DOCSLIB.ORG

Subcloning Notebook Guide, BR152

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Subcloning Notebook Guide, BR152 Classic Subcloning Basic Steps for Subcloning Subcloning is a basic procedure in molecular biology required to move inserts from one vector to another to gain the desired functionality to study your insert. Essentially all subcloning reactions proceed the same way as illustrated in the figure below. You release and purify your insert from the parent vector, ligate this insert into a prepared destination vector, transform this ligation reaction into competent bacterial cells. Then you screen the transformed cells for the insert. This Subcloning Notebook will guide you through every step in the process. Destination Parent Vector Vector Dephosphorylation reduces the chance of vector self-ligation Release insert from Digest vector parent vector with to accept insert to virtually zero. restriction digests Dephosphorylation Gel isolation band of interest is a practical Gel-purify Chapters insert Purify vector necessity 1 and 2 in subcloning. You get the fragment Gel isolation of vector Generated you need. by PCR reduces background by Ligate insert to vector eliminating uncut vector from the transformation. Transform Chapter 3 Screen Miniprep Digest 1 2 3 4 –Vector –Insert Chapter 4 4497TA www.promega.com • [email protected] 3 Classic Subcloning Subcloning Strategy See the Compatible Ends Before you begin your subcloning, you need to know: The restriction enzyme Table on page 61 for (RE) sites available for subcloning in your parent vector multiple cloning region (or in the insert if you need to digest the insert); the RE sites available a listing of overhangs in the destination vector multiple cloning region (MCR); and if these same compatible with sites also occur in your insert. Once you know this information, you can Promega enzymes. begin to ask questions about which subcloning strategy to use. Do the parent & Do the parent & destination vectors Re-evaluate strategy destination vector No have compatible No by using blunt ends have common RE RE sites which (see page 15). sites in their MCRs? generate ends? Ye s Ye s Proceed with common or Will these RE sites Is orientation No No compatible-end allow you to keep important? methods orientation of (see page 6 or 7). the insert? Ye s Ye s Will at least one Re-evaluate strategy site allow you to No using compatible- Do any of these keep orientation? end (see page 7) restriction sites or blunt ends. No 4498MA occur within the insert? Ye s Proceed with Ye s common restriction Consider the site method “Cut-Blunt-Cut” (see page 6). procedure One or both (see page 8) of the sites? or use compatible end or blunt-end method. One Both Consider partial Re-evaluate strategy restriction digest using compatible (see page 14) or ends or by using search for different blunt ends. compatible ends or blunting ends. 4 Promega Subcloning Notebook Classic Subcloning Subcloning Strategy: Common Restriction Sites If your parent and destination vector multiple cloning regions contain common restriction sites and neither of these restriction sites occur within your insert, you have a very straightforward subcloning process. You digest your parent and destination vectors with the same two enzymes followed by dephosphorylation of the destination vector. The insert and the dephosphorylated vector are then separated on an agarose gel and purified using a system such as the Wizard® SV Gel and PCR Clean-Up System (see page 28) and ligated. The T4 DNA Ligase will join the DNA through reforming the bond between the 5′-PO4 coming from the insert and the 3′-OH of the vector. The vector has been dephosphorylated so the second bond will