SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficientsmallcelllungcancer Adrian C

Imaging, Diagnosis, Prognosis

SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-DeficientSmallCellLungCancer Adrian C. Moss,1, 2 , 3 Gregory M. Jacobson,1Lauren E.Walker,1Neil W. Blake,2 Ernie Marshall,3 and Judy M. Coulson1

Abstract Purpose: Specific markers of circulating tumor cells may be informative in managing lung cancer. Because the RE-1silencing transcription factor (REST/NRSF) is a transcriptional repressor that is inactivated in neuroendocrine lung cancer, we identified REST-regulated transcripts (CHGA, CHGB, SCG3,VGF, and PCSK1) for evaluation as biomarkers in peripheral blood. Experimental Design: Transcripts were screened across lung cancer and normal cell lines. Candidates were assessed by reverse transcription-PCR and hybridization of RNA extracted from the peripheral blood of 111lung cancer patients obtained at clinical presentation and from 27 cancer-free individuals. Results: Expression profiling revealed multiple chromogranin transcripts were readily induced on RESTdepletion, most notably SCG3 was induced >500-fold. The SCG3 transcript was also over- expressed by 12,000-fold in neuroendocrine compared with nonneuroendocrine lung cancer cells. In peripheral blood of lung cancer patients and cancer-free individuals, we found that SCG3 was more tumor-specific and more sensitive than other chromogranin transcripts as a biomarker of circulating tumor cells. Overall, 36% of small cell lung cancer (SCLC) and 16% of non-SCLC patients scored positively for normalized SCG3 transcript. This correlated with worse survival among SCLC patients with limited disease (n =33;P = 0.022) but not extensive disease (n =29;P = 0.459). Interestingly, the subcohort of 6 SCLC patients with resistance to platinum/ etoposide chemotherapy all scored positively for peripheral blood SCG3 transcript (P = 0.022). Conclusions: SCG3 mRNA, a component of the REST-dependent neurosecretory transcriptional profile, provides a sensitive prognostic biomarker for noninvasive monitoring of neuroendocrine lung cancer.

Lung cancer is the leading cancer killer in the United States and progression through autocrine growth loops or paracrine the United Kingdom, accounting for 22% of all UK cancer signaling (1, 2). Unlike NSCLC, SCLC are frequently metastatic deaths and ranking highest for both incidence and mortality at presentation so not generally amenable to surgical resection throughout most of the world. It is classified into small cell and, while initially chemosensitive and radiosensitive, the lung cancer (SCLC)or non-SCLC (NSCLC).Thirty-two percent majority rapidly recur. Although multimodality therapies have of lung tumors show a spectrum of neuroendocrine differen- improved the control of this disease (3), the UK 5-year survival tiation, comprising mainly SCLC, together with carcinoids and rate remains at 6%. Biomarkers for SCLC could be exploited to neuroendocrine NSCLC. They express and secrete a variety of characterize primary or metastatic tumor samples but might neuropeptides and hormones that can contribute to tumor more usefully be developed to assay blood or other body fluids to monitor tumors noninvasively. Potential applications include early detection of disease, initial diagnosis, clinical staging, prognosis, prediction of response to specific therapy, or Authors’ Affiliations: 1Physiological Laboratory, School of Biomedical Sciences, monitoring remission and disease progression. and 2Division of Medical Microbiology, University of Liverpool, Liverpool, United The neuroendocrine phenotype of SCLC distinguishes them 3 Kingdom and Clatterbridge Centre for Oncology NHSTrust,Wirral, United Kingdom from most other normal or neoplastic cells in the lung. Received 5/6/08; revised 8/11/08; accepted 9/7/08. Grant support: Clatterbridge Cancer Research Trust grant CCO 2003/01 (A.C. Although routine pathologic diagnosis of SCLC from broncho- Moss, J.M. Coulson, N.W. Blake, and E. Marshall) and Cancer Research UK project scopic biopsies relies on morphologic criteria, there are grant C8737/A3246 (J.M. Coulson and G.M. Jacobson). established immunohistochemical markers like neuron-specific The costs of publication of this article were defrayed in part by the payment of page enolase and neuronal cell adhesion molecule. Serum markers charges. This article must therefore be hereby marked advertisement in accordance for SCLC include the secreted neuropeptides neuron-specific with 18 U.S.C. Section 1734 solely to indicate this fact. Note: Supplementary data for this article are available at Clinical Cancer Research enolase (4, 5), arginine vasopressin (6), gastrin-releasing pep- Online (http://clincancerres.aacrjournals.org/). tide precursors (5), and chromogranin A (CHGA; refs. 5, 7). Requests for reprints: Judy M. Coulson, Physiological Laboratory, School of However, their utility is limited by serum peptide stability, the Biomedical Sciences, University of Liverpool, Crown Street, Liverpool L69 3BX, variability in neuropeptides secreted by individual tumors, and United Kingdom. Phone: 44-151-794-5850; Fax: 44-151-794-4434; E-mail: [email protected]. the secretion of multiple processed peptides. Thus, there are F 2009 American Association for Cancer Research. currently no established serum markers used in prognosis or doi:10.1158/1078-0432.CCR-08-1163 treatment of SCLC patients. Importantly though, shed lung

