The Cytotoxic Effects of Morinda Citrifolia Through Tlr4 in Human Breast Cancer Cells

THE CYTOTOXIC EFFECTS OF MORINDA CITRIFOLIA THROUGH TLR4 IN HUMAN BREAST CANCER CELLS

A DISSERTATION

SUBMITTED TO THE FACULTY OF CLARK ATLANTA UNIVERSITY

IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR

THE DEGREE OF DOCTOR OF PHILOSOPHY

SABRENIA M. PARKER

DEPARTMENT OF CHEMISTRY

ATLANTA, GEORGIA

SABRENIA M. PARKER

ACKNOWLEDGMENTS.. 11

LIST OF FIGURES x

LIST OF TABLES xii

LIST OF ABBREVIATIONS xlii

CHAPTER 1: INTRODUCTION

1.1 Background and Review of Literature 1

1.1.1 What is Complementary and Alternative Medicine9 1

1.1.2 What is Morinda citr~folia9 3

1.1.2.1 Origin 3

1.1.2.2 Traditional and Modern Uses 3

1.1.2.3 ProfihingM. citr~folia 6

1.1.2.4 Evidence of Bio logical Activity 12

1.1.3 Breast Cancer 15

1.1.3.1 Prevalence 15

1.1.3.2 Risk Factors 17

1.1.3.3 Etiology 17

1.1.4 Immunology: Innate and Adaptive Immunity 19

1.1.4.1 Immunity 19

1.1.4.2 Toll-like Receptors 20

1.1.4.2.1 Summary of the TLR Signaling Pathway. . . 22

1.1.4.2.2 Toll-like Receptor 4 25 1.1.5 Recent Patents in the TLR Pathway 28

1.1.5.1 Toll-like Receptor Patents. . . 28

1.1.5.2 TLR variants 28

1.1.5.3 Adaptor proteins 30

1.1.6 Cancer Cells and Immune Surveillance. 31

1.2 Specific Aims 33

CHAPTER 2: RESEARCH DESIGN AND METHODOLOGY

2.1 Subject Stock 37

2.1.1 Cell lines and culture 37

2.1.2 Morindacitrifolia 37

2.2 Empirical Data and Collection 38

2.2.1 Small-scale extractions of noni powder 38

2.2.2 Large-scale extractions of noni powder in BuOH 41

2.2.3 Analysis of cell cytotoxicity 41

2.2.3.1 Single treatment with noni extraction dilutions 41

2.2.3.2 Multiple treatments with noni extraction dilutions . . . 42

2.2.3.3 Treatment with BuNoni dilutions plus LPS-RS 42

2.2.4 GeneChip Target Preparation and Hybridization 43

2.2.5 Microarray Data Analysis 44

2.2.6 Semiquantitative Reverse Transcription PCR 44

2.2.6.1 RT-PCR verification 47

2.2.6.2 Western blot analysis 48

vii 2.2.7 CytoTox~ONETM Homogeneous Membrane Integrity Assay. . . 50

2.2.8 Wound-healing Assay 51

2.2.9 Colony formation Assay 51

2.2.10 FACS analysis and Annexin V/PE Assay 52

2.2.10.1 Analysis of cellular DNA content by flow cytometry. 52

2.2.10.2 Assessment ofApoptosis 53

2.2.11 IC50 (Dose-response curve) Assay 53

2.3 Statistical Analysis 54

CHAPTER 3: RESULTS AND DISCUSSION

3.1. Noni Characterized 55

3.2 Results Observed 55

3.2.1 Extracts ofNoni display cytotoxic effects 55

3.2.2 BuNoni’s IC50 value in cell proliferation 62

3.2.3 Gene expression profiles identify cytotoxic pathways • 63

3.2.3.1 Microarray results were confirmed 78

3.2.3.2 Signaling pathway was analyzed 80

3.2.4 TLR4 agonist induces cell death in human BrCa cells • 86

3.2.5 Viability assays used to show the cytotoxic effect of BuNoni. 91

3.2.5.1 BuNoni extract caused a decrease in LDH 91

3.2.5.2 FACS shows BuNoni extract caused apoptotic effect. 93

3.2.6 BuNoni inhibits cell migration and alters cell structure 98

viii . 3.2.7 BuNoni prevents tumor formation • . • • 102

3.3 Discussion of Results • . • 104

3.3.1 Effect of extraction on cell proliferation • .111

3.3.2 Clinical Impact of the Research • . . 112

3.4 Conclusion • . . .118

3.5 Future Directions and Impact 121

4.0 References 125 LIST OF FIGURES

Figure Page

1. Morinda citr~folia plant 4

2. Structures of glycosidic sugars isolated from M. citrifolia 11

3. Toll-like Receptor Pathway 24

4. Multi-solvent Survival Curves 59

5. BuOH Survival Curve with MDA-MB-231 cells 62

6. Dose Response Curve of BuNoni on MDA-MB-23 1 cells 63

7. RT-PCR Confirmations using BuNoniILPS 80

8. Ingenuity Pathway 82

9. RT-PCR Gene Confirmation 85

10. TLR4 Expression on Breast Cancer Cell Line Panel 86

11. Comparison of Glycosides from BuNoni extract 87

12. Effect of BuNoni on Proliferation ofMDA-JvfB-231 Cells 89

13. Effect of BuNoni on Proliferation of T47-D Cells 89

14. Effect of LPS-RS on MDA-MB-231 Cell Survival 91

15. Effect of LPS-RS on MDA-MB-23 1 Cells % Recovery 91

16. Lactate Dehydrogenase Measurement 94

17. Flow Cytometric Analysis 96

18. IRAK-1 Analysis 97

19. Caspase-7 Analysis 98

20. PARP/IRAK-4/IRAK-2 Analysis 98 21. Wound Healing ~a1ysis ~ 100

22. Morphology Observation 103

23. Colony Formation Assay Results 105

24. TLR4 Pathway Leading to Apoptosis 111

25. Toll-like Receptor Pathway with BuNoni 116 LIST OF TABLES

Table Page

1. List of Compounds Found in Morinda citr~folia...... 7

2. List of Toll-like Receptors and Their Mutants 29

3. List of Adaptor Proteins 31

4. List of Solvent Abbreviations 39

5. Microscale Extraction Solvents 40

6. List of RT-PCR Primers 45

7. List of 1°Antibodies 49

8. List of 2° Antibodies 50

9. Microarray List of Regulated Genes 65

10. List of Select Regulated Genes 77

11. Description of Human BrCa Cell Lines. . 84

xii LIST OF ABBREVIATIONS

AM Alternative Medicine

AMPK AMP-activated protein kinase

AP-l Activator protein-i

BMI Body Mass Index

BrCa Breast Cancer

BuOH Butanol

BuNoni Butanol Noni extract

C. albicans Candida albicans

CAM Complementary and Alternative Medicine

CD14 Cluster of differentiation 14 cRNA Copy ribonucleic acid

CHC13 Chloroform

CM Complementary Medicine

CpG Cytosine—phosphate-—-Guanine

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid cDNA Copy deoxyribonucleic acid

DPPH 1,1 -Diphenyl-2-Picrylhydrazyl

DTT Dithiotbreitol

DXR Doxorubicin

EDTA Ethylenedinitrile tetra-acetic acid

EGFR Epidermal growth factor receptor

xiii EGTA Ethylene glycol tetra-acetic acid

ER Estrogen Receptor

Era Estrogen receptor-a

EtBr Ethidium bromide

EtOH Ethanol

FAAD Fas-Associated Death Domain Protein

FACS Fluorescence-activated cell sorter

FBS Fetal Bovine Serum

Fyn Human gene ofprotein-tyrosine kinase oncogene family

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

GPR3O G Protein-coupled Receptor 30

HC1 Hydrochloric acid

HepOH Heptanol

HER2 Human epidermal growth factor receptor-2

HexOH Hexanol

HIV Human immunodeficiency virus

HRP Horseradish peroxidase-conjugated

HRT Hormone replacement therapy

1C50 Half maximal inhibitory concentration

IFN-~3 Interferon-Beta

IgG Immunoglobulin G

IHC Immunohistochemistry

IKK Inhibitor of Kappa Light Polypeptide Gene Enhancer in B Cells Kinase

xiv IL-i Interleukin- 1

IL-i R Interleukin- 1 Receptor

IRAK Interleukin (IL)- 1 Receptor—associated Kinase

IRF Interferon regulatory factor

JNK c-Jun N-terminal Kinase

Lck Leukocyte-specific protein tyrosine kinase

LDH Lactate dehydrogenase

LLC Lewis Lung Carcinoma

LPS Lipopolysaccharide

LPS-RS Rhodobacter sphaeroides lipopolysaccaride luc Luciferase-positive

Lyn V-yes-i Yamaguchi sarcoma viral related oncogene homolog

M. citrifolia Morinda citrifolia

MAPK Mitogen-activated protein kinases

MD-2 Lymphocyte antigen 96

MeOH Methanol

MgC12 Magnesium Chloride

MKK Mitogen-Activated Protein Kinase Kinase mRNA Messenger ribonucleic acid

MS Mass Spectometry

MSDS Material safety data sheet

MyD88 Myeloid differentiation primary response gene (88)

NaC1 Sodium Chloride NF-icB Nuclear Factor-Kappa B

NIH National Institutes of Health

NMR Nuclear magnetic resonance

OctOH Octanol

OXL Oxaliplatin

PBS Phosphate buffered saline

PE Phycoerythrin

PenOH Pentanol

P1 Propidium iodide

PR Progesterone Receptor

PrOH Propanol

PVDF Polyvinylidene Fluoride membrane

RNA Ribonucleic acid

RPMI Roswell Park Memorial Institute

RT Reverse transcriptase

RTPCR Reverse transcription-polymerase chain reaction

SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis

Ser/Thr Serine/Threonine shRNA Short hairpin RNA

Src A family of proto-oncogenic tyrosine kinases

TBE Tris-Borate-EDTA buffer

TBK-1 TANK-binding kinase 1

TBST Tris-Buffered Saline Tween-20

xvi TC Cytotoxic T cell

TIR Toll-interleukin 1 receptor

TIRAP Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein

TLR Toll-like Receptor

TNF Tumor necrosis factor

TNJ Tahitian Noni Juice®

TRAF TNF Receptor Associated Factor

TRAM TRIF-related adaptor molecule

Treg Thymus regulatory cells

TRIF TIR-domain-containing adapter-inducing interferon-~3

Tris—HC1 Tris hydrochloric acid

UVB-induced Ultraviolet radiation-induced at wavelength 290 to 320 nm

xvii ACKNOWLEDGMENTS

This is dedicated to Reagan and Riley and the future Parker children to come. I would like to thank my family and friends for their constant encouragement and support throughout the course of this dissertation when it seemed this day would never come. More directly, I would like to thank my children for their understanding and unconditional love during this time of hard work and for believing in me and praying that I achieved my education goals to leave a new legacy for generations to come. I would like to thank the National Institutes of Health (NIH), National

Center for Complementary and Alternative Medicine (NCCAM) for support from grant

#5R03AT003935-02. I would also like to thank the Minority Biomedical Research Support

(MBRS) Research Initiative for Scientific Enhancement (RISE) Program-NIH! National Institute of General Medical Sciences (NIGMS) for support from grant #5R25GM060414. I would like to thank the laboratories at Emory Winship Cancer Center for working with me to ensure that I completed my task at hand. I would also like to thank my professors for their patience and explanations throughout my research and this dissertation writing process. And, I would like to especially thank Dr. Paul McGeady (deceased) for giving me this opportunity and encouraging me to finish the task he started. CHAPTER 1

INTRODUCTION

1.1 Background and Review ofLiterature

1.1.1 What is Complementary and Alternative Medicine?

Complementary and alternative medicine (CAM), as used in the modern western world, covers an extensive range of medical approaches that do not fall within the realm of conventional medicine. CAM is a broad domain of healing resources that encompasses diverse health care systems and medical treatments, healing therapies, and various nontraditional medical approaches, which includes those health care practices and products not currently considered a fundamental part oftraditional medicineJ’31

CAM practices complement mainstream medicine and are described by its users as preventing or treating illness, and promoting health and well being.~3’4~ The use of CAM contributes to a common whole, whether by satisfying a therapeutic demand not met by conventional practices, or by diversifying the conceptual basis of medicine.

Although the two are used interchangeably, the distinction between complementary and alternative therapies is crucial.~’1 Complementary medicine (CM) is a group of diagnostic and therapeutic disciplines used in conjunction with conventional medicine. For example with complementary aromatherapy, the scent of oils from plants and trees, once inhaled, purportedly promotes health and well-being and helps to lessen a patient’s discomfort following surgery. [591 CM is typically used to supplement 2 mainstream medicine while relieving the symptoms of a disease or disorder through noninvasive treatments that carry minimal or no side effects. Although CM is usually not taught or used in Western medical schools or hospitals, the integration of conventional medicine and CM therapies is of increasing interest.~’°’41 This is, in part, because CM addresses how disease affects the whole person; ergo, it is sometimes referred to as holistic medicine. CM also includes acupuncture, herbal medicine, massage, support groups, and yoga.~517~

Alternative medicine (AM), on the other hand, is used in place of conventional medicine. AM covers a broad range of unconventional healing philosophies combined with a rich array of techniques, modalities, and approaches that use natural substances such as herbs, botanicals, homeopathics, nutritional supplements, and whole foods.~’8’ 19]

Case in point, instead of undergoing surgery, radiation, or chemotherapy, conventional doctors have recommended using a special diet to treat cancer, which is just one of many examples of an AM.~20’211 Chemoprevention is another promising AM emerging in cancer research, which administers therapeutic agents to inhibit, delay, or reverse the process of carcinogenesisJ221 Although a fair amount ofwhat is labeled AM comes to us from other cultures or from ancient healing traditions, a great deal of what is now labeled AM originated in the United States. Alternative therapies include folk medicine, herbal medicine, diet fads, homeopathy, faith healing, new-age healing, chiropractic, acupuncture, naturopathy, and music therapy. [23~241

A small number of CAM therapies originally considered to be purely alternative approaches are finding a place in cancer treatment, though not as cures, but as complementary therapies that may help patients feel better and recover faster. Use of 3 alternative medicines, particularly herbal supplements, has increased considerably over the past two decades in the US. The American market for herbs and other botanical remedies was $4.5 billion in 2007, and there is increasing media focus on the benefits of these preparations.~’8’ 25-30] The total costs for conventional care when combined with

CAM are observably lower than the average costs annually. However, an important gap exists between the knowledge-based statistical and mechanistic understandings of the effects of these supplements and the claims made by their distributors. No single determinant of the present popularity of CAM exists, but there is a correlation between signs ofpositive effects and the sales figures of commercial CAM products. Whether applied singly or in combination with conventional medicine, CAM offers maximum therapeutic benefit by incorporating plant, animal and mineral based medicines to treat, diagnose, and prevent illnesses and/or maintain well-beingJ31341

1.1.2 What is Morinda cit4folia?

1.1.2.1 Origin

Identified in older botanical literature as Indian mulberry, Morinda citr~folia is a member of the family Rubiaceae and is known to modern-day users as noni It is indigenous to Southeast Asia, perhaps originating in Indonesia, and is a native tree

(approximately 3 — 9 meters tall) found along the coastlines of many Pacific regions.~351

The noni plant grows well on any soil, including sandy shores and open rocky as well as shady forests. It is tolerant of saline soils, drought conditions, and secondary soils; hence it is found on volcanic loams, lava-strewn coasts, and clearings or limestone outcrops. Despite its indifference to growth terrains, this shrub reaches maturity in 4 about 18 months, standing heights of 15-20 feet and yielding between 4-8 kilograms

(kg) of fruit every month throughout the year. The plant flowers and produces a small white flower, growing from a fleshy structure. The noni fruit is oval and medium sized of approximately 4-7 centimeters (cm) and has many seeds as shown in figure 1.[36401

At first, the fruit buds green, then turns light yellow or white when ripe; it has a pungent odor when ripening and is thus oddly known as vomit fruit. Because of its impartial ground preferences, the Pacific regions house the optimal source of climate, soil conditions and the ideal environment, which allows M. citr~folia to grow larger and more lush there.~37’38’411

Fig. 1. Morinda citifolia.

1.1.2.2 Traditional and Modern Uses

Practically all of the noni plant is usable, contributing to its popularity throughout the Pacific. It was domesticated and cultivated by the Polynesians and

Tahitians nearly 2000 years ago and was eventually adopted by Hawaiians.~35’411 Oddly, 5 the fruit is pungent and is sometimes also called the starvation or vomit fruit; notwithstanding its strong smell and bitter taste, the early Polynesians consumed noni in times of famine. Traditionally, Australian aborigines consumed whole noni fruit as did the people in Burma, who ate the ripened fruit raw with salt and cooked unripe fruits in curries and other dishes.~411 The young leaves were also eaten as a dietary source, containing 4-6% of protein, and even the seeds are edible when roasted.~421 Today, cultivators focus primarily on the fruit and its juice, but the roots and bark contain pigments that were also used by Polynesian natives as dyes for cloths.~41~

Depending upon the regional location and the needs of the native people, the traditional medicinal uses of the noni plant varies as well. Research into the medical applications of noni indicate that virtually every part of the plant is used as some form of medicine, and native healers have exploited its therapeutic qualities for ages.~411 It is the second most popular plant used in herbal remedies of Pacific Islanders, especially

Hawaiians; the leaves, flowers, fruit, and bark are used to treat eye disorders, skin wounds and abscesses, gum and throat problems, respiratory ailments, constipation, and fever. Noni is also used in India for its unique ability to improve physical conditions. In

Malaysia, the ripe fruits are infused with water, and then gargled to relieve sore throats, and the heated leaves are applied to the chest to alleviate coughs, nausea, and colic. It has been noted for its curative effects in both low blood pressure and high blood pressure.~431 Hirazumi et al. (1999) reported that noni is used to treat cancer, infection, arthritis, diabetes, asthma, and hypertension.~441 Other conditions treated with noni, either alone or in combination with other botanicals, include fevers, heart disease, respiratory ailments, gastrointestinal, skin disease, menstrual or urinary problems, 6 diabetes, human immunodeficiency virus (HIV), and venereal diseases.~39’431 Noni users also report that benefits of using it include immediate energy and enhanced physical performance, and many producers and distributors now offer it as a “healthier” alternative to sugary energy drinics and sodas.~45~ The National Institutes of Health

(NIH) has sponsored clinical trials using well-defined preparations of noni to characterize and determine the tolerated dose ofnoni fruit extracts, and anti-tumor and symptom control properties of the extract. [46]

1.1.2.3 Profiling M citr~folia

Chemicals from plant sources that possess protective or disease preventive properties, but lack nutritional value, are called phytochemicals and interchangeably nutraceuticals. Most identified biologically active phytochemicals possess antioxidant activity, protect eukaryotic cells against oxidative damage, and reduce the risk of developing certain types of cancers.~47’481 The M citr~folia plant has enjoyed decades in the limelight as popular folk medicine, and a variety of phytochemical constituents have been identified in the leaves, bark, stem, flowers and fruits of the plant as shown in

Table 1. [35, 37, 39,41,49-62] Various components of noni have been shown to display epidemiological effects on human health; currently, there are several ongoing scientific studies using noni to analyze its chemical effects, revealing a plethora of new insights into the biological and pharmacological benefits of its use. In particular, the efficacy of noni on human cancers with respect to antitumor activity is of great interest.~42’56’631

Presumably, the biomedical interest in noni has increased over the last decade primarily because of its effects on cell proliferation and activity. 7

Table 1

List of Compounds Found in Morinda citrifolia.

Noni Plant Compound(s) Description Proposed effects of organ(s) compounds FRUIT and Oligo- and Long-chain sugar Immunostimulatory; FRUIT Polysaccharides molecules that function as immunomodulatory; JUICE dietary fiber, yielding antibacterial; short chain fatty acids antitumor; anticancer. with numerous potential health properties.

Alkaloids Naturally occurring Enzyme activity and amines from plants. protein structure.

Vitamins and Magnesium; iron; The positive effects of Minerals potassium; selenium; zinc; the vitamins and copper; sulfur; ascorbic minerals in noni juice acid (vitamin C). are documented. Scopoletin Dilates vasculature and lowers blood pressure; histamine- inhibiting; allergies; Alzheimer ‘s disease. LEAVES, Anthraquinones Damnacanthal Antiseptic and STEMS and antibacterial effects in OTHER digestive tract. FOLIAGE Glycosides Noni juice is a source of DPPH free radical vitamin C. scavenging activity; inhibition ofUVB induced Activator Protein-i activity in cell cultures.

ROOTS Anthraquinones Damnacanthal Inhibits formation of lung carcinoma in mice.

Morindin and Flavonol glycoside; Dyes, yellow and red Morindone iridoids and a colorants used for tapa citrifolinoside. cloth; antibacterial. 8

Recent research has identified several active phytochemicals in the noni plant, which supports the idea that these chemicals influence human physiology. Hence, the widely marketed Tahitian Noni Juice (TNJ®), which claims usefulness as a curative or preventative in disease treatment, is currently sold with the promise to “support bodily systems, increase mental clarity, and optimize physical performance.”~45’64’ 65] Although there is little scientific evidence to either support or refute these claims, a number of investigators have isolated a wide range ofbioactive substances. Among documented nutraceuticals, noni contains a polysaccharide-rich substance, glycosides, anthraquinones, iridoids and a several other bioactive plant substancesJ36’55’661

Polysaccharides play important roles in living organisms. They are sugar polymers made up of many monosaccharides that are joined together by glycosidic bonds, which are formed by a condensation reaction, in essence making them relatively complex carbohydrates.~67’681 They tend to be amorphous and insoluble in water.

Polysaccharides have a general formula of C~(H2O)~- 1, where n is usually a large number between 200 and 2500. Often, six-carbon monosaccharides make up the polymer backbone of repeating units; thus, (C6HioO5)~ can also represent the general formula, where n = {40...3000}. They are often classified on the basis of the number of monosaccharide types present in the molecule, and are therefore very large, often branched, macromolecules.~671 Polysaccharides can be divided into two broad groups:

(1) storage polysaccharides, such as starch and glycogen, and (2) structural polysaccharides, such as cellulose and chitin; pectins are chitin of a glucose derivative. [68] 9

An alcohol-precipitate ofnoni fruit juice (noni-ppt) has been chemically characterized and contains predominantly pectic polysaccharides (e.g., homogalacturonan, arabinan, type I arabinogalactan, and rhamnogalacturonan).~55~

Hirazumi et al. (1994) found that noni-ppt was capable of inciting the release of several immune system mediators from other murine effector cells, including interleukin-1~3

(1 L- 113), IL- 10, other interleukins, and nitric oxide. [69] Studies also revealed that noni ppt displayed substantial anticancer activity, inhibited tumor growth, and stimulated immune responses in lung carcinomas.~42’441 As a result, enhancement of the immune response is expected to mediate anti-tumor activity by triggering macrophages to release tumoricidal mediators, resulting in suppressed tumor growth.

Glycosides also play diverse important roles in the biological processes of life.

Many glycosides are present in flowers and fruit pigments, various medicines (including antibiotics), condiments, and dyes derived from plants. Not all chemicals are active in plants; hence, many plants store important chemicals in the form of inactive g1ycosides.~701 In chemistry, the sugar part of this molecule is bound to a hydroxy compound i.e. a non-sugar, qualifying it as a glycoside, thus excluding the polysaccharides. If the stored chemicals are needed, they can easily become available for use by the plant; accordingly, the glyco sides are brought in contact with water and an enzyme, and the sugar part is broken off. Whereas the sugar group is called the glycone of the molecule, the non-sugar group as the aglycone moiety of the glycoside.~70’ 71]

Anthraquinone glycosides contain an aglycone group that is a derivative of an aromatic organic compound, anthraquinone. Chemical analysis of noni also revealed the presence of anthraquinones, which are compounds based on anthracenes.~511 10

Anthraquinone occurs naturally in some plants (e.g. aloe, senna, and rhubarb), fungi, lichens, and serves as a basic skeleton for pigment in insects.~72’ 73] A number of anthraquinone derivatives, which include rubiadin, morindone, lucidin and damnacanthal (3 -Hydroxy- 1 -methoxyanthraquinone-2-aldehyde), have been isolated from various parts ofnoni as shown in figure 1 ~[721 Conventional chemotherapeutics such as doxorubicin (DXR) and mitoxanthrone belong to this family of compounds as well.

Ghai et al. (US Patent 2003/0004116 Al) describes three active glycoside compounds found in the fruit pulp of noni using a butanol (BuOH) extraction method.

Mass Spectrometry (MS) and multiple nuclear magnetic resonance (NMR) methods identified the glycosidic structures to be 6-O-(13-D-glucopyranosyl)-1-O-octanoyl-/3-D- glucopyranose, 6-O-Q3-D-glucopyranosyl)- 1 -O-hexanoyl-j3-D-glucopyranose and 3- methylbut-3-enyl 6-O-~3-D-glucopyranosy1-f3-D-glucopyranoside as shown in figure

~ 751 In addition to the BuOH extract, several other noni extractions were used in cell proliferation and cytotoxicity assays on various cancer cell lines, where data indicated the BuOH fraction as showing the most cytotoxic effects after 24 hours of treatment.

They determined that these three active compounds isolated from noni using the BuOH extraction method displayed potential anti-tumor and anti-proliferative activity as cancer prevention or treatment agents. Oral administration of these nutraceutical compositions include, but are not limited to, formulation as a food supplement, capsule or tablet as described in the U.S. Pharmacopeia, and liquid preparations in the form of syrups and dry products.~65’ 76-80] HO

Fig. 2. Structures of glycosidic sugars found in M. citr~folia. (A.) 6-O-(~3-D- glucopyranosyl)- 1 -O-octanoy1-~3-D-g1ucopyranose, (B.) 6-O-(f3-D-glucopyranosyl)- 1-0- hexanoyl-~3-D-glucopyranose, and (C.) 3-methylbut-3-enyl 6-O-/3-D-glucopyranosyl-f3- D-glucopyranoside.

Iridoids are cyclopentanopyran monoterpenoids, often occurring as glycosides, found in a large number of plant families.~81’ 82] One of the first iridoids isolated from noni was asperuloside, and several others have been described more recently, including citrifolinoside extracted from noni 1eaves.~59’831 Several novel di- and tri-saccharide fatty acid esters have also been isolated from noni fruit. They contain one or two short chain fatty acids attached to glucose residues, and given their amphipathic character, may be responsible for the soapy character of the fruit.~841 12

1.1.2.4 Evidence ofBiological Activity

The nutraceuticals in the M citr~folia extract have been shown to have favorable effects in cancer treatment. Different components in a botanical may possess protective or disease preventive properties; and in the noni plant, damnacanthal, iridoids, and disaccharide fatty acid esters were identified as pertinent to these preventive processes.

The polysaccharide-rich substance (noni-ppt) may operate by modulating the responsiveness of immune cells, and might prevent the escape of cells with hyperactive

Ras from immune surveillance. In 1994, researchers reported anticancer activity of noni-ppt on lung cancer in C57 B116 mice; they concluded that noni acts indirectly by enhancing the host immune system involving macrophages.~441 Researchers at the

University of Hawaii later showed mice implanted with Lewis Lung Carcinoma (LLC) treated with noni-ppt had a significantly prolonged life by up to 75% in comparison to the control group.~411 Berg and Furusawa further described how noni-ppt stimulated tumor necrosis factor (TNF) and interleukin 1 (IL-i) in mice.~851 Asahina et al. (1996) reported that an alcohol extract of the noni fruit hindered the production oftumour necrosis factor-a (TNF- a), an endogenous tumor promoter in macrophages.~41~ Noni ppt displayed some anticancer activity and inhibited tumor growth in syngeneic mice

(meaning they are geneticallyidentical or closely related and immunologically compatible). Other reports suggest that the enhancement of anticancer drugs, in combination with noni-ppt, may be beneficial to cancer patients by allowing decreased chemotherapy and/or radiation doses.~42~ Noni-ppt has proven anti-tumor activity, improved the survival time with cancer, and it is believed to be a useful supplement in cancer treatments. 13

Those compounds in noni listed above shown to possess protective or disease preventive properties i.e., damnacanthal, iridoids, and disaccharide fatty acid esters, have been shown or hypothesized to block or inhibit the function of Ras-pathway components, which activates many signaling cascades relating to cell growth, proliferation, and survival.~86’871 Of 500 tested botanical extracts, Hiramatsu et al.

