DOCSLIB.ORG

SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficientsmallcelllungcancer Adrian C

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficientsmallcelllungcancer Adrian C Imaging, Diagnosis, Prognosis SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-DeficientSmallCellLungCancer Adrian C. Moss,1, 2 , 3 Gregory M. Jacobson,1Lauren E.Walker,1Neil W. Blake,2 Ernie Marshall,3 and Judy M. Coulson1 Abstract Purpose: Specific markers of circulating tumor cells may be informative in managing lung cancer. Because the RE-1silencing transcription factor (REST/NRSF) is a transcriptional repressor that is inactivated in neuroendocrine lung cancer, we identified REST-regulated transcripts (CHGA, CHGB, SCG3,VGF, and PCSK1) for evaluation as biomarkers in peripheral blood. Experimental Design: Transcripts were screened across lung cancer and normal cell lines. Candidates were assessed by reverse transcription-PCR and hybridization of RNA extracted from the peripheral blood of 111lung cancer patients obtained at clinical presentation and from 27 cancer-free individuals. Results: Expression profiling revealed multiple chromogranin transcripts were readily induced on RESTdepletion, most notably SCG3 was induced >500-fold. The SCG3 transcript was also over- expressed by 12,000-fold in neuroendocrine compared with nonneuroendocrine lung cancer cells. In peripheral blood of lung cancer patients and cancer-free individuals, we found that SCG3 was more tumor-specific and more sensitive than other chromogranin transcripts as a biomarker of circulating tumor cells. Overall, 36% of small cell lung cancer (SCLC) and 16% of non-SCLC patients scored positively for normalized SCG3 transcript. This correlated with worse survival among SCLC patients with limited disease (n =33;P = 0.022) but not extensive disease (n =29;P = 0.459). Interestingly, the subcohort of 6 SCLC patients with resistance to platinum/ etoposide chemotherapy all scored positively for peripheral blood SCG3 transcript (P = 0.022). Conclusions: SCG3 mRNA, a component of the REST-dependent neurosecretory transcrip- tional profile, provides a sensitive prognostic biomarker for noninvasive monitoring of neuro- endocrine lung cancer. Lung cancer is the leading cancer killer in the United States and progression through autocrine growth loops or paracrine the United Kingdom, accounting for 22% of all UK cancer signaling (1, 2). Unlike NSCLC, SCLC are frequently metastatic deaths and ranking highest for both incidence and mortality at presentation so not generally amenable to surgical resection throughout most of the world. It is classified into small cell and, while initially chemosensitive and radiosensitive, the lung cancer (SCLC)or non-SCLC (NSCLC).Thirty-two percent majority rapidly recur. Although multimodality therapies have of lung tumors show a spectrum of neuroendocrine differen- improved the control of this disease (3), the UK 5-year survival tiation, comprising mainly SCLC, together with carcinoids and rate remains at 6%. Biomarkers for SCLC could be exploited to neuroendocrine NSCLC. They express and secrete a variety of characterize primary or metastatic tumor samples but might neuropeptides and hormones that can contribute to tumor more usefully be developed to assay blood or other body fluids to monitor tumors noninvasively. Potential applications include early detection of disease, initial diagnosis, clinical staging, prognosis, prediction of response to specific therapy, or Authors’ Affiliations: 1Physiological Laboratory, School of Biomedical Sciences, monitoring remission and disease progression. and 2Division of Medical Microbiology, University of Liverpool, Liverpool, United The neuroendocrine phenotype of SCLC distinguishes them 3 Kingdom and Clatterbridge Centre for Oncology NHSTrust,Wirral, United Kingdom from most other normal or neoplastic cells in the lung. Received 5/6/08; revised 8/11/08; accepted 9/7/08. Grant support: Clatterbridge Cancer Research Trust grant CCO 2003/01 (A.C. Although routine pathologic diagnosis of SCLC from broncho- Moss, J.M. Coulson, N.W. Blake, and E. Marshall) and Cancer Research UK project scopic biopsies relies on morphologic criteria, there are grant C8737/A3246 (J.M. Coulson and G.M. Jacobson). established immunohistochemical markers like neuron-specific The costs of publication of this article were defrayed in part by the payment of page enolase and neuronal cell adhesion molecule. Serum markers charges. This article must therefore be hereby marked advertisement in accordance for SCLC include the secreted