not be formed in vitro (indicated by the OH). These nicks will be repaired in the bacteria upon transformation. Insert in pGEM®-3Zf(+) Vector Multiple cloning region of pGL3-Basic Vector …GA ATTCG AGCTC GGTAC CCGGG GATCC Insert TCTAG AGTCG ACCTG CAGGC ATGCA AGCTT… …GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGTAAGCTTGG… EcoR I Sac I Kpn I Ava I BamH I Xba I Sal I Pst I Sph I Hind III Kpn I Sac I Mlu I Nhe I Xma I Xho I Bgl II Hind III Sma I Acc I Acc65 I Sma I Hinc II Sac I Sac I Hind III Hind III CIAP PO 4 C A GAGCT OH –AGCTT PO TCGAG TTCGA 4 C– OH A T4 DNA Ligase See page 18 See page 13 for information on for information dephosphorylating vectors. on double Sac I OH See page 23 for information on ligating restriction GAGCTC AAGCTT the insert and vector. enzyme digests. CTCGAG TTCGAA OH Hind III Insert transferred from pGEM®-3Zf(+) Vector to pGL3-Basic Vector. 4499MA www.promega.com • [email protected] 5 Classic Subcloning Subcloning Strategy: Common Restriction Sites with Partial Digests Having a restriction site in both the multiple cloning region and Insert in pGEM®3Zf(+) Vector the insert does not Sac I exclude the use of …GA ATTCG AGCTC GGTAC CCGGG GATCCInsert TCTAG AGTCG ACCTG CAGGC ATGCA AGCTT… this site for EcoR I Sac I Kpn I Ava I BamH I Xba I Sal I Pst I Sph I Hind III Sma I Acc I Hinc II subcloning. A partial Hind III restriction digest (complete digest) strategy can be employed. Sac I Insert Hind III Sac I Multiple cloning region of pGL3-Basic Vector Sac I Concentration …GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGTAAGCTTGG… Kpn I Sac I Mlu I Nhe I Xma I Xho I Bgl II Hind III Acc65 I Sma I Partial Gel isolate Sac I the band Sac I digest you want. Hind III (complete digest with both enzymes) CIAP Sac I PO4 C A GAGCT OH –AGCTT TCGAG TTCGA PO4 C– OH A T4 DNA Ligase See page 14 for information on partial restriction digests. Sac I OH Sac I GAGCTC AAGCTT CTCGAG TTCGAA OH Hind III 4500MA Insert transferred from pGEM®-3Zf(+) Vector to pGL3-Basic Vector. 6 Promega Subcloning Notebook Classic Subcloning Subcloning Strategy: Moving Inserts with Compatible Restriction Sites If you don’t have common restriction sites in the parent and destination vector multiple cloning regions, you may have compatible restriction sites. Compatible restriction sites have the same overhang sequence and can be ligated together. In this example, Xba I and Nhe I both produce the same 5′ overhang sequence. Cut sites from these two are exactly matching and ligate well. However, neither the Xba I or Nhe I sites are regenerated in the ligation. A table of compatible ends is present on page 61 of this Notebook. Compatible end ligation is straightforward after the enzymes are identified. Xba I or Spe I is compatible with the Nhe I site of the Sal I is compatible with pGL3-Basic Vector. the Xho I site in the Xba I and Sal I have better buffer compatibility pGL3-Basic Vector. for the double digest than Spe I and Sal I. Insert in pGEM®-9Zf(–) Vector Multiple cloning region of pGL3-Basic Vector …TAT GCATCACTAG TAAGC TTTGC TCTAG A Insert GAATT CGTCG ACGAG CTC… …GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGTAAGCTTGG… Nsi I Spe I Hind III Xba I EcoR I Sal I Sac I Kpn I Sac I Mlu I Nhe I Xma I Xho I Bgl II Hind III Acc65 I Sma I Xba I Nhe I Sal I Xho I Dephosphorylation Gel Isolation of insert Gel Isolation PO4 CTAGA G G OH TCGAG T CAGCT PO4 CGATC OH C T4 DNA Ligase See the Compatible End Table on page 61 Xba I Xho I of the Technical OH Appendix for GCTAGA GTCGAG a listing of CGATCT CAGCTC OH compatible ends to Nhe I Sal I Promega enzymes. Insert transferred from pGEM-9Zf(–) Vector to pGL3-Basic Vector. 