(1993) found noni to be the most effective in inhibiting growth of Ras-transformed cells.~871 Ras or its homologs are present in virtually all living things, and fungi possess two Ras genes. Banerjee et al. (2006) reported that an extract ofnoni fruit interfered with the conversion of Candida albicans (serum-induced) from cellular yeast to a deadly filamentous form i.e., pathogenic.~881 Hence, noni is effective in combating C. albicans and it may have potential therapeutic value with regard to candidiasis, which is a fungal infection (mycosis) or yeast infection. These results were similar to those obtained in C. albicans with FPT Inhibitor III, a synthetic substrate analog inhibitor of Ras prenylation.~88’891 Moreover, the similar response to noni and a prenylation inhibitor as well as the isoprenoid character of biologically active noni components suggests that

Noni may also inhibit protein prenylation.

The body’s ability to balance an underactive immune system versus an active immune system is referred to as immunomodulation, and noni is thought to indirectly employ immunomodulation to suppress tumors. Researchers state that both prophylactic and therapeutic potentials against the immunomodulator sensitive Sarcoma 180 tumour system are found in the fruit juice ofM citr~folia. They reported that allogeneic mice

(meaning they are genetically different although belonging to or obtained from the same species) showed a cure rate of25%-45% with respect to the antitumour activity ofnoni 14 ppt.~90~ In 1999, Hirazuma and Furusawa reported that the ethanol-precipitable, water- soluble form of the noni fruit juice extract illustrated antitumor and immunomodulatory activity.~44’911 While the noni-ppt effects may not directly involve Ras inactivation, in the organism they may provide adjuvant activity to inhibition of the Ras pathway by small-molecule components.

The anthraquinone, damnacanthal, causes phenotypic reversion of K-Ras transformed rat kidney cells (K-Ras-NRK).~871 Damnacanthal has also been shown to be an inhibitor of the activity of certain tyrosine kinases, whose aberrant expression levels are known to be involved in oncogenic processes. Compelling inhibitory effects on tyrosine kinases, such as leukocyte-specific protein tyrosine kinase (Lck), V-src sarcoma

(Schmidt-Ruppin A-2) viral oncogene homolog (Src), and V-yes-i Yamaguchi sarcoma viral related oncogene homolog (Lyn), as well as epidermal growth factor receptor

(EGFR), were reported by Hiwasa et al.(1999).~921 Faltynek et al.(1995) showed damnacanthal was a potent mixed inhibitor of p5&clc with an IC50 of 17 nM and < 20- fold less selective for p60src and p59~. Lck Src, Lyn and Fyn are all members of the

Src kinase family.~721 Other studies showed that Lewis Lung Carcinoma (LLC) cells treated with damnacanthal prior to implantation in the abdominal cavity of mice prevented tumor development compared to untreated cancer cells anti-cancer activity.~69~

A wide variety of medicinal plants contain iridoids, a class of secondary metabolites; they are thought to be responsible for the some of their pharmaceutical activities. Asperuloside, an iridoid glycoside, has been characterized as an inhibitor of

P13-kinase, an important signal transduction effector of Ras.~931 Sang et al. (2001) reported that another iridoid, citrifolinoside, inhibits the UV-induced activity of 15 activator protein 1 (AP-1) transcription factors.~591 Using a similar bioassay, Liu et al.

(2001) demonstrated that iridoids and fatty acid glycosides from BuOH extracts of noni fruit also inhibit AP-1 activity.~841

Therefore, noni is believed to have a significant influence on impeding the growth of cancer cells which express hyperactive Ras. By blocking Ras activity, further production in the signaling cascade is prevented.~94~ In essence, one may thinic of treatment with multi-component botanical preparations like noni as combination therapy. This therapeutic approach (where two or more drugs are used) is intended to reduce the frequency at which acquired resistance arises, permits use of lower doses

(since drugs combined may have a better-than-additive therapeutic effect), and correspondingly better toxicity proflles.~951 Different components of noni may inhibit

Ras prenylation, P13 kinase activity, Src kinases and AP- 1 transcription factor, and the collective activity of these and other components result in an effective anti-cancer activity.

1.1.3 Breast Cancer

1.1.3.1 Prevalence

Historically, breast cancer (BrCa) had been regarded as a terminal disease, but medical advances have significantly increased survival prospects for patients who are diagnosed in the early stage of the disease.~96981 Studies show that death rates of BrCa are decreasing; yet, in both incidence and death, it still ranics high as a common cause of cancer worldwide. Although every woman is at risk for BrCa, the lifetime risk of any particular woman getting BrCa is about 1 in 8, and the risk of her dying from BrCa is 1 16 in ~ 1001 On the other hand, male BrCa occurs at a significantly lowered rate and accounts for only a fraction of all men who get and die from BrCa.~’°’1

Mutation of breast cells to malignant form is the starting point of BrCa acquisition of a malignant phenotype. Once the unrestricted cell growth commences, breast tumors develop into two main categories of cancer: noninvasive and invasive.

Noninvasive BrCas are described as in situ, meaning they are confined to the area where the phenomenon occurred; hence these cancers are referred to as either ductal carcinoma in situ or lobular carcinoma in situ.~’°21 However, both types of noninvasive BrCa have the potential to progress into the more problematic invasive form, where they will have the ability to spread from the breast to other parts of the body and grow in other organs.

Thus, malignant breast tumors can interfere with normal body function and be life threatening. While it is noted that cancer can develop in any type ofbreast tissue, tumors usually form in the ducts or lobules of the breastJ’°2’ 1031

Ergo, invasive BrCa is a more serious form of breast disease. Not only do the malignant cells infiltrate normal breast tissue, they spread and invade surrounding areas as well.~’°44091 Invasive BrCa occurs in different forms, but the most common type is invasion of the ductal carcinoma. Although invasive ductal carcinomas emerge in the ducts, accumulating tumor cells extend to adjacent tissues, and potentially open a door for metastasis to arise. When metastatic cancer cells move beyond the original breast tumor site, they spread to other parts of the body i.e., lungs, liver, skin and etc. Even if this migration occurs and the spreading is extensive, it is still considered BrCa. Invasive ductal carcinoma accounts for approximately 80% of all diagnosed BrCas.~°4’ 1051 1.1.3.2 Risk Factors

There are some increased risk factors to be considered when trying to understand

BrCa and its mortality rate. These risks can only fall under one oftwo umbrellas: 1) those you cannot change, and 2) those you can control. Those risk factors that you cannot change include gender, age, and genetic characteristics to name a few. [110-118]

Being a female is a major risk for contracting BrCa; this is because of the breasts’ constant exposure to the effects of estrogen and progesterone, essentially the female hormones, which are chemical messengers in the body essential for the normal growth and development of the breast and tissues. Consequently, these growth-promoting hormones cause women to be 100 times more likely to get BrCa than men.~”91 And as a female ages, her chances of developing BrCa increases; of the invasive BrCa diagnosed, about 1 out of 8 were among women younger than 45, but every 2 out of 3 women over

50 possessed advanced BrCasJ’°°’ 120-1221

.3.3 Etiology

Additionally, the most common gene defects occur in BRCA1 and BRCA2, which are normally inherited cancer preventive genes. However, if a parent passes a mutated copy of BRCA1 or BRCA2 to their offspring, these genes may fail to make proteins that keep cells from growing abnormally; then, the incidence of developing

BrCa increases to an 80% chance.~’231261 Thus, inherited genes and gene mutations from parents are thought to be responsible for about 5% to 10% of BrCa cases.~’27’291 For example, Carey et al. (2006) reported that inadequate diagnosis of young African

American women with BrCa was jointly contributed to by higher occurrence ofbasal like breast tumors (lacking the expression of hormone receptors) and a lower incidence 18 of luminal A tumors (express hormone receptors).~’301 Albeit, the supposition that studies of BrCa occurrence in African American workmen are often confounded by unequal access to care; yet, differences in the biology of BrCa between African

American and Caucasian women are partially attributed to inequality in negative prognostic indicators of the diseaseJ’31’ 132] Information acquired from the SEER database in Atlanta, GA shows the basal-like phenotype accounts for approximately

30% of the BrCa cases overall. However, African American women account for about

47% of those BrCa cases, which is over twice as many as Caucasian women at approximately 22%.[133]

Controllable risk factors that increase chances of developing BrCa are those associated with life-style and core choices. These include alcohol use of more than 1-2 glasses per day, hormone replacement therapy, late-in-life childbearing, and the controversial topic of obesity, to name a few.~”°’ 111, 134.137] Although alcohol consumption in moderation helps protect against heart disease, studies show that more than half a glass of wine a day may actually increase the risk of developing BrCa. It is indicative that risk is proportional to consumption: the more alcohol consumed, the greater the risk.~’ 3 8-140] For many years, women have been offered hormone replacement therapy (HRT) to relieve menopausal and postmenopausal symptoms and to prevent osteoporosis. For HRT, doctors prescribe estrogen and progesterone, which have been shown to slightly increase the risk of BrCa in women and increase with duration of use of the therapy.~’41’431 Women who never have children, or delay having their first child until after age 30, also increase their chances of developing BrCa. Although the risk is slight, studies have shown that both cases add to the already exponentially increased 19

potential of BrCa development for women after entering into their thirties.~’°4’ 135] While obesity is implicated in a copious number of diseases, its association with BrCa occurrence is still disputed. Individuals with a body mass index (BMI) over 30 are considered obese, and it has been confirmed that overweight women produce more estrogen, which has been proven to increase risks.~ 144-148] The already abundant list of controllable risk factors continues to grow, but simply applying life-style changes may have a large impact on the future incidence of BrCa altogether.

1.1.4 Immunology: Innate andAdaptive Immunity

1.1.4.] Immunity

Immunology covers the study of all aspects of the immune system in every organism and describes a state of having adequate biological defenses to avoid infection, disease, and foreign invaders. Like all cells in the human body, cancer cells start out as normal cells, but adversely begin to grow out of control. The immune system plays a role in limiting the cancer development, often times before these cells have a chance to grow. In addition to having the remarkable task of dealing with an assortment of pathogens in the environment, the immune system responds to the environmental factors it encounters on the basis of discrimination between self and non-self~’49’5~ Even though profound changes have occurred on the inside cancer cells, the outer appearances look normal; for that reason, some cancer cells escape the immune system’s surveillance mechanism. In this way, these abnormal cells grow and multiply without triggering an immune response.~27’291 20

Immunity involves both non-specific and specific components and as such is further divided into the innate and adaptive immunity systems. Irrespective of antigenic specificity, the innate immune system is engaged non-specifically acting as either as a barrier or as an eliminator of a wide range of pathogens. This system is present from birth and is an important initial step in clearing the pathogen, thus reflecting immediate biological defense against the outside world. Innate immunity protects an individual from microorganisms regardless of experiences; it does not require prior memory nor does it generate an augmented secondary response. [152, 153]

Conversely, the other component of the immune system is acquired during life, adapting and reconciling itself to each new disease encountered. The adaptive immune system is able to generate pathogen-specific immunity and gives an efficient means of clearing the pathogen.~’541581 This system is often sub-divided into two major types depending on how the immunity was introduced: naturally acquired immunity and artificially acquired immunity.~581 Although contact with a disease causing agent is not deliberate, the former immunity occurs through fortuitous contact, whereas the latter immunity develops only through deliberate actions such as vaccination. The adaptive immune system and the innate immune system work jointly, through cross-talk, which is critical for launching an effective immune response.~58’ 159]

.4.2 The Toll-like Receptors

The first lines of defense in the human innate immune system are membrane receptors called Toll-like receptors (TLRs). This family of receptors functions as primary sensors to recognize microbial pathogens.~’49’ 155, 160-166] Subsequent binding of ligands to TLRs lends to activation of cellular signaling pathways that regulate 21 expression of genes related to inflammation and immunity.~’611 The discovery and supporting evidence of functional and structural diversity suggests TLRs are key participants in cellular immunity and are important to various medical conditions including the tumor microenvironment. TLR heterogeneity emphasizes the role of these receptors and suggests a new opportunity to develop therapies targeting specific or multiple TLRs that may contribute to the treatment of a myriad of diseases including various cancers.~49’ 160, 161, 163, 1651

Toll-likes receptors (TLRs) comprise a superfamily of transmembrane proteins that play a key role in the activation of primary cellular immunity. The presence of microbial pathogens triggers intrinsic defenses of innate immune responses via TLRs, which are known for their recognition of conserved molecular patterns of microbial components.~55’ 161, 162, 166, 167] Hence, the lost or inhibition of this instinctive system leads to an immune comprised individual. The innate immune system can be inactivated by disruption in associate proteins that interact with TLRs and subsequent signaling proteins downstream.~49’ 160, 161, 168] Over the past several years, a number of TLR genes have been identified and characterized, and the successive number of such genes being discovered continues to fill a void in immunologyJ149’ 155, 157, 169] TLRs and associate genes have been designated according to their appropriate ligand and immune response.

Some of the most well known and widely studied TLR genes include TLR 1 through 9, in addition to accessory genes: Cluster of differentiation 14 (CD14), Myeloid

Differentiation Primary-Response gene 88 (MyD8 8), and IRAKs (IL-i receptor associated kinases).~’70~731 Pinpointing alterations in the innate immune recognition of

TLR genes and associated co-factored genes with relationship to various cancers is the 22

gateway to understanding tumor immunology.~’60’ 174-177] Some of our literary research cumulatively focused on reviewing the number of recently issued patents related to innate cellular immunity and aimed at examining the newly published patent applications that have identified novel genes as targets for cancer treatment. In addition, innovative approaches related to the design and recent advances in the development of clinically usefully therapies for inflammation and cancer patients, were assessed with special emphasis on characterization of TLRs and accessory proteins. Select examples of TLR/accessory protein-related patents were cited to highlight certain points; thus the coverage of the innate immunology patents in the text is not encyclopedic.

1.1.4.2.1 Summary of the TLR Signaling Pathway

Toll-like receptors are named for their similarity to Toll, a receptor originally known for its developmental function in the fruit fly, Drosophila melanogasterJ1781 In addition to fruit flies, TLRs are members of the Interleukin- 1 receptor (IL-i R) superfamily expressed in a sundry array of organisms such as mammals and plants that operate as key sensors in innate immunity. Survival of a host is contingent on its ability to sense the presence of pathogens and to provide tailored responses against microbial infection.~51’ 175, 179, 1801 Because TLRs recognize conserved motifs among pathogens, they stand at the vanguard of immunological defense, serving as the reactive components of a multitier signaling cascade that plays a significant role in inflammation, cellular immune regulation, and cell proliferation and survival.~’751 Since their discovery in mammals, the TLR family has grown to now consist of 13 members, with only 11 receptors having been characterized and used to elucidate cellular immunity. Although they share significant homology in their cytoplasmic regions, the To11IIL-1R (TIR) 23 domain, individual TLRs recognize specific microbial components, including lipopolysaccharide (LPS), bacterial lipoproteins, peptidoglycan, viral and bacterial DNA

(deoxyribonucleic acid), and they activate signaling pathways correspondingly. Thus, when microorganisms are detected, TLRs are engaged and subsequently trigger activation of the innate immune system, discriminating between specific patterns of microbial agents.~51’ 171, 1811 As shown in figure 3, TLR activates two major signaling pathways: (1) one pathway leading to the activation of the two transcription factors

Nuclear Factor-KappaB (NF-icB) and Interferon Regulatory Factor-3 (IRF3); and (2) another pathway leading to the activation ofNF-icB and the Mitogen-Activated Protein

Kinases (MAPKs) p38 and c-Jun Kinase (JNK).~’82’ 183, 1841 The primary pathway is activated by most of the TLRs; however, the secondary pathway is activated by TLR3 and TLR4, which allows for an additional set of genes to be induced such as Interferon

Beta (IFN-f3) and other antiviral genes.U85~ 186] 24

~i4PKs

~NWB

Fig. 3. Toll-like Receptor Pathway

TLR1 was the first Toll-like receptor to be discovered and is found on the surface of macrophages and neutrophilsJ’87~ It works in conjunction with TLR2, which is found at the surface of immune system cells. While TLR1 recognizes peptidoglycan and (diacyl) lipoproteins, TLR2 is essential for the recognition of microbial lipopeptides.~70’ 188, 1891 These two toll-like receptors form a heterodimer, and they collaboratively modulate responses to the microbial components.~90’ 1911 TLR3, TLR5,

TLR6, TLR8, and TLR9 are all characterized as immune responses regulators and 25 intrinsic participants in programmed cell death. TLR4 detects LPS on Gram-negative bacteria and functions in association with MD-2 (also known as lymphocyte antigen 96) to confer responsiveness and to initiate immune responses launched by LPS. [192, 193]

TLR5 mediates the detection of bacterial flagellins, and TLR9 detects the unmethylated

CpG (Cytidine-phosphate-Guanosine) patterns present in bacterial DNA. Both TLR5 and TLR9 transduce a signal to the nucleus similar to TLR1 0 in that they all act via

MyD88 and TRAF6 (TNF receptor associated factor 6), leading to NF-icB activation, cytokine secretion and the inflammatory response.~’94’ 195] TLR7 recognizes single stranded RNA (ribonucleic acid) in endosomes, which is common in viral genomes internalized by macrophages.~’96’ 1971 It is hypothesized that TLR1 1 plays a protective role in preventing infection of internal organs of the urogenital system.~’971

.4.2.2 Toll-like Receptor 4

Of the Toll-like receptors described, the mammalian TLR4 is of most notable mention as it answers critical questions about the association of pathogenic stimulants with the initiation of host immune defenses. Because TLR4 detects LPS on Gram- negative bacteria, it is a key player of the human endotoxin sensor and has become a new target for combating gram-negative infections.~’981 However, without the aid of a helper molecule, TLR4 does not function as an LPS receptor. Recognition of LPS also requires the MD-2 protein, which provides a link between the receptor and LPS signalingJ’992011 Unlike TLR2, whose response is more or less enhanced by MD-2,

TLR4 cannot be activated by stimuli without the presence of MD-2. Ergo, TLR4 has an absolute requirement of MD-2 for cell immunity activation.~200’2021 After being 26 triggered, TLR4 engages a set of MyD88 adaptor proteins divided into four possible subsystems: MyD88, TIRAP (toll-interleukin 1 receptor (TIR) domain-containing adaptor protein), TRIF (TIR-domain-containing adapter-inducing interferon-~3), and

TRAM (TRIF-related adaptor molecule). Downstream signaling for most TLRs is dependent on the MyD88 complex; however, some pathways are MyD8 8-independent.

[203,204]

Both TRIF and TRAM are MyD88-independent signaling pathways associated with TLR3 and TLR4, where TRAM is a requirement between TRIF and TLR4.~203’ 205]

These MyD88-independent cascades link TLR4 to pathways that lead to TANK Binding

Kinase-1 (TBK1) and the subsequent activation of Interferon regulatory factor 3 (IRF3), which then activates essential inflammatory immune response interferons a and ~[206-2081

MyD88 deficiency in the liver triggers TRIF regulation, which indicates organ-specific regulation of signaling pathways. This TLR4 pathway (MyD8 8-independent) ultimately stimulates NF-icB, thereby upregulating costimulatory molecules CD4O, CD8O, and

CD86. These regulating molecules then activate T-cell production and immune response. However, overproduction of these molecules can also lead to organ failure and death, which verifies that the regulations of these pathways are critical.~’64’ 209]

TLR4 activates two distinct signaling pathways that are MyD88-dependent:

MyD88 and TIRAP/Mal, which induce the production of proinflammatory cytokines.

Following the stimulation of MyD88, the TLR4 complex associates with IRAK.~2101

More specifically, TLR4 is linked to the IRAK1 and the IRAK4 Serine/Threonine

Kinases, in which the latter also supports signaling from T-cell receptors. When TLR4 is activated by LPS, IRAK4 is recruited by MyD88, resultantly governing the 27 phosphorylation of IRAK1. This induction then leads to two distinct IRAK1 subsystems: the TRAF6 multiplex and the IRAK2 pathJ2111 Upon interaction between autophosphorylated IRAK1 and TRAF6, the two quickly dissociate from the receptor to form a complex with TGF-Beta-Activated Kinase- 1 (TAK1) and the TAK1 -Binding

Proteins (-1 and -2). This newly formed composite eventually phosphorylates both p38

Kinases and JNKs (c-Jun N-terminal Kinase) by activating MKK3 (Mitogen-Activated

Protein Kinase Kinase) -3, MKK6 and MKK7, thus allowing p38 and INKs to then enter the nucleus and induce the expression of their target genes. [212] On the other hand, the

TRAF6/TAK1 merger also phosphorylates the Inhibitor of Kappa Light Polypeptide

Gene Enhancer in B Cells Kinase (IKK) complex, which in turn phosphorylates I

KappaB. 1-KappaB is ubiquinated and subsequently degraded, thereby allowing the translocation of NF-icB to the nucleus, which enables induction for the expression of its target cell survival genes. [213,214]

In contrast to IRAK1 and IRAK4, IRAK2 (which is reported to participate in the

ILl -induced upregulation ofNF-KB) is not catalytically active nor does it have any detectable kinase activity. [215,2161 This is the second IRAK1 subsystem, where IRAK2 is the activated downstream of IRAK1, leading to Fas-Associated protein with Death

Domain (FADD). FADD is an adaptor molecule that transduces a downstream signaling cascade resulting in the sequential activation ofCaspase-8.~217’2181 FADD bridges the

Fas-receptor along with other death receptors to Caspase-8, resulting in oligomerization of the Caspase-8 protein.~219’2201 This, in turn, drives the Caspase-8 protein’s autoactivation through self-cleavage, and activated Caspase-8 then activates other 28 downstream caspases. Consequentially, this series of events implements and commits the cell to undergo apoptosis, resulting in cell death. [2211

1.1.5 Recent Patents in the TLR Pathway

1.1.5.1 Toll-like Receptor Patents

Hardiman et al. describe a comprehensive description of toll-like receptors in their patent, US 7,271,248, EP1925666 and application US20080025974, where they support evidence for nine human toll-like receptors along with their production and use.

They include the cDNA sequences of TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, modulating the physiology of a cell with an antagonist or agonist for these receptors.

TLRs differ from one another with regard to their distinctive ligand, with each unique ligand eliciting a particular signal transduction as described above. After the discovery of TLR4, other toll-like receptors followed, respectively binding to different degradative products ofbacterial and viral infections. Other patents, such as W02008010902, support the methods for vaccine development and for inducing cytokines through TLRs and the complement system.

1.1.5.2 TLR variants

A soluble Toll-like receptor for TLR2 was invented by Schiffrin et al., patent

U57230078B2. As indicated, TLR2 works with several other TLRs as a heterodimer in recognizing bacterial cell components on the surface of the cell membrane. Likewise,

Apetoh et al., application EP2007/057402, invents the use ofnucleic variants of TLR4 and provides compounds for treating and preventing cancer in patients that express the mutant TLR4 or the dysfunctional TLR4 (patent application M02008/0096993). This 29 theme of identifying novel TLRs and their mutants is shown in Table 2, with patent applications identifying TLR5, TLR1 1, TLR12 by Zlatkin et al. (US2008/003 8250) and

TLR3 mutants by Duffy et a!., patent application US2007/0203064.

Table 2

List of Toll-like Receptors and Their Mutants

APPLICATION GENE NAME INVENTORS NO. IRAK-M Flavell R, Kobayashi K, Medzhitov R US 2003/0157539

TL4 Dysfunction Apetoh L; Kroemer g; Zitvogel L US 2008/0096993

TRAM Fitzgeral K, Rowe D, Golenbock D US 2005/0158799

TRL11 GhoshS US 2005/0239093

TLR signaling University of Pennsylvania US 2008/010902

IRAK1 c splice variants Leung WP, Rao N US 2007/0243181

TLR receptors Hardiman G Rock F, Fernando B, US 2005/0112659 Kastelein R, Ho 5, Liu, YJ

Immune modulators Foxwell B; Feldmann M US 2008/0124322

TLR3 mutants ufl~,’ K, Cunningham M, Mbow ML, US 2007/0203 064 Sarisky R

T1CAM-1 Seya T, Matsumoto M, Oshiumi H US 2006/0134128

IRF3 Moore P, Pith-Rowe P US 2005/0054033

TLR5, TLR11, TLR12 Zlatkin I; McCormick J US 2008/0038250 30

1.1.5.3 Adaptorproteins

One of the important players in cellular innate immunity is the adaptor protein

MyD88. This protein is essential for signal transduction from the TLRs to the associated kinases downstream. With a molecular weight of 32kD, this protein is highly conserved and is expressed throughout various tissues.~561 Slims et al. patent

US6,887,684B2 and Beyaert et a!. patent US7122656B2 describe the MyD88 protein, state its relevance to innate immunity signal transduction, and take claim to agents that modify its function. Other such adaptor proteins include the IRAKs (patent application

US2007/0243 181), and TIRAP (US patent 7,285,535), which is described as an adaptor protein for Toll interleukin- 1 receptor protein. These are listed in Table 2 and 3. 31

Table 3

List of Adaptor Proteins

GENE NAME INVENTORS PATENT NO. Mouse TLR 7,8,9 Bauer 5, Lipford D, Wagner E US 6,943,240

TIRAP Medzhitov R, Homg T, Barton G US 7,285,535

MYD88 ADAPTOR Slims J, Bird T, O’Neill L US 6,887,684

MYD88 SPLICE VAR. Beyaert Z, Janssens S US 7,122,656

STLR2 Schiffein B, Affolter M, Labeta M US 7,230,078

TLR Hardiman GT, Rock F, Bazan J, Kastelein US 7,271,248; 2,3,4,5,7,8,9,10 R, Ho 5, LiuY EP1925666

IRAK2 Ni J, Feng P, Muzio M, Dixit V US 6,653,452

IRAK3 Cao Z. US 6,576,444

IRAK4 Wesche H, Li S US 6,818,419

TLR4 variants Schwarts US 6,913,888

1.1.6 Cancer Cells and Immune Surveillance

It is extremely important to understand the mechanisms used by cancer cells to escape from immune control and limit the success of immunotherapy. Cells in the thymus (an organ located in the upper anterior portion of the chest cavity), for example, stimulate the production and maturation of human T cells, which are necessary for the 32 maintenance of immunological tolerance. Normally, when cells are pathogenically infected, foreign proteins are degraded via antigen processing by cytotoxic T cells (Tc), which release cytotoxins that eventually lead to cell death destroying pathogenic or otherwise dysfunctional cells. Ergo, a properly functioning immune system discriminates between self (antigens of an organisms own cells) and non-self (any of the antigens present that originated outside the body).~222’2231 When selfYnon-self discrimination fails, the immune system destroys cells and tissues of the body and as a result causes autoimmune diseases. Hence, thymus regulatory cells (Treg), which belong to a group of lymphocytes, are responsible for shutting down T cell-mediated immunity toward the end of an immune reaction.~2241 Wang et al. (2006) emphasizes that human Treg cells have the capability of preventing autoimmune diseases; this, in part, is due to key role they play in negative selection in the thymus by suppressing auto- reactive T cells that escaped the elimination process.~225~ Wang and Wang further explain that tumor cells have the ability to enlist Treg cells to suppress host immune responses against self- or non-self-antigens, thus inhibiting antitumor immunity. [226]

Moreover, antigen-specific Treg cells can induce tumor-specific local immune tolerance in the tumor microenvironment, and recent studies have shown that elevated proportions of Treg cells are present in various types of human cancers. This circumstance adversely limits the efficacy and success of cancer immunotherapy. Case in point, recent findings demonstrate that TLRs regulate the functional control of human Treg cel1s.~2261 Because of their natural presence in the immune system, this linic between the suppressive activity of Treg cells and TLR signaling makes the pair a good target for designing the ways to improve the outcome of cancer treatment or prevention. 33

Furthermore, this is not only creates an opportunity to manipulate TLR signaling to control innate immunity against cancer, but is also a new prospect for ways to control various immune responses at the cellular and molecular level.