neuropeptides neuron-specific with 18 U.S.C. Section 1734 solely to indicate this fact. Note: Supplementary data for this article are available at Clinical Cancer Research enolase (4, 5), arginine vasopressin (6), gastrin-releasing pep- Online (http://clincancerres.aacrjournals.org/). tide precursors (5), and chromogranin A (CHGA; refs. 5, 7). Requests for reprints: Judy M. Coulson, Physiological Laboratory, School of However, their utility is limited by serum peptide stability, the Biomedical Sciences, University of Liverpool, Crown Street, Liverpool L69 3BX, variability in neuropeptides secreted by individual tumors, and United Kingdom. Phone: 44-151-794-5850; Fax: 44-151-794-4434; E-mail: [email protected]. the secretion of multiple processed peptides. Thus, there are F 2009 American Association for Cancer Research. currently no established serum markers used in prognosis or doi:10.1158/1078-0432.CCR-08-1163 treatment of SCLC patients. Importantly though, shed lung Clin Cancer Res 2009;15(1) January 1, 2009 274 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 mRNA in CTC from Neuroendocrine Lung Cancer with ANP, could contribute to hyponatremia in some SCLC Translational Relevance patients (23). We recently undertook expression profiling in nonneuroendocrine lung cancer cells experimentally depleted There are presently no well-established prognostic or of REST to better annotate the REST regulome in lung cancer.5 predictive biomarkers in SCLC and all patients receive stan- We reasoned that SCLC-associated transcripts, whose elevated dard chemotherapy for what is a heterogeneous disease. expression is triggered by loss of REST, would be potential Although initially chemosensitive, recurrence is often rapid markers of SCLC tumors and should not be expressed in and survival rates are poor. Only a minority of patients with normal blood cells. We therefore screened for several genes limited disease are currently eligible for concurrent chemo- induced in our model5 (CHGA, CHGB, SCG3, VGF and PCSK1) radiotherapy. The ability to detect SCLC biomarkers, such as candidate biomarkers. Despite transcriptional coregulation as SCG3 transcript, in the peripheral blood or other acces- by REST, we found surprisingly diverse expression profiles for sible body fluids could be used for minimally invasive lon- these mRNAs among lung cancer cell lines and in blood of gitudinal monitoring of disease. These have potential cancer-free individuals (CFI). We identified SCG3 as the most applications in early detection, diagnosis, staging, progno- sensitive and specific of these transcripts as a marker for CTC in sis, predicting response to specific therapy, or monitoring SCLC. Furthermore, we found that it is prognostic of worse response, remission, relapse, and disease progression for survival and was evident in patients with poor response to clinical management. Putative predictive factors may aid chemotherapy. clinical trial development around emerging therapies; for example, biomarkers might be useful to monitor the sub- group of patients who would have de novo chemoresist- ance to standard therapy (20-30%). A predictor of poor Materials and Methods response for limited disease patients might advocate alter- native (nonplatinum) chemotherapy; for example, current Cell culture, small interfering RNA treatment, and immunoblotting. trials suggest a role for Amrubicin (anthracycline activity COR-L47, NCI-H727, NCI-H322, NCI-H647, NCI-H2170, MRC5VA (Cancer Research UK Cell Services), SV40 immortalized human and topoisomerase inhibitor) in chemorefractory SCLC at keratinocytes (SVK), HeLa, NCI-H460, A549, and other SCLC (16) relapse. Furthermore, a prognostic factor would arm clini- were cultured in RPMI 1640 or DMEM (Autogen Bioclear)with 10% cians and patients with essential information on individual- bovine calf serum (Pierce)at 37 jC and 5% CO2. Normal human ized treatment options and the required intensity of bronchial epithelial cells (Cambrex BioScience)and BEAS-2B were therapy. We therefore believe that the data reported here maintained in complete small airway growth medium (Cambrex). NCI- have identified SCG3 as a blood biomarker with the poten- H460 cells were transfected by electroporation (Biorad GenepulserII) tial for future development in clinical practice. with 600 pmol of the small interfering RNA (siRNA)sequences: siREST1 (CAACGAAUCUACCCAUAUUUU), siREST5 (CAUCCUA- CUUGUCCUAAUAUU), siCON1 (UAGCGACUAAACACAUCAA), or siCON2 (UAAGGCUAUGAAGAGAUAC; Dharmacon)or no siRNA cancer cells appear in peripheral blood as circulating tumor (mock)as described elsewhere. 5 Cells were harvested at 3 days post- cells (CTC)or micrometastases. CTC mRNA can be extracted transfection for preparation of either protein or RNA. Protein was from the nucleated cell fraction of peripheral blood and the extracted by direct cell lysis in 2Â Laemmli sample buffer and distinct transcriptional profile of SCLC provides candidate quantified by BCA assay (Pierce). DTT was then added and samples mRNAs for development of specific