4501MA In this example, none of the restriction sites used for the compatible-end subcloning are regenerated in the final ligation product. www.promega.com • [email protected] 7 Classic Subcloning Subcloning Strategy: Moving Inserts with Only One Common Site You’ve looked for common sites or compatible sites and you can find only one match on one side of your insert. What do you do about the other side of the insert? You can use a method commonly referred to as “cut-blunt-cut”. Any restriction site can be made blunt through the action of T4 DNA Polymerase. Simply digest the parent vector and blunt that site with T4 DNA Polymerase (protocols on page 16), run the products on a gel, purify and proceed with the common or compatible end restriction enzyme digestion. In this example, the destination vector has Sma I site, which leaves a blunt end. Most vectors have at least one blunt-ended restriction site that can accept the newly created blunt end from the insert. If you don’t have such a site or the site would not be in the correct orientation, the same “cut-blunt-cut” strategy may be applied to the destination vector as well. ® pALTER®-1 -1 Vector with Insert The pALTER Vector is ® used with the Altered Sites in vitro …GA ATTC Insert G GATCC TCTAG AGTCG ACCTG CAGGC ATGCA AGCTT… See page 16 EcoR I BamH I Xba I Sal I Pst I Sph I Hind III Site-Directed for T4 DNA Mutagenesis System. Polymerase EcoR I procedure. T4 DNA Polymerase Multiple cloning region of pGL3-Basic Vector AATTC Insert G GATCC TCTAG AGTCG ACCTG CAGGC ATGCA AGCTT… …GGTACCGAGCTCTTACGCGTGCTAGCCCGGGCTCGAGATCTGTAAGCTTGG… TTAAG BamH I Xba I Sal I Pst I Sph I Hind III Kpn I Sac I Mlu I Nhe I Xma I Xho I Bgl II Hind III Acc65 I Sma I Sma I Hind III Hind III CIAP Gel Isolation PO AATTC A 4 CCC OH AGCTTGG TTAAG TTCGA PO 4 GGG OH ACC This may T4 DNA Ligase commonly The cut-blunt-cut strategy can also be used on be referred destination vectors as well.
Load more

Recommended publications
  • Subcloning, Expression, and Enzymatic Study of PRMT5
    Georgia State University ScholarWorks @ Georgia State University Biology Theses Department of Biology Summer 7-12-2010 Subcloning, Expression, and Enzymatic Study of PRMT5 Ran Guo Georgia State University Follow this and additional works at: https://scholarworks.gsu.edu/biology_theses Part of the Biology Commons Recommended Citation Guo, Ran, "Subcloning, Expression, and Enzymatic Study of PRMT5." Thesis, Georgia State University, 2010. https://scholarworks.gsu.edu/biology_theses/26 This Thesis is brought to you for free and open access by the Department of Biology at ScholarWorks @ Georgia State University. It has been accepted for inclusion in Biology Theses by an authorized administrator of ScholarWorks @ Georgia State University. For more information, please contact [email protected]. SUBCLONING, EXPRESSION, AND ENZYMATIC STUDY OF PRMT5 by RAN GUO Under the Direction of Yujun George Zheng ABSTRACT Protein arginine methyltransferases (PRMTs) mediate the transfer of methyl groups to arginine residues in histone and non-histone proteins. PRMT5 is an important member of PRMTs which symmetrically dimethylates arginine 8 in histone H3 (H3R8) and arginine 3 in histone H4 (H4R3). PRMT5 was reported to inhibit some tumor suppressors in leukemia and lymphoma cells and regulate p53 gene, through affecting the promoter of p53. Through methylation of H4R3, PRMT5 can recruit DNA-methyltransferase 3A (DNMT3A) which regulates gene transcription. All the above suggest that PRMT5 has an important function of suppressing cell apoptosis and is a potential anticancer target. Currently, the enzymatic activities of PRMT5 are not clearly understood. In our study, we improved the protein expression methodology and greatly enhanced the yield and quality of the recombinant PRMT5.
