycin resistance has a negative teremia in both groups.
    [Show full text]
  • Clostridioides Difficile As a Dynamic Vehicle for The
    microorganisms Review Clostridioides difficile as a Dynamic Vehicle for the Dissemination of Antimicrobial-Resistance Determinants: Review and In Silico Analysis Philip Kartalidis 1, Anargyros Skoulakis 1, Katerina Tsilipounidaki 1 , Zoi Florou 1, Efthymia Petinaki 1 and George C. Fthenakis 2,* 1 Department of Clinical and Laboratory Research, Faculty of Medicine, School of Health Sciences, University of Thessaly, 41110 Larissa, Greece; [email protected] (P.K.); [email protected] (A.S.); [email protected] (K.T.); zoi_fl@hotmail.com (Z.F.); [email protected] (E.P.) 2 Veterinary Faculty, University of Thessaly, 43100 Karditsa, Greece * Correspondence: [email protected] Abstract: The present paper is divided into two parts. The first part focuses on the role of Clostrid- ioides difficile in the accumulation of genes associated with antimicrobial resistance and then the transmission of them to other pathogenic bacteria occupying the same human intestinal niche. The second part describes an in silico analysis of the genomes of C. difficile available in GenBank, with regard to the presence of mobile genetic elements and antimicrobial resistance genes. The diversity of the C. difficile genome is discussed, and the current status of resistance of the organisms to various antimicrobial agents is reviewed. The role of transposons associated with antimicrobial resistance is Citation: Kartalidis, P.; Skoulakis, A.; appraised; the importance of plasmids associated with antimicrobial resistance is discussed, and the Tsilipounidaki, K.; Florou, Z.; significance of bacteriophages as a potential shuttle for antimicrobial resistance genes is presented. Petinaki, E.; Fthenakis, G.C. In the in silico study, 1101 C. difficile genomes were found to harbor mobile genetic elements; Tn6009, Clostridioides difficile as a Dynamic Tn6105, CTn7 and Tn6192, Tn6194 and IS256 were the ones more frequently identified.
    [Show full text]