Load more

Recommended publications
  • The Hypothalamus in Schizophrenia Research: No Longer a Wallflower Existence
    The Open Neuroendocrinology Journal, 2010, 3, 59-67 59 Open Access The Hypothalamus in Schizophrenia Research: No Longer a Wallflower Existence Hans-Gert Bernstein*,1, Gerburg Keilhoff 2, Johann Steiner1, Henrik Dobrowolny1 and Bernhard Bogerts1 1Department of Psychiatry and 2Institute of Biochemistry and Cell Biology, Otto v. Guericke University Magdeburg, Leipziger Str. 44, D-39120 Magdeburg, Germany Abstract: The hypothalamus is commonly believed to play only a subordinated role in schizophrenia. The present review attempts at condensing findings of the last two decades showing that hypothalamus is involved in many pathways found disturbed in schizophrenia (hypothalamus-pituitary- axis, hypothalamus-pituitary-thyroid axis, hypothalamus-pituitary- gonadal axis, metabolic syndrome, sleep-wakefulness cycle, and neuroimmune dysfunction). On the basis of this knowl- edge it is suggested to reconsider the place of the hypothalamus in the puzzle of schizophrenia. Keywords: Hypothalamus, schizophrenia, hippocampus, depression, stress, neuroendocrinology, neuroimmunology. 1. INTRODUCTION to be less, or even only marginally, affected in schizophre- nia. Until recently, the hypothalamus is thought to belong to Schizophrenia is a severe, chronic brain disorder afflict- the latter group. With this review we try to show that this ing about 1% percent of the population. The disease mainly important brain region is in many ways involved in the impairs multiple cognitive domains including memory, at- pathophysiology of schizophrenia, and that we therefore tention and executive function, and typically produces a life- should reconsider the place of the hypothalamus in the puz- time of disability and severe emotional distress for affected zle of schizophrenia. individuals [1]. The clinical features of the disorder appear in the second to third decade of life.
    [Show full text]
  • Endogenous Peptide Discovery of the Rat Circadian Clock a FOCUSED STUDY of the SUPRACHIASMATIC NUCLEUS by ULTRAHIGH PERFORMANCE TANDEM MASS □ SPECTROMETRY* S
    Research Endogenous Peptide Discovery of the Rat Circadian Clock A FOCUSED STUDY OF THE SUPRACHIASMATIC NUCLEUS BY ULTRAHIGH PERFORMANCE TANDEM MASS □ SPECTROMETRY* S Ji Eun Lee‡§, Norman Atkins, Jr.¶, Nathan G. Hatcherʈ, Leonid Zamdborg‡§, Martha U. Gillette§¶**, Jonathan V. Sweedler‡§¶ʈ, and Neil L. Kelleher‡§‡‡ Understanding how a small brain region, the suprachias- pyroglutamylation, or acetylation. These aspects of peptide matic nucleus (SCN), can synchronize the body’s circa- synthesis impact the properties of neuropeptides, further ex- dian rhythms is an ongoing research area. This important panding their diverse physiological implications. Therefore, time-keeping system requires a complex suite of peptide unveiling new peptides and unreported peptide properties is hormones and transmitters that remain incompletely critical to advancing our understanding of nervous system characterized. Here, capillary liquid chromatography and function. FTMS have been coupled with tailored software for the Historically, the analysis of neuropeptides was performed analysis of endogenous peptides present in the SCN of the rat brain. After ex vivo processing of brain slices, by Edman degradation in which the N-terminal amino acid is peptide extraction, identification, and characterization sequentially removed. However, analysis by this method is from tandem FTMS data with <5-ppm mass accuracy slow and does not allow for sequencing of the peptides con- produced a hyperconfident list of 102 endogenous pep- taining N-terminal PTMs (5). Immunological techniques, such tides, including 33 previously unidentified peptides, and as radioimmunoassay and immunohistochemistry, are used 12 peptides that were post-translationally modified with for measuring relative peptide levels and spatial localization, amidation, phosphorylation, pyroglutamylation, or acety- but these methods only detect peptide sequences with known lation.