Clin Cancer Res 2009;15(1) January 1, 2009 274 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 mRNA in CTC from Neuroendocrine Lung Cancer

with ANP, could contribute to hyponatremia in some SCLC Translational Relevance patients (23). We recently undertook expression profiling in nonneuroendocrine lung cancer cells experimentally depleted There are presently no well-established prognostic or of REST to better annotate the REST regulome in lung cancer.5 predictive biomarkers in SCLC and all patients receive stan- We reasoned that SCLC-associated transcripts, whose elevated dard chemotherapy for what is a heterogeneous disease. expression is triggered by loss of REST, would be potential Although initially chemosensitive, recurrence is often rapid markers of SCLC tumors and should not be expressed in and survival rates are poor. Only a minority of patients with normal blood cells. We therefore screened for several genes limited disease are currently eligible for concurrent chemo- induced in our model5 (CHGA, CHGB, SCG3, VGF and PCSK1) radiotherapy. The ability to detect SCLC biomarkers, such as candidate biomarkers. Despite transcriptional coregulation as SCG3 transcript, in the peripheral blood or other acces- by REST, we found surprisingly diverse expression profiles for sible body fluids could be used for minimally invasive lon- these mRNAs among lung cancer cell lines and in blood of gitudinal monitoring of disease. These have potential cancer-free individuals (CFI). We identified SCG3 as the most applications in early detection, diagnosis, staging, progno- sensitive and specific of these transcripts as a marker for CTC in sis, predicting response to specific therapy, or monitoring SCLC. Furthermore, we found that it is prognostic of worse response, remission, relapse, and disease progression for survival and was evident in patients with poor response to clinical management. Putative predictive factors may aid chemotherapy. clinical trial development around emerging therapies; for example, biomarkers might be useful to monitor the subgroup of patients who would have de novo chemoresist- ance to standard therapy (20-30%). A predictor of poor Materials and Methods response for limited disease patients might advocate alternative (nonplatinum) chemotherapy; for example, current Cell culture, small interfering RNA treatment, and immunoblotting. trials suggest a role for Amrubicin (anthracycline activity COR-L47, NCI-H727, NCI-H322, NCI-H647, NCI-H2170, MRC5VA (Cancer Research UK Cell Services), SV40 immortalized human and topoisomerase inhibitor) in chemorefractory SCLC at keratinocytes (SVK), HeLa, NCI-H460, A549, and other SCLC (16) relapse. Furthermore, a prognostic factor would arm clini- were cultured in RPMI 1640 or DMEM (Autogen Bioclear)with 10% cians and patients with essential information on individual- bovine calf serum (Pierce)at 37 jC and 5% CO2. Normal human ized treatment options and the required intensity of bronchial epithelial cells (Cambrex BioScience)and BEAS-2B were therapy. We therefore believe that the data reported here maintained in complete small airway growth medium (Cambrex). NCI- have identified SCG3 as a blood biomarker with the poten- H460 cells were transfected by electroporation (Biorad GenepulserII) tial for future development in clinical practice. with 600 pmol of the small interfering RNA (siRNA)sequences: siREST1 (CAACGAAUCUACCCAUAUUUU), siREST5 (CAUCCUA- CUUGUCCUAAUAUU), siCON1 (UAGCGACUAAACACAUCAA), or siCON2 (UAAGGCUAUGAAGAGAUAC; Dharmacon)or no siRNA cancer cells appear in peripheral blood as circulating tumor (mock)as described elsewhere. 5 Cells were harvested at 3 days post- cells (CTC)or micrometastases. CTC mRNA can be extracted transfection for preparation of either protein or RNA. Protein was from the nucleated cell fraction of peripheral blood and the extracted by direct cell lysis in 2Â Laemmli sample buffer and distinct transcriptional profile of SCLC provides candidate quantified by BCA assay (Pierce). DTT was then added and samples mRNAs for development of specific and sensitive biomarkers to were denatured. Protein (20 Ag)was resolved on 8% SDS-PAGE gels distinguish them from normal circulatory blood cells. Previous andtransferredtoBiotraceNTmembrane(VWRInternational). studies reported that transcripts for the neuropeptides CHGA Replicate blots were probed with anti-REST (Upstate)or anti-actin (8), prepro-gastrin-releasing peptide (9, 10), arginine vasopres- (Sigma)antibodies. Proteins were visualized using SuperSignal West sin,4 or the neuromedin B receptor (11)were detected in blood (Pierce). RNA preparation and reverse transcription-PCR from cultured from 52%, 50%, 21%, and 32% of SCLC patients, respectively. cells. Total RNA was prepared from untreated cell lines or NCI- However, only marginal association with survival and no H460 cells transfected with siRNA. Each PCR primer pair flanked an correlation with treatment outcome were found. intron, and where appropriate, the reverse primer recognized the exon The RE-1 silencing transcription factor (REST/NRSF; refs. 12, harboring an Affymetrix probe set. Sequences used to design primers 13)is a repressor of neuronal and neuroendocrine genes in were CGHA (NM_001275; ref. 8), CHGB (NM_001819.1), PCSK1 nonneuronal cells and functions by recruiting corepressors (NM_000439.3), SCG3 (NM_013243), VGF (NM_003378), PCSK2 through two distinct domains. It is widely expressed in cells (NM_002594.2), and SCG2 (NM_003469). cDNA (100 AL)was first outside the nervous system, including lymphocytes. However, it synthesized from 1 Ag total RNA by reverse transcription (Promega). A is differentially expressed in neuroblastoma, medulloblastoma, For semiquantitative reverse transcription-PCR (RT-PCR), 3 L cDNA or SCLC, prostate, breast, and colorectal cancers (reviewed in refs. reverse transcriptase-negative control were amplified with HotStar Taq (Qiagen)using standardized reaction conditions and optimized cycle 14, 15). In SCLC, REST is depleted and alternative splicing numbers (35 cycles for VGF and 40 cycles for other genes). Electro- produces a sNRSF/REST4 isoform lacking one repression phoresed PCR products were imaged at nonsaturating levels (Geneflash; domain (1, 16–19); furthermore, REST corepressors are lost Syngene)relative to GAPDH amplicons (25 cycles).Quantitative in neuroendocrine NSCLC (20). REST contributes to transcrip- real-time RT-PCR (QPCR)was done in triplicate with 1 AL cDNA, tional regulation of arginine vasopressin (21), a commonly 300 nmol primers, and IQ SYBR Green Supermix using an IQ5 real- detected neuropeptide mRNA in SCLC (22)which, together time PCR detection system (Bio-Rad). Samples underwent 40 cycles of