    [Show full text]
  • Restriction Endonucleases
    Molecular Biology Problem Solver: A Laboratory Guide. Edited by Alan S. Gerstein Copyright © 2001 by Wiley-Liss, Inc. ISBNs: 0-471-37972-7 (Paper); 0-471-22390-5 (Electronic) 9 Restriction Endonucleases Derek Robinson, Paul R. Walsh, and Joseph A. Bonventre Background Information . 226 Which Restriction Enzymes Are Commercially Available? . 226 Why Are Some Enzymes More Expensive Than Others? . 227 What Can You Do to Reduce the Cost of Working with Restriction Enzymes? . 228 If You Could Select among Several Restriction Enzymes for Your Application, What Criteria Should You Consider to Make the Most Appropriate Choice? . 229 What Are the General Properties of Restriction Endonucleases? . 232 What Insight Is Provided by a Restriction Enzyme’s Quality Control Data? . 233 How Stable Are Restriction Enzymes? . 236 How Stable Are Diluted Restriction Enzymes? . 236 Simple Digests . 236 How Should You Set up a Simple Restriction Digest? . 236 Is It Wise to Modify the Suggested Reaction Conditions? . 237 Complex Restriction Digestions . 239 How Can a Substrate Affect the Restriction Digest? . 239 Should You Alter the Reaction Volume and DNA Concentration? . 241 Double Digests: Simultaneous or Sequential? . 242 225 Genomic Digests . 244 When Preparing Genomic DNA for Southern Blotting, How Can You Determine If Complete Digestion Has Been Obtained? . 244 What Are Your Options If You Must Create Additional Rare or Unique Restriction Sites? . 247 Troubleshooting . 255 What Can Cause a Simple Restriction Digest to Fail? . 255 The Volume of Enzyme in the Vial Appears Very Low. Did Leakage Occur during Shipment? . 259 The Enzyme Shipment Sat on the Shipping Dock for Two Days.
    [Show full text]
  • Experiment 2 Plasmid DNA Isolation, Restriction Digestion and Gel Electrophoresis
    Experiment 2 Plasmid DNA Isolation, Restriction Digestion and Gel Electrophoresis Plasmid DNA isolation introduction: diatomaceous earth. After RNaseA treatment, The application of molecular biology techniques the DNA containing supernatant is bound to the to the analysis of complex genomes depends on diatomaceous earth in a chaotropic buffer, the ability to prepare pure plasmid DNA. Most often guanadine chloride or urea. The plasmid DNA isolation techniques come in two chaotropic buffer will force the silica flavors, simple - low quality DNA preparations (diatomaceous earth) to interact and more complex, time-consuming high quality DNA preparations. For many DNA manipulations such as restriction enzyme analysis, subcloning and agarose gel electrophoresis, the simple methods are sufficient. The high quality preparations are required for most DNA sequencing, PCR manipulations, transformation hydrophobically with the DNA. Purification using and other techniques. silica-technology is based on a simple bind- wash-elute procedure. Nucleic acids are The alkaline lysis preparation is the most adsorbed to the silica-gel membrane in the commonly used method for isolating small presence of high concentrations of amounts of plasmid DNA, often called minipreps. chaotropic salts, which remove water from This method uses SDS as a weak detergent to hydrated molecules in solution. Polysaccharides denature the cells in the presence of NaOH, and proteins do not adsorb and are removed. which acts to hydrolyze the cell wall and other After a wash step, pure nucleic acids are eluted cellular molecules. The high pH is neutralized by under low-salt conditions in small volumes, ready the addition of potassium acetate. The for immediate use without further concentration.
    [Show full text]
  • Gibson Assembly Cloning Guide, Second Edition
    Gibson Assembly® CLONING GUIDE 2ND EDITION RESTRICTION DIGESTFREE, SEAMLESS CLONING Applications, tools, and protocols for the Gibson Assembly® method: • Single Insert • Multiple Inserts • Site-Directed Mutagenesis #DNAMYWAY sgidna.com/gibson-assembly Foreword Contents Foreword The Gibson Assembly method has been an integral part of our work at Synthetic Genomics, Inc. and the J. Craig Venter Institute (JCVI) for nearly a decade, enabling us to synthesize a complete bacterial genome in 2008, create the first synthetic cell in 2010, and generate a minimal bacterial genome in 2016. These studies form the framework for basic research in understanding the fundamental principles of cellular function and the precise function of essential genes. Additionally, synthetic cells can potentially be harnessed for commercial applications which could offer great benefits to society through the renewable and sustainable production of therapeutics, biofuels, and biobased textiles. In 2004, JCVI had embarked on a quest to synthesize genome-sized DNA and needed to develop the tools to make this possible. When I first learned that JCVI was attempting to create a synthetic cell, I truly understood the significance and reached out to Hamilton (Ham) Smith, who leads the Synthetic Biology Group at JCVI. I joined Ham’s team as a postdoctoral fellow and the development of Gibson Assembly began as I started investigating methods that would allow overlapping DNA fragments to be assembled toward the goal of generating genome- sized DNA. Over time, we had multiple methods in place for assembling DNA molecules by in vitro recombination, including the method that would later come to be known as Gibson Assembly.