    [Show full text]
  • Changes of Tlqp-21 in Response to Glucose Load
    bioRxiv preprint doi: https://doi.org/10.1101/626283; this version posted May 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. CHANGES OF TLQP-21 IN RESPONSE TO GLUCOSE LOAD Giulia Corda1, Barbara Noli1, Barbara Manconi2, Carla Brancia1, Manuela Pellegrini3, Fabio Naro3, Gian-Luca Ferri1 and Cristina Cocco1 1NEF-Laboratory, Department of Biomedical Sciences, University of Cagliari, Monserrato (CA), Italy2 Department of Life and Enviromental Sciences, University of Cagliari, Monserrato (CA), Italy 3Department of Anatomical, Istological and Legal medicine Sciences of the locomotor apparatus, University of “La Sapienza’, Roma, Italy Abstract 5 The TLQP-21 peptide peripherally potentiates glucose-stimulated insulin secretion. The aim of this study was to investigate a possible endocrine mechanism through which TLQP- 21 increases the insulin secretion. Using an antibody specific for the common N-terminal portion of the TLQP peptides, we studied pancreas and plasma of mice subjected to intraperitoneal glucose load, by immunohistochemistry and immunosorbent assay (ELISA), 10 alone or coupled to High Performance Liquid Chromatography (HLPC). Mice underwent a period of starvation hence have received a glucose load, or saline, and were sacrificed 30 or 120 minutes later. In normal endocrine pancreas, the TLQP-antiserum stained either peripheral or central cells. Interestingly, 30 min after a glucose load, TLQP immunostaining was disappeared in pancreas and, when analysed by ELISA, the TLQP-levels started to 15 increase in plasma reaching peak concentration at 120 min.
    [Show full text]
  • RNA Sequencing Analysis Reveals the Gnrh Induced Citrullinome
    Authors Michelle A. Londe, Kenneth G. Gerow, Amy M. Navratil, Shaihla A. Khan, Brian S. Edwards, Paul R. Thompson, John Diller, Kenneth L. Jones, and Brian D. Cherrington This dissertation/thesis is available at Wyoming Scholars Repository: http://repository.uwyo.edu/honors_theses_15-16/48 Londe 1 RNA sequencing analysis reveals the GnRH induced citrullinome Michelle A. Londe1, Shaihla A. Khan2, Brian S. Edwards2, Paul R. Thompson3, John Diller4, Kenneth L. Jones4, Kenneth G. Gerow1, Brian D. Cherrington2, Amy M. Navratil2 1Department of Statistics, University of Wyoming, Laramie, Wyoming, 82071 2Department of Zoology and Physiology, University of Wyoming, Laramie, Wyoming, 82071 3University of Massachusetts Medical School, Department of Biochemistry and Molecular Pharmacology, Worcester, MA, United States of America 4 Department of Biochemistry and Molecular Genetics, University of Colorado, Anschutz campus, Aurora, 80045. Key words: histone modification, peptidylarginine deiminase, gene regulation, RNA-sequencing Londe 2 Secretion of gonadotropin releasing hormone (GnRH) from the hypothalamus is critical for the secretion of the gonadotropins luteinizing hormone (LH) and follicle stimulating hormone (FSH). GnRH binds to its receptors on the plasma membrane of anterior pituitary gonadotropes and stimulates the release of these hormones. LH is crucial for regulating the function of the testes in men and the ovaries in women. In women, LH is important in carrying out functions in women’s menstrual cycles and stimulates the release of progesterone if pregnancy occurs.1 FSH is also important for reproduction, with its main roles also responsible for the maintenance of the menstrual cycle, release of estrogen and progesterone, as well as the growth of ovarian follicles.2 Given the essential role of gonadotropin production to fertility, major effort has gone into defining the mechanisms initiated by GnRH to regulate gonadotropin gene expression at the promoter/transcription factor level.