Specific Aims

The putative anti-tumorigenic effects of extracts from the tropical M. citr~folia

(Noni) tree in BrCa cells remain to be clarified. The purpose of this project was to elucidate the cytotoxic effects of extracts from noni on BrCa cells as potential antiproliferative and anti-tumor agents. There are many facets to attaining the goals ofthis project and questions that must be addressed hereto. For example, what is the anti- tumor effect of noni and how does it operate with regards to cell proliferation and cell survival? What are the possible mechanisms of action and the targets of noni in BrCa cells? One possible explanation for noni’s cytotoxic effects is the elicited defense of the innate immune system. We hypothesized that noni operates by targeting the innate immune system, triggering activation of the TLR pathway, which regulates cell proliferation and cell survival. To examine noni’s cytotoxic effect on BrCa cells, the following studies were performed:

I: Noni Extractions: Because cancer treatments are limited, it is

necessary to explore CAM research to maximize the nutraceuticals

found in plants. Reports describing many of the characterized

compounds extracted from noni use a variety of organic solvents, with

each method individually isolating a specific component. However,

we followed a different auspice by working to maintain plant integrity 34 as per CAM requirements. Extraction of natural products that yields the desired active components is achieved by the selectivity of the solvent. As a general rule, theory and experience should guide the selection of an appropriate solvent; thus, our selection process for the optimal solvent followed certain criteria: dissolvability, inertion to reaction conditions, and finally extractability. A successful solid- liquid extraction, existing of an organic (alcohol) matrix and the active agent, has to take into account separation and recovery of the solvent from extract, and separation and recovery of solvent from extraction residual. Therefore, polarities, dielectric constants, and miscibility of the solvents had to be taken into account. These parameters provided a means of control, particularly to increase the energy of the colliding particles (noni components vs. solvent) to achieve a quickened, stable reaction that sieved the maximum concentration of desired noni components. Hence, our aim was to identif~’ the optimal solvent and to isolate and extract as many active ingredients in noni as possible for pharmacological use.

II. Functional characterization of Noni. Ongoing reports concerning the anti-cancer effects ofM. citr~folia interested us in performing an in vitro study of noni extracts on different human BrCa cell lines. Our aim was to examine the cytotoxic effects and analyze the growth of the various BrCa cell lines with and without noni extract(s) treatment, 35 which allowed us to determine the most suitable extraction method and effective dosage of noni extract with respect to time and physiological characteristics. The arithmetical probability of this aim was determined by Student t-test analysis to determine statistical significance, where the p-value (*) <0.05.

III: Identification of gene expression responses and possible cytotoxic pathways induced by Noni in human breast cancer cells.

The analysis of the changes in patterns of gene expression in BrCa cells, in response to therapeutic agents, would provide valuable information concerning the development and growth of BrCa. Our aim was to determine the RNA expression profiles of cultured BrCa cells in response to their exposure to the most effective noni extract treatment by performing microarray analysis using U133A Affymetrix

Chips. This allowed us to determine which genes are up-regulated or down-regulated in response to the treatment, followed by Real-Time

PCR and Western blot analysis for microarray analysis confirmation.

By examining the RNA expression data to determine the pathways affected by the noni extract treatment, we determined the molecular mechanism of action in BrCa cells in response to noni extract treatment. This information was valuable in determining the types of

BrCa that were most responsive to noni treatment. 36

IV: Profiling and analyzing the physiological observations of BrCa cells in response to Noni treatment. Evasion of endogenous cell death processes (apoptosis, necrosis and autophagy) represents an important characteristic by which metastatic cancer gains a selective survival advantage. It is necessary to understand the cellular and molecular changes in the development of BrCa and to selectively identifS’ and to monitor the effectiveness of suitable anti-tumor agents on the carcinogenic pathways. Our aim was to analyze the physiological cellular phenotypes of BrCa cells in response to noni treatment. Statistical significance was determined by the Student t-test, where, the p-value (*) <0.05. CHAPTER 2

RESEARCH DESIGN AND METHODOLOGY

2.1 Subject Stock

2.1.1 Cell lines and culture

The human breast cancer cell lines: (1) MDA-MB-231, (2) T47D, and (3) MCF-7, were obtained from the American Type Culture Collection (ATCC) [Rockville, MD,

USA]. All lines were cultured and maintained in Roswell Park Memorial Institute medium (RPMI) 1640 complete medium (pH 7.2-7.4) supplemented with penicillin G

(100 U/mI), streptomycin (100 U/ml) and 10% fetal bovine serum (FBS) at 37°C and 5% carbon dioxide. For experimental purposes, cells were generally grown to ‘—90% confluence in T-25 and/or T-75 tissue culture flasks. Cells were routinely sub-cultured using 2.5 gIL trypsirt/ethylenedinitrile tetra-acetic acid (EDTA) solution (Sigma, MO).

2.1.2 Morinda citr~folia

The M. cit4folia plant was grown to white fruit ripeness. The whole plant (fruit, leaves, stems and roots) was then harvested, freeze-dried, and then ground into fine noni powder at the FDA-approved facility on Maui Island, Hawaii. Dried noni powder was obtained from Hawaiian Herbal Blessings Inc., Kauai, HI. 38

2.2 Empirical Data and Collection

2.2.1 Small-scale extractions of noni powder

The extraction method of Arpomsuwan was modified to increase the chance of isolating as many active phytochemicals as possib1e.~2271 For initial extractions, we used dried noni powder and 14 different solvents systems (Fisher Scientific Co., Fair Lawn,

NJ), as listed in Table 5, to find a suitable extraction method and identify the optimal solvent to use from the list in Table 4. Approximately 1 g of dried noni powder was suspended in 1 ml of solvent in 2.0 ml microcentrifuge tubes (VWR International, West

Chester, PA) and allowed to stir for two days at 4 °C with agitation on a TC-7 Spin wheel (New Brunswick Scientific Co., Inc., Edison, NJ). Solvents were clarified by centrifugation and filtered with a 0.2~ nylon membrane filter (VWR International, West

Chester, PA) and then dried via a Thermo Savant SPD1 1V Speedvac (Holbrook, NY). 39

Table 4

List of solvents and their abbreviations

SOLVENT CHEMICAL FORMULA ABBREVIATION Ethanol C2H5OH EtOH

Methanol CH3OH MeOH

Butanol C4H10O BuOH

Chloroform CHC13 CHC13

Propanol (CH3)2CHOH PrOH

Pentanol C5H120 PenOH

Heptanol CH3(CH2)60H HepOH

Hexanol C6H13OH HexOH

Octanol CH3(CH2)70H OctOH

Water H20 H2O 40

Table 5

List of solvent systems used in extractions and their properties

DIELECTRIC BOILING SOLVENTS CONSTANT POINT % YIELD 95% EtOH 24.3 78.4 °C 1.1

MeOH 32.6 64.7 °C 1.8

1-BuOH 17.8 117.7 °C 4

CHC13 4.8 61.2 °C 79

2-PrOH 20.1 82 °C 1.4

MeOH/BuOH ** 2.2

95%EtOH/BuOH ** *** 1.5

CHC13/BuOH ** 0.5

(+1.-) 2-BuOH 15.8 94 °C 2

3-PenOH 13.9 116 °C 2.1

3-BuOH 12.47 82.4 °C 0.6

3-HepOH 6.7 66 °C 2.2

3-HexOH 13.3 135 °C 1.8

3-OctOH 10.3 195 °C 2

H2Oheated approx. 55.6 **** 3.4

H2Ormtemp 78.4 **** 2.1 41

2.2.2 Large-scale extractions ofnoni powder in BuOH

For a large scale extraction, 300 g of dried noni powder was suspended in 2500 ml BuOH (C4H9OH) solvent allowed to stir for two days at room temperature. The extraction was filtered using 0.2 p.m nylon membrane filter only via vacuum pump. The filtrate was dried via a Labconco Rotary Evaporator (119108933, Germany) noting the boiling point of BuOH: 117.73 °C. The extract was then collected, yielding 33.61%, and desired concentration of treatment was calculated using C1V1= C2V2 to obtain the required volume of crude noni extract needed to give a final concentration of treatment and redissolved extract in the calculated amount of dimethyl sulfoxide (DMSO) [Fisher

Biotech, NJ]. Various amounts of crude noni extract were added to RPMI 1640 medium to obtain working concentrations (1, 2, 3, and 5 mg/mi of BuNoni). Treatments were sterilized with syringe and 0.2 p.m nylon membrane filter prior to treating cells. Making of the crude noni extracts was later modified to use 95% EtOH instead of DMSO and filter sterilized prior to application to cells.

2.2.3 Analysis ofcell cytotoxicity

2.2.3.1 Single treatment ofcells with noni extraction dilutions

cells were affixed to the wells and stained via crystal violet assay. The 24 — 72 hour strips were then treated once with RMPI 1640 complete media containing desired concentration of noni extracts; fresh media was added to 72 hour strips after the 48-hour 42 strips were removed. Corresponding intervals were removed daily and cells were affixed to the wells via crystal violet assay, air dried, and quantified simultaneously with a spectrophotometer.

2.2.3.2 Multiple treatments ofcells with noni extraction dilutions

BrCa cells were plated at 1 X ~ cells/well in 8-well strips of 96-well Falcon plates and allowed to adhere overnight. At the 0-hour time point, the media was removed by inversion and light tapping, respective strips were removed, and the living cells were affixed to the wells and stained via crystal violet assay. The 24— 72 hour strips were then treated daily with RPMI 1640 complete media containing desired concentration of noni extracts; corresponding intervals were removed daily and cells were affixed to the wells via crystal violet assay, air dried, and quantified simultaneously with a spectrophotometer.

2.2.3.3 Treatment with BuNoni dilutions plus LPS-RS

BrCa cells were plated at 1 X 1 0~ cells/well in 8-well strips of 96-well Falcon plates and allowed to adhere overnight. At the 0-hour time point, the media was removed by inversion and light tapping, respective strips were removed, and the living cells were affixed to the wells and stained via crystal violet assay. The 24— 72 hour strips were then treated once with RMPI 1640 complete media containing various concentrations of BuNoni extracts, respectively, and Rhodobacter sphaeroides lipopolysaccharide (LPS-RS). Respective cells were pretreated with 10 ~ig/~il LPS-RS for 1 hour prior to adding the final concentrations of 1 and 2 mg/ml BuNoni plus LPS 43

RS. Treatments were adjusted to maintain 10 ~ig/j.tl LPS-RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells.

Corresponding intervals were removed daily and cells were affixed to the wells via crystal violet assay, air dried, and quantified simultaneously with a spectrophotometer.

2.2.4 GeneChip Target Preparation and Hybridization

MDA-MB-23 1 cells were treated with 2 mg/mi BuNoni dissolved in 95% EtOH for 2 hours, after which cell pellets were collected. More than ten micrograms (10 big) of total RNA was isolated and collected in three independent experiments. RNA was annealed to oligo(dT) primers containing T7 promoter and reverse transcribed into double stranded cDNA using Superscript II reverse transcriptase (Invitrogen Life

Technologies). After the cDNA was cleaned up with the GeneChip Sample Cleanup

Module (Aff~’metrix, Santa Clara, CA), biotin-labeled cRNA was generated from the cDNA using a supplied Bioarray Transcript Labeling Kit (Enzo Life Science Inc /

Affymetrix, Santa Clara, CA) as described by the manufacturer. The Biotinylated cRNA was purified using the supplied GeneChip Sample Cleanup Module, alcohol precipitated and quantified with a spectrophotometer. Afterwards, the biotin-labeled cRNA was taken to the Yerkes Primate Center, Microarray Facility (Atlanta, GA) and hybridized on triplicate Affymetrix HG-Ui 33A (contains about 22,283 genes, known and EST)

GeneChips at 450 °C for 16 hours, and then washed and stained with strepavidin phycoerythrin. The GeneChip was processed on the Affymetrix Fluidics Station 400 and the images were measured with a Hewlett- Packard Gene Array Scanner (Hewlett

Packard Co., Palo Alto, CA). 44

2.2.5 Microarray Data Analysis

After the absolute analysis (average difference determinations for each probe set) of all replicate microarray was performed by Microarray Suite version 5.0 software

(MAS 5.0, Aff~’metrix, Santa Clara, CA), the resulting data was exported to GeneSpring

GX 7.3 (Silicon Genetics, Redwood City, CA) for further analysis. In GeneSpring, the cross-gene error model was enabled and the following three types of normalization were applied to the exported data; all raw measurement values less than 0.01 were increased and set to the cut off value of 0.01; each chip was normalized using a distribution of all genes around the 50th percentile to control for chip-wide variations in intensity; and finally the signal intensity of each gene was divided by its median intensity in the control sample.

2.2.6 Semiquantitative Reverse Transcriptase PCR (Polymerase Chain Reaction)

MDA-MB-23 1 and T47-D cells were plated in a 6 well plate to reach ~—80% confluence. The following day the cells were treated with vehicle PBS (phosphate buffered saline) or 1 mg/mi BuNoni extract. Total RNA was extracted using the Qiagen

RNeasy kit, 5~ig of RNA was used for reverse transcription. The RNA from the control or infected cells was incubated with random hexamers and dNTPs for 5 minutes at 65

°C, then 0.1 M dithiothreitol (DTT), 25mM magnesium chloride (MgC12), lox RT buffer, RNAsin and Superscript II reverse transcriptase (Invitrogen) was added and the mixture was incubated at 42 °C for 1 hour. The amplification conditions for each chosen gene were optimized using a Perkin Elmer 9700 DNA thermocycler. The cDNA served as a template for PCR using a variety ofprimers listed in Table 6. 45

Table 6

List of primers used in RT-PCR

PRIMER SEQUENCE Tm SIZE NFKB 1A605 5’CAC CTC CAC TCC ATC CTG AA 56.4°C NFKB 1A821 3’GCC CTG GTAGGTAACTCT GTT GAC 59.0°C 216

PCDH7 U4652 5’AAG GAG AAT AAG GGG CAA AAA 53.4°C PCDH7L4853 3’AGGGGTGGGGAAGAGAAA 55.6°C 201

PRKAcB 1033 5’AAG GAC CTT CTACGGACC CTG CTG 60.5°C PRKAcB 1411 3’CGG GAT GAT GGC AAT AAAGAC CTC 57.7°C 378

PTPRH 127 5’CAC CCA CTT GAG CCC AGATTC 58.1°C PTPRH 390 3’GTAGCCAGAACT CCAGAC CCA AAT 58.7°C 263

RPL1 9 up 5’TCA GCA GAT CCG GAA GCT CAT CAA 60.2°C

RPL1 9 LO 3’TAC AGG CTG TGA TAC ATG TGG CGA 60.1°C ***

STYK 640 5’CGG GAT GTG ATG ACT ATG GA 53.8°C STYK 1123 3’AGC GCA GCT CTC TAG GTG A 58.2°C 483

TLR2 245 5 ‘GGG TCT TGG GGG TCA TCA TCA 59.6°C TLR2 569 3’AAG AAA GGG GCT TGA ACC AGG AAG 59.4°C 324

TLR3 1721 5’CAA CTT AGC GCT CTG GAAACA 59.5°C TLR3 1978 3’GCTGGCCCGAAAACCTTCTTCT 60.1°C 257

TLR4 2577 5’AAAAGC CCT GCT GGATGG TAAAT 57.2°C TLR4 2583 3’ATG CCC ACC TGG AAG ACT CTG TAT 59.7°C *** 46

List of primers used in RT-PCR (Continued)

PRIMER SEQUENCE Tm SIZE VCAM-1 F 5’CGTCTTGGTCAGCCCTTCCT 59.4°C

VCAM-1 R 3’ACATTCATATACTCCCGCATCCTTC 56.5°C ***

ZNF8O4A 2435 5’GGA GGA GAAAAA GAG GCA GAT T 57.8°C ZNF8O4A 2640 3 ‘GGAAGG AGA TTG TTA GGG TGG AAA 56.6°C 205

CD14 902 5’CGG CTC TCT GTC CCC ACAAG 60.2°C CD14 1225 3’ATTCCCGTCCAGTGTCAGGTTATC 58.4°C 323

EGFR 5121 5’TTT ACA GGT GCG AAT GAC AGT AGC 57.2°C EGFR 5393 3’TGATAAATT GGATGG GGT GGA 54.0°C 272

E-SELECTN F 5’GGC AGT GGA CAC AGC AAA TC 56.8°C

E-SELECT1N R 3’TGG ACA GCATCG CAT CTC A 56.6°C ***

GAPDH 355 62.5°C GAPDH 774 3’ACG CCT GCT TCA CCA CCT TCT TG 62.0°C 419

GPR39 U2038 5’CTT TCA CTC CAG CTC CTT CCT T 56.5°C GPR39L2301 3’GCACCACCATCCTGTTCCA 57.6°C 263

HUBB 453 5’GCG CCG AGC TGG TTG AT 58.9°C HTUBB 732 3’TCA TAG AGG GCC TCG TTG TCAA 57.9°C 279

ICAM-1 F 5’AGG CCA CCC CAG AGG ACA AC 62.0°C ICAM-1 R 3’CCCATTATGACTGCGGCTA 59.4°C *** 47

List of primers used in RT-PCR (Continued)

PRIMER SEQUENCE Tm SIZE IFIT1 U746 5’CCATTT TCT TTG CTT CCC CTAA 53.4°C IFrrl L1202 3’CTTTTCTGTGATTGCCTGCTTC 54.7°C 456

IFIT2 U 1286 5’CAA CTA CTC CAT CTG CGG TAT 57.3°C IFIT2 L1580 3’CTCTATTCTTCATTC CCCATT CCA 54.4°C 294

IFIT3 518 5’TGG GGAAAC TAC GCC TGG GTC TA 61.8°C IFIT3 807 3’CAATGGCCTGCTTCAAAACATCAG 57.2°C 289

1L24 23 5’GCT TCT TTACCC CTC ACAATC C 55.7°C 1L24 255 3’GGG CAC TTT AAT CCA CAT TTT ATC 52.5°C 232

MYD88 up 5’CTG GCCTCT GGCATATTCAT 54.8°C MYD88 LO 3’CAG CTAAGAACC ATG GCA CCT 57.1°C ~

2.6.1 RT-PCR ver~fication

Three jig (3 jig) of the resulting cDNA was used as template in the PCR reaction.

The above primers specific to the chosen genes were generated using OligoTM program

and optimized for PCR use. Primers for 13-actin were used as internal control to ensure

equality of level of cDNA input and optimal PCR conditions (linear range). The PCR products were loaded on 2 % TBE agarose gel, stained with ethidium bromide (EtBr),

and imaged using a Bio-Rad gel documentation systems (Gel Doc 2000, Bio-Rad,

Hercules, CA) 48

2.2. 6.2 Western blot analysis

Cells were seeded into flasks and grown to 50 - 60% confluence for 24 hours.

The cells were then placed in RPMI 1640 complete medium with vehicle and BuNoni extract (1, 2, and 5 mg/mi) in the presence or absence of LPS-RS for a period of 2 and

48 hours. Respective cells were pretreated with 10 jig/jil LPS-RS for 1 hour prior to adding the final concentrations of 1, 2, and 5 mg/mi BuNoni plus LPS-RS. Treatments were adjusted to maintain 10 jig/~il LPS-RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells. Floating cells were extracted and the attached cultured cells were rinsed twice with ice cold PBS and transferred into a lysis buffer (Cell Signaling Technology, Beverly, MA) containing

20 mM Tris—HC1 (tris hydrochloride) [pH 7.5], 150 mM NaC1 (sodium chloride), 1 mM

Na2EDTA (sodium ethylenediaminetetraacetic acid), 1 mM EGTA (ethylene glycol tetraacetic acid), 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM /3-glycerophosphate,

1 mM Na3VO4 (sodium vanadate), 1 ~tg/m1 leupeptin and lx protease inhibitor cocktail

(Calbiochem, San Diego, CA) using standard methods. Western blot was carried out using standard techniques. Briefly, equal amounts of proteins in each sample were resolved in 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS

PAGE) and the proteins transferred onto Polyvinylidene Difluoride (PVDF) membranes.

After blocking with 5% non-fat dried milk in Tris-Buffered Saline Tween-20 (TBST) for

1 hour, the membranes were incubated over night with the appropriate dilution of primary antibody (mouse monoclonal and rabbit polyclonal) at 4 °C overnight (Table

7A). The membranes were then incubated with an IgG horseradish peroxidase conjugated secondary antibody for 1 hour at room temperature (Table 7B). All protein 49 blots were treated with Enhanced Chemiluminescence western reagents kits (Amersham

Biosciences UK limited, UK) and light emission was captured on X-ray hyperfilms

(Amersham Biosciences UK limited, UK) for up to 10 minutes and processed on a

Kodak M35A X-OMAT processor (Eastman Kodak, Rochester, NY) for visualization.

Densitometric analysis was performed with a Typhoon 9410 Variable Mode Imager

(Amersham Biosciences, UK limited, UK).

Table 7A

List of 10 Antibodies

10 ANTIBODY SOURCE MOLECULAR WEIGHT COMPANY STOCK # TLR4 Rabbit 75-80 kDa Abcam ab47093

IRAK1 Rabbit 81 kDa Cell Signaling 4359

IRAK2 Rabbit 62 kDa Cell Signaling 4367

IRAKM Rabbit 68 kDa Cell Signaling 4369

IRAK4 Rabbit 55 kDa Cell Signaling 4363

Caspase-8 Mouse 18,43,57 kDa Cell Signaling 9746

Caspase-3 Rabbit 17, 19, 35 kDa Cell Signaling 9662

Caspase-7 Rabbit 20, 35 kDa Cell Signaling 9492

PARP Rabbit 24, 89, 116 kDa Cell Signaling 9542 50

Table 8

List of 2° Antibodies

2° ANTIBODY SOURCE COMPANY STOCK # Anti-rabbit IgG HRP-linked Antibody Goat Cell Signaling 7074

Anti-mouse IgG, HRP-linked Antibody Horse Cell Signaling 7076

2.2.7 CytoTox-ONETM Homogeneous Membrane Integrity Assay

This assay measures membrane integrity determined by lactate dehydrogenase

(LDH) release into media. MDA-MB-231 cells were seeded at a cell density of 2 X ~ into 96-well opaque-walled tissue culture plates compatible with fluorometer (solid bottom) via a multichannel pipette and allowed to adhere overnight. RPMI 1640 complete medium was added with vehicle and BuNoni extract (2 and 5 mg/ml) in the presence or absence of LPS-RS for a period of 48 hours so the final volume was 100 ~l in each well. Respective cells were pretreated with 10 ~.tg/jil LPS-RS for 1 hour prior to adding the final concentrations of 2 and 5 mg/mi BuNoni plus LPS-RS. Treatments were adjusted to maintain 10 ~.tg/jii LPS-RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells. An equal volume of 100

~l of CytoTox-ONETM Reagent (Promega, Madison, WI) was added to the cell culture medium present in each well and shaken for 30 seconds. The assay was incubated at 22

°C for 10 minutes and 50 ~l of Stop Solution was added to each well. The plate was shaken again for 10 seconds and the fluorescence with an excitation wavelength of 560 nm and an emission wavelength of 590 nm was recorded within one hour to avoid increased background fluorescence.

2.2.8 Wound-healing assay

For experimental purposes, previously selected human BrCa cells lines were grown to —90% confluence in 12-well Falcon plates. After cells were allowed to attach and reach confluence, using a sterile 10 jil pipette tip, a “wound” (scratch) was created in the cell monolayer of each well in a single stripe. Cells were rinsed once with RPMI

1640 complete medium and exposed to BuNoni extract and the antagonist for up to 24 hours. Respective cells were pretreated with 10 ~ig/jil LPS.-RS for 1 hour prior to adding the final concentrations of 1 and 2 mg/ml BuNoni plus LPS-RS. Treatments were adjusted to maintain 10 jig/jil LPS-RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells. Images were taken at the 0 hour and migration of cells into wounded areas was observed with an inverted microscope; photographs of treated cells moving within the scratch were taken at 12 and

24 hours time points.

2.2.9 Colonyformation assay

Single-cell suspensions ofMDA-MB-23lcells were plated at a density of 1 x i05 cells/well in 6-well plates as allowed to adhere overnight. Cells were then treated with 1 and 2 mg/ml BuNoni in the presence or absence of 10 jig/jil LPS-RS. The medium was replaced with fresh medium containing the corresponding treatments every 72 hours.

After 5 days, the medium was removed and cell colonies were stained with 0.005% 52 crystal violet for 1 hour at room temperature, rinsed with 1X-PBS buffer, and air dried.

Plates were placed on a flatbed scanner to captures images of the results.

2.2.10 FA CS analysis and Annexin V/PE Assay

2.2.10.1 Analysis ofcellular DNA content byflow cytometry

The cells were grown at 50—60% confluence in T75 flasks and then treated with a diluted range of BuNoni extract (1, 2, 3, and 5mg/ml) in the presence or absence of LPS

RS in RPMI 1640 medium for 48 hours at 37 °C in a humidified atmosphere incubator containing 5% Co2. Respective cells were pretreated with 10 ~.tg/~ii LPS-RS for 1 hour prior to adding the final concentrations of 1 and 2 mg/mi BuNoni plus LPS-RS.

Treatments were adjusted to maintain 10 j.igJ~il LPS-RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells. After incubation, the floating cells were collected by centrifugation, whereas adherent cells were harvested by trypsin-EDTA solution to produce a single cell suspension. The cells were transferred to a 15 ml falcon tube then pelleted by centrifugation, and 1 ml of cold

PBS was added twice for washing the cells. Then, the cell pellets were suspended in 1 ml PBS and fixed inS ml ice-cold 70% EtOH at 4 °C. After resuspension with 1 ml

PBS, the cells were incubated with RNase A (20 mg/L) and P1 (propidium iodide) [50 mg/LI and shaken for 1 hour at 37 °C in the dark. The stained cells were analyzed using a FACScan flow cytometer in combination with BD lysis II software (Becton Dickinson

San Jose, CA, USA). 53

2.2.10.2 Assessment of apoptosis

The cells were treated and harvested as above. Annexin-V and PE

(phycoerythrin) double staining kit (Roche Applied Science, Indianapolis, IN) was used to assess apoptosis, and then cells were immediately analyzed by flow cytometry.

Apoptotic cells were defined as FAAD~/PE cells. The gated cells were then plotted for annexin-V FAAD and PE in a 2-way dot plot to assess percentage of apoptotic MDA

MB-23 1 cells. Early apoptotic cells were localized in the lower right quadrant of the dot-plot graph, while late apoptotic cells were localized in the upper right quadrant using annexin-V-fluorescein vs. PE.