    [Show full text]
  • Cloning of Gene Coding Glyceraldehyde-3-Phosphate Dehydrogenase Using Puc18 Vector
    Available online a t www.pelagiaresearchlibrary.com Pelagia Research Library European Journal of Experimental Biology, 2015, 5(3):52-57 ISSN: 2248 –9215 CODEN (USA): EJEBAU Cloning of gene coding glyceraldehyde-3-phosphate dehydrogenase using puc18 vector Manoj Kumar Dooda, Akhilesh Kushwaha *, Aquib Hasan and Manish Kushwaha Institute of Transgene Life Sciences, Lucknow (U.P), India _____________________________________________________________________________________________ ABSTRACT The term recombinant DNA technology, DNA cloning, molecular cloning, or gene cloning all refers to the same process. Gene cloning is a set of experimental methods in molecular biology and useful in many areas of research and for biomedical applications. It is the production of exact copies (clones) of a particular gene or DNA sequence using genetic engineering techniques. cDNA is synthesized by using template RNA isolated from blood sample (human). GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) is one of the most commonly used housekeeping genes used in comparisons of gene expression data. Amplify the gene (GAPDH) using primer forward and reverse with the sequence of 5’-TGATGACATCAAGAAGGTGGTGAA-3’ and 5’-TCCTTGGAGGCCATGTGGGCCAT- 3’.pUC18 high copy cloning vector for replication in E. coli, suitable for “blue-white screening” technique and cleaved with the help of SmaI restriction enzyme. Modern cloning vectors include selectable markers (most frequently antibiotic resistant marker) that allow only cells in which the vector but necessarily the insert has been transfected to grow. Additionally the cloning vectors may contain color selection markers which provide blue/white screening (i.e. alpha complementation) on X- Gal and IPTG containing medium. Keywords: RNA isolation; TRIzol method; Gene cloning; Blue/white screening; Agarose gel electrophoresis.
    [Show full text]
  • Digestion of DNA with Restriction Endonucleases 3.1.2
    RESTRICTION ENDONUCLEASES SECTION I Digestion of DNA with Restriction UNIT 3.1 Endonucleases Restriction endonucleases recognize short DNA sequences and cleave double-stranded DNA at specific sites within or adjacent to the recognition sequences. Restriction endonuclease cleavage of DNA into discrete fragments is one of the most basic procedures in molecular biology. The first method presented in this unit is the cleavage of a single DNA sample with a single restriction endonuclease (see Basic Protocol). A number of common applications of this technique are also described. These include digesting a given DNA sample with more than one endonuclease (see Alternate Protocol 1), digesting multiple DNA samples with the same endonuclease (see Alternate Protocol 2), and partially digesting DNA such that cleavage only occurs at a subset of the restriction sites (see Alternate Protocol 3). A protocol for methylating specific DNA sequences and protecting them from restriction endonuclease cleavage is also presented (see Support Protocol). A collection of tables describing restriction endonucleases and their properties (including information about recognition sequences, types of termini produced, buffer conditions, and conditions for thermal inactivation) is given at the end of this unit (see Table 3.1.1, Table 3.1.2, Table 3.1.3, and Table 3.1.4). DIGESTING A SINGLE DNA SAMPLE WITH A SINGLE RESTRICTION BASIC ENDONUCLEASE PROTOCOL Restriction endonuclease cleavage is accomplished simply by incubating the enzyme(s) with the DNA in appropriate reaction conditions. The amounts of enzyme and DNA, the buffer and ionic concentrations, and the temperature and duration of the reaction will vary depending upon the specific application.