    [Show full text]
  • Selective Expression of TLQP-21 and Other VGF Peptides in Gastric Neuroendocrine Cells and Modulation by Feeding
    329 Selective expression of TLQP-21 and other VGF peptides in gastric neuroendocrine cells and modulation by feeding Carla Brancia1, Cristina Cocco1, Filomena D’Amato1, Barbara Noli1, Fabrizio Sanna2, Roberta Possenti3, Antonio Argiolas2 and Gian-Luca Ferri1 1NEF-Laboratory, Department of Cytomorphology and 2Department of Neuroscience, University of Cagliari, 09042 Monserrato (Cagliari), Italy 3Institute of Neurobiology and Molecular Medicine, CNR, and Department of Neuroscience, Tor Vergata University, 00133 Rome, Italy (Correspondence should be addressed to G-L Ferri; Email: [email protected]) Abstract Although vgf gene knockout mice are hypermetabolic, confined to neurons. VGF mRNA was present in the above administration of the VGF peptide TLQP-21 itself increased gastric endocrine cell types, and was prominent in chief cells, energy consumption. Agonist–antagonist roles are thus in parallel with low-intensity staining for further cleaved suggested for different VGF peptides, and the definition of products from the C-terminal region of VGF (HVLL their tissue heterogeneity is mandatory. We studied the rat peptides: VGF605–614). In swine stomach, a comparable stomach using antisera to C- or N-terminal sequences of profile of VGF peptides was revealed by immunohistochem- known or predicted VGF peptides in immunohistochemistry istry. When fed and fasted rats were studied, a clear-cut, and ELISA. TLQP (rat VGF556–565) peptide/s were most selective decrease on fasting was observed for TLQP peptides abundant (162G11 pmol/g, meanGS.E.M.) and were brightly only (162G11 vs 74G5.3 pmol/g, fed versus fasted rats, immunostained in enterochromaffin-like (ECL) cells and meanGS.E.M., P!0.00001). In conclusion, specific VGF somatostatin cells.
    [Show full text]
  • Reduced Serum VGF Levels Are Linked with Suicide Risk in Chinese Han
    Li et al. BMC Psychiatry (2020) 20:225 https://doi.org/10.1186/s12888-020-02634-9 RESEARCH ARTICLE Open Access Reduced serum VGF levels are linked with suicide risk in Chinese Han patients with major depressive disorder Xingxing Li1†, Huifei Ge2†, Dongsheng Zhou1†, Xiangping Wu1†, Gangqiao Qi2, Zan Chen1, Chang Yu1, Yuanyuan Zhang1, Haihang Yu1 and Chuang Wang3* Abstract Background: VGF (nonacronymic) is a neuropeptide that plays an important role in the pathogenesis of major depressive disorder (MDD). However, no studies have yet investigated VGF levels in patients with MDD who are at risk of suicide. The purpose of the present study was to determine whether serum VGF levels are related to suicide risk in patients with MMD. Methods: A total of 107 patients with MDD and 40 normal control participated in the present study. The risk of suicide was assessed using the Nurses Global Assessment of Suicide Risk (NGASR). On this basis, 60 patients were assigned to a high-risk group (NGASR≥9) and 47 were assigned to a low-risk group (NGASR< 9). The severity of depression was measured using the 17-item Hamilton Depression Rating Scale (HDRS). Levels of serum VGF were determined using a double antibody sandwich enzyme-linked immunosorbent assay. Results: Serum VGF levels in the high-risk group (883.34 ± 139.67 pg/mL) were significantly lower than in the low- risk group (1020.56 ± 131.76 pg/mL) and in the control group (1107.00 ± 155.38 pg/mL) (F = 31.90, p < 0.001). In patients with MDD, suicide risk was significantly negatively correlated with VGF levels (r = − 0.55, p = 0.001).