2.2.11 IC50 (Dose-response curve) Assay

BrCa cells were plated at 2 X 1 0~ cells/well in 8-well strips of 96-well Falcon plates and allowed to adhere overnight. At the 0-hour time point, the media was removed by inversion and light tapping. Wells were treated with RPMI 1640 complete media containing two-fold serial dilutions (from 3 mg/ml to 0.047 mg/ml) of BuNoni extracts and varied serial dilutions (from 10 p.g/~il to 0.00195 ~.tg/~.tl) of LPS-RS, respectively. Respective cells were pretreated with varied serial dilutions of LPS-RS synonymously for 1 hour prior to adding the final concentrations of BuNoni plus LPS

RS. Treatments were adjusted to maintain varied serial dilutions ofLPS-RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells. At 48 hours, cells were affixed to the wells via crystal violet assay, air dried, and quantified with a spectrophotometer. 54

2.3 Statistical analysis

The statistical probability of our aims was calculated by Student t-test analysis to determine the arithmetical significance. As a general rule, the null hypothesis plays a major role in scientific applications, and it is necessary to test the significance of differences in control groups and respective treatments. We performed the Student t-test to calculate the p-value (indicated by *) below the threshold for statistical significance

(0.05 level), where our null hypothesis was assumed to be true. CHAPTER 3

RESULTS AND DISCUSSION

3.1. Noni Characterized

M. citrifolia has been processed into noni powder using several methods, which includes but is not limited to, freeze-drying, sun-drying and air-drying. The fruit is usually then pounded into powder for reconstitution with dilutants such as water or mixed fruit juices. Hawaiian Herbal Blessings, Inc., uses the freeze-drying technique, removing only water (http://www. hawaiian-noniworks.com). From start to finish, plants are grown to yield white ripe fruit, after which the plant is picked at its peak of ripeness, frozen, and freeze-dried prior to being pulverized into a fine powder. It takes about 10 pounds of fresh noni plant to make 1 pound of freeze-dried powder. The processing company has an assortment of products; however, we were only interested in the dehydrated noni powder, which preserved the nutrients and phytochemicals.

3.2 Results Observed

3.2.1 Extracts ofNoni display cytotoxic effects

There have been several studies used to examine the physiological effects of extracts on cancer cells, which are processed and prepared by an assortment of methods.

Some of the compositions derived from extracting the dried powder include

55 56 polysaccharides, glycosides, alkaloids and anthraquinones; ergo, as shown in Table 1, each nutraceutical has its own effect and benefits to human health. Our initial experiments included a variety of alcohols, alone or in combination, water (room temperature and heated), and chloroform (CHC13), which has a myriad of uses as a reagent and a solvent. To identify a suitable solvent, we tested the alcohols that ranged from primary to more fatty chain alcohols, each with MSDS specifications for use, volatility, and toxicity as shown in Table 4. Specifically, EtOH is classified as a primary alcohol with one of its two carbons attached to a hydroxyl group containing at least two hydrogen atoms; it is a colorless, yet flammable, liquid that has a strong characteristic odor. MeOH is the simplest alcohol, with only one carbon attached to a hydroxyl group; it, too, is colorless and flammable with a distinctive odor, but is somewhat milder and sweeter than EtOH. A third alcohol, BuOH, is also considered primary with a 4 carbon structure; it belongs to the higher alcohols and branched-chain alcohols. Each of these alcohols are common laboratory solvents that are also used a fuels and as intermediates in chemical syntheses.~2281

Other solvents on the higher order of alcohols were also used such as 2- propanol, +1- 2-butanol, 1 -pentanol, 3-butanol, 3-hexanol, 3-heptanol, and 3-octanol.

The simplest example of an alcohol, 2-PrOH and also known as isopropyl alcohol, is a secondary alcohol with the alcohol carbon attached to two other carbons. Sec-butanol,

2-BuOH, is also a secondary alcohol used as a solvent and as an intermediate in the manufacture of other chemicals. The five carbon atoms alcohol, 1 -PenOH, was used as well as isobutanol, 3-BuOH; both of these alcohols are colorless and flammable and are used as coatings. Three straight chain isomeric alcohols were used: 3-HexOH, 3- 57

HepOH, and 3-OctOH; they are also clear, colorless liquids that are slightly soluble in

water used in cosmetics for their pleasant fragrance.~228~

We initially used micro-scaled extractions to examine these solvents

simultaneously. The dried powder was reconstituted in the respective solvents by

continuous stirring for approximately 48 hours. This resulted in separation of most of

the phytochemicals from the undesirable compounds, after which the noni extracts were

filtered and dried down for further use. Although the size of the filter did not change, it

was necessary to note the boiling point of each solvent due to the volatile nature of

alcohols such as butanol and hexanol as well as chloroform, with boiling points of 118

°C, 135 °C, and 61 °C, respectively. This was important because the extractions were

dried down in a rotary evaporator, where ambient pressure became equal to the

saturated vapor pressure. Under these conditions, the solvents have lower boiling points

than when the liquids are at atmospheric pressure; thus, in such a vacuum pressured

environment the temperature was set at 55 °C to account for the highest to the lowest

temperature required.

The recovery of noni extract depended highly on the size of the extraction. For

example, when extracting the on a micro-scale level e.g., 2 g ofnoni powder plus 2 ml

of solvent for each starting amount, the resulting amount ranged from 0.2 g to 1.6 g of

extract after filtering to yield a final weight of 1% to 3% of the initial weight after

drying down. A larger scale extraction yielded approximately 11% of the original dried

noni powder weight as demonstrated in Table 4. Therefore, using the large-scale

extraction method, 50 g ofnoni powder yielded about 5.5 g of extracted phytochemicals. A by-product of oil residue also formed during the drying down of the 58

extraction, which also showed favorable results on the treatment of human cancer cells

and will be examined extensively at a future time. Notably, once noni extract is

dissolved, its potency deteriorates at temperatures greater than -20 °C after a 2 week

period; the noni extracts added to medium to obtain concentrated treatments lose

effectiveness after about 24 hours. As a result, all noni extracts were stored in -80 °C

until required for use and treatments were made fresh on the day of use.

As indicated by the survival curves in figure 4, several noni extraction

methods inhibited the growth of the three human BrCa cell lines. The EtOH, MeOH,

and BuOH extractions inhibited the growth of MCF-7 human BrCa cells in comparison

to the non-treated cells; however, after 24 hours the cells recovered. Differently, EtOH,

MeOH, and BuOH extractions had a drastic effect on MDA-MB-23 1 cells as exhibited

by a slower growth rate compared to the control cells, shown in figure 4. Surprisingly,

the EtOH extraction on T47-D human BrCa cell line did not exhibit cell growth in

contrast to the MeOH extraction, which showed cell growth up to 24 hours and killing

shortly after 24 hours. Of the cell lines tested, the T47D human BrCa cells, which

express the ER, PR, and HER2 receptors, were the most sensitive to the growth inhibitory effects of the butanol fraction, which showed cell death for up to 72 hours

(figure 4). 59

Sun isal Cnn e 1mg mLMCF-7 250

209 • Methanol

— Ethanol 150

I Bulanol

;~ 109 *“Chloi ofoiin

50 ~ No It’.

0 Hours 24 Hours 72 Hours

Sun’IvaI Curve lmgImL MDA-MB-231 1400

1200 Methanol 1000

800 —0—Ethanol

600 ••••*~• Bntanol

400 —a—Chloroform

200 ——NoR~

0 0 Hours 24 Hours 48 Hours 72 Hours 60

Sur~ n .iI (‘ur~ e ling/mL T47D 375

325

275 —4—Ethanol ~ 225

—— Bn(anol r 175 ailoiofoiin 125 —0—No Rx 75

25 Oflours 24Hours 48Hours 72Hours

Fig. 4 (A, B, C). Effect of multi-solvent extraction methods on cell proliferation in human BrCa cells: (A) MCF7, (B) MDA-MB-23 1, and (C) T47-D.

Our findings were supported by previous reports that showed that a BuOH soluble

fraction ofnoni fruit extract (US Patent 2003 0004116 Al) containing three novel glycoside compounds, displayed potential activity as anti-tumor and anti-proliferative agents on cancer cells. Therefore, we used BuOH as the standard solvent for all proceeding extractions for subsequent experiments because it yielded the greatest cytotoxic effects in human BrCa cells. Although other extracts were tested, the stability of certain solvents, such as chloroform, was inconsistent, and the extracts with a low concentration ofphytochemicals resulted in no inhibition of cell growth or had marginal effects on each of the BrCa as shown in figure 4. Although we initially used DMSO to dissolve the extracts as crude noni extracts, we changed the resuspension solution to

9500 EtOH to usurp any lethal effect that DMSO may have been having on the BrCa 61

cells. The proposed cytotoxic percentage of DMSO is approximately 0.2% for normal

cells; for EtOH, the cytotoxic effect is slightly greater than 0.5%.

Guided by the results of these experiments, we further tested the growth

inhibitory activity ofbutanoi noni extracts (BuNoni) resuspended in 95% EtOH in order

to explore its cytotoxic effects on cell proliferation and cell survival. BrCa cells were

exposed to three concentrations (0.5, 1, and 2 mg/mi) of BuNoni extract for 72 hours

and the number of viable cells was determined by the crystal violet assay. Although

most breast cells maintain the normal phenotype, MDA-MB-23 1 cells lose normalcy in

breast cancer progression. In vitro, they have an invasive phenotype because they have

lost the expression of E-cadherin, estrogen receptor and progesterone receptor. As

shown in figure 5, MDA-MB-23 1 cells were examined in the presence or absence of

BuNoni treatment (0.5, 1, and 2 mg/mi). At 2 mg/mi, the cell death was evident and

cell survival was drastically decreased up to 72 hours. Although it appeared that cells

began to recover by 72 hours, cell proliferation still did not reach 100% and was

significantly lower than those cells not exposed to BuNoni. At the 1 mg/mi dose, cell

death was obvious along with decreased the cell survival through 24 hours. Yet, the

growth recovery seemed to take place shortly before 48 hours, but the % survival is well

below untreated cells. Even the lowest dosage, 0.5 mg/mi, exhibited a decreased cell

survival rate, but not necessarily cell death. Still, by 72 hours the proliferation rate was

close to half the rate of the cells not exposed to BuNoni. Similar preliminary results were obtained in an additional study using T47-D cells (not shown). 62

0~ Sur~ i~ al Cur’s e fijDA..MB.23 1 700

600 —.— oR’~ 500 —4—2mg ml BuNoimi

—•—i mg ml BtmOH

—*—OA mn~ ml 200 BimOH

100

0 0 Hours 24 Hours 48 Hours 72 Hours

Fig. 5. Effect of BuNoni extraction on cell proliferation in MDA-MB-23 1 human BrCa

cells.

2.2 BuNoni ‘s IC50 value in cellproliferation

MDA-MB-23 1 cells were treated with BuNoni extract at various concentrations

(serial diluted from 3 mg ml to 0.047 mg/mi) for 0 - 48 hours, and the cell viability was

determined by a number of assays. As shown in figure 6, BuNoni extract inhibited the

growth and proliferation of MDA-MB-23 1 cells in a dose- and time-dependent manner.

The IC50 value for BuNoni extract 48 hours after treatment was 1.5 mg/ml ± 025 mg/ml, where statistics show the p value is 0.0022. 63

Ivff)A-I~JE-231 I)ose Re.cpoii~e Cuz ye 120

‘oo - —----—-----~~ - —-__ _-

80 -‘—-—--—- -~ -——--~__—

~ 40 - —-—~_——______

0 0 20 ______

0 00 00 00 00 00 00 00 Z E 00 — — 0 0 Co ceitti aflon of BuNoin

Fig. 6. Effect of BuNoni on MDA-MB-23 1 cells. MDA-MB-23 1 cells were treated 48

hours with serial diluted concentrations of BuNoni, where *p — 0.0022.

2.3 Gene expression profiles iden4fy cytotoxic pathways

To examine the gene expression profile of MDA-MB-23 1 cells were treated

with 2 mg/mi BuNoni extract, with DMSO control for 2 hours. The profile was generated by cDNA microarray from 3 independent experiments. After RNA extraction, gene expression profiles were recorded using Affymetrix HG Ui 33 Plus 2.0

GeneChip Arrays as described. Expression profiles were normalized to the control (no treatment) condition and all calculations performed during analysis were based on the log ratio of the normalized values to ensure that up-regulated and down-regulated patterns of expression were given equal weight. The Affymetrix chip (U133A) used 64 contains 22,000 transcripts, and based on Aff~’metrix present or absent detection of the transcripts, a list of 185 genes was considered for further analysis in Table 8.

Regulated genes were identified using the following selection criteria: minimal signal intensity> median and fold change vs. control> 1.5 in three independent experiments.

A minimal change of 3-fold difference, coupled with a minimal raw value of 100 to ensure that unreliable and low range expression values were eliminated. 65

Table 9

Microarray List of Regulated Genes

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION chromosome 2 open reading frame 10.07 AF052145 C2orflO 10 (ZNF8O4A)

alkaline phosphatase, placental 8.665 NM_001 632 ALPP (Regan isozyme)

7.956 AWl 03422 PCBP2 Poly(rC) binding protein 2

protein kinase, cAMP-dependent, 6.696 AA130247 PRKACB catalytic, beta

6.429 NM 002589 PCDH7 BH-protocadherin (brain-heart)

5.486 NM 001508 GPR39 G protein-coupled receptor 39

radical S-adenosyl methionine 5.028 A1337069 RSAD2 domain cont. 2

purinergic receptor P2Y, G-protein 5.006 NM_002564 P2RY2 coupled, 2

SMAD, mothers against DPP 4.803 NM_005904 SMAD7 homolog 7 (Drosophila)

ALPPL2,allcaline phosphatase, 4.75 8 Ml 3077 ALPP placental 2O2742_s_at

protein kinase, cAMP-dependent, 4.699 NM_00273 1 PRKACB catalytic, beta

heterogeneous nuclear 4.496 AW450929 HNRPA1 ribonucleoprotein Al 66

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION zinc finger CCCH-type containing 4.402 NM_025079 ZC3H12A 12A

4.365 NM_017695 SYTL2 synaptotagmzin-like 2

4.298 NM_001630 ANXA8 annexin A8

polycystic kidney disease 2 4.273 NM 000297 PKD2 (autosomal dominant)

4.236 AK026980 ZNF37B zinc finger protein 37b (KOX 21)

receptor tyrosine kinase-like orphan 4.199 NM 005012 ROR1 receptor 1

sterile alpha motif domain 4.105 NM 017654 SAMD9 containing 9

SMAD, mothers against DPP 4.074 A1628464 SMAD6 homolog 6

anterior gradient 2 homolog 3.996 AF088867 AGR2 (Xenopus laevis)

chromosome 1 open reading frame 3.99 AF247168 Clorf63 63

3.914 NM 000600 1L6 interleukin 6 (interferon, beta 2)

cleavage stimulation factor, 3’ pre 3.912 A1872408 CSTF2T RNA, subunit 2, 64kDa, tau variant

Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 3.904 W74620 HNRPD 37kDa)

3.898 NM 024680 E2F8 E2F transcription factor 8 67

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION GBAP glucosidase, beta; acid 3.877 D13287 GBA (includes glucosylceramidase)

3.848 NM 021069 SORBS2 sorbin and SH3 domain containing 2

inhibitor of DNA binding 1, dominant negative helix-loop-helix 3.84 D13889 ID1 protein

serum/glucocorticoid regulated 3.827 NM 005627 SGK kinase

solute carrier family 2 (facilitated 3.803 NM_017585 SLC2A6 glucose transporter), member 6

heterogeneous nuclear 3.802 A1144007 HNRPA1 ribonucleoprotein Al

ADAM metallopeptidase with 3.797 AB002364 ADAMTS3 thrombospondin type 1 motif, 3

protein phosphatase 1, regulatory 3.791 NM 006242 PPP1R3D subunit 3D

peptidylprolyl isomerase A 3.752 A1191118 PPIA (cyclophilinA)

solute carrier family 22 (organic 3.607 NM_003059 SLC22A4 cation transporter), member 4

Splicing factor proline/glutamine rich (polypyrimidine tract binding 3.563 AV705803 SFPQ protein associated)

3.539 NM_01 8147 FAIM Fas apoptotic inhibitory molecule

3.52 BC004409 GTPBP7 GTP-binding protein 7 68

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION 2’-5 ‘-oligoadenylate synthetase 2, 3.517 NM 016817 OAS2 69/7lkDa

colony stimulating factor 2 3.422 Ml 1734 CSF2 (granulocyte-macrophage)

3.422 NM 003543 HIST1H4H histone 1, H4h

3.41 NM_014908 TMEM15 transmembrane protein 15

3.407 NM 025208 PDGFD platelet derived growth factor D

3.3 83 NM_014048 MKL2 MKL/myocardin-like 2

3.378 AF112857 CCNE2 cyclinE2

solute carrier organic anion 3.362 NM_016354 SLCO4A1 transporter family, member 4A1

3.357 AL137351 ANKRD26 ankyrin repeat domain 26

3.353 NM_007237 SP14O SP14O nuclear body protein

3.344 MS 7731 CXCL2 chemokine (C-X-C motif) ligand 2

3.329 NMO3 0952 NUAK family, SNF1 -like kinase, 2

3.301 NM_024591 CHMP6 chromatin modifying protein 6

3.292 AL353759 HIST1H2AC histone 1, H2ac

3.285 AU154985 AK2 adenylate kinase 2

Eukaryotic translation initiation 3.283 AW500473 EIF4EBP2 factor 4E binding protein 2 69

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION 3.279 NM 006350 FST follistatin

colony stimulating factor 3 3.248 NM_000759 CSF3 (granulocyte)

3.422 NM 003543 HIST1H4H histone 1, H4h

3.41 NM 014908 TMEM15 transmembrane protein 15

3.407 NM_025208 PDGFD platelet derived growth factor D

3.383 NM 014048 MKL2 MKL/myocardin-like 2

IFN-induced protein with 3.153 NM_001548 IFIT1 tetratricopeptide repeats 1

interferon-induced protein with 3.149 BE888744 IFIT2 tetratricopeptide repeats 2

FXYD domain, ion transport 3.147 BE552409 FXYD5 regulator 5

interferon-induced protein with 3.134 NM_001549 IFIT3 tetratricopeptide repeats 3

RAB1 7, member RAS oncogene 3.132 NM_022449 RAB17 family

3.129 BC005926 EVI2B ecotropic viral integration site 2B

3.101 X62048 WEE1 WEE1 homolog (S. pombe)

Pre-B-cell leukemia transcription 3.092 AL049381 PBX1 factor 1 70

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION polymerase (RNA) II polypeptide 3.061 AA772747 POLR2L L, 7.6 kDa

3.059 AL365505 RBL1 retinoblastoma-like 1 (p107)

EPM2A (laforin) interacting protein 3.054 NM 014805 EPM2AJP1 1

tumor protein p53 inducible protein 3.051 BC000474 TP5313 3

3.03 6 NM_002090 CXCL3 chemokine (C-X-C motit) ligand 3

nuclear factor of kappa light polypeptide gene enhancer in B- 3.004 A1078167 NFKBIA cells inhibitor, alpha

CM1O minichromosome maintenance deficient 10 (S. 3.001 NM 018518 MCM1O cerevisiae)

0.33 NM_003417 ZNF264 zinc finger protein 264

0.328 NM_005228 EGFR epidermal growth factor receptor

0.327 AF070596 LOC57146 promethin

GABA(A) receptor-associated 0.326 BF125756 GABARAPL1 proteinlikel

0.326 NM 021013 KRTHA4 keratin, hair, acidic, 4

protein tyrosine phosphatase type 0.326 NM 007079 PTP4A3 IVA, member 3

0.324 NM_000640 IL13RA2 interleukin 13 receptor, alpha 2 71

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION spermidine/spermine Ni- 0.324 NM 002970 SAT acetyltransferase

0.3 23 NM_0248 17 FLJ1 3710 hypothetical protein FLJ1 3710

0.323 NM_024052 C17orf39 chromosome 17 open reading frame 39

interleukin 6 receptor; interleukin 6 0.316 NM_000565 IL6R receptor

GABA(A) receptor-associated protein 0.314 AF087847 GABARAPL1 like 1

spermidine/spermine Ni - 0.311 M55580 SAT acetyltransferase

protein tyrosine phosphatase, receptor 0.31 NM_002849 PTPRR type, R

tumor necrosis factor receptor superfamily, member 1 Od, decoy with 0.307 AF021233 TNFRSF1OD truncated death domain

synuclein, alpha interacting protein 0.3 07 NM_005460 SNCAIP (synphilin)

0.307 NM_004049 BCL2A1 BCL2-related protein Al

0.307 NM_Ui 8383 WDR33 WD repeat domain 33

0.306 A1357376 NEDD4L neural precursor cell expressed

0.3 05 NM_U22U4i GAN giant axonal neuropathy (gigaxonin) 72

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION 0.305 NM_013394 FGF1 fibroblast growth factor 1 (acidic)

0.304 AF201292 TSC22D2 TSC22 domain family, member 2

0.302 NM 014845 K1AA0274 K1AA0274

0.301 AF003934 GDF15 growth differentiation factor 15

3 -hydroxy~3~methylglutaryl~co enzyme A 0.298 NM 002130 HMGCS1 synthase 1 (soluble)

0.297 AF217963 MAGED1 melanoma antigen family D, 1

protein tyrosine phosphatase type IVA, 0.297 BCOO3 105 PTP4A3 member 3

0.295 AW450751 DOCK9 Dedicator of cytokinesis 9

spermidine/spermine Ni - 0.289 BE97 1383 SAT acetyltransferase

cytocbrome P450, family 27, subfamily 0.285 NM_000785 CYP27B1 B, polypeptide 1

Protein phosphatase 2, regulatory subunit 0.283 AW772123 PPP2R5C B (B56), gamma isoform

0.282 A1056359 MAPT microtubule-assocjated protein tau

0.281 BE217882 KIAA1718 KIAA1718 protein

protein phosphatase 1, regulatory subunit 0.279 NM 002714 PPP1R1O 10

0.278 NM 001671 ASGR1 asialoglycoprotein receptor 1 73

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION 0.278 NM_014059 RGC32 response gene to complement 32

0.278 AK027194 CIAS1 cold autoinflammatory syndrome 1

solute carrier family 17 (anion/sugar 0.275 NM_012434 SLC17A5 transporter), member 5

tissue factor pathway inhibitor (lipoprotein-associated coagulation 0.271 AFO21 834 TFPI inhibitor)

0.27 BE552334 EIF5 eukaryotic translation initiation factor 5

KDEL (Lys-Asp-Glu-Leu) endoplasmic 0.268 NM_01 6657 KDELR3 reticulum protein retention receptor 3

solute carrier family 2 (facilitated glucose 0.266 BE550486 SLC2A3 transporter), member 3

0.266 BG251521 cDNADKFZp586B211

0.266 AW026491 CCND2 cyclin D2

0.266 J03778 MAPT microtubule-associated protein tau

amine oxidase, copper containing 2 0.265 NM_009590 AOC2 (retina-specific)

protein phosphatase 1, regulatory subunit 0.263 A1492873 PPP1R1O 10

0.261 AL096710 DST dystonin

cDNA DKFZp586B21 1 (from clone 0.261 AA045174 DKFZp586B211) 74

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION ATP-binding cassette, sub-family F 0.251 NM_005692 ABCF2 (GCN2O), member 2

0.229 AA778684 SLC2A3 solute carrier family 2

0.224 AV704962 SC4MOL sterol-C4-methyl oxidase-like

0.224 NM 000076 CDKN1 C cyclin-dependent kinase inhibitor 1 C

0.221 NM 014961 RIPX rap2 interacting protein x

0.221 NM 012257 HBP1 HMG-box transcription factor 1

0.221 NM 003 155 STC1 stanniocalcin 1

0.219 BE300521 INSIG1 insulin induced gene 1

0.218 NM 001145 ANG RNASE4 angiogenin, ribonuclease,

0.218 D64137 CDKN1C cyclin-dependent kinase inhibitor 1C

0.217 R78668 CDKN1 C cyclin-dependent kinase inhibitor 1 C

NIMA (never in mitosis gene a)-related 0.217 AJ191920 NEK3 kinase 3

0.216 NM 031272 TEX14 testis expressed sequence 14

0.215 NM 019891 ERO1LB ERO1-like beta (S. cerevisiae)

0.207 BC004241 LAMA4 laminin, alpha 4

0.206 NM 006931 SLC2A3 solute carrier family 2 75

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION 0.199 NM_006472 TXNIP thioredoxin interacting protein

0.198 NM_01 8039 JMJD2D jumonji domain containing 2D

protein tyrosine phosphatase, receptor 0.197 U77917 PTPRR type, R

0.196 AA812232 TXNIP thioredoxin interacting protein

0.193 BG292233 INSIG1 insulin induced gene 1

0.186 NM 006538 BCL2L11 BCL2-like 11 (apoptosis facilitator)

Cyclin-dependent kinase inhibitor 1 C 0.184 N95363 CDKN1C (p5 7, Kip2)

0.179 NM 020152 C2lorf7 chromosome 21 open reading frame 7

0.179 A1439556 TXNIP thioredoxin interacting protein

0.17 NM 005542 INSIG1 insulin induced gene 1

0.166 X59065 FGF1 fibroblast growth factor 1 (acidic)

0.165 NM 000817 GAD1 glutamate decarboxylase 1 (brain, 67kDa)

phosphodiesterase 4D interacting protein 0.147 H15535 PDE4DIP (myomegalin)

G protein-coupled receptor kinase 0.145 NM 014776 GIT2 interactor 2

0.143 AK001406 SENP6 SUMO 1 /sentrin specific peptidase 6

0.131 A1300520 STC1 stanniocalcjn 1 76

Microarray List of Regulated Genes (Continued)

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION 0.13 NM 006850 1L24 interleukin24

0.13 NM 001723 DST dystonin

0.123 AW006750 KLHL24 kelch-like 24 (Drosophila)

0.117 U46768 STC1 stanniocalcin 1

0.115 NM_003 734 AOC3 amine oxidase, copper containing 3

0.113 AW006750 KLHL24 keich-like 24 (Drosophila)

0.086 AU143984 SEC24D SEC24 related gene family (S. cerevisiae)

Thus, a maximal t-test p-value of 0.05 (without multiple testing corrections) was applied to derive a truncated list of 14 genes (0.7%) with expression significantly altered between treated and untreated cells. Of those 185 identified genes, 10 were significantly up-regulated while 4 were significantly down-regulated, represented in

Table 9. These genes are related to regulatory function and immune function with the exception of Znf~04a, which is the most up-regulated, but is not suggested as an immune component. [229] 77

Table 10

Select List of Regulated Genes

GENBANK GENE FOLD CHANGE SYMBOL DESCRIPTION 10.07 ZNF8O4A ZNF8O4A

8.665 ALPP Alkaline phosphatase

7.956 PCBP2 Poly(rC) binding protein 2

6.696 PRKACB Protein kinase, cAMP-dependent

6.429 PCDH7 BH-protocaderin 7

3.344 CXCL2 Chemokine ligand 2

3.153 IFIT1 Interferon-induced protein 1

3.149 IFIT2 Interferon-induced protein 2

3.134 IFIT3 Interferon-induced protein 3

3.036 CXCL3 Chemokine ligand 3

-3.75 CCND2 Cyclin D2

-4.25 CDKN1C Cyclin-dependent kinase inhibitor 1C

-6.02 FGF1 Fibroblast growth factor 1 (acidic)

-7.69 1L24 Interleukin-24

Several of the up-regulated genes are collectively related to immunity and cell cycle. Isozymes of alkaline phosphatase, ALPP, have been studied extensively in the past few years because oftheir importance as markers for diagnosis of cell deregulation 78

in various diseases; it was shown that variations in alkaline phosphatase activity

effected the distribution of cells throughout the cell cycle.~2301 PCBP2, Poly(rC) binding

protein 2, has been implicated in control of mRNA stabilization, translation, and a

diverse set ofpost-transcriptional control pathways such as selective cap-independent

transcription.~231~ PRKACB is a member of the Ser/Thr protein kinase family and is a

catalytic subunit of AMPK that plays a key role in mediating its biological functions. It

is c-AMP-dependent and regulates an assortment of cellular processes including

proliferation, the cell cycle, and gene transcription.~232’2331 Protocadherin 7, PCDH7,

belongs to a subfamily (pro-) of the cadherin superfamily and is thought to function in

cell-cell recognition and adhesion.~234~ CXCL2 and CXCL3 are from a small group of

chemokines, which are known to play essential roles in the development, homeostasis,

and function of the immune system.~229’2351 IFIT1, IFIF2, and IFIT3 are interferon-

induced proteins that play immunologically defensive roles against microbial infections,

and because they exhibit antiproliferative and differentiating activities, IFITs are

thought to be ideal antitumor agents.~229’2361

The down-regulated genes are mostly centered on regulatory functions and

differentiation rather than immunity or cell cycle. Cyclin D2, also known as CCND2, belongs to the highly conserved cyclin family of genes; they are characterized by a vivid recurrence in protein abundance through the cell cycle and function as regulators of CDK kinases.~237’238~ CDKN1C, cyclin-dependent kinase inhibitor 1C, is a negative regulator of cell pro liferation.~2391 Fibroblast growth factors, FGFs, are involved in diverse biological processes, such proliferation and differentiation ofwide variety of cells and tissues as well as tumor growth. [240~ 241] And finally, interleukin 24 (IL-24) 79 belongs to IL-b family of cytokines that is known as a tumor suppressing protein; IL-

24 seems to control in cell survival and proliferation by inducing rapid activation of the

Stat-i and Stat-3 transcription factors.~2422441

.2.3.1 Microarray results were confirmed

In figure 7, we took the highest expressers for analysis to just confirm our microarray data and reverse-transcription PCRs (RT-PCRs) were carried out on a total of ii chosen probe sets, ofwhich six (6) were up-regulated and five (5) were down- regulated (not shown) from the expression analysis data shown. Tubulin (housekeeping gene) probes were used as internal standards and showed that similar quantities of RNA were used in these assays. These RT-PCR results are consistent with the observations from the microarray data. Because of initial signaling events, we chose to examine the transcript levels at 2 hours of BuNoni treatment; we also used a 6 hours time point for further observation. The RT-PCR results revealed that the PCDH7 and PRKACB were slightly up-regulated at 2 hours in comparison to the 0 hour, while Znf~O4a, IFIT1, and

IFIT2 were drastically increased at 2 hours, but showed decrease at 6 hour almost similar to the 0 hour. GRP3 9 showed no significant change in transcript level at either hour. 80

B Ohrs 2hs 6hrs

pcdh7 A Ohrs 2hrs 6hrs znf8O4a PCdh7[ J gpr39 Zn1~O4a [ •1 ~r39 [ ~t2

PRKAC13 pikacl3 [ ffiQf ifiti Thblin2 I I Tub

Fig. 7(A, B). Gene expression oJMDA-MB-231 human breast cancer cells. (A) MDA MB-231 cells were treated for 12 hours using 1 mg/mI concentrations of LPS for 0, 2 and 6 hours. (B) MDA-MB-23 1 cells were treated for 12 hours using 1 mg/mI concentrations of BuNoni for 0, 2 (because of initial signaling events) and 6 hours.