5 G.M. Jacobson, B.S. Lane, L.E.Walker, J.M. Coulson. REST/NRSF controls neuro- 4 S.Ahmed,J.M.Coulson,andP.J.Woll,unpublisheddata. endocrine and oncogenic transcriptional programs in lung cancer. In preparation.

www.aacrjournals.org 275 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. Imaging, Diagnosis, Prognosis amplification at 94jC (30 s)and 60 jC (60 s), fluorescence was read at g-32P end-labeled oligonucleotide (ACTACTTAATCTCGGCCTTATCA- 60jC, and melt curves analyzed. For each sample, the Ct values for test CAGAAAGCCAAGCA)spanning exon 5/6 of SCG3 (NM_013243). genes were normalized to the reference gene ACTB and relative Samples were processed in the same way for CHGA using the previously expression represented as 2-DCt. described primers and probe (8)and for SCG2 or PCSK2 with Collection of clinical material and data. Clinical material was oligonucleotide probes (CAAAAAGAGGAAATCTTTCAAACATGGCT- collected prospectively between June 2003 and May 2006 under ethical GAAG and CTGGCCTCCAACTATAATGCCGAAGCAAG, respectively). (Wirral LREC 64/02, Liverpool LREC 04/01/272M/A, and St. Helen’s Membranes were hybridized with probes (24)for 16 h, then washed to a and Knowsley LREC 2003/2004-39)and hospital R&D approval with stringency of 2Â SSC/0.1% SDS at 65jC, and exposed to autoradiogra- informed consent from SCLC and NSCLC patients presenting within phy film at -80jC for 1 h up to 72 h. All patient samples were tested in the Merseyside and Cheshire Cancer Network at Clatterbridge Centre duplicate for SCG3; samples were classed as positive if the transcript was for Oncology, Liverpool Cardiothoracic Centre, and Whiston Hospital. detected at least once on 72 h exposure. SCG3 amplicon intensity was Peripheral blood samples and clinical characteristics (age, sex, disease standardized to the positive control for each membrane using ImageJ and stage, performance status, treatment, response to therapy, and date of then normalized to ACTB as determined by QPCR for each cDNA. death)were collected from newly diagnosed lung cancer patients before Samples were scored for the intensity of the SCG3 amplicon above a chemotherapy. As unfit patients were not approached to participate in statistically determined threshold. the study, the recruited cohort includes more limited disease patients Statistical analysis. Receiver operating characteristic and statistical with better performance status than the typical Merseyside and Cheshire analysis of standard prognostic variables was carried out using SPSS. Cancer Network lung cancer population. B-samples were collected from Sample size analysis was done using Statsdirect. Survival data were 20 SCLC patients in the cohort fit enough to be approached at follow- calculated from date of diagnosis to date of death; 5 SCLC patients up at least 4 months after completion of chemotherapy. Patient blood recruited to the study subsequent to initial diagnoses with lung cancer was collected into PAXgene RNA tubes (Qiagen)for total RNA were excluded from these analyses. Treatment response was scored extraction. Control RNA samples were obtained from blood collected according to the treating clinician/radiologist assessment and was under ethical approval from healthy donors accompanying patients to unavailable for four SCLC. Multivariate analysis was done using Cox clinic or purchased as total leukocyte RNA from CFI (AMS Biotechnol- regression. The Kaplan-Meier method was used to estimate survival and ogy). Clinical characteristics for the consecutive series of 67 SCLC and the log-rank test was used to correlate this with SCG3 based on scoring 44 NSCLC patients recruited to the study are summarized in Table 1. positively for the transcript at least once in the two replicate assays. RNA preparation, RT-PCR, and hybridization for clinical Analysis of treatment response in SCLC where smaller patient samples. RNA was extracted using the PAXgene system (Qiagen) subgroups were compared was based on detection frequency, but according to the manufacturer’s directions. RNA quality and quantity normalized scores followed the same trends. were determined and 0.25 Ag converted to cDNA. Volumes corresponding to 6% or 24% of the cDNA reaction were amplified by QPCR for ACTB and by conventional RT-PCR for candidate transcripts Results (35 or 40 cycles). Controls were a reverse transcriptase-negative reaction for each cDNA, a reaction with no template (no cDNA), an amplicon SCG3 is highly transcribed in REST-deficient lung cancer. We from a SCLC cell line diluted 1:300 (positive), and the ACTB amplicon as found by expression profiling that conditional depletion of a hybridization control (negative). SCG3 RT-PCR products were electro- REST in NSCLC cells using siRNA could alter transcription of phoresed, transferred to Hybond-XL (GE Healthcare), and probed with several hundred genes, partly mimicking the transcriptional

Table 1. Clinical characteristics for 111 recruited lung cancer patients

Clinical characteristics SCLC NSCLC Patients recruited (n)6744 Median (range) age at diagnosis (y) 63 (38-85) 69 (40-84) Sex (% female) 46.8 34.1 % Current or ex-smoker 97 100 Disease stage (n) 62* 39* LD (%) 53.2 ED (%) 46.8 Stage I-II (%) 5.1 Stage III-IV (%) 94.9 Performance status (n)62*39* 0-2 (%) 95.5 97.5 3-4 (%) 4.5 2.5 Treatment with at least one chemotherapy cycle (n)66* 43* Platinum/etoposide (%) 97.0 Carboplatin/gemcitabine (%) 93.2 Response to treatment (n)58*31* Complete response (%) 24.1 3.2 Partial response (%) 65.5 67.7 Stable disease (%) 3.5 12.9 Progressive disease (%) 6.9 16.2 Survival (n) 62* 39* Median (95% CI) survival (mo) 12 (10.1-14.1) 10 (7.0-13.0) 1 y survival (%) 48.4 41.0 2 y survival (%) 21.9 15.4

*Number of patients where data were available.