    [Show full text]
  • Neuroendocrine Role for VGF
    REVIEW ARTICLE published: 02 February 2015 doi: 10.3389/fendo.2015.00003 Neuroendocrine role for VGF 1 2 2 Jo E. Lewis , John M. Brameld and Preeti H. Jethwa * 1 Queen’s Medical Centre, School of Life Sciences, University of Nottingham Medical School, Nottingham, UK 2 Division of Nutritional Sciences, School of Biosciences, University of Nottingham, Loughborough, UK Edited by: The vgf gene (non-acronymic) is highly conserved and was identified on the basis of its Hubert Vaudry, University of Rouen, rapid induction in vitro by nerve growth factor, although can also be induced by brain- France derived neurotrophic factor, and glial-derived growth factor. The VGF gene gives rise to a Reviewed by: Alena Sumova, Academy of Sciences 68 kDa precursor polypeptide, which is induced robustly, relatively selectively and is syn- of the Czech Republic, Czech Republic thesized exclusively in neuronal and neuroendocrine cells. Post-translational processing by Ruud Buijs, Universidad Autónoma de neuroendocrine specific prohormone convertases in these cells results in the production of México, Mexico a number of smaller peptides.TheVGF gene and peptides are widely expressed throughout *Correspondence: the brain, particularly in the hypothalamus and hippocampus, in peripheral tissues including Preeti H. Jethwa, Division of Nutritional Sciences, School of the pituitary gland, the adrenal glands, and the pancreas, and in the gastrointestinal tract in Biosciences, University of both the myenteric plexus and in endocrine cells. VGF peptides have been associated with Nottingham, Sutton Bonington a number of neuroendocrine roles, and in this review, we aim to describe these roles to Campus, Loughborough, LE12 5RD, highlight the importance of VGF as therapeutic target for a number of disorders, particularly UK e-mail: preeti.jethwa@nottingham.
    [Show full text]
  • Expression of VGF Mrna in Developing Neuroendocrine and Endocrine Tissues
    227 Expression of VGF mRNA in developing neuroendocrine and endocrine tissues S E Snyder1, B Peng3, J E Pintar3 and S R J Salton1,2 1Fishberg Research Center for Neurobiology, Mount Sinai School of Medicine, New York, New York 10029, USA 2Department of Geriatrics, Mount Sinai School of Medicine, New York, New York 10029, USA 3Department of Neuroscience and Cell Biology, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854, USA (Requests for offprints should be addressed toSRJSalton,Fishberg Research Center for Neurobiology, Box 1065, Mount Sinai School of Medicine, One Gustave L Levy Place, New York, NY 10029-6945, USA; Email: [email protected]) (S E Snyder is currently at Department of Pediatrics, Division of Child Neurology, New York Presbyterian Hospital, Weill Cornell Medical Center, 525E. 68th St., New York, New York 10021, USA) Abstract Analysis of knockout mice suggests that the neurotropin- CNS and PNS have been completed, little is known about inducible secreted polypeptide VGF (non-acronymic) the ontogeny of VGF expression in endocrine and neuro- plays an important role in the regulation of energy balance. endocrine tissues. Here, we report that VGF mRNA is VGF is synthesized by neurons in the central and periph- detectable as early as embryonic day 15·5 in the develop- eral nervous systems (CNS, PNS), as well as in the adult ing rat gastrointestinal and esophageal lumen, pancreas, pituitary, adrenal medulla, endocrine cells of the stomach adrenal, and pituitary, and we further demonstrate that and pancreatic beta cells. Thus VGF, like cholecystokinin, VGF mRNA is synthesized in the gravid rat uterus, leptin, ghrelin and other peptide hormones that have been together supporting possible functional roles for this shown to regulate feeding and energy expenditure, is polypeptide outside the nervous system and in the enteric synthesized in both the gut and the brain.