    [Show full text]
  • GFP Plasmid) 35X
    Název: Biotechnology and Fluorescent protein Školitel: Ana Maria Jimenez Jimenez, Iva Blažková Datum: 19.7.2013 Reg.č.projektu: CZ.1.07/2.3.00/20.0148 Název projektu: Mezinárodní spolupráce v oblasti "in vivo" zobrazovacích technik INTRODUCTION GFP - Green fluorescent protein A protein composed of 238 amino acid residues (26.9 kDa) exhibits bright green fluorescence when exposed to light in the blue to ultraviolet range GFP was isolated from the jellyfish Aequorea victoria. In cell and molecular biology, the GFP gene is frequently used as a reporter of expression The GFP gene has been introduced and expressed in many bacteria, yeast and other fungi, fish, plant and mammalian cells. Green fluorescent protein (GFP) Nobel prize in Chemistry (2008): for the discovery and development of the green fluorescent protein, GFP Osamu Shimomura Martin Chalfie Roger Y. Tsien Now GFP is found in laboratories all over the world where it is used in every conceivable plant and animal GFP Types Fluorescent proteins enable the creation of highly specific biosensors to monitor a wide range of intracellular phenomena. Mutagenesis of A. victoria GFP has resulted in fluorescent proteins that range in color from blue to yellow Transluminator Fluoresence spectrophotometry Fluorescence In-vivo Xtreme Detection Fluorescence microscopy In-vivo Xtreme cm Polyacrylamide gel In-vivo Xtreme 1/16 1/8 1/4 1/2 1 10000 y = 9003x + 732,46 9000 R² = 0,9984 Max-Backgroumd 8000 7000 Rostoucí koncentrace Mean-Background 6000 5000 4000 3000 y = 5748,2x + 490,64 R² = 0,9995 2000 Fluorescence intensity [a.u.] 1000 0 0 0,2 0,4 0,6 0,8 1 1,2 concentration [µg/ml] In-vivo Xtreme GFP encapsulated GFP in liposome GFP water in liposome Max.int: 8800 a.
    [Show full text]
  • Molecular Biology and Applied Genetics
    MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included.
    [Show full text]
  • Restriction Digest
    PROTOCOL 3: RESTRICTION DIGEST TEACHER VERSION THE GENOME TEACHING GENERATION PROTOCOL 3: RESTRICTION DIGEST PROTOCOL 3: RESTRICTION DIGEST TEACHER VERSION PRE-REQUISITES & GOALS STUDENT PRE-REQUISITES Prior to implementing this lab, students should understand: • The central dogma of how DNA bases code for mRNA and then for proteins • How DNA samples were collected and prepared for PCR • The steps that occur during the process of polymerase change reaction (PCR) • What restriction enzymes are and how they work • How the sequence variants in OXTR and CYP2C19 are affected by restriction enzyme digestion • The purpose of PROTOCOL 3 is to determine genotype STUDENT LEARNING GOALS 1. Perform restriction digestion of PCR products of CYP2C19 and/or OXTR. 2. Describe the possible genotypes for individuals with the CYP2C19 and/or OXTR genes. 3. Predict what each genotype will look like after gel electrophoresis and why. 2 TEACHING THE GENOME GENERATION | THE JACKSON LABORATORY PROTOCOL 3: RESTRICTION DIGEST TEACHER VERSION CURRICULUM INTEGRATION Use the planning notes space provided to reflect on how this protocol will be integrated into your classroom. You’ll find every course is different, and you may need to make changes in your preparation or set-up depending on which course you are teaching. Course name: 1. What prior knowledge do the students need? 2. How much time will this lesson take? 3. What materials do I need to prepare in advance? 4. Will the students work independently, in pairs, or in small groups? 5. What might be challenge points
    [Show full text]
  • (51) International Patent Classification: MC, MK, MT, NL, NO, PL, PT, RO
    ( (51) International Patent Classification: MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, C12Q 1/6811 (2018.01) C40B 40/06 (2006.01) TR), OAPI (BF, BJ, CF, CG, Cl, CM, GA, GN, GQ, GW, C12Q 1/6853 (2018.01) C40B 40/08 (2006.01) KM, ML, MR, NE, SN, TD, TG). C12Q 1/6855 (2018.01) Published: (21) International Application Number: — with international search report (Art. 21(3)) PCT/US20 19/035481 — with sequence listing part of description (Rule 5.2(a)) (22) International Filing Date: 05 June 2019 (05.06.2019) (25) Filing Language: English (26) Publication Language: English (30) Priority Data: 62/680,946 05 June 2018 (05.06.2018) US (71) Applicant: ARRAKIS THERAPEUTICS, INC. [US/US]; 830 Winter Street, Waltham, Massachusetts 0245 1 (US). (72) Inventors: BLAIN, Jonathan Craig; 148 Boston Rock Road, Melrose, Massachusetts 02176 (US). BARSOUM, James Gregory; 6 Moreland Avenue, Lexington, Massa¬ chusetts 02421 (US). KUBICA, Neil; 57 Lincoln House Point, Swampscott, Massachusetts 01907 (US). PETTER, Jennifer C.; 22 Robinwood Land, Stow, Massachusetts 01775 (US). SELETSKY, Alexandra East; 60 Quincy Street, Medford, Massachusetts 02155 (US). (74) Agent: REID, Andrea L.C. et al.; One International Place, 40th Floor, 100 Oliver Street, Boston, Massachusetts 021 10-2605 (US). (81) Designated States (unless otherwise indicated, for every kind of national protection available) : AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW,KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • SNP2RFLP: a Computational Tool to Facilitate Genetic Mapping Using Benchtop Analysis of Snps
    Mamm Genome (2008) 19:687–690 DOI 10.1007/s00335-008-9149-2 SNP2RFLP: a computational tool to facilitate genetic mapping using benchtop analysis of SNPs Wesley A. Beckstead Æ Bryan C. Bjork Æ Rolf W. Stottmann Æ Shamil Sunyaev Æ David R. Beier Received: 9 September 2008 / Accepted: 24 September 2008 / Published online: 29 October 2008 Ó Springer Science+Business Media, LLC 2008 Abstract Genome-wide analysis of single nucleotide Introduction polymorphism (SNP) markers is an extremely efficient means for genetic mapping of mutations or traits in mice. The positional cloning and characterization of mutations in However, this approach often defines a relatively large the mouse is a powerful means for functional annotation of recombinant interval. To facilitate the refinement of this the mammalian genome. Many mouse gene mutations interval, we developed the program SNP2RFLP. This cause phenotypes that serve as models of human genetic program can be used to identify region-specific SNPs in disorders. Mapping and positional cloning of these poten- which the polymorphic nucleotide creates a restriction tially accelerate our understanding of the mouse gene, its fragment length polymorphism (RFLP) that can be readily human ortholog, and the underlying etiology of the disor- assayed at the benchtop using restriction enzyme digestion der. The utilization of single nucleotide polymorphism of SNP-containing PCR products. The program permits (SNP) markers has markedly facilitated genetic mapping user-defined queries that maximize the informative mark- because they are abundant throughout the genome and can ers for a particular application. This facilitates fine- be analyzed in a high-throughput manner using automated mapping in a region containing a mutation of interest, technology (Wang et al.
    [Show full text]
  • Easy Subcloning Prot
    Easy Subcloning by Michael Koelle Subcloning should be easy and fast, and work every time. The following protocols minimize the number of manipulations required to prepare DNA fragments for ligations, thereby both saving time and increasing reliability. Preparation of DNA fragments for ligation. 1. Restriction digests: Always cut a lot of your starting plasmids in a small volume; this will help in the gel purification of your restriction fragments by giving you a high concentration of DNA compared to agarose in your gel slice.. About 1 µg in a 20 µl reaction is good. For double digests: you almost never have to digest with one enzyme, adjust the buffer, and digest with the second. Look in the Biolabs catalogue to find a compromise buffer, and save yourself some time. Don't use just 1 unit of enzyme and wait an hour: your time is worth too much, and the enzymes are cheap and pure. Use about a 10-fold enzyme excess and digest about 30 min. 2. Playing with the ends. Blunting 5' overhangs: Add 1 µl 2 mM all four dNTPs to your 20 µl restriction digest. Add 0.5-1 µl Klenow (2-5 units), and incubate at room temp for 30 min. Blunting 3' overhangs: Add 1 µl 2 mM all four dNTPs to your 20 µl restriction digest. Add 0.5-1 µl T4 DNA polymerase, and incubate at 37° for 5 min. T4 polymerase has a more active 3' to 5' exo activity than Klenow, and so is preferred for this reaction, but Klenow will work.
    [Show full text]