.2.3.2 Signaling pathway was analyzed

To identify signaling pathways affected in response to BuNoni extract treatment,

Ingenuity Pathways Analysis (IPA; Ingenuity Systems, Redwood City CA) software

was used to search and explore regulated genes, build pathways, and analyze our array data in the context ofbiological processes and molecular networks as shown in figure 8.

Upon survey of the extensive 185 regulated-gene list, we noticed that several genes were related to the innate immune system. Those genes strongly associated with cell death and relevant pathways were chosen for fhrther analysis and verification. Since 81

our extract contained components that are similar to LPS, the TLR4 pathway was

chosen as the first candidate to look at; thus, we started with the pathway that was more

easily testable. Ergo, these selected genes are essentially related to the Toll-like receptor pathway, which suggested the innate immune system was being activated.

Although other pathways lead to cell death are present, there was a stronger correlation to the innate immune system, which proved to be the most likely pathway to describe

BuNoni’s mechanism of action. 82

.~rI~s 1.23 Merg~a 1 A

~rrarsIbi!iir Spire

PD&

A hatusG m4~ ~I5 lit? &2A1

213L:. ii ~AumL’u.juie

RORI Cir1cI~ ES 4919) tin

nfl

C~top iIsnl

I ITS

/ / / —______.Iuclejs j/ , I, ,1~ — / , —— /, — — /1,_ _~ ltc —-— ‘ 6~~’ — — — — i~ft~ P~R 2- ACNE2(in€o EG91i~) —— Ri

~. :1---- A04 1101?i 1.17’

C 2S00~0til’i,rvtrSnThni. (ii UI0Q~~I 544usd

Fig. 8. Microarray analysis generated by Ingenuity Pathway Analysis. 83

TLR4 is a key player of the initiation of host immune defenses and stands at the vanguard of the Toll-like receptor pathway. It engages a set ofMyD88 adaptor proteins as previously described and detects LPS (structurally similar to noni) on Gram-negative bacteria.~199’2111 For our interest, we chose a panel of human BrCa cell lines (Table 11) and looked at the expression ofTLR4 and MyD88 levels, along with other receptors, adaptors, and gene expressions as a result of our pathway analysis as shown in figure 9. 84

Table 11

Description of human cancer cell lines.

BrCa CELL HORMONE lINE GENDER ETHNICITY TISSUE MORPHOLOGY STATUS HCC- Mammary 1806 Female Black gland Epithelial ER-/PR-/Her2-

MDA- Mammary MB-23 1 Female Caucasian gland Epithelial ER-/PR-/Her2-

Mammary MCF-7 Female Caucasian gland Epithelial ER+/PR+/Her2+

MDA- Mammary MB-435 Female Caucasian gland Epithelial ER-/PR-/Her2+

Mammary BT-20 Female Caucasian gland Epithelial ER-/PR+/Her2+

HCC- Mammary 1143 Female Caucasian gland Epithelial ER-/PR-/Her2-

Mammary T47-D Female Caucasian gland Epithelial ER+/PR+/Her2+

Mammary BT-474 Female Caucasian gland Epithelial ER-/PR+/Her2+ 85

ERA I I ERB b/up GPR3O I I TLR4

MYD 88

TLR2 IFIT3 I I Tublin j ~ GAPDH I 1 Fig. 9. RT-PCR of human cancer cell lines looking at different adaptor, receptor, and gene expressions.

Because we used different samples from those used during the microarray

analysis, our RT-PCR results were confirmatory, rather than evidential; thus, they revealed transcript levels of TLR4 to be very significant in both MDA-MB-23 1 and

T47-D cells, with MyD88 being highly expressed in MDA-MB-23 1 only and just slightly in HCC-1 806 and BT-20 epithelial cells. Furthermore, estrogen receptor alpha

(ERa), which is activated by the sex hormone estrogen and important for activation of transcription, was substantially expressed in T47-D, MCF-7, and BT-074 BrCa cells as well as in HCC- 1143 epithelial cells. GPR3 0 (G Protein-coupled Receptor 30), which plays a role in the signaling events following stimulation of cells and tissues probably 86 due to its high affmity for estrogen, was variably expressed in MCF-7, and BT-074

HCC- 1143 and HCC- 1806 cells; there was a considerable level of transcript expression in MDA-MB-23 1 cells. Toll-like receptor 2 (TLR2), which is also implicated in innate immunity, was only expressed in HCC-1143 cells. IFIT3 appeared to be significantly expressed in HCC-1143, followed by a slightly decreased expression in MDA-MB-231 cells and further decrease in BT-20 cells; T47-D and BT-074 BrCa cells showed marginal transcript levels of IFIT3. The housekeeping genes, tubulin and GAPDH, confirmed that sample loading was equal.

Although TLR4 transcripts were highly expressed in MDA-MB-23 1 and T47-D cell lines, protein analysis revealed dissimilar results. With the exception of HCC- 1143 cells and the addition of MDA-MB-468 epithelial cells, the same panel was used to detect the sensitivity of human cancer cells to TLR4 through western blotting in figure

10. There seems to be no real correlation with the protein levels of TLR4 and the sensitivity to killing on this panel of human cancer cells. Moreover, signaling from

TLR4 to downstream genes is post-translational rather than transcriptional, which may explain the differences in transcript and protein expression levels.

ThR41 1 Actin~—~L~~

Fig. 10. TLR4 Expression in Breast cancer cell line panel. Protein expression ofTLR4 in a panel of human BrCa cells was done to detect the sensitivity of cells to TLR4. 87

3.2.4 TLR4 agonist induces cell death in human BrCa cells

In figure 11, The TLR4 agonist, LPS, is structurally similar to the reported sugars in M. citr~folia: 6-O-(i3-D-glucopyranosyl)-1-O-octanoyl-~3-D-glucopyranose, 6-

O-(f3-D-glucopyranosyl)- 1 -O-hexanoyl-~-D-glucopyranose and 3 -methylbut-3 -enyl 6-

Ofl-D-glucopyranosyl-f3-D-glucopyranoside.

Glyco sides LPS LPS-RS

Fig. 11. Comparison of Glycosides from BuNoni extract. (A) Structures of glycosidic sugars isolated from M. citrifolia (B) Structures of agonist hexa-acylated lipid A (LPS) from E. coli and antagonist penta-acylated lipid A (LPS-RS) from R. sphaeroides.

We therefore examined the effects of LPS and the antagonist, LPS-RS, on human BrCa cell growth. As shown in figure 12, pre-incubation with LPS-RS blocked BuNoni from actively inhibiting cell growth, thereby allowing the cancer cells to continue to grow at 88 or near the normal rate. Because the general structures are the same, LPS-RS showed similar findings using BuNoni in comparison to previous research results using LPS.

MDA-MB-23 1 cells were treated once in the presence or absence of BuNoni (1 and 2 mg/ml), LPS-RS (10 ~g/~.d), and LPS (10 ~ig/~il) and combinations of BuNoniJLPS-RS and LPS/LPS-RS for 72 hours. Respective cells were pretreated with 10 jig/jil LPS-RS for 1 hour prior to adding a final concentration of 1 and 2 mg/mi BuNoni plus LPS-RS and 10 j.tg/~l LPS plus LPS-RS. Treatments were adjusted to maintain 10 jig/~il LPS

RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells. The number of viable cells was determined using a crystal violet staining assay. BuNoni treatment at 2 mg/mi showed greater than 50% cell death at 48 hours, but plateaus thereafter; the 1 mg/mi showed decreased cell growth rate but not necessarily cell death, with recovery taking place shortly before 48 hours. Although

BuNoni in conjunction with LPS-RS does not show the same trend as LPS-RS alone, there is still a protective effect as it is seen by the slower cell growth rate but no apparent cell death. There is little difference between the control, LPS, and LPS + LPS

RS treatments. However, LPS-RS alone seems to stimulate cell growth as seen by the greater incline after 48 hours. Similar results were obtained using T47-D BrCa cells as shown in figure 13. 89

0 0 Sui~iv.i1 (‘na ye MDA MB 2~1 600 ~No Rx

500 10 ~igfmi LPS RS 400 —.—.i mg/mi BuN oni ~ 300 I mg/mi 0 B uN oni + 10 ~ig’mi 200 LPS.RS 2mg/mi BuNoni 100 2mg/mi BuNoni+ 10 pg/mI LPS-RS OHours 24Hours 48Hours 72Hours 10 pg/mi LPS

Fig. 12. Effect of BuNoni on cell proliferation MDA-MB-231 human BrCa cells pretreated with LPS-RS, where *p 0.008 1.

% Survival Curve T47D 600 —~ No Rx

500 lOng/mi LPSRS

— -a— — 1 mg/mi 400 BuNoid 1mg/mi BuNoni + 300 LP$RS 2mg/mi BuNoni 200 2mg/mi BuNonj + LPSRS —— lOugmi 100 LPS • lOugmi LI’S + 0 LPSRS OHours 24Hours 4STTours 72ITours

Fig. 13. Effect of BuNoni on cell proliferation T47-D human breast cancer cells pretreated with LPS-RS. 90

In figure 14, MDA-MB-23 1 cells were pretreated with apportioned

concentrations of LPS-RS for 1 hour and afterwards treated 48 hours with 2 mg/mi

BuNoni in combination with synonymous dilutions of LPS-RS. The 2 mg/mi BuNoni

only treatment shows approximately 50% decrease in cell survival in comparison to the

control. When pretreated with LPS-RS, there appears to be a protective effect on cells,

which decreased the effectiveness of the BuNoni treatment. At the maximum amount

of LPS-RS (10 ~ig/pJ ± 0.05 ~ig/jil) the cell growth is approximately 85% survival of the

control, which substantiates the effectiveness of the antagonist’s protection. In figure

15, where we attempted to find the IC50 value of LPS-RS, it is apparent that at the

minimum LPS-RS concentration (0.039 ~g/~il ± 0.05 ~.tg/jil), the cytotoxcity of BuNoni

is not effective enough to prevent cell growth, and although the IC50 value was not

determined, the cell recovery rises to approximately 64% survival of the control. By

2.5 ~ig/jil ± 0.05 ~.tg/jil, the cell recovery is well over 72% and the trend of proliferation prevention continues for all other BuNoniILPS-RS concentrations ± 0.05 p~g/jil as well. 91

1\IDA 1%IB 231DoscRespons~ Ciii~e

120

100 - —— ______

so •——~------—--—-———---———— ____ — —

~ 60—— -______a ~~1 40

20 —______DO

0 2 0 -~ -~ -~ z DO — — ‘a

Concenn anon of LPS-RS

Fig. 14. Effect of LPS-RS dilutions in BuNoni on MDA-MB-231ce11 survival, where *p

= 0.0049.

MD4 PilE 23lDose Response Ciii~ e

120

100 —

so — —--————------—-—————-— -——— -- 160

40--- — —— -~--—————-— — 4,

20— —

0 2 DO DO DO DO DO DO z DO ‘a ~s-~ — — ‘a 2 DO 2 (‘on~enn anon of LPS-Rsui 2 ing in! BuNoni

Fig. 15. Effect of LPS-RS dilutions in BuNoni on MDA-MB-23lcell recovery, where *p = 0.0049. 92

3.2.5 Viability assays used to show the cytotoxic effect ofBuNoni

There are two distinct mechanisms by which cell death can occur: necrosis or apoptosis.~245’2461 There was several cell viability assays used to study the cytotoxic effects of BuNoni extract on BrCa cells. We performed the following assays as singular options or as confirming combinations: (1) Necrosis assay to histologically measure the release of lactate dehydrogenase (LDH) from cells with a damaged membrane and estimate the number ofnon-viable cells present, (2) fluorescence-activated cell sorter

(FACS) analysis and Annexin V-PE assay, a fluorescent-based apoptosis assay to observe intracellular uptake of BuNoni extract in BrCa cells and detect changes in the mitochondrial membrane potential, which allowed us to distinguish between healthy and apoptotic cells, and (3) dose-response curves to measure the effectiveness of

BuNoni extract inhibiting function.

2.5.1 BuNoni extract caused a decrease in LDH (lactate dehydrogenase)

In order to examine cell viability, we chose to use a cytotoxicity assay to accurately quanti1~,’ the number ofviable cells in the cell culture. Cells undergoing necrotic death rapidly leak the enzyme lactate dehydrogenase into the medium, which we measured using the CytoTox-ONETM Assay (Cayman Chemical Co., Ann Arbor,

MI). MDA-MB-23 1 BrCa cells were plated at 2 X 1 0~ cells/well in black 96-well plates and treated with 100 ~l of BuNoni (2 and 5 mglml) in the presence or absence ofLPS

RS. Respective cells were pretreated with 10 ~g/ji1 LPS-RS for 1 hour prior to adding a fmal concentration of 2 and 5 mg/ml BuNoni plus LPS-RS and 10 ~g/~l LPS plus LPS

RS. Treatments were adjusted to maintain 10 j.igJ~.tl LPS-RS concentration and 93 modified with necessary amount ofBuNoni to compensate for the pretreatment in wells.

The number of viable cells was determined using a crystal violet staining assay. We avoided prolonged exposure of the reconstituted reagent to light in order to prevent a decreased in sensitivity and an undesirable increase in background fluorescence in the assay. A linear relationship (r2 > 0.95) between cell number and fluorescence (560

Ex/590 Em) using the LDH cytotoxicity kit was measured 48 hours after treatment.

The values shown for each treatment are significantly different than the “zero” cell background fluorescence. However, the BuNoni treatments are remarkably different from all other treatments where the no treatment (No Rx) is a baseline of cells undergoing normal necrosis. There appears to be a drastic increase of LDH release in cells treated with LPS-RS alone in comparison to the control; reasons for the perceived necrotic stimulation in this assay are currently unknown since cell growth is very much apparent in the survival curves using LPS-RS treatment alone. However, 2 mg/mi

BuNoni plus LPS-RS showed a decrease in LDH release in comparison to the control, but had a marked increase in LDH release in comparison to the 2 mg/ml BuNoni alone, which was highly expected, where the calculated p-value was 0.024. Ergo, the BuNoni treatments alone (2 and 5 mg/mi) show the necrosis rate to be well under 50% release in comparison to the blank and 18% and 27% of the control, respectively. This decrease in LDH release in the BuNoni treatments verifies that the cells are not dying by means of necrosis in figure 16, suggesting that LPS-RS protects cells from the effects of BuNoni, and necrosis is nil in the BuNoni treatments alone. 94

Nerosis Ass~v ~00

250-~------—------—------.—

200 -H—

150 -

B~aiik Nc, Rx ETOH LPS-RS 2mg/mi 2mg BuNoni 5mg/ml BuNoni + LPS-RS BuNoni

Ti eahnentc

Fig. 16. Lactate dehydrogenase release by MDA-MB-23 1 cells exposed to BuNoni, where *p 0.024.

3.2.5.2 FA CS shows BuNoni extract caused apoptotic effect

Flow cytometric analysis allowed quantitative measurement of live, dead, and

early and late apoptotic cells in untreated cells and in response to BuNoni treatment.

MDA-MB-23 1 cells were cultured with medium (RPMJ 1640 medium containing 10%

FBS) alone (A), with vehicle control (B) or BuNoni extract (final concentration of 2, 3, and 5mg/ml in RPMJ 1640 medium containing 1000 FBS) with (F, G) or without 10

~g/jil LPS-RS (C, D, and E) in RPMI 1640 medium for 48 hours. Respective cells were pretreated with 10 jig/~.il LPS-RS for 1 hour prior to adding a final concentration of 2 mg/ml BuNoni plus LPS-RS. The treatment was adjusted to maintain 10 p.g j.~l LPS-RS concentration and modified with necessary amount of BuNoni to compensate for the pretreatment in wells. The cells were stained with annexin-V FAAD/PE, then subjected 95 to flow cytometry and FAAD-labeled cells were visualized using the BD lysis II software. In figure 17, FACS sorting showed that the apoptotic rates for cells were exposed to LPS-RS in the presence or absence of 2 mg/mi BuNoni extract and yielded an apoptosis rate of2l .52% and 26.73%, respectively. The BuNoni extracts (C, D, and

E) alone were 68.8%, 78.8%, and 98.2%, respectively; these results showed that the apoptotic cells were significantly increased in a concentration dependent manner in

MDA-MB-23 1 cells, which were considerably higher than the no treatment (A) and vehicle control (B): 9.1% and 7.4%, respectively. Similar results were obtained at least in three independent experiments. l0~

10~ 10~

10 I0 I -J 9.14% 7.38% 63.83% 10~ ~:

00 27.76 100 100 0’ 100 0 0 C Ann~.in•V P0 FED-H ~nne’ir,-VPE FL2-H ArIn~.,n-VP0

A No Ri W EtOll C 2 mg/mI BnNoni 113 mg’ml BuNoni

I0~

0 0

-J ~-ç ~- “~•- 26.73% 0’ 10 ~ -. i0~ 21.52%

o0 100 6900 - 0 II 100 101 ,o2 Io~ 100 101 10 FL -H 7n -~in-. PP FL2-H Anne~in-VPE FL:H Fnrl.’xnVP6

E. 5 mg/mI BuNoni F. LPS-RS G. 2 mgtnil BuNoni+ LPS-RS

Fig. 17. Flow Cytometric Analysis of MDA-MB-231 cells after exposure to BuNoni.

ON 97

Furthermore, the modification of several IRAKs and caspase-regulated genes such as

PARP has been reported to function by inducing the apoptosis pathway. [247~ 248] In figures 22 and 23, we used the 2 hour time point for in vitro studies that was synonymous with our transcripts to observe post-translational events such as IRAK undergoing autophosphorylation shortly after IL-i stimulation and the caspase cleavage after exposure to BuNoni. These figures show protein regulation with increase expression of phosphorylated IRAK-1 (fig. 18), using 1 mg/mi BuNoni for 60 minutes and 2 mg/mi BuNoni for 30 minutes, and with increased expression of cleaved caspase

7 (fig. 19) using BuNoni alone versus BuNoni plus LPS-RS. Figure 20 demonstrates

PARP cleavage at 2 and 20 hours using 2 mg/mi BuNoni as well as the induction of

IRAK2 phosphorylation. There’s also an increase in the expression of IRAK-4 at 4 hours and 20 hours as shown in figure 20. The increase of IRAK-4, -1, and -2, caspase

7, and PARP, in addition to the annexin-V assay results, suggests BuNoni induces cell death and verifies the TLR4 signaling event leading to apoptosis in human BrCa cells.

C.) ~ 111111

I fIRAK~1 P-ACtiIi

Fig. 18. MDA-MB-231 cells regulate IRAK-1 after exposure to BuNoni. 98

-I I

I I Caspase-7 P-Actin

Fig. 19. MDA-MB-23 1 cells regulate Caspase-7 after exposure to BuNoni.

2 mWmlBuNoni g gggIii

4c~’. ~ PARP

IRAK-2 I___ -~ LRAK-4

Fig. 20. MDA-MB-23 1 cells regulate PARP, IRAK-4, and IRAK-2 after exposure to 2 mg/ml BuNoni. 99

3.2.6 BuNoni inhibits cell migration and alters cell structure

To investigate whether the migratory properties of BrCa in response to BuNoni

treatment, MDA-MB-23 1 cells were allowed to attach and reach confluence, then treated

with BuNoni extracts to yield a final concentration of 1, 2, and 3 mg/mi in RPMI 1640

medium in the presence or absence of 10 jig/jil LPS-RS and to a final concentration of

10 j~g/~il LPS in the presence or absence of 10 ~g/jil LPS-RS. Respective cells were

pretreated with 10 ~ig/pJ LPS-RS for 1 hour prior to adding the final concentrations of

1, 2, and 3 mg/mi BuNoni plus LPS-RS and 10 ~ig/~ii LPS plus LPS-RS. Treatments

were adjusted to maintain 10 j.tg/~il LPS-RS concentration and modified with necessary

amount of BuNoni to compensate for the pretreatment in wells. Control cultures received either no treatment or 95% EtOH vehicle in RPMI 1640 medium equivalent to the highest concentration. At 0, 12, and 24 hours, the cells attached to the culture dish were photographed in figure 21. Cell migration was not inhibited in the cultures treated with 10 ig/j.il LPS-RS and LPS (C, D) as compared to controls (A, B); but migration was drastically inhibited in cultures treated with BuNoni extract (E, G, I). In simultaneous experiments, however, addition of LPS-RS to BuNoni extract resulted in decreased visible migration inhibition. From these observations we chose to use 2 mg/mi BuNoni extract for subsequent routine experimentation. til h1

4-’

C C 101

01w 121w 24 hr

- _t - :~-. ~~••~•~• H o • i::. —. C 1mg/mi BuNoni • . . 4 ‘I ~ ~—: •~ a ~ - . . . t.. • •r~~ ≥~-, -. .i• .r 0..• .2 _..~.c.•:..t ~ .~, rt-~.% ‘~W ‘c~~’•-~’ ‘-,•\‘~•• - -

• .. ~ ..~i. b~’ - ≤9~-~ ~

-~ ::~;- r, - -:~ • ~ 1 mg/mi BuNoni - ;6”’ +RS-LPS -; -:~ •~A’ AO?~ ~ :~kt [*~i- Si~ •~t •_-,4•- ~. — ~t._i4 . . •._~ . • -a ‘.~. ~,f•. L — ,4 4 __k~1 4Zp%4~. ~ %Ü:~. ~fl

- :. ••.~ b~,.. ~-. •‘-~ ~ ~:

— ~ —. ‘ a~

4 ~ •43• a. -~ ~‘t~ ,)~ - ~-~C-~ -) • A • A 2 mg/mi BuNoni — -. - 4 ,... -I’ ‘1• . - •_ -A.

., ‘~•âr~ * .. ~-~- ‘~ —: • ~‘ ir’~)%~~. 4~~~~~ ;~‘—a-~ ~

- •‘ ~

4’. -i~-. •‘-: •~ S ‘- N.c .— r~-- ~ c’:. 2mg/mi BuNoni • :-- • ~ ~•~: : ••~ ~ + RS-LPS ~..• •~‘~ :-k.~ ,~- ~?4w42 it’

Fig. 21. BuNoni inhibits cell migration of human BrCa cells. 102

To further assess the migration- and growth-inhibitory activity of the BuNoni, a

MDA-MB-23 1 cell population was exposed to 5 mg/mi of BuNoni in figure 22. After cells were allowed to attach and reach confluence, cell cultures received BuNoni extract to yield a final concentration of 5 mg/mi in RPMI 1640 medium in the presence or absence of 10 jig/pJ LPS-RS, which was then added in equal volumes to the wells.

Respective cells were pretreated with 10 ~ig/j~l LPS-RS for 1 hour prior to adding the fmal concentrations of 5 mg/mi BuNoni plus LPS-RS. Morphology change of the cells was observed with an inverted microscope and photographs of treated cells were taken at the indicated time points. It is apparent that the 5 mglml BuNoni concentration was highly effective in altering the structure of the cells, which caused them to have a rounded appearance, which is inconsistent with normally spindle morphology found in untreated cells as demonstrated in figure 18. Thus, this change in morphology was acquiescent to induced cell death by BuNoni extract. This change in morphology supports our previous findings that cells treated with BuNoni extract were undergoing apoptosis. 103

Our 121w 24hr 4Shr ~ :~

A ~ ~.

(I ~

5 mg/nil BuNoni

-..~.. 5~. ~. a” •0 ~ ‘0’,~ ~ ~ ~ .~

• •.~ ~ ~• ‘0 ~ 3•. .t..&:~... ° .:,~ ~;‘:~. - ~•, ;.• .. • - :. ~ ‘~ I • • t~.• C .-•.~ . • . .. ~ ~ ~ -. . i1~~ .~‘ ,.‘ _‘~o• ~ ‘•~~ q~y~c ~ -~ t 3 ~ ;~ •c ~ f- .~ - .~- ~ • ~ •~•::~~ ~ - ~ — 5mg/mi BuNoni+ RS-LPS

Fig. 22. BuNoni changes the morphology of human BrCa cells.