    [Show full text]
  • Rfx6 Promotes the Differentiation of Peptide-Secreting Enteroendocrine Cells While Repressing Genetic Programs Controlling Serotonin Production
    bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Rfx6 promotes the differentiation of peptide-secreting enteroendocrine cells while repressing genetic programs controlling serotonin production Julie Piccand1,2,3,4#, Constance Vagne1,2,3,4#, Florence Blot1,2,3,4#, Aline Meunier1,2,3,4, Anthony Beucher1,2,3,4, Perrine Strasser1,2,3,4, Mari L. Lund5, Sabitri Ghimire1,2,3,4, Laure Nivlet1,2,3,4, Céline Lapp1,2,3,4, Natalia Petersen5, MaJa S. Engelstoft5, Christelle Thibault-Carpentier1,2,3,4, Céline Keime 1,2,3,4 , Sara Jimenez Correa1,2,3,4, Valérie Schreiber1,2,3,4, Nacho Molina1,2,3,4, Thue W. Schwartz5, Adèle De Arcangelis1,2,3,4* and Gérard Gradwohl1,2,3,4* 1Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC), 2Institut National de la Santé et de la Recherche Médicale (INSERM) U1258, 3Centre National de Recherche Scientifique (CNRS) UMR7104, 4Université de Strasbourg, 1 rue Laurent Fries, 67404 Illkirch, France. 5Centre for Metabolic Receptology, Novo Nordisk Foundation Center for Basic Metabolic Research, Faculty of Health Science, University of Copenhagen, Denmark. # contributed equally * Corresponding authors: Gérard Gradwohl or Adèle De Arcangelis 1 Rue Laurent Fries, 67404 Illkirch, France, Phone: 0033 3 88 65 33 12, Fax: 0033 3 88 65 32 01, email: [email protected]; [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/704924; this version posted July 19, 2019.
    [Show full text]
  • Vasoactive Intestinal Peptide Controls the Suprachiasmatic Circadian Clock Network Via ERK1/2 and DUSP4 Signalling
    ARTICLE https://doi.org/10.1038/s41467-019-08427-3 OPEN Vasoactive intestinal peptide controls the suprachiasmatic circadian clock network via ERK1/2 and DUSP4 signalling Ryan Hamnett 1,2, Priya Crosby1, Johanna E. Chesham1 & Michael H. Hastings 1 The suprachiasmatic nucleus (SCN) co-ordinates circadian behaviour and physiology in mammals. Its cell-autonomous circadian oscillations pivot around a well characterised tran- 1234567890():,; scriptional/translational feedback loop (TTFL), whilst the SCN circuit as a whole is syn- chronised to solar time by its retinorecipient cells that express and release vasoactive intestinal peptide (VIP). The cell-autonomous and circuit-level mechanisms whereby VIP synchronises the SCN are poorly understood. We show that SCN slices in organotypic culture demonstrate rapid and sustained circuit-level circadian responses to VIP that are mediated at a cell-autonomous level. This is accompanied by changes across a broad transcriptional network and by significant VIP-directed plasticity in the internal phasing of the cell- autonomous TTFL. Signalling via ERK1/2 and tuning by its negative regulator DUSP4 are critical elements of the VIP-directed circadian re-programming. In summary, we provide detailed mechanistic insight into VIP signal transduction in the SCN at the level of genes, cells and neural circuit. 1 MRC Laboratory of Molecular Biology, Francis Crick Ave, Cambridge CB2 0QH, UK. 2Present address: Department of Neurosurgery, Stanford University, 318 Campus Drive, Stanford, CA 94305, USA. Correspondence and requests for materials should be addressed to M.H.H. (email: [email protected]) NATURE COMMUNICATIONS | (2019) 10:542 | https://doi.org/10.1038/s41467-019-08427-3 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-08427-3 ircadian (~24 h) rhythms are intrinsic biological oscilla- VIP signal transduction, particularly via the ERK1/2 cascade.