Clin Cancer Res 2009;15(1) January 1, 2009 276 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 mRNA in CTC from Neuroendocrine Lung Cancer program of SCLC.5 Among the significantly induced transcripts neuroendocrine NSCLC cell lines, normal lung cell lines, or were several members of the chromogranin and secretogranin peripheral blood of CFI (Fig. 1). We initially screened 40 family: CHGA, CHGB, SCG3, and VGF together with PCSK1, an consecutive blood samples, collected at diagnosis from the enzyme that processes these proteins into peptides for series of consenting SCLC patients, for SCG3 and for the secretion. Importantly, four of these genes were also highly previously characterized marker CHGA (8)using the same transcribed in the SCLC cell line NCI-H69 relative to the methodology employed for CFI. We detected SCG3 in 5 of NSCLC cell line NCI-H460 on DNA microarray analysis.5 Thus, these 40 samples but were unable to detected CHGA (data not we sought to further investigate their transcriptional profiles in shown), suggesting that, in agreement with our data from cell lung cancer cells by RT-PCR, along with two related genes, lines, SCG3 is a more sensitive marker for SCLC in vivo. SCG2 and PCSK2, which were not induced by REST depletion. To improve detection of SCG3 transcript and to validate the We first compared the transcriptional response to REST assay sensitivity and reproducibility, we now increased the siRNA treatment of NCI-H460 cells (Fig. 1A). Basal transcript amount of template to 24% of each cDNA reaction. Peripheral levels varied among the genes, but although mRNA was blood samples were collected from a healthy volunteer into undetectable for SCG3 or PCSK2, CHGA was not substantially PAXgene tubes and spiked with a serial dilution of SCG3- repressed in NCI-H460 cells. Both SCG2 and PCSK2 have been expressing SCLC cells (Lu-165)before preparation of RNA. identified from genome-wide chromatin immunoprecipitation SCG3 transcript could be detected from f10 SCLC cells/mL by screening for REST binding sites (25, 26), but we confirmed RT-PCR and hybridization with the SCG3-specific radiolabeled that neither gene was regulated by REST in these lung cancer probe (Supplementary Fig. S1), comparable with studies cells. Nonetheless, each gene identified from our microarray employing similar methodologies to detect arginine vasopres- study was induced by depletion with both siRNA sequences sin,4 prepro-gastrin-releasing peptide (10), and CHGA (8) targeting REST, confirming that CHGA, CHGB, SCG3, VGF, and transcripts. These other studies did not address assay reproduc- PCSK1 were all REST-responsive. Notably, SCG3 transcription ibility. However, using replicate QPCR analysis for SCG3, we was exquisitely sensitive to loss of the REST repressor. show that assay reproducibility decreased in line with the Whereas CHGA, CHGB and PCSK1 (5, 8, 27, 28)are number of SCLC cells/mL of blood (Supplementary Fig. S1), established markers for SCLC, to the best of our knowledge, suggesting the ability to detect these transcripts will reflect the VGF and SCG3 have not been previously characterized in lung patient CTC burden. cancer. We initially screened a panel of SCLC, carcinoid (NCI- To determine the frequency with which SCG3 transcript H727), nonneuroendocrine NSCLC and control cell lines by could be detected in lung cancer patient blood, we now conventional RT-PCR to correlate transcription with REST analyzed the whole cohort of 67 SCLC, 44 NSCLC, and 27 CFI. status for these genes (Fig. 1B). The transcript most stringently Each sample was tested in duplicate by PCR using 24% of the