2.7 BuNoni prevents tumorformation

Cells that are able to form colonies also have the ability to form tumors, and the

colony formation assay is a conventional method to observe the cloning efficiency of

cells. In this assay, MDA-MB-23 1 BrCa cells are plated at low density and allowed to

grow to form individual attached colonies in liquid media. We examined the cells after

treatment with 1 and 2 mg/ml BuNoni in the absence and in the presence of 10 jig/pJ

LPS-RS. Respective cells were pretreated with 10 ~ig/j.ii LPS-RS for 1 hour prior to

adding the final concentrations of 1 and 2 mg/mi BuNoni plus LPS-RS. The medium was replaced with fresh medium containing the corresponding treatments every 72 104 hours. After 5 days, the cell colonies were stained with 0.005% crystal violet.

Although colony numbers and sizes are usually analyzed with a cell counter, however, we visually observed the appearance of the wells to conclude cloning efficiency rather than quantifying the surviving colonies. As shown in figure 23, BuNoni treatment changes the cells’ sensitivity to cell death as evidence by a decreased number of colonies formed. In comparison to the control (A), the rate of colony formation of the

LPS-RS treated cells (B) is quite similar. However, cells treated with BuNoni in the absence and in the presence of LPS-RS showed a considerable difference in colony formation than the control (A). At 1 and 2 mg/ml concentrations (C, E), BuNoni inhibited the cells from forming colonies (i.e., containing more than 50 cells per colony). Similarly, cells treated with BuNoni in conjunction with LPS-RS (D, F) showed a substantial variation from the control as well as the LPS-RS treatment (B) alone. 105

c~ ~

Fig. 23. BuNoni prevents tumor formation in human BrCa cells.

3.3 Discussion ofResults

Noni has unequivocally been established as an anti-cancer agent in a plethora of experimental data. A crucial step in our investigations was the systematic selection of the optimal solvent to use in the isolation of bioactive constituents found in noni. One challenge was presented by the fact that several studies have been conducted using different alcohols and aqueous solutions, indicating diverse effects of treatment on disease, particularly cancer. Consequently, we extended our experiment to include not only water, basic alcohols and chloroform, but also combinations of assorted alcohols to 106

evaluate the variability of alcohol extracted noni, and compare the cytotoxic effects of

these noni extractions on human BrCa cell lines. This, in part, was because of the

differences in solvent classification and effects. To clarifS’, solvents are classified into

two basic categories: polar and non-polar, which are governed by their dielectric

constants. A dielectric constant of less than 15 generally grades a solvent as nonpolar,

such as those used in our multi-solvent extractions (CHC13 at 4.8, 1- PenOH at 13.9, 3-

BuOH at 12.47, 3-HepOH at 6.7, 3-HexOH at 13.3, and 3-OctOH at 10.3), which can

reduce the solute’s internal charge.~228’2491 Moreover, these individual solvents, with the

exception of CHC13 and 3-BuOH, are longer-chain alcohols (five or more carbon

atoms), whose water miscibility decreases sharply as the number of carbons increases.

Consequently, the preliminary results of our initial growth assay revealed that neither of

these was an ideal solvent for our crude noni extract.

Interestingly, those extracts collected by using alcohols with greater dielectric

constants (EtOH at 24.3, MeOH at 17.3, PrOH at 20.1, and BuOH at 17.6) appeared to

have more favorable effects on the inhibition of cellular proliferation.~2281 They are all

moderately miscible as their hydroxyl group makes them soluble according to their

polarity: EtOH > MeOH> PrOH >BuOH, which is indicative of the predominate -OH

group on the first three and more of a balance between two opposing solubility trends

respective to the butano1.~2491 In addition, the nonpolar end of these alcohols also allows

them to dissolve nonpolar substances such as plant materials, which includes essential

oils, flavoring, and medicinal agents. This aided us in deciding which alcohol and/or

combinations of solvents would be ideal for extracting the nutraceuticals from noni and identifying the best extraction method for anti-tumor treatment, predictably yielding the 107

best possible results to induce cell cycle arrest and/or apoptosis in BrCa cell lines. Our

results demonstrated the EtOH, MeOH, and BuOH extracts displaying a cytotoxic effect

on the growth and proliferation of BrCa cells; BuOH, as seen, yielded the greatest

lethality to the cells and was ultimately identified as the optimal solvent of choice.

Whereas data substantiated inhibited activity of BrCa cell growth using BuNoni,

we did not fractionate by means of column chromatography or medium-pressure liquid

chromatography, high-pressure liquid chromatography, or gel permeation

chromatography (Sephadex LH-20). A precept for CAM research is that NCCAM

(National Center for Complementary and Alternative Medicine) is less concerned about

individual plant constituents as oppose to maintaining the integrity of the plant as a

whole to use as medicinal agents. Hence, there was no need to fractionate noni in

accordance with the guidelines of a CAM project. Moreover, it is possible that the

components act together to create their cytotoxic effect on cancer cells, so fractionating

may have resulted in losing some phytochemical activity. Our decision not to

fractionate was also in part because other studies had afready shown fractions of noni

being used in cancer cell growth inhibition assays. The most convincing evidence came

by way of our collaborators in Hawaii, where they isolated sugars thought to be the

active components in the BuOH extraction of noni. Their procedure led to the isolation

of pure compounds, and the chemical structures of the compounds isolated were

established by means of mass spectroscopy. They were identified as: a) 6-O-(f3 f3-D- glycopyranosyl)- 1 -O-octanoyl-13-D-glucopyranose, b) 6-O-(13-D-glycopyranosyl)- 1-0- hexanoyl-~3-D-glucopyranose, c) 3-methylbut-3 -enyl-6-O-~3-D- glycopyranosyl-~3-D- glucopyranoside, which all have glycosidic backbones (US Patent 2003/000411 6A1). 108

Lui et al. (2001) reported that of the three novel glycosides isolated, 6-O-(13-D-

glycopyranosyl)-1-O-octanoyl-f3-D~g1ucopyranose showed inhibitory effects in the

mouse epidermal JB6 cell line on AP-1 activity induced by EGF, which controls a

number of cellular processes including differentiation, proliferation, and apoptosis. [84]

The in vitro responses oftumor cells to the multiple solvent noni extractions

were measured by means of cell growth inhibition assays. Many factors that maintain

the normal phenotype of a breast cell are lost in breast cancer progression. For

example, these BrCa cells lines differ by their hormone receptor statuses, which are

important regulators of growth and differentiation. Estrogen receptor (ER),

progesterone receptor (PR), and the human epidermal growth factor receptor-2 (HER2)

are prognostic markers for BrCa Different combinations of the expression or loss of

these hormones receptors make up the BrCa phenotypes; ergo, ER- and ER+ tumors

display entirely different gene-expression phenotypes. Two prominent phenotypes are

triple positive and triple negative. While T47D and MCF-7 BrCa.cells are ER+/PR+/

HER2+, MDA-MB-23 1 cells are ER-/PR-/HER2- and have lost the expression ofE

cadherin.~250’ 251] Current target therapies are geared towards ER+/HER2+ (antiestrogens

and Herceptin), which consequentially makes MDA-MB-23 1 cells (triple negative) more difficult to treat.~252~ This panel of BrCa cells was chosen to analyze the effects of noni among diverse cell lines and observe the sensitivity of the cells due to the treatment of the extract. Three of seven alcohol extractions in Table 4 inhibited the cellular growth of T47D, MDA-MB-23 1, and MCF-7 human BrCa cells. The other solvents were not as potent as n-BuOH on this BrCa cell trio. While the effect of

MeOH appeared to be the next most effective extraction on these three cell lines, 109

repeated assays did not yield similar results. The BuOH extract had proven to be the

most consistent treatment, particularly with the triple negative phenotype cells. We

therefore proceeded with subsequent experiments using the BuNoni as our extract of

choice on primarily MDA-MB-23 1 cells (ER-/PR-/HER2-). Favorable results may be

beneficial for chemotherapeutics in this population of cancer cells intrinsically resistant

to treatment and benefit CAM research by use of nutraceuticals extracted from noni.

Cell signaling governs basic cellular activity and operates as a complex system

of communication to relay cellular information in response to the environment.

Through use of microarray analysis of BrCa cells treated with BuNoni, we elucidated

the plausible mechanism of action and were able to exam the regulation of genes using

RNA expression data that suggested the innate immunity system was the target site for

BuNoni’s toxic mode of action. Although multiple pathways could be interacting as shown by 185 genes, we were looking for the major pathway that would lead to cell death. Observation of the TLR signaling pathways enabled us to determine the manner of cell death induction whether by apoptosis, necrosis, or some other form of mortality.

In cells treated with BuNoni, microarray analysis revealed that the genes coding for apoptosis-inducing and -supporting products were increased, such as CXCL2 and

CXCL3. IFIT1, IFIF2, and IFIT3, whose mRNA levels increased, are also connected with immunologically defensive roles against microbial infections and are known for their antiproliferative and differentiative activities.

Many of the genes regulated in MDA-MB-23 1 after treatment with BuNoni encode proteins involved in the regulation of the Toll-like receptors; thus, the observed cell death was indicative of the TLR4 pathway leading to apoptosis. Apoptosis aids in 110 establishing a natural balance between cell proliferation and cell death by destroying excess, damaged or abnormal cells. To further investigate this pathway, we used western blot analysis to evaluate the regulation of key proteins involved in programmed cell death. The results showed an increase in apoptotic events that contributed to the decrease in cellular proliferation. The activation of the TLR/TLR4 pathway sensitizes the cells to apoptosis induction as shown in figure 24. Sun et al. (2008) reported consistent results in the reduction of apoptosis of colon cancer cells by upregulating

Bcl-xL, an anti-apoptotic protein, using DXR and oxaliplatin (OXL); moreover, they contend that the anti-tumor effects ofrapamycin is exercised through the reversal of

TLR4-induced apoptosis resistance oftumor cells to chemotherapy, thereby causing the cancer cells to be susceptible to anti-tumor chemical reagents.~2531 I LPS~ ‘-- ~t

.a~w — ______41!]. I

‘a

S [IRAnI

— a — NFkB (Caspase-a) — — ~%_ — —

MAPT,Cs ~1% (Caspase-3, ~7_1

‘1 I

+ Ap optosis

Fig. 24. Toll-like Receptor Pathway identifying mechanism of action of BuNoni through TLR4 activation. 112

We found that treatment of BrCa cells with BuNoni altered their cellular

phenotype, causing them to lose their spindle shape as shown in figure 19. After

BuNoni treatment, the morphology of MDA-MB-23 1 human BrCa tumor cells

gradually detached from the bottom of culture plates (12 - 48 hours). The structure

change of cells was verified with an inverted microscope, where it showed severe

attenuation by 24 hours and distorted cell shape by 48 hours. These changes include

retracted bead-like cells with an appearance ofhaving considerable shrinkage from the

treatment; they were no longer spindle shaped like the untreated cells. These effects are

consistent in both 3 mg/nil (not shown) and 5 mg/mi BuNoni, which were extremely

effective in inducing cell death. These results corroborate the results of our previous

studies by our Hawaiian collaborators (Katalin Czissar, personal communication)

indicating that the growth inhibitory effect ofnoni is associated with activation of

specific stress response pathways and apoptosis.

3.1 Effect ofextraction on cellproliferation

As for the dose-response curve using LPS-RS in conjunction with BuNoni, the

IC50 value was not attained in figures 14 and 15, in part because of mixed inhibition of the two drugs. In Michaelis-Menten competitive kinetic inhibition, the LPS-RS would represent the substrate, and BuNoni would be considered as the inhibitor. Thus, LPS

RS would bind to CD14 which binds to MD-2, and ultimately binds to the TLR4 active site without causing a reaction such as change in cell growth, thereby preventing

BuNoni from binding to the same site to prevent proliferation. However, the BuNoni concentration was constant at 2 mg/ml, and there were only concentration variations in 113

the antagonist, LSP-RS, which was added to the cells 1 hour prior to adding the

combination of the two drugs; the inhibitor (BuNoni), consequently, was unable to

prevent the substrate (LPS-RS) from binding to TLR4. This new arrangement

circumvented the Michaelis-Menten kinetic theory of competitive inhibition, where

instead ofvying for the same position i.e., E + S + I <~> ES + I, the two drugs formed

a different complex: E + S <==> ES <> ES + I --> ESI in a slightly modified mixed

inhibition. Initially, the BuNoni treatment reduced cell growth by 50%. Yet, the dose-

response at the lowest concentration of LSP-RS (0.39 j.~gI~.tl) revealed the inhibitor

beginning to lose its efficacy. As the substrate concentration overcame the presence of

BuNoni, the survival rate increased to 64% with a drastic increase to 85% with the

maximum substrate concentration (10 j.tg/~il) application. It is apparent that exposure to

BuNoni was ineffective in maintaining a steady killing rate because LPS-RS saturated

the TLR4 active binding site. There are two possible pathways for BuNoni to affect the

cells through TLR4: (1) IRF and (2) apoptosis. We surmised that binding of LPS-RS to the CD14/MD-2 complex and then to the active site of TLR4 in this modified mixed inhibition altered the apoptotic effect of BuNoni, sending it down the IFR pathway, which aids in cellular growth.

3.3.2 Clinicallmpact of the Research

Breast cancer is currently the second leading cause of cancer-related deaths of women in the United States.~2541 Although there have been major improvements in the prognosis of cancer over the past 10 years, surgery, radiotherapy, and chemotherapy remain the three forms of cancer treatments used. The latter treatment, chemotherapy, 114

uses medication to kill or slow tumor growth, but the efficacy of the drug depends on its

ability to halt cell division. There are two types of chemotherapeutic drugs: cell-cycle

specific (kills cancer cells only when they are dividing) and cell-cycle non-specific (kill

cancer cells when they are at rest). Thus, chemotherapy is typically given in cycles

since the scheduling of administering the medications is not only based on the type of

cells and the rate at which they divide, but also the time at which a given drug is likely

to be beneficial.~2551 Chemotherapy is thought to be most effective when cells are

rapidly dividing, but unfortunately the drugs cannot make a distinction between normal

cells and cancer cells. The aim of cancer treatment is to kill all of the tumor tissue

without killing the other normal cells in the body, and clinical trials are necessary to

evaluate the effectiveness of new drugs or CAM therapy in conjunction with current

cancer treatments.

Our findings with BuNoni as a CAM therapeutic may have a great impact on

clinical cancer care and is promising in improving cancer treatment regimens. For example, Taxol® is a chemotherapy drug that is currently given for BrCa cells and is a mitotic inhibitor. Taxol is a diterpene produced by a coniferous plant from the genus of yews called Taxus, which also includes taxanes such as paclitaxel and docetaxel. Since the cells grow by cell division (mitosis), Taxol’s mechanism of action is to prevent cancer cells from completing the mitosis process by sticking to them while they try to divide.~2561 Taxol mimics bacterial LPS, and its highly reactive substituent analogs have been utilized in lieu of its superior chemistry to recognize LPS-binding and signaling molecules. Kawasaki et at. (2001) demonstrated that MD-2 is a prerequisite for Taxol induced TLR4-mediated signaling. [257, 258] Likewise, recognition of LPS requires the 115

MD-2 protein, and TLR4 cannot be activated by stimuli without the presence of MD

2 [200,256,259] Thus, they concluded that in addition to sharing a TLR4/MyD88-

dependent pathway, Taxol and LPS also share TLR4-dependent/MyD88-independent

pathway, where one leads to stimulated NF-icB while the other leads to apoptosis as

shown in figure 25.[260,26h1 Ergo, TLR4 has an absolute requirement of MD-2 for cell

immunity activation, and we have illustrated noni’s cytotoxic effect on the human BrCa

cells in vitro, where BuNoni inhibits the growth of cancer cells by binding to the TLR4 receptor, ultimately leading to apoptosis. A novel drug combination of Taxol and

BuNoni would attack cancer cells by preventing them from dividing and metastasizing and consequently going through programmed cell death (fig. 25). It may be worthwhile to evaluate the addition of targeted agents, such as BuOH, to chemotherapy regimens in clinical trials and determine if they could improve efficacy without compromising safety. LPS Anthracyclines: Dox, Adriamycin .—Taxols: Paclitaxel ~bo

[IRAK4I _____

[IRAii] —b [~K2] —‘“---‘ Apoptosis

MAPKs

NFkB JNK IRF IRF3

Kim bro Laboratory, 2008

-A Fig. 25. Toll-like Receptor Pathway demonstrating mechanism of action of chemotherapeutics and BuNoni. -A 117

Another common chemotherapeutic agent used to treat BrCa cells is doxorubicin

(DXR), an anthracycline antibiotic; however, its mechanism of action is complex and

still somewhat unclear, though it is thought to interact with DNA by intercalation. [262]

Several combinations of drugs with DXR are being used in an attempt to increase the

drug’s efficacy and decrease its side effects, such as complete alopecia, heart

arrhythmias, and decrease in white blood cells called neutropenia. DXR causes the

unwinding of DNA for transcription by inhibiting the progression of the enzyme

topoisomerase II, which cuts both strands of the DNA helix simultaneously in order to

change the linking number of the molecule.~263~ Chua et a!. (2006) further deduced that

up-regulation of several caspases i.e., -2, -3, -8, -9, and -12, as well as p53 in H9c2

induced apoptosis by the treatment of DXR.~2641 A proposed clinical study will be useful in examining the efficacy of DXR in combination with BuNoni to determine any

adverse or beneficial effects. We hypothesize that BuNoni will not decrease the effectiveness of the drug, but rather enhance efficacy of the chemotherapy by decreasing cell growth and increasing levels of apoptosis. This may reduce the need for cumulatively increased doses of DXR and decrease the risks of developing cardiac and other side effects. Additional future studies will combine CAM with conventional therapies i.e., Doxorubin and Taxol, which bind TLR4 or accompanying molecules.

On another note, cancer patients also attempt to self-treat cancer through the use of complementary and alternative medicine; this is done quite often without informing their healthcare providers. Unfortunately, the use of CAM agents may decrease the efficacy of their allopathic treatments, and result in unfavorable outcomes of the chemotherapy treatments. Case in point, a single nucleotide change can alter the 118

response of the innate cellular immune response. Although this change in

responsiveness can be diagnosed with genetic analysis by clinicians, patients might

haphazardly choose a self-prescribed course of treatment without considering the

genetic change identified in their tumor cells or germline DNA. Furthermore, recent

studies have suggested that mutations in human TLR4 correlate with the outcomes of

anticancer chemotherapy and radiotherapy.~2651 Qureshi et al. (1999) found that an LPS

hyporesponsiveness is created by a mutation in mouse TLR4, where in vitro

observations allowed them to identify in inbred endotoxin-tolerant mice the same gene

at the LPS locus in two different hyporesponsive strains. Their results confirmed the hypothesis that the endotoxin tolerance was due to perturbation of the TLR4 function.~2661 Therefore, a patient unaware of such evidence does realize the effects that

CAM agents may have on the mechanism of cellular activation respective to TLR4 in host responses to LPS nor whether or not the herbal might increase cancer cell growth and decrease levels of apoptosis, which lessens the efficacy of the chemotherapy.

Dysfunction in TLRs or associated gene products, such as restoration of lost or mutated

TLRs, may result in inadequate or inappropriate immune response and ultimately affect the cell’s innate immune response changing the prognosis.~2672691 Through knowledge of the chromosomal position, novel single nucleotide changes in TLR and TLR-related genes, prognostic and diagnostic screens could better determine which gene may contribute to or be responsible for a patient’s disease and consequential proper treatment. 119

3.4 Conclusion

Convincing evidence reported by investigators shows that tumorigenic growth

of selective cancer depends on the disruption of the normal apoptotic process.~253’2701 In

this study, we sought to determine whether BuNoni induces apoptosis oftriple negative

human BrCa cells, MDA-MB-231; we observed the regulation of apoptosis in addition

to the regulation of genes involved in control of cell proliferation. Our results

demonstrated that BuNoni inhibits cell growth via the TLR4 pathway and indicated the

extract could sensitize BrCa cells for apoptotic events. Future animal studies will be required to determine whether BuNoni induces the apoptosis of human BrCa cells in vivo. Since the concentrations of BuNoni required to effectively induce apoptosis are low, the noni extract should be evaluated further to determine its potential as a chemopreventive or chemo-complimentive agent.

Furthermore, apoptosis is triggered by the activation of caspases that cleave many cellular substrates.~2711 In this study, we observed an increase in the levels of caspases, particularly Caspase-7 and noted that BuNoni appeared to induce this activation in a time-dependent manner. Our results also revealed that BuNoni caused an increase in PARP cleavage, which facilitates irreversible cellular disassembly and serves as a marker of cells undergoing apoptosis.~2721 Preincubation with LPS-RS appeared to protect the cells from BuNoni’s cytotoxic effect; the cells treated with LPS singly or in combination with pretreatment of LPS-RS showed no visible change in the activation of apoptotic events. In addition to these results, we not only concluded that

BuNoni treatments induced the activation of Caspase-7 and cleaved PARP, but also showed compelling evidence by way of an annexin-V assay that verified the cells were 120

indeed going through apoptosis. Figure 17 illustrated that compared to the control and

the vehicle, the BuNoni treated cells were positive for annexin-V, which indicated that

there was a loss of cell viability. The BuNoni treated cells had an overwhelming

increase in apoptosis i.e., 68.8%, 78.8%, and 98.2%, respectively; uptake of the dye

meant that they were either in early or late stage apoptosis as seen in the right upper and

lower quadrants of the square. Also, the results of the necrosis assay in figure 16

showed that only small amounts of LDH was being released from the BuNoni treated

cells as compared to the controls, yielding under 50% release of lactate dehydrogenase

in comparison to the blank and 18% and 27% of the controls, respectively.

Conclusively, these results present BuNoni as a potential cancer chemotherapeutic

agent and further evaluations of its potential as an anti-carcinogenic agent in

experimental animal models is warranted.

Goto et a!. (2008) elucidated that cell migration was induced by specific ligand

activation of TLR4.~273~ There is also supporting evidence that innate immune cells

participate in neoplastic progression.~2741 In particular, the development of full-blown

neoplasia requires that cancer cells have to overcome their autonomous immune

pathways as well as those extrinsic immune barriers.~2751 As a result, TLRs are key participants in the mammalian innate immune system. To investigate whether BuNoni retards growth and migration of MDA-MB-23 1 human BrCa cells, we performed wound healing assays; we chose to use multiple BuNoni extract concentrations to further identify the minimum amount required to still deliver maximum effectiveness.

We also decided to test the effects of BuNoni on cultures of BrCa cells to see if it would exhibit antitumor activity and prevent colony formation. Our results revealed that 121

BuNoni undeniably demonstrated antitumor activities against BrCa cells, in an

interesting dose-dependent manner. Preincubation with LPS-RS blocked BuNoni from

binding to the cells, thereby acting as a protector; cells treated with BuNoni in

conjunction with pretreatment of LPS-RS showed no visible cell migration inhibition.

However, it is also apparent that the 2 mg/mi BuNoni concentration was highly

effective in inhibiting cell migration and/or killing cells at 24 hours. The controls

exhibited continued migration; the BuNoni-treated cells both showed partial migration

or no migration at all, mainly during the closing of the wound.

Furthermore, when the biological defense system is impaired, cells carrying the abnormal genes are able to pass mutations from one cell generation to the next. It is the accumulation of these pathological abnormalities that leads to development of aberrant cell colony formations over time.~2761 The soft agar colony formation assay is classical and is more commonly used as an in vitro assay to measure anchorage-independent growth; however, we used the liquid media colony formation assay to visually observe cloning efficiency instead. In this assay, wells treated with as little as 1 mg/mi BuNoni showed impeded colony formation; the controls showed that colonies had formed in the wells, but no colonies were visible in the wells treated with BuNoni. This indicated that the extract was effective in preventing colony formations and would thus be successful in preventing tumor formation. It is worth highlighting that cloning efficiency determined by this liquid media assay is the visual effect of changes in the cells’ sensitivity and slower growth affected by BuNoni treatments. Additionally, manual quantitation of colonies in this format can be laborious and subjective, particularly for liquid media colonies, which perhaps lends to its infrequent application. This has 122

always been a complication to the extensive application of colony formation analyses

altogether. Albeit, there are colony-counting machines for quantitating attached

colonies, but there exists no similar reported quantitation of colonies in liquid

suspension. Thus, our results visually explicate the functional activity of BuNoni on

human BrCa cells, and substantiate the concept ofnoni extracts as potential therapeutic

agents to control cancer tumor formation and progression.

Future Directions

Over the past several years, cancer biologist have spent vast amounts of energy studying the tumor microenvironment and discovering relevant drug targets related to this unique environment. The Morinda citr~folia (noni) tree is a popular complementary and alternative medicine (CAM)-related botanical that has been used as a food supplement and herbal medicine throughout the Pacific for over 2000 years.~’55~ The nutraceuticals in noni extracts act as anti-tumor agents and may enhance current cancer treatments. We have shown the BuNoni extract to inhibit BrCa cell growth by inducing apoptosis through interaction with Toll-like Receptor 4 (TLR4), which is a precursor to immunological defense. This pathway may be stimulated by the interaction of noni constituents with TLR4, followed by a cascade signal via several adaptor molecules

(e.g., MyD88) and kinases as shown in figure 3. Noni’s proposed interaction with

TLR4 is significant since a common polymorphism in TLR4 (Asp299Gly) appears to contribute to the efficacy of certain chemotherapies (e.g., adriamycin and paclitaxel). [149, 1571 This suggests BrCa patients harboring the TLR4 299Asp allele may have higher responsiveness to noni combined with chemotherapeutic agents. As a 123

result, the identification and characterization of TLR genes associated with

compromised immunity and/or cancer is critical for identifying new targets for

treatment and may offer insights into the mechanisms of disease development.

Moreover, with the long-term goal of improving clinical management of BrCa, the

researchers may seek to explore the molecular mechanisms of noni on BrCa cells via

TLR4. Such studies may elucidate the anti-tumor effect ofnoni respective to TLR4-

signaling mediation, which induces apoptosis in BrCa cells and increases the efficacy of

adriamycin and paclitaxel. Two approaches may be used to analyze this hypothesis: (1)

delineate the cytotoxic action of noni on BrCa cells and xenograft tumors treated with

or without adriamycin or paclitaxel; and (2) determine the effect of noni on syngeneic breast tumor growth and recipient tumor-associated host cells in TLR4-deficient and wild-type mice.

In order to implement approach one (1), studies will have to be done to analyze the molecular mechanisms and efficacy of noni to treat and prevent BrCa; then, researchers will be able to delineate the cytotoxic action of noni on BrCa cells and xenograft tumors treated with or without adriamycin or paclitaxel. They may quantify the extent of BrCa metastasis to the lungs, liver, and lymph nodes, and do a measurement oftumor burden in MDA-MB-23 1 -luciferase-positive (luc) as well as

MCF-7-luc xenografts (by orthotopic mammary fat pad injection) before and after noni treatment using a Caliper/Xenogen IVIS Biophotonic Imaging System. Also, investigators might evaluate the impact of noni treatment on apoptosis and cell proliferation in excised breast tumors using immunohistochemistry (IHC) and morphologic analysis of respective biomarkers (e.g., caspase-3, Ki67) as well as TLR4- 124

signaling proteins (phospho-NFkB, IRAK2, IRAK4, and TBK). The molecular

mechanisms of noni (plus chemotherapeutic)-mediated apoptosis may be revealed by

quantifying and validating temporal mRNA and active protein expression of essential

TLR4-signaling factors (e.g., IRAKs, p65, Akt) in the presence or absence of TLR4 or

adaptor molecule agonists (LPS) and antagonists (LPS-RS, siRNA TLR-4, siRNA

MyD88) treated BrCa cell lines. We believe that these studies will reveal the molecular mechanisms of noni-mediated apoptosis of BrCa cells.