    [Show full text]
  • The Role of Neuropeptides in Suicidal Behavior: a Systematic Review
    Hindawi Publishing Corporation BioMed Research International Volume 2013, Article ID 687575, 22 pages http://dx.doi.org/10.1155/2013/687575 Review Article The Role of Neuropeptides in Suicidal Behavior: A Systematic Review Gianluca Serafini,1 Maurizio Pompili,1 Daniel Lindqvist,2 Yogesh Dwivedi,3 and Paolo Girardi1 1 Department of Neurosciences, Mental Health and Sensory Organs, Suicide Prevention Center, Sant’Andrea Hospital, SapienzaUniversityofRome,1035-1039ViadiGrottarossa,00189Rome,Italy 2 Department of Clinical Sciences, Section of Psychiatry,LundUniversity,SE-22185Lund,Sweden 3 Psychiatric Institute, Department of Psychiatry, College of Medicine, University of Illinois at Chicago, Chicago, IL 60612, USA Correspondence should be addressed to Gianluca Serafini; [email protected] Received 27 April 2013; Revised 1 July 2013; Accepted 3 July 2013 Academic Editor: Rajnish Chaturvedi Copyright © 2013 Gianluca Serafini et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. There is a growing evidence that neuropeptides may be involved in the pathophysiology of suicidal behavior. A critical review of the literature was conducted to investigate the association between neuropeptides and suicidal behavior. Only articles from peer-reviewed journals were selected for the inclusion in the present review. Twenty-six articles were assessed for eligibility but only 22 studies were included. Most studies have documented an association between suicidality and some neuropeptides such as corticotropin-releasing factor (CRF), VGF, cholecystokinin, substance P, and neuropeptide Y (NPY), which have been demonstrated to act as key neuromodulators of emotional processing. Significant differences in neuropeptides levels have been found in those who have attempted or completed suicide compared with healthy controls or those dying from other causes.
    [Show full text]
  • Selective Expression of TLQP-21 and Other VGF Peptides in Gastric Neuroendocrine Cells and Modulation by Feeding
    329 Selective expression of TLQP-21 and other VGF peptides in gastric neuroendocrine cells and modulation by feeding Carla Brancia1, Cristina Cocco1, Filomena D’Amato1, Barbara Noli1, Fabrizio Sanna2, Roberta Possenti3, Antonio Argiolas2 and Gian-Luca Ferri1 1NEF-Laboratory, Department of Cytomorphology and 2Department of Neuroscience, University of Cagliari, 09042 Monserrato (Cagliari), Italy 3Institute of Neurobiology and Molecular Medicine, CNR, and Department of Neuroscience, Tor Vergata University, 00133 Rome, Italy (Correspondence should be addressed to G-L Ferri; Email: [email protected]) Abstract Although vgf gene knockout mice are hypermetabolic, confined to neurons. VGF mRNA was present in the above administration of the VGF peptide TLQP-21 itself increased gastric endocrine cell types, and was prominent in chief cells, energy consumption. Agonist–antagonist roles are thus in parallel with low-intensity staining for further cleaved suggested for different VGF peptides, and the definition of products from the C-terminal region of VGF (HVLL their tissue heterogeneity is mandatory. We studied the rat peptides: VGF605–614). In swine stomach, a comparable stomach using antisera to C- or N-terminal sequences of profile of VGF peptides was revealed by immunohistochem- known or predicted VGF peptides in immunohistochemistry istry. When fed and fasted rats were studied, a clear-cut, and ELISA. TLQP (rat VGF556–565) peptide/s were most selective decrease on fasting was observed for TLQP peptides abundant (162G11 pmol/g, meanGS.E.M.) and were brightly only (162G11 vs 74G5.3 pmol/g, fed versus fasted rats, immunostained in enterochromaffin-like (ECL) cells and meanGS.E.M., P!0.00001). In conclusion, specific VGF somatostatin cells.
    [Show full text]