restricted to neuroendocrine lung cancer cells was SCG3. cDNA reaction and hybridization. Because assay reproducibility Although CHGA transcript has been tested as a specific marker reflects the number of SCG3-expressing cells (Supplementary in SCLC (8), in this study, we detected CHGA transcripts in four Fig. S1), patients were regarded as positive if SCG3 mRNA was of five nonneuroendocrine NSCLC cell lines. CHGB, VGF, detected at least once. The results for the SCLC cohort are PCSK1, and PCSK2 were also expressed in several NSCLC. In shown in Fig. 2 and all data are summarized in Table 2. Overall, contrast, SCG3 was detected by conventional RT-PCR in neither the SCG3 detection frequency among SCLC samples collected NSCLC nor normal cells derived from lung epithelium or at diagnosis was 54%, with a third of samples positive in both fibroblasts. By QPCR analysis, the mean differential expression replicates. Interestingly, SCG3 mRNA was also detectable in of SCG3 between neuroendocrine and nonneuroendocrine 75% of 20 SCLC follow-up samples (SCLC-B)and in 34% of lung cancer cell lines was >12,000-fold compared with 3,600- NSCLC patients. Unexpectedly however, employing this more fold for CHGA (Fig. 1B). These data suggest the SCG3 transcript sensitive methodology now identified low levels of SCG3 should be a specific and sensitive marker for tumors that lose transcript in 67% of CFI samples. REST. The reference gene ACTB was evaluated by QPCR for all SCG3 mRNA can be used to detect CTC from neuroendocrine peripheral blood RNA samples and the mean Ct value in CFI lung cancer. The paucity of a candidate biomarker transcript in was 19.8 (SD = 1.10)compared with 22.0 (SD = 1.93)for SCLC normal circulatory cells is a prerequisite for exploiting it to and 21.5 (SD = 1.59)for NSCLC patients, showing that RNA detect CTC. Therefore, we first screened peripheral blood RNA recovered from CFI was of significantly higher quality than that samples from CFI for the transcripts of interest. We excluded from cancer patients (P < 0.0001). To account for this variable, CHGB, VGF, and PCSK1 after the first screen, as mRNA was we used ACTB transcript quantification by QPCR to derive a detected in at least one case by RT-PCR alone (data not shown). normalized SCG3 expression score (Fig. 3). Receiver operating These data imply that only a subset of REST-regulated mRNAs characteristic analysis for the SCLC and CFI cohorts was then will be candidate biomarkers for SCLC in blood. To improve used to select the most suitable threshold value for scoring the assay sensitivity and specificity for the other candidate samples as positive and excluding false-negatives (Supplemen- transcripts, we conducted RT-PCR (using 6% of cDNA reaction) tary Fig. S2). The selected threshold of 0.043 excluded the entire followed by hybridization with a cDNA-specific radiolabeled CFI group, whereas the SCG3-positive rate in SCLC patients at probe and autoradiography (Fig. 1C). In 20 blood samples diagnosis was 35.8% [24 of 67; 95% confidence interval (95% from CFI, we found SCG2 mRNA in three individuals, but we CI), 24.3-47.3%] compared with 15.9% (7 of 44) in NSCLC did not detect CHGA, PCSK2, or SCG3 transcripts. SCG3 was patients (95% CI, 5.1-26.7%; Fig. 3; Table 2). Based on the selected for further evaluation, as this transcript was most observed probability of scoring above the threshold in SCLC highly expressed on REST depletion and among neuroendo- (0.36)and CFI (0),the sample sizes were predicted to be crine lung cancer cell lines but was not detected in non- appropriately powered (55 cases and 22 controls: 95% power).

www.aacrjournals.org 277 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. Imaging, Diagnosis, Prognosis

Fig. 1. Expression of chromogranin family transcripts in REST-depleted neuroendocrine lung cancer and peripheral blood of CFI. A, transcript induction on RESTdepletion for the chromogranin/secretogranin family and their processing enzymes. Semiquantitative endpoint RT-PCR was carried out at optimized cycle numbers for each gene of interest and the reference gene GAPDH. Representative data for RNA collected 3 days post-transfection with control or RESTsiRNA sequences. An immunoblot is aligned to illustrate REST protein status (top). B, transcripts show differential expression across a panel of17SCLC, NSCLC, and normal control cell lines. Quantitative SCG3 (black bars) DCt and CHGA (gray bars) expression profiles derived by QPCR are aligned (bottom), showing the mean expression relative to ACTB (log10 2 ; n =3).Bars, SD. C, autoradiograms showing candidate transcript detection from the peripheral blood RNA of 20 CFI. CHGA, SCG2, PCSK2, and SCG3 were amplified from 6% of cDNA (+)or reverse transcriptase-negative (-)reactions by 40 cycles of PCR, blotted, and hybridized with gene-specific radiolabeled oligonucleotide probes. Dashed white lines, discontinuities in gels and blots.

Clin Cancer Res 2009;15(1) January 1, 2009 278 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 mRNA in CTC from Neuroendocrine Lung Cancer

Although not significantly different (P = 0.242), a positive already have overt metastases at presentation. In peripheral score was more common among SCLC patients with extensive blood collected from 20 SCLC patients >4 months post- disease (ED; 41.4%; 95% CI, 23.5-59.3%)than those with chemotherapy, the SCG3-positive rate rose to 60% (12 of 20; limited disease (LD; 27.3%; 95% CI, 12.1-42.5%; Table 2), 95% CI, 38.5-81.5%)compared with 25% (5 of 20; 95% CI, consistent with a higher level of CTC in individuals who 6.0-44.0%)of the same cohort at the time of diagnosis. These

Fig. 2. SCG3 mRNA is a peripheral blood biomarker in SCLC patients. Autoradiograms showing SCG3 transcript detection from the peripheral blood RNA of 67 SCLC patients at 48 h exposure. SCG3 was amplified in duplicate from 24% of cDNA (+) or reverse transcriptase-negative (-)reactions by 40 cycles of PCR, blotted, and hybridized with a SCG3-specific radiolabeled oligonucleotide. Duplicate analysis of each sample.

www.aacrjournals.org 279 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. Imaging, Diagnosis, Prognosis

Table 2. SCG3 mRNA detection and scoring in peripheral blood with survival statistics for SCLC patients

Cancer status No. tested SCG3 mRNA detected Scored normalized SCG3 Positive Negative Positive Negative SCLC* 67 36 31 24 43 SCLC-Bc 2015 5 12 8 NSCLC* 44 15 29 7 37 CFI 27 18 9 027 SCLCb 62 33 29 21 41 Survival (mo) Median (95% CI) 12 (10.0-14.1) 11 (7.7-14.3) 13 (10.4-15.6) 11 (8.1-13.9) 13 (10.4-15.6) Mean (SE) 15.7 (1.46) 13.4 (1.34) 17.9 (2.52) 12.5 (1.47) 17.2 (2.01) P (log-rank test) 0.137 0.095 SCLC LDb 33 16 17 9 24 Survival (mo) Median (95% CI) 17 (13.9-20.1) 17 (12.6-21.4) 17 (4.2-29.8) 13 (7.2-18.8) 19 (10.4-27.6) Mean (SE) 19.8 (2.19) 16.3 (1.89) 22.2 (3.44) 12.6 (1.88) 22.2 (2.68) P (log-rank test) 0.194 0.022 SCLC EDb 29 17 12 12 17 Survival (mo) Median (95% CI) 9 (7.3-10.7) 8 (6.7-9.3) 9 (5.6-12.4) 9 (6.4-11.6) 8 (5.3-10.7) Mean (SE) 10.6 (1.21) 10.5 (1.62) 10.7 (1.75) 12.1 (2.11) 9.5 (1.36) P (log-rank test) 0.713 0.459

Abbreviations: LD, limited disease; ED, extensive disease. *Number of SCLC and NSCLC samples collected at initial presentation. cNumber of SCLC-B samples collected from a subset of the SCLC cohort at follow-up >4 mo post-chemotherapy. bNumber of SCLC samples collected at initial diagnosis where survival data were available. preliminary data show that SCG3 could be readily detected at tion, although the biomarker may also prove useful for patient follow-up, suggesting that it may be useful for monitoring other patient groups. longitudinal monitoring of disease. For both SCLC and NSCLC patients, survival correlated with SCG3 transcript in peripheral blood of SCLC patients is treatment response (P < 0.001; Fig. 4C). Those that responded prognostic for poor survival and associated with worse treatment to standard platinum-based chemotherapy had a mean survival response. Based on the assumption that the normalized SCG3 of 19.9 months (SE = 1.70)and those who did not respond had transcript score reflects the CTC burden in patients, we used SPSS to test for differences in survival by the log-rank test. Cox regression found that disease staging (P = 0.001), treatment response (P < 0.001), and normalized SCG3 transcript (P = 0.044)were significant variables for survival of SCLC patients, but age (P = 0.611)and performance status ( P = 0.366) were not. Thus, although overall survival was most highly correlated with treatment response, normalized SCG3 and treatment response were cumulative hazards. Kaplan-Meier estimates predicted a mean survival of 15.7 months (SE = 1.46) for the SCLC study cohort, which decreased among the group of SCLC patients positive for normalized SCG3 (Table 2)although not reaching significance (P = 0.095). Overall survival among SCLC patients was highly correlated with the stage of disease at presentation (P < 0.001; Fig. 4A). To determine whether the SCG3 biomarker might be useful in further prognostic stratification among the LD or ED patients, we derived Kaplan-Meier estimates within each subgroup (Fig. 4B). SCG3-negative LD patients showed significantly better survival than those who scored positively for normalized SCG3 (P = 0.022; Table 2). Clinical characteristics of LD patients stratified by SCG3 status were similar (data not shown). In contrast, there was no correlation between SCG3 detection score and survival of ED patients (P = 0.459; Table 2). For Fig. 3. Scoring of SCG3 mRNA in lung cancer patients and CFI. Quantification of NSCLC, there was no significant correlation between SCG3 hybridized SCG3 RT-PCR products in clinical samples normalized to ACTB.Values mRNA score and mean survival (P = 0.821). Thus, the current are a percentage of control expression and a threshold of 0.043 was applied to score peripheral blood mRNA samples positive. Sixty-seven SCLC, 44 NSCLC, 27 assay for SCG3 transcript in the peripheral blood was of CFI, and 20 post-chemotherapy SCLC-B samples were analyzed in duplicate; all prognostic significance in SCLC patients with LD at presenta- quantifiable products are shown.

Clin Cancer Res 2009;15(1) January 1, 2009 280 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 mRNA in CTC from Neuroendocrine Lung Cancer

Fig. 4. Peripheral blood SCG3 mRNA is a prognostic biomarker in SCLC.A to C, cumulative survival curves derived from Kaplan-Meier survival estimates and log-rank tests for patients entering the study at their initial diagnosis with lung cancer. Crosses, censored individuals. A, survival of 62 SCLC patients according to stage of disease: LD and ED (P < 0.001). B, survival of 33 SCLC patients with LD according to scoring for normalized SCG3 transcript (P = 0.022). C, survival of 89 lung cancer patients with evaluable treatment response according to response to platinum-based chemotherapy (P < 0.001). D, detection of SCG3 mRNA in the peripheral blood of 58 SCLC patients entering the study at initial diagnosis who were evaluable for treatment response displayed by treatment responder type (P = 0.022, Fisher’s exact test): complete response (CR), partial response (PR), stable disease (SD), or progressive disease (PD). a mean survival of only 9.7 months (SE = 1.73). The SCLC their low basal expression in hematopoietic cells. Because cohort received up to 6 cycles of carboplatin/etoposide; for 58 REST was first described as a transcriptional repressor that evaluable patients including both LD and ED, Fisher’s exact test silenced expression of neuronal genes in nonneuronal cells showed a significant correlation between detecting SCG3 (12, 13), we hypothesized that transcripts restricted by REST, transcript in SCLC and overall response (P = 0.022). Although yet expressed in SCLC, should distinguish these CTC from this study included only a small number of SCLC patients who hematopoietic cells. However, REST has transpired to be a failed to respond, it is interesting to note that all 6 patients were complex transcriptional regulator, with dynamic, gene-specif- SCG3 positive (Fig. 4D). Thus, SCG3 transcript in peripheral ic, and cell-type specific factors determining the pool of blood may also be predictive for SCLC patients less likely to repressed genes. Although collated data from recent studies of respond to standard chemotherapy. RE-1 prediction, REST overexpression, or genome-wide chromatin immunoprecipitation (25, 26, 29–36)suggested Discussion that each of the seven genes screened here are potential REST targets, we found that not all were induced by REST The application of tumor-associated transcripts as bio- depletion in lung cancer. Furthermore, we found wide markers of CTC in whole peripheral blood is dependent on variation among the restriction of these genes to neuroendocrine

www.aacrjournals.org 281 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. Imaging, Diagnosis, Prognosis lung cancer cells and among their expression in the peripheral as LD or ED and there is potential additional benefit in using a blood of CFI. biomarker like SCG3 to stratify the LD patients into better or Consistent with an earlier report that six SCLC-associated worse survival groups. transcripts (neuronal cell adhesion molecule, PGP9.5, gastrin, Furthermore, response to standard chemotherapy is impor- gastrin receptor, synaptophysin, and gastrin-releasing peptide tant in determining survival but at present cannot be predicted receptor)were evident in peripheral blood from CFI (10),we at the time of diagnosis. The survival correlation with SCG3 we could detect several chromogranin transcripts in control blood report here may, at least in part, be attributable to the samples. Although one CFI sample was positive for several association with response to chemotherapy. Although the transcripts screened, suggesting that we may not have realized numbers are small, all the SCLC patients who did not respond an entirely cancer-free control group, these transcripts in CFI to conventional treatment in this cohort were positive for SCG3 blood are most likely derived from leukocytes. In fact, the transcript in peripheral blood. A validated test for subgroups of peripheral blood transcriptome represents f80% of the SCLC patients with LD who are less likely to respond to human genome (37)and some tumor-associated transcripts standard chemotherapy might advocate alternative combined are induced by lymphocyte activation (38). chemotherapy regimes or entry into clinical trials for novel REST is a putative tumor suppressor in cancers of nonneuronal agents. Thus, whether SCG3 positivity predicts for worse origin (39). We identified the SCG3 transcript as an alternate survival because of worse response to treatment or for other candidate biomarker because it was the most highly induced reasons (more aggressive tumors), it may be developed as a transcript in genome-wide analysis of REST depletion in NSCLC5 useful biomarker to stratify the patient population. and is transcribed at a high level in SCLC. This suggested that it SCG3 has cellular functions in scaffolding neuroendocrine could be exploited for detection of rare CTC in peripheral blood. secretion and as a secreted neuropeptide (43–45). Although, In common with earlier studies of SCLC-derived transcripts in like other neuropeptides, it may be involved in autocrine blood, we did not isolate CTC but instead monitored the regulation in SCLC, this remains to be explored and there is no nucleated cell fraction from whole blood. We saw a high obvious mechanistic association between SCG3 expression in differential in SCG3 transcript levels between SCLC and CFI, tumors and response to platinum-based therapy or topoiso- supporting our assumption that it is derived from tumor cells; merase II inhibitors. However, we are using SCG3 as surrogate furthermore, in our hands, SCG3 proved more sensitive than readout for tumor cells that have lost REST and we have shown detection of CHGA transcript. Although application of the elsewhere that transcription of several hundred genes is current assay in diagnosis is precluded by the low sensitivity, it markedly