The second approach (2) will determine the effect of noni on syngeneic breast tumor growth and recipient tumor-associated host cells in TLR4-deficient and wild-type mice. These studies will disclose whether TLR4 over- or under-expression may reduce

BrCa tumor growth and/or alter TLR4 signaling pathways, as outlined in approach 1, following treatment with noni or noni plus adriamycin or paclitaxel using a novel syngeneic BrCa model harboring a hyposensitive TLR4 (Pro7l2His) allele i.e.,

TLR4LPS-d BALB/cByJ mice. We anticipate synegenic mice orthotopically (breast fat pad challenged) with 4T1-luc cells over-expressing TLR-4 will have reduced tumor growth relative to control groups (i.e., wild-type 4T1-luc cells or 4T1-luc expressing shRNA TLR4 cells in TLR4-/- or wild-type BALB/cByJ mice. Shared genetic backgrounds between these mice and cell lines will allow for clarification of the function of TLR4 on tumor growth in the context of an intact (innate and adaptive) immune system.

Cumulatively, the findings of these two approaches will: (1) provide proof of concept for use ofnoni in mainstream BrCa treatment protocols to improve the efficacy of hard to treat triple-negative BrCa cases; (2) eluidate the mechanism(s) of noni on 125

BrCa tumor burden, presumably by stimulating apoptosis and inhibiting cell proliferation; (3) determine whether the genetic pre-disposition of some patients (i.e.,

Asp299Gly TLR4) may enhance responsiveness to noni alone or together with conventional chemotherapies to reduce tumor burden; and (4) be the first of future studies to established “personalized” CAM approaches to put an end to BrCa. 126

4.0 REFERENCES

1. Roberti di Sarsina, P., The Social Demandfor a Medicine Focused on the Person: The Contribution of CAM to Healthcare and Healthgenesis. Evid Based Complement Altemat Med, 2007. 4(Suppl 1): p. 45-51. 2. Evans, M., et al., Decisions to use complementary and alternative medicine (CAM) by male cancer patients: information-seeking roles and types ofevidence used. BMC Complement Altern Mcd, 2007. 7: p. 25. 3. Berman, B.M., S. Hartnoll, and B. Bausell, CAM evaluation comes into the mainstream: NIH specialized Centers of research and the University of Maryland Centerfor Alternative Medicine Research in Arthritis. Complement Ther Med, 2000. 8(2): p. 119-22. 4. Shmueli, A. and J. Shuval, Are users of complementary and alternative medicine sicker than non-users? Evid Based Complement Alternat Med, 2007. 4(2): p. 251-5. 5. Buckle, J., Aromatherapy: the scents for survival. Beginnings, 1994. 14(5): p. 1, 7. 6. Chiravalle, P. and R. McCaffrey, Alternative therapy applicationsfor postoperative nausea and vomiting. Holist Nurs Pract, 2005. 19(5): p. 207-10. 7. Wang, S.M., A.A. Caidwell-Andrews, and Z.N. Kain, The use ofcomplementary and alternative medicines by surgical patients: afollow-up survey study. Anesth Anaig, 2003. 97(4): p. 1010-5, table of contents. 8. Norred, C.L., Minimizing preoperative anxiety with alternative caring-healing therapies. AORN J, 2000. 72(5): p. 83 8-40, 842-3. 9. Buckle, J., Aromatherapy inperianesthesia nursing. J Perianesth Nurs, 1999. 14(6): p. 336-44. 10. Rakel, D.P., et al., CAM education: promoting a salutogenicfocus in health care. J Altem Complement Mcd, 2008. 14(1): p. 87-93. 11. Ghassemi, 3., Finding the evidence in CAM: a student’s perspective. Evid Based Complement Alternat Mcd, 2005. 2(3): p. 395-7. 12. Brinkhaus, B., Ct al., Integration ofcomplementary and alternative medicine

into German medical school curricula -- contradictions between the opinions of decision makers and the status quo. Forsch Komplementarmed Kiass Naturheilkd, 2005. 12(3): p. 139-43. 13. Kreitzer, M.J., et al., Attitudes toward CAM among medical, nursing, and pharmacyfaculty and students: a comparative analysis. Altern Ther Health Mcd, 2002. 8(6): p. 44-7, 50-3. 14. Hui, K.K., et al., Introducing integrative East-West medicine to medical students and residents. J Altem Complement Mcd, 2002. 8(4): p. 507-15. 15. Andreescu, C., B.H. Mulsant, and J.E. Emanuel, Complementary and alternative medicine in the treatment ofbipolar disorder--a review of the evidence. J Affect Disord, 2008. 110(1-2): p. 16-26. 16. Fleming, S., et al., CAM therapies among primary care patients using opioid therapyfor chronic pain. BMC Complement Altem Mcd, 2007. 7: p. 15. 127

17. Bielory, L., J. Russin, and G.B. Zuckerman, Clinical efficacy, mechanisms of action, and adverse effects of complementary and alternative medicine therapies for asthma. Allergy Asthma Proc, 2004. 25(5): P. 283-91. 18. Rossler, W., et al., The use of complementary and alternative medicine in the general population: resultsfrom a longitudinal community study. Psychol Med, 2007. 37(1): p. 73-84. 19. Hana, G., et al., The use ofcomplementary and alternative therapies by cancer patients in northern Israel. Isr Med Assoc J, 2005. 7(4): p. 243-7. 20. Weitzman, S., Complementary and alternative (CAM) dietary therapies for cancer. Pediatr Blood Cancer, 2008. 50(2 Suppi): p. 494-7; discussion 498. 21. Cohen, R.J., K. Ek, and C.X. Pan, Complementary and alternative medicine (CAM) use by older adults: a comparison ofself-report and physician chart documentation. J Gerontol A Biol Sci Med Sci, 2002. 57(4): p. M223-7. 22. Campbell, F.C. and G.P. Collett, Chemopreventive properties of curcumin. Future Oncol, 2005. 1(3): p. 405-14. 23. Jindal, V., A. Ge, and P.J. Mansky, Safety and efficacy ofacupuncture in children: a review of the evidence. J Pediatr Hematol Oncol, 2008. 30(6): p. 43 1-42. 24. Wardwell, W.I., Alternative medicine in the United States. Soc Sci Med, 1994. 38(8): p. 1061-8. 25. Kelly, K.M., Bringing evidence to complementary and alternative medicine in children with cancer: Focus on nutrition-related therapies. Pediatr Blood Cancer, 2008. 50(2 Suppl): p. 490-3; discussion 498. 26. Goldstein, M.S., et al., The use and perceived benefit ofcomplementary and alternative medicine among Californians with cancer. Psychooncology, 2008. 17(1): p. 19-25. 27. Trangmar, P. and V.A. Diaz, Investigating complementary and alternative medicine use in a Spanish-speaking Hispanic community in South Carolina. Ann Fam Med, 2008. 6 Suppi 1: p. S 12-5. 28. Smith, T.C., et al., Complementary and alternative medicine use among US Naiy and Marine Corps personnel. BMC Complement Altern Med, 2007. 7: p. 16. 29. Ortiz, B.I., et al., Complementary and alternative medicine use among Hispanics in the United States. Ann Pharmacother, 2007. 41(6): p. 994-1004. 30. Tascilar, M., et al., Complementary and alternative medicine during cancer treatment: beyond innocence. Oncologist, 2006. 11(7): p. 732-41. 31. Su, D., L. Li, and J.A. Pagan, Acculturation and the use ofcomplementary and alternative medicine. Soc Sci Med, 2008. 66(2): p. 439-53. 32. Wu, P., et al., Use ofcomplementary and alternative medicine among women with depression: results ofa national survey. Psychiatr Serv, 2007. 5 8(3): p. 349-56. 33. Jean, D. and C. Cyr, Use of complementary and alternative medicine in a general pediatric clinic. Pediatrics, 2007. 120(1): p. e138-41. 34. Sliva, D., et al., Biologic activity ofspores and dried powderfrom Ganoderma lucidumfor the inhibition ofhighly invasive human breast and prostate cancer cells. J Altern Complement Mcd, 2003. 9(4): p. 491-7. 128

35. Chan-Blanco, Y., Vaillant, Fabrice, Perez, Ana Mercedes, Reynes, Max, Brillouet, Jean-Marc, and Brat, Pierre The nonifruit (Morinda citr~folia L.): A review ofagricultural research, nutritional and therapeutic properties Journal of Food Composition and Analysis, 2005. Volume 19(6-7, September- November 2006): p. 645-654. 36. Potterat, 0. and M. Hamburger, Morinda citrjfolia (Noni)fruit--phytochemistry, pharmacology, safety. Planta Med, 2007. 73(3): p. 191-9. 37. Pawlus, A.D. and D.A. Kinghorn, Review of the ethnobotany, chemistiy, biological activity and safety of the botanical dietary supplement Morinda cit4folia (noni). J Pharm Pharmacol, 2007. 59(12): p. 1587-609. 38. Palu, A.K., et al., Knowing your noni tree and traditional usage eliminates confusion. Biochem Biophys Res Commun, 2006. 35 1(3): p. 577. 39. McClatchey, W., From Polynesian healers to healthfood stores: changing perspectives ofMorinda citr~folia (Rubiaceae). Integr Cancer Ther, 2002. 1(2): p. 110-20; discussion 120. 40. Abbott, l.A. and C. Shimazu, The geographic origin of the plants most commonly usedfor medicine by Hawaiians. J Ethnopharmacol, 1985. 14(2-3): p. 213-22. 41. Wang, M.Y., et al., Morinda citr~folia (Noni): a literature review and recent advances in Noni research. Acta Pharmacol Sin, 2002. 23(12): p. 1127-41. 42. Wang, M.Y. and C. Su, Cancer preventive effect ofMorinda citr~folia (Noni). AnnN Y Acad Sci, 2001. 952: p. 161-8. 43. Solomon, T. and T.T. Hien, Clinical research in the tropics: some thoughts for the beginner. Ann Trop Med Parasitol, 1999. 93(7): p. 773-6. 44. Hirazumi, A. and E. Furusawa, An immunomodulatoiypolysaccharide-rich substancefrom thefruitjuice ofMorinda citr~folia (noni) with antitumour activity. Phytother Res, 1999. 13(5): p. 380-7. 45. Ma, D.L., et al., Evaluation of the ergogenic potential ofnonijuice. Phytother Res, 2007. 21(11): p. 1100-1. 46. Johansen, R., [The healthfoodproduct Noni--does marketing harmonize with the current status of research?]. Tidsskr Nor Laegeforen, 2008. 128(6): p. 694- 7. 47. Espin, J.C., M.T. Garcia-Conesa, and F.A. Tomas-Barberan, Nutraceuticals: facts andfiction. Phytochemistry, 2007. 68(22-24): p. 2986-3008. 48. Schwartz, J.B., Nutraceuticals: sorting outfact, fiction, and uncertainty. J Gend SpecifMed, 2000. 3(4): p. 30-2, 37. 49. Kamiya, K., et al., Chemical constituents ofMorinda citr~folia roots exhibit hypoglycemic effects in streptozotocin-induced diabetic mice. Biol Pharm Bull, 2008. 3 1(5): p. 935-8. 50. Takashima, J., et al., New constituents from the leaves ofMorinda citr~folia. Chem Pharm Bull (Tokyo), 2007. 55(2): p. 343-5. 51. Westendorf, J., et al., Toxicological and analytical investigations ofnoni (Morinda citr~folia) fruitjuice. J Agric Food Chem, 2007. 55(2): p. 529-37. 52. Siddiqui, B.S., et al., New anthraquinones from the stem ofMorinda citrifolia Linn. Nat Prod Res, 2006. 20(12): p. 1136-44. 129

53. Samoylenko, V., et al., New constituents from noni (Morinda citr~folia) fruit juice. J Agric Food Chem, 2006. 54(17): p. 6398-402. 54. Caizuola, I., G.L. Gianfranceschi, and V. Marsili, Comparative activity of antioxidantsfrom wheat sprouts, Morinda citr~folia, fermentedpapaya and white tea. Tnt J Food SciNutr, 2006. 57(3-4): p. 168-77. 55. Bui, A.K., A. Bacic, and F. Pettolino, Polysaccharide composition of thefruit juice ofMorinda citr~folia (Noni). Phytochemistry, 2006. 67(12): p. 1271-5. 56. Pawlus, A.D., et al., An anthraquinone with potent quinone reductase-inducing activity and other constituents of thefruits ofMorinda citr~folia (noni). J Nat Prod, 2005. 68(12): p. 1720-2. 57. Kamiya, K., et al., New anthraquinone and iridoidfrom thefruits ofMorinda citr~folia. Chem Pharm Bull (Tokyo), 2005. 53(12): p. 1597-9. 58. Kamiya, K., Ct al., Chemical constituents ofMorinda citr(foliafruits inhibit copper-induced low-density lipoprotein oxidation. J Agric Food Chem, 2004. 52(19): p. 5843-8. 59. Sang, S., et al., A new unusual iridoid with inhibition ofactivator protein-i (AP 1) from the leaves ofMorinda citr~folia L. Org Lett, 2001. 3(9): p. 1307-9. 60. Sang, S., et al., Flavonol glycosides and novel iridoidglycosidefrom the leaves ofMorinda citr~folia. J Agric Food Chem, 2001. 49(9): p. 4478-81. 61. West, B.J. and B.N. Zhou, IdentjfIcation ofmajor aroma compounds in the leaf ofMorinda citrjfolia Linn. Nat Med (Tokyo), 2008. 62(4): p. 485-7. 62. Ancolio, C., et al., Antimalarial activity ofextracts and alkaloids isolatedfrom six plants used in traditional medicine in Mali and Sao Tome. Phytother Res, 2002. 16(7): p. 646-9. 63. Akthisa, T., Ct al., Anti-inflammatory and Potential Cancer Chemopreventive Constituents of the Fruits ofMorinda citr~folia (Noni). J Nat Prod, 2008. 71(7): p. 1322. 64. Wang, M.Y., et al., Hepatic protection by nonifruitjuice against CC1(4)- induced chronic liver damage infemale SD rats. Plant Foods Hum Nutr, 2008. 63(3): p. 141-5. 65. Palu, A.K., et al., The effects ofMorinda citrifolia L. (noni) on the immune system: its molecular mechanisms ofaction. J Ethnopharmacol, 2008. 115(3): p. 502-6. 66. Sang, S., et al., New unusual iridoidsfrom the leaves ofnoni (Morinda citr~folia L.) show inhibitory effect on ultraviolet B-induced transcriptional activator protein-i (AP-i) activity. Bioorg Med Chem, 2003. 11(12): p. 2499-502. 67. Sutherland, I.W., Polysaccharidesfrom Microorganisms, Plants and Animals. Polysaccharides I: Polysaccharides from Prokaryotes ed. E.J. Vandamme. Vol. 5. 2002: Wetheim: Wiley VCH. 68. Guo, H., et al., Current understanding on biosynthesis ofmicrobial polysaccharides. Cuff Top Med Chem, 2008. 8(2): p. 141-51. 69. Hirazumi, A., et al., Anticancer activity ofMorinda citr~folia (noni) on intraperitoneally implanted Lewis lung carcinoma in syngeneic mice. Proc West Pharmacol Soc, 1994. 37: p. 145-6. 70. Brito-Arias, M., Synthesis and Characterization of Glycosides, ed. Springer. Vol. XII. 2007. 352. 130

71. Ferraris, R.P., Dietary and developmental regulation ofintestinal sugar transport. Biochemical Journal 360 2001. 360: p. 265—276. 72. Faltynek, C.R., et al., Damnacanthal is a highly potent, selective inhibitor of p56lck tyrosine kinase activity. Biochemistry, 1995. 34(38): p. 12404-10. 73. Djozan, D. and Y. Assadi, Determination of anthraquinones in rhubarb roots, dockflowers and senna leaves by normal-phase high performance liquid chromatography. Talanta, 1995. 42(6): p. 861-5. 74. Wang, M., et al., Novel glycosidesfrom noni (Morinda citr~folia). J Nat Prod, 2000. 63(8): p. 1182-3. 75. Wang, M., et al., Novel trisaccharidefatty acid ester ident~fiedfrom thefruits of Morinda citr~folia (Noni). J Agric Food Chem, 1999. 47(12): p. 4880-2. 76. Pandey, R. and G.K. Khuller, Nanoparticle-based oral drug delivery system for

an injectable antibiotic - streptomycin. Evaluation in a murine tuberculosis model. Chemotherapy, 2007. 53(6): p. 437-41. 77. Lutsiak, M.E., G.S. Kwon, and J. Samuel, Biodegradable nanoparticle delivery ofa Th2-biasedpeptidefor induction of Thi immune responses. J Pharm Pharmacol, 2006. 58(6): p. 739-47. 78. Moghimi, S.M., Recent developments in polymeric nanoparticle engineering and their applications in experimental and clinical oncology. Anticancer Agents Med Chem, 2006. 6(6): p. 553-561. 79. Fletcher, S., K. Steffy, and D. Averett, Masked oral prodrugs of toll-like receptor 7 agonists: a new approachfor the treatment of infectious disease. Cuff Opin Investig Drugs, 2006. 7(8): p. 702-8. 80. Terry, M.B., et al., Association offrequency and duration ofaspirin use and hormone receptor status with breast cancer risk Jama, 2004. 29 1(20): p. 243 3- 40. 81. Dinda, B., S. Debnath, and Y. Harigaya, Naturally occurring iridoids. A review, part 1. Chem Pharm Bull (Tokyo), 2007. 55(2): p. 159-222. 82. Sang, S., et al., Iridoid glycosidesfrom the leaves ofMorinda citr~folia. J Nat Prod, 2001. 64(6): p. 799-800. 83. Levand, 0. and H.0. Larson, Some chemical constituents ofMorinda citr~folia. PlantaMed, 1979. 36(2): p. 186-7. 84. Liu, G., et a!., Two novel glycosides from thefruits ofMorinda citr~folia (noni) inhibit AP-1 transactivation and cell transformation in the mouse epidermal JB6 cell line. Cancer Res, 2001. 61(15): p. 5749-56. 85. Berg, J.T. and E. Furusawa, Failure ofjuice orjuice extractfrom the noni plant (Morinda citr~folia) to protect rats against oxygen toxicity. Hawaii Med J, 2007. 66(2): p. 41-4. 86. Potterat, 0., et a!., Iden4fication of TLC markers and quant~fIcation by HPLC MS of various constituents in nonifruitpowder and commercial noni-derived products. J Agric Food Chem, 2007. 55(1 8): p. 7489-94. 87. Hiramatsu, T., et a!., Induction ofnormal phenotypes in ras-transformed cells by damnacanthalfrom Morinda cit4folia. Cancer Lett, 1993. 73(2-3): p. 161-6. 88. Banerjee, S., et al., An extract ofMorinda citr~folia interferes with the serum- inducedformation offilamentous structures in Candida albicans and inhibits germination ofAspergillus nidulans. Am J Chin Med, 2006. 34(3): p. 503-9. 131

89. Dolence, J.M., et al., Yeast proteinfarnesyltransferase: steady-state kinetic studies ofsubstrate binding. Biochemistry, 1995. 34(5 1): p. 16687-94. 90. Furusawa, E., et a!., Antitumourpotential ofapolysaccharide-rich substance from thefruitjuice ofMorinda cit4folia (Noni) on sarcoma 180 ascites tumour in mice. Phytother Res, 2003. 17(10): p. 1158-64. 91. Hirazumi, A., et al., Immunomodulation contributes to the anticancer activity of morinda cit4folia (noni) fruitjuice. Proc West Pharmacol Soc, 1996. 39: p. 7-9. 92. Hiwasa, T., et al., Stimulation of ultraviolet-induced apoptosis ofhuman fibroblast UVr-1 cells by tyrosine kinase inhibitors. FEBS Lett, 1999. 444(2-3): p. 173-6. 93. Frew T, P.G., Berggren M, Abraham RT, Ashendel CL, et al. , A multiwell assay for inhibitors ofphosphatidylinositol-3-kinase and the ident~flcation ofnatural product inhibitors. Anticancer Research, 1994. 14(6B): p. 2425-8. 94. von Lintig, F.C.D., A. D.; Varki, N. M.; Wallace, A. M.; Casteel, D. E. und Boss, G. R., Ras activation in human breast cancer. Breast Cancer Res.Treat., 2000. 62(6): p. 5 1-62. 95. Fitzgerald, J.B., et al., Systems biology and combination therapy in the questfor clinical efficacy. Nat Chem Biol, 2006. 2(9): p. 458-66. 96. Field, T.S., et al., Under utilization ofsurveillance mammography among older breast cancer survivors. J Gen Intern Med, 2008. 23(2): p. 158-63. 97. Mayer, E.L., L.A. Carey, and H.J. Burstein, Clinical trial update: implications and management of residual disease after neoadjuvant therapyfor breast cancer. Breast Cancer Res, 2007. 9(5): p. 110. 98. Sassi, F., H.S. Lull, and E. Guadagnoli, Reducing racial/ethnic disparities in female breast cancer: screening rates and stage at diagnosis. Am J Public Health, 2006. 96(12): p. 2165-72. 99. Lester, J., Breast cancer in 2007: incidence, risk assessment, and risk reduction strategies. Clin J Oncol Nurs, 2007. 11(5): p. 619-22. 100. Jemal, A., E. Ward, and M.J. Thun, Recent trends in breast cancer incidence rates by age and tumor characteristics among US. women. Breast Cancer Res, 2007. 9(3): p. R28. 101. Leinung, S., L.C. Horn, and J. Backe, [Male breast cancer: histoiy, epidemiology, genetic and histopathology]. Zentralbi Chir, 2007. 132(5): p. 379- 85. 102. Nomura, M., et al., A case of noninvasive ductal carcinoma arising in malignant phyllodes tumor. Breast Cancer, 2006. 13(1): p. 89-94. 103. Hara, H. and K. Suda, Review of the cytologicfeatures of noninvasive ductal carcinomas of the pancreas: differences from invasive ductal carcinoma. Am J Clin Pathol, 2008. 129(1): p. 115-29. 104. Funaki, K., et al., Invasive ductal breast carcinoma metastatic to uterus. mt J Gynaecol Obstet, 2008. 100(3): p. 282-4. 105. Wiechmann, L. and H.M. Kuerer, The molecularjourneyfrom ductal carcinoma in situ to invasive breast cancer. Cancer, 2008. 112(10): p. 2130-42. 106. Wenzel, C., et a!., Invasive ductal carcinoma and invasive lobular carcinoma of breast differ in responsefollowing neoadjuvant therapy with epidoxorubicin and docetaxel + G-CSF. Breast Cancer Res Treat, 2006. 132

107. Trere, D., et al., Cell proliferation in breast cancer is a major determinant of clinical outcome in node-positive but not in node-negative patients. Appi Immunohistochem Mol Morphol, 2006. 14(3): p. 3 14-23. 108. Simpson, P.T., et al., Molecular evolution ofbreast cancer. J Pathol, 2005. 205(2): p. 248-54. 109. Paquette, B., et al., Invasiveness of breast cancer cells MDA-MB-231 through extracellular matrix is increased by the estradiol metabolite 4-hydroxyestradiol. mt J Cancer, 2005. 113(5): p. 706-11. 110. Trichopoulos, D., et al., Early We events and conditions and breast cancer risk: from epidemiology to etiology. mt J Cancer, 2008. 122(3): p. 48 1-5. 111. Suzuki, R., et al., Alcohol intake and risk ofbreast cancer defined by estrogen andprogesterone receptor status--a meta-analysis ofepidemiological studies. Int J Cancer, 2008. 122(8): p. 1832-41. 112. Stuedal, A., et al., Does breast size mod(fy the association between mammographic density and breast cancer risk? Cancer Epidemiol Biomarkers Prey, 2008. 17(3): p. 621-7. 113. Shore, R.E., et al., Polymorphisms in XPC and ERCC2 genes, smoking and breast cancer risk. mt J Cancer, 2008. 122(9): p. 2101-5. 114. Pfeiffer, R.M., et al., Racial differences in breast cancer trends in the United States (2000-2004). J Nati Cancer Inst, 2008. 100(10): p. 751-2. 115. Peplonska, B., et al., AdulthoodL~fetime PhysicalActivily and Breast Cancer. Epidemiology, 2008. 19(2): p. 226-236. 116. Kyndi, M., et al., Estrogen receptor, progesterone receptor, HER-2, and response to postmastectomy radiotherapy in high-risk breast cancer: the Danish Breast Cancer Cooperative Group. J Clin Oncol, 2008. 26(9): p. 1419-26. 117. Kaufman, E.L., et al., Effect of breast cancer radiotherapy and cigarette smoking on risk ofsecond primary lung cancer. J Clin Oncol, 2008. 26(3): p. 392-8. 118. Cohn, W.F., S.M. Jones, and S. Miesfeldt, “Are you at riskfor hereditary breast cancer? “: development of a personal risk assessment toolfor hereditary breast and ovarian cancer. J Genet Couns, 2008. 17(1): p. 64-78. 119. Thomas, S.R., et al., Invasive breast cancer after initiation oftestosterone replacement therapy in a man--a warning to endocrinologists. Endocr Pract, 2008. 14(2): p. 201-3. 120. Levi, F., et al., Trends in breast cancer incidence among women under the age offorty. Br J Cancer, 2007. 97(7): p. 1013-4. 121. Moser, K., J. Patnick, and V. Beral, Do women know that the risk of breast cancer increases with age? Br J Gen Pract, 2007. 57(538): p. 404-6. 122. Hopwood, P., et al., The impact ofage and clinicalfactors on quality of 4fe in early breast cancer: an analysis of 2208 women recruited to the UK START Trial (Standardisation ofBreast Radiotherapy Trial). Breast, 2007. 16(3): p. 241-51. 123. Ratajska, M., et al., BR CA] and BRCA2 point mutations and large rearrangements in breast and ovarian cancerfamilies in Northern Poland. Oncol Rep, 2008. 19(1): p. 263-8. 133

124. Easton, D.F., et al., A systematic genetic assessment of 1,433 sequence variants of unknown clinical sign~flcance in the BRCA1 and BR CA 2 breast cancer- predisposition genes. Am J Hum Genet, 2007. 8 1(5): p. 873-83. 125. Kenen, R., A. Ardern-Jones, and R. Eeles, “Social separation” among women under 40 years of age diagnosed with breast cancer and carrying a BR CA] or BRCA2 mutation. J Genet Couns, 2006. 15(3): p. 149-62. 126. Bergthorsson, J.T., et al., BRCAJ and BRCA2 mutation status and cancerfamily history ofDanish women affected with multjfocal or bilateral breast cancer at a young age. J Med Genet, 2001. 38(6): p. 361-8. 127. Marshall, M. and S. Solomon, Hereditary breast-ovarian cancer: clinical findings and medical management. Plast Surg Nurs, 2007. 27(3): p. 124-7. 128. Kotsopoulos, J., et a!., Age atfirst birth and the risk ofbreast cancer in BRCA] and BRCA2 mutation carriers. Breast Cancer Res Treat, 2007. 105(2): p. 221-8. 129. Halbert, C.H., L.J. Kessler, and E. Mitchell, Genetic testingfor inherited breast cancer risk in African Americans. Cancer Invest, 2005. 23(4): p. 285-95. 130. Carey, L.A., et al., Race, breast cancer subtypes, and survival in the Carolina Breast Cancer Study. JAMA, 2006. 295(2 1): p. 2492-502. 131. Stark, A., et al., Advanced stages andpoorly differentiated grade are associated with an increased risk ofHER2/neu positive breast carcinoma only in White women: findingsfrom a prospective cohort study ofAfrican-American and White-American women. Breast Cancer Res Treat, 2008. 107(3): p. 405-14. 132. Ihemelandu, C.U., et al., Basal cell-like (triple-negative) breast cancer, a predictor of distant metastasis in African American women. Am J Surg, 2008. 195(2): p. 153-8. 133. Lund, M.J., et a!., High prevalence of triple-negative tumors in an urban cancer center. Cancer, 2008. 134. Verkooijen, H.M., et al., Family history ofbreast or ovarian cancer mod~fles the risk ofsecondary leukemia after breast cancer: resultsfrom a population-based study. mt j Cancer, 2008. 122(5): p. 1114-7. 135. Soerjomataram, I. and J.W. Coebergh, Should women be advised to havefirst childbirth at age <20 years to reduce breast cancer risk? J Cancer Res Clm Oncol, 2007. 133(1 1): p. 903. 136. Foidart, J.M., et a!., Hormone therapy and breast cancer risk. Climacteric, 2007. 10 Suppl2: p.54-61. 137. Chlebowski, R.T., et al., Predicting risk of breast cancer inpostmenopausal women by hormone receptor status. J Nat! Cancer Inst, 2007. 99(22): p. 1695- 705. 138. Terry, M.B., et a!., Lifetime alcohol intake and breast cancer risk. Ann Epidemiol, 2006. 16(3): p. 230-40. 139. Coute!le, C., et al., Riskfactors in alcohol associated breast cancer: alcohol dehydrogenase polymorphism and estrogens. mt J Oncol, 2004. 25(4): p. 1127- 32. 140. Aronson, K., Alcohol: a recently ident~fled riskfactorfor breast cancer. CMAJ, 2003. 168(9): p. 1147-8. 134

141. Saeki, T., et al., No increase ofbreast cancer incidence in Japanese women who received hormone replacement therapy: overview ofa case-control study of breast cancer risk in Japan. Tnt J Clin Oncol, 2008. 13(1): p. 8-11. 142. Willey, S.C. and C. Cocilovo, Screening andfollow-up of the patient at high risk for breast cancer. Obstet Gynecol, 2007. 110(6): p. 1404-16. 143. Erbas, B., et al., Incidence of invasive breast cancer and ductal carcinoma in situ in a screening program by age: should older women continue screening? Cancer Epidemiol Biomarkers Prey, 2004. 13(10): p. 1569-73. 144. Carmichael, A.R., Obesity as a riskfactorfor development and poor prognosis ofbreast cancer. BJOG, 2006. 113(10): p. 1160-6. 145. Chlebowski, R.T., Obesity and early-stage breast cancer. J Clin Oncol, 2005. 23(7): p. 1345-7. 146. Consedine, N.S., et al., Obesity and awareness ofobesity as riskfactorsfor breast cancer in six ethnic groups. Obes Res, 2004. 12(10): p. 1680-9. 147. Bamett, J.B., The relationship between obesity and breast cancer risk and mortality. Nutr Rev, 2003. 6 1(2): p. 73-6. 148. Morimoto, L.M., et al., Obesity, body size, and risk ofpostmenopausal breast cancer: the Women’s Health Initiative (United States). Cancer Causes Control, 2002. 13(8): p. 741-51. 149. Dasari, P., I.C. Nicholson, and H. Zola, Toll-like receptors. J Biol Regul Homeost Agents, 2008. 22(1): p. 17-26. 150. Verstak, B., P. Hertzog, and A. Mansell, Toll-like receptor signalling and the clinical benefits that lie within. Inflamm Res, 2007. 56(1): p. 1-10. 151. Lien, E. and R.R. Ingalls, Toll-like receptors. Crit Care Med, 2002. 30(1 Supp): p. Si-Sli. 152. Uematsu, S. and S. Akira, [Role of toll-like receptor in immunological defence mechanism]. Nippon Naika Gakkai Zasshi, 2005. 94(2): p. 355-61. 153. Beutler, B., The Toll-like receptors: analysis byforward genetic methods. Immunogenetics, 2005. 57(6): p. 385-92. 154. Rhule, A., et al., Toll-like receptor ligand-induced activation of murine DC2.4 cells is attenuated by Panax notoginseng. J Ethnopharmacol, 2008. 116(1): p. 179-86. 155. Essakalli, M., et al., [Toll-like receptors.]. Pathol Biol (Paris), 2008. 156. Brikos, C. and L.A. O’Neill, Signalling of toll-like receptors. Handb Exp Pharmacol, 2008(183): p. 21-50. 157. Uematsu, S. and S. Akira, The role of Toll-like receptors in immune disorders. Expert Opin Biol Ther, 2006. 6(3): p. 203-14. 158. Alberts, B.A.J., Julian Lewis, Martin Raff, Keith Roberts, and Peter Walters, Molecular Biology ofthe Cell. Fourth ed. 2002, New York: Taylor & Francis Group. 159. Janeway, C.P.T., Mark Walport, and Mark Shlomchik, Immunobiology. Fifth ed. 2001, New York: Garland Science. 160. Wang, R.F., Y. Miyahara, and H.Y. Wang, Toll-like receptors and immune regulation: implicationsfor cancer therapy. Oncogene, 2008. 27(2): p. 18 1-9. 161. Uematsu, S. and S. Alcira, Toll-Like receptors (TLRs) and their ligands. Handb Exp Pharmacol, 2008(1 83): p. 1-20. 135

162. Uematsu, S. and S. Akira, [Toll-like receptor and innate immunity]. Seilcagaku, 2007. 79(8): p. 769-76. 163. Pulendran, B., Tolls and beyond--many roads to vaccine immunity. N Engi J Med, 2007. 356(17): p. 1776-8. 164. Tsan, M.F., Toll-like receptors, inflammation and cancer. Semin Cancer Biol, 2006. 16(1): p. 32-7. 165. Beutler, B., Toll-like receptors and their place in immunology. Where does the immune response to infection begin? Nat Rev Immunol, 2004. 4(7): p. 498. 166. Barton, G.M. and R. Medzhitov, Toll-like receptor signaling pathways. Science, 2003. 300(5625): p. 1524-5. 167. Jin, M.S. and J.O. Lee, Structures of the Toll-like Receptor Family and Its Ligand Complexes. Immunity, 2008. 29(2): p. 182-91. 168. Calich, V.L., et al., Toll-like receptors andfungal infections: the role of TLR2, TLR4 and MyD88 inparacoccidioidomycosis. FEMS Immunol Med Microbiol, 2008. 53(1): p. 1-7. 169. Du, X., et a!., Three novel mammalian toll-like receptors: gene structure, expression, and evolution. Eur Cytokine Netw, 2000. 11(3): p. 362-71. 170. Muzio, M., et al., Toll-like receptors: a growingfamily of immune receptors that are djfferentially expressed and regulated by different leukocytes. J Leukoc Biol, 2000. 67(4): p. 450-6. 171. Akira, S., M. Yamamoto, and K. Takeda, Role ofadapters in Toll-like receptor signalling. Biochem Soc Trans, 2003. 31(Pt 3): p. 637-42. 172. Gelman, A.E., et al., Toll-like receptor ligands directly promote activated CD4+ Tcell survival. J Immunol, 2004. 172(10): p. 6065-73. 173. Jiang, Z., et al., CDJ4 is requiredfor MyD88-independent LPS signaling. Nat Immunol, 2005. 6(6): p. 565-70. 174. Spaner, D.E., et al., Obstacles to effective Toll-like receptor agonist therapyfor hematologic malignancies. Oncogene, 2008. 27(2): p. 208-17. 175. Chen, R., et a!., Cancers take their Toll--thefunction and regulation of Toll-like receptors in cancer cells. Oncogene, 2008. 27(2): p. 225-33. 176. Romagne, F., Current andfuture drugs targeting one class of innate immunity receptors: the Toll-like receptors. Drug Discov Today, 2007. 12(1-2): p. 80-7. 177. Lazarus, R., et al., Single nucleotide polymorphisms in innate immunity genes: abundant variation and potential role in complex human disease. Immunol Rev, 2002. 190: p. 9-25. 178. Lemaitre, B., et al., The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent an4fungal response in Drosophila adults. Cell, 1996. 86(6): p. 973-83. 179. Tsujimoto, H., et al., Role of Toll-like receptors in the development ofsepsis. Shock, 2008. 29(3): p. 3 15-21. 180. Frantz, S., G. Erti, and J. Bauersachs, Mechanisms ofdisease: Toll-like receptors in cardiovascular disease. Nat Clin Pract Cardiovasc Med, 2007. 4(8): p. 444-54. 181. Beutler, B., Toll-like receptors: how they work and what they do. Cuff Opin Hematol, 2002. 9(1): p. 2-10. 136

182. Youn, H.S., et al., Selenium suppresses the activation oftranscriptionfactor NF-kappa B and IRF3 induced by TLR3 or TLR4 agonists. mt Immunopharmacol, 2008. 8(3): p. 495-501. 183. Wang, L., et al., TLR4 signaling in cancer cells promotes chemoattraction of immature dendritic cells via autocrine CCL2O. Biochem Biophys Res Commun, 2008. 366(3): p. 852-6. 184. Carmody, R.J. and Y.H. Chen, Nuclearfactor-kappaB: activation and regulation during toll-like receptor signaling. Cell Mo! Immunol, 2007. 4(1): p. 3 1-41. 185. Goriely, S., et al., Interferon regulatoryfactor 3 is involved in Toll-like receptor 4 (TLR4)- and TLR3-inducedlL-12p35 gene activation. Blood, 2006. 107(3): p. 1078-84. 186. Doyle, S., et a!., IRF3 mediates a TLR3/TLR4-spec~fic antiviral gene program. Immunity, 2002. 17(3): p. 251-63. 187. Gay, N.J., et al., A leucine-rich repeat peptide derivedfrom the Drosophila Toll receptorforms extendedfilaments with a beta-sheet structure. FEBS Lett, 1991. 291(1): p. 87-91. 188. Nakata, T., et al., CD14 directly binds to triacylated lipopeptides andfacilitates recognition of the lipopeptides by the receptor complex of Toll-like receptors 2 and 1 without binding to the complex. Cell Microbiol, 2006. 8(12): p. 1899-909. 189. Muzio, M., et al., Toll like receptorfamily (TLT) and signalling pathway. Eur Cytokine Netw, 2000. 11(3): p. 489-90. 190. Jin, X., et al., Toll-like receptors (TLRs) expression andfunction in response to inactivate hyphae ofFusarium solani in immortalized human corneal epithelial cells. Mol Vis, 2007. 13: p. 1953-61. 191. Farhat, K., Ct al., Heterodimerization of TLR2 with TLRJ or TLR6 expands the ligand spectrum but does not lead to d~fferential signaling. J Leukoc Biol, 2008. 83(3): p. 692-701. 192. Beutler, B., et al., Genetic analysis of innate immunity: ident~flcation and function of the TIR adapter proteins. Adv Exp Med Biol, 2005. 560: p. 29-39. 193. Smimova, I., Ct al., Excess ofrare amino acidpolymorphisms in the Toll-like receptor 4 in humans. Genetics, 2001. 15 8(4): p. 1657-64. 194. Hartupee, J., X. Li, and T. Hamilton, Interleukin 1 alpha-induced NFkappaB activation and chemokine mRNA stabilization diverge at IRAKJ. J Biol Chem, 2008. 283(23): p. 15689-93. 195. Vivarelli, M.S., et al., RIP links TLR4 to Akt and is essentialfor cell survival in response to LPS stimulation. J Exp Mcd, 2004. 200(3): p. 3 99-404. 196. Uematsu, S. and S. Alcira, Toll-like receptors and Type I inteiferons. J Biol Chem, 2007. 282(21): p. 153 19-23. 197. Lauw, F.N., D.R. Caffrey, and D.T. Golenbock, Ofmice and man: TLR]1 (finally) finds profilin. Trends Immunol, 2005. 26(10): p. 509-11. 198. Beutler, B., et al., Genetic analysis of host resistance: Toll-like receptor signaling and immunity at large. Annu Rev Immunol, 2006. 24: p. 353-89. 199. Freudenberg, M.A., et al., Lipopolysaccharide sensing an importantfactor in the innate immune response to Gram-negative bacterial infections: benefits and hazards ofLPS hypersensitivity. Immunobiology, 2008. 213(3-4): p. 193-203. 137

200. Lohmann, K.L., et al., The equine TLR4/MD-2 complex mediates recognition of lipopolysaccharide from Rhodobacter sphaeroides as an agonist. J Endotoxin Res, 2007. 13(4): p. 235-42. 201. Vives-Pi, M., et al., Evidence ofexpression ofendotoxin receptors CDJ4, toll- like receptors TLR4 and TLR2 and associated molecule MD-2 and ofsensitivity to endotoxin (LPS) in islet beta cells. Clin Exp Immunol, 2003. 133(2): p. 208- 18. 202. Yamamoto, M., et al., Essential rolefor TIRAP in activation of the signalling cascade shared by TLR2 and TLR4. Nature, 2002. 420(69 13): p. 324-9. 203. Takeda, K. and S. Akira, TLR signaling pathways. Semin Immunol, 2004. 16(1): p. 3-9. 204. Esen, N. and T. Kielian, Central role for MyD88 in the responses ofmicroglia to pathogen-associated molecular patterns. J Immunol, 2006. 176(11): p. 6802-11. 205. Tanimura, N., et al., Roles for LPS-dependent interaction and relocation of TLR4 and TRAM in TRIF-signaling. Biochem Biophys Res Commun, 2008. 368(1): p. 94-9. 206. Pandey, S. and D.K. Agrawal, Immunobiology of Toll-like receptors: emerging trends. Immunol Cell Biol, 2006. 84(4): p. 333-41. 207. Yamamoto, M., et al., Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science, 2003. 301(5633): p. 640-3. 208. Yamamoto, M., et al., TRAM is specifically involved in the Toll-like receptor 4- mediated MyD88-independent signaling pathway. Nat Immunol, 2003. 4(11): p. 1144-50. 209. Nalbandian, G., et al., The selective estrogen receptor modulators, tamox~fen and ralox~fene, impair dendritic cell differentiation and activation. J Immunol, 2005. 175(4): p. 2666-75. 210. Beutler, B., Innate immune responses to microbial poisons: discovery and function of the Toll-like receptors. Annu Rev Pharmacol Toxicol, 2003. 43: p. 609-28. 211. Lu, Y.C., W.C. Yeh, and P.S. Ohashi, LPS/TLR4 signal transduction pathway. Cytokine, 2008. 42(2): p. 145-51. 212. Hoebe, K. and B. Beutler, Forward genetic analysis of TLR-signaling pathways: an evaluation. Adv Drug Deliv Rev, 2008. 60(7): p. 824-9. 213. Kawagoe, T., et al., Essential role ofIRAK-4 protein and its kinase activity in Toll-like receptor-mediated immune responses but not in TCR signaling. J Exp Med, 2007. 204(5): p. 1013-24. 214. Xia, Y., K. Yamagata, and T.L. Krukoff, D~fferential expression of the CDJ4/TLR4 complex and inflammatory signaling moleculesfollowing i.c.v. administration ofLPS. Brain Res, 2006. 1095(1): p. 85-95. 215. Kawagoe, T., et al., Sequential control of Toll-like receptor-dependent responses byIRAKJ and IRAK2. Nat Immunol, 2008. 9(6): p. 684-91. 216. Keating, S.E., et al., IRAK-2 participates in multiple toll-like receptor signaling pathways to NFkappaB via activation of TRAF6 ubiquitination. J Biol Chem, 2007. 282(46): p. 33435-43. 138

217. Zhande, R., et al., FADD negatively regulates lipopolysaccharide signaling by impairing interleukin-1 receptor-associated kinase 1-MyD88 interaction. Mol Cell Biol, 2007. 27(21): p. 7394-404. 218. Into, T., et al., Stimulation ofhuman Toll-like receptor (TLR) 2 and TLR6 with membrane l4~oproteins ofMycoplasmafermentans induces apoptotic cell death after NF-kappa B activation. Cell Microbiol, 2004. 6(2): p. 187-99. 219. Matsumoto, N., R. Imamura, and T. Suda, Caspase-8- and JNK-dependentAP-1 activation is requiredfor Fas ligand-inducedlL-8 production. FEBS J, 2007. 274(9): p. 23 76-84. 220. Chao, W., et al., Fas-associated death-domain protein inhibits TNF-alpha mediated NF-kappaB activation in cardiomyocytes. Am J Physiol Heart Circ Physiol, 2005. 289(5): p. H2073-80. 221. Lemmers, B., et al., Essential rolefor caspase-8 in Toll-like receptors and NFkappaB signaling. J Biol Chem, 2007. 282(10): p. 7416-23. 222. Ploegh, H.L., Bridging B cell and T cell recognition of antigen. J Immunol, 2007. 179(1 1): p. 7193. 223. Mak, T.W., The Tcell antigen receptor: “The Hunting of the Snark”. Eur J Immunol, 2007. 37 Suppl 1: p. S83-93. 224. Li, J., et al., High cell surface expression of CD4 allows distinction of CD4(+)CD25(+) antigen-spec~c effector T cellsfrom CD4(+)CD25(+) regulatory T cells in murine experimental autoimmune encephalomyelitis. J Neuroimmunol, 2007. 192(1-2): p. 57-67. 225. Wang, R.F., Regulatory Tcells and toll-like receptors in cancer therapy. Cancer Res, 2006. 66(10): p. 4987-90. 226. Wang, H.Y. and R.F. Wang, Regulatory Tcells and cancer. Cuff Opin Immunol, 2007. 19(2): p. 217-23. 227. Arpomsuwan, T. and T. Punjanon, Tumor cell-selective antipro4ferative effect ofthe extractfrom Morinda citr~foliafruits. Phytother Res, 2006. 20(6): p. 515- 7. 228. The Merck index: an encyclopedia of chemicals, drugs, and biologicals, M.J. O’Neil, Editor. 2006: Whitehouse Station, NJ. 229. Ovstebo, R., et al., Identjflcation ofgenes particularly sensitive to lipopolysaccharide (LPS) in human monocytes induced by wild-type versus LPS deficient Neisseria meningitidis strains. Infect Immun, 2008. 76(6): p. 2685-95. 230. Fedarko, N.S., et al., Human bone cell enzyme expression and cellular heterogeneity: correlation ofalkaline phosphatase enzyme activity with cell cycle. J Cell Physiol, 1990. 144(1): p. 115-21. 231. Makeyev, A.V. and S.A. Liebhaber, The poly(C)-binding proteins: a multiplicity offunctions and a search for mechanisms. RNA, 2002. 8(3): p. 265-78. 232. Cartier, C., et al., Active cAMP-dependent protein kinase incorporated within highly pur~fIed HIV-i particles is requiredfor viral infectivity and interacts with viral capsidprotein. J Biol Chem, 2003. 278(37): p. 35211-9. 233. Dwivedi, Y., et al., [(3)H]cAMP binding sites andprotein kinase a activity in the prefrontal cortex ofsuicide victims. Am J Psychiatry, 2002. 159(1): p. 66-73. 139

234. Yoshida, K., Fibroblast cell shape and adhesion in vitro is altered by overexpression of the 7a and 7b isoforms ofprotocadherin 7, but not the 7c isoform. Cell Mol Biol Lett, 2003. 8(3): p. 735-41. 235. Nomiyama, H., et al., Identjfication ofa novel CXCL1-like chemokine gene in macaques and its inactivation in hominids. J Interferon Cytokine Res, 2007. 27(1): p. 32-7. 236. Kawada, J., et al., Analysis ofgene-expression profiles by oligonucleotide microarray in children with influenza. J Gen Virol, 2006. 87(Pt 6): p. 1677-83. 237. Angelis, E., et al., A cyclin D2-Rb pathway regulates cardiac myocyte size and RNA polymerase III after biomechanical stress in adult myocardium. Circ Res, 2008. 102(10): p. 1222-9. 238. Hishida, T., et al., Crucial roles ofD-iype cyclins in the early stage ofadzpocyte djfferentiation. Biochem Biophys Res Commun, 2008. 370(2): p. 289-94. 239. Ma, Y. and W.D. Cress, Transcriptional upregulation ofp57 (Kip2) by the cyclin-dependent kinase inhibitor BMS-38 7032 is E2F dependent and serves as a negativefeedback loop limiting cytotoxicity. Oncogene, 2006. 240. Kim, S.J., et al., Differential effect ofFGF and PDGF on cellproljferation and migration in osteoblastic cells. Growth Factors, 2007. 25(2): p. 77-86. 241. Ornitz, D.M. and N. Itoh, Fibroblast growth factors. Genome Biol, 2001. 2(3): p. REVIEWS3 005. 242. Wang, M. and P. Liang, Interleukin-24 and its receptors. Immunology, 2005. 114(2): p. 166-70. 243. Sauane, M., et al., Mda-7/IL-24 induces apoptosis ofdiverse cancer cell lines through JAK/STA T-independent pathways. J Cell Physiol, 2003. 196(2): p. 334- 45. 244. Sarkar, D., et al., mda-7 (IL-24): signaling andfunctional roles. Biotechniques, 2002. Suppi: p. 3 0-9. 245. Kroemer, G., et al., Class~fIcation ofcell death: recommendations of the Nomenclature Committee on Cell Death 2009. Cell Death Differ, 2008. 246. Bursch, W., et al., Cell death and autophagy: Cytokines, drugs, and nutritional factors. Toxicology, 2008. 254(3): p. 147-57. 247. Song, J.J. and Y.J. Lee, Differential cleavage ofMstl by caspase-7/-3 is responsiblefor TRAIL-induced activation of the MAPK superfamily. Cell Signal, 2008. 20(5): p. 892-906. 248. Li, T., et al., D~ferential induction ofapoptosis by LFS and taxol in monocytic cells. Mol Immunol, 2005. 42(9): p. 1049-55. 249. Homback, J.M., Organic Chemistiy. Second Edition ed. 2006: Pacific Grove: Thomson Brooks/Cole. 1328. 250. Lund, M.J., et al., Race and triple negative threats to breast cancer survival: a population-based study in Atlanta, GA. Breast Cancer Res Treat, 2008. 251. Siziopikou, K.P. and M. Cobleigh, The basal subtype ofbreast carcinomas may represent the group ofbreast tumors that could benefitfrom EGFR-targeted therapies. Breast, 2007. 16(1): p. 104-7. 252. Dunnwald, L.K., M.A. Rossing, and C.I. Li, Hormone receptor status, tumor

characteristic and prognosis - a prospective cohort of breast cancer patients. Breast Cancer Res, 2007. 9(1): p. R6. 140

253. Sun, Q., et al., Rapamycin suppresses TLR4-triggeredlL-6 andPGE(2) production ofcolon cancer cells by inhibiting TLR4 expression and NF-kappaB activation. Mol Imrnunol, 2008. 45(10): p. 2929-36. 254. Cronan, T.A., et al., Predictors ofmammography screening among ethnically diverse low-income women. J Womens Health (Larchmt), 2008. 17(4): p. 527- 37. 255. Joensuu, H., Systemic chemotherapyfor cancer: from weapon to treatment. Lancet Oncol, 2008. 9(3): p. 304. 256. Zimmer, S.M., et al., Paclitaxel Binding to Human and Murine MD-2. J Biol Chem, 2008. 283(41): p. 27916-26. 257. Kawasaki, K., H. Nogawa, and M. Nishijima, IdentWcation ofmouse MD-2 residues importantforforming the cell surface TLR4-MD-2 complex recognized by anti-TLR4-MD-2 antibodies, andfor conferring LPS and taxol responsiveness on mouse TLR4 by alanine-scanning mutagenesis. J Immunol, 2003. 170(1): p. 413-20. 258. Kawasaki, K., K. Gomi, and M. Nishijima, Cutting edge: Gln22 of mouse MD-2 is essentialfor species-spec~flc lipopolysaccharide mimetic action of taxol. J Immunol, 2001. 166(1): p. 11-4. 259. Kennedy, M.N., et a!., A complex ofsoluble MD-2 and lipopolysaccharide serves as an activating ligandfor Toll-like receptor 4. J Biol Chem, 2004. 279(33): p. 34698-704. 260. He, W., et al., TLR4 signalingpromotes immune escape ofhuman lung cancer cells by inducing immunosuppressive cytokines and apoptosis resistance. Mol Immunol, 2007. 44(11): p. 2850-9. 261. Wang, J., et al., MyD88 is involved in the signalling pathwayfor Taxol-induced apoptosis and TNF-alpha expression in human myelomonocytic cells. Br J Haematol, 2002. 118(2): p. 638-45. 262. Smith, L., et al., The analysis ofdoxorubicin resistance in human breast cancer cells using antibody microarrays. Mol Cancer Ther, 2006. 5(8): p. 2115-20. 263. Kellogg, G.E., J.N. Scarsdale, and F.A. Fomari, Jr., Iden4flcation and hydropathic characterization ofstructuralfeatures affecting sequence spec~fIcity for doxorubicin intercalation into DNA double-stranded polynucleotides. Nucleic Acids Res, 1998. 26(20): p. 4721-32. 264. Chua, C.C., et al., Multiple actions ofp~fIthrin-alpha on doxorubicin-induced apoptosis in rat myoblastic H9c2 cells. Am J Physiol Heart Circ Physiol, 2006. 290(6): p. H2606-13. 265. Kroemer, G. and L. Zitvogel, Death, danger, and immunity: an infernal trio. Immunol Rev, 2007. 220: p. 5-7. 266. Qureshi, S.T., P. Gros, and D. Malo, The Lps locus: genetic regulation ofhost responses to bacterial lzpopolysaccharide. Inflamm Res, 1999. 48(12): p. 613- 20. 267. Apetoh, L., et al., Toll-like receptor 4-dependent contribution of the immune system to anticancer chemotherapy and radiotherapy. Nat Med, 2007. 13(9): p. 1050-9. 268. Murata, M., Activation ofToll-like receptor 2 by a novel preparation ofcell wall skeleton from Mycobacterium bovis BCG Tokyo (SMP-105) sufficiently 141

enhances immune responses against tumors. Cancer Sci, 2008. 99(7): p. 1435- 40. 269. Ahmed, S.U., Ct al., Anti-tumor effect ofan intratumoral administration of dendritic cells in combination with TS-J, an oralfluoropyrimidine anti-cancer drug, and OK-432, a streptococcal immunopotentiator: involvement of toll-like receptor 4. J Immunother, 2004. 27(6): p. 432-41. 270. Apetoh, L., et al., The interaction between HMGB1 and TLR4 dictates the outcome ofanticancer chemotherapy and radiotherapy. Immunol Rev, 2007. 220: p. 47-59. 271. Haidara, K., et al., Implication ofcaspases and subcellular compartments in tert-butylhydroperoxide induced apoptosis. Toxicol Appi Pharmacol, 2008. 229(1): p. 65-76. 272. Oliver, F.J., et al., Importance ofpoly(ADP-ribose) polymerase and its cleavage in apoptosis. Lessonfrom an uncleavable mutant. J Biol Chem, 1998. 273(50): p. 33533-9. 273. Goto, Y., et al., Activation of Toll-like receptors 2, 3, and 4 on human melanoma cells induces inflammatoryfactors. Mol Cancer Ther, 2008. 7(11): p. 3642-53. 274. Coussens, L.M. and Z. Werb, Inflammation and cancer. Nature, 2002. 420(6917): p. 860-7. 275. Zitvogel, L., A. Tesniere, and G. Kroemer, Cancer despite immunosurveillance: immunoselection and immunosubversion. Nat Rev Immunol, 2006. 6(10): p. 715-27. 276. Wren, B.G., The origin ofbreast cancer. Menopause, 2007. 14(6): p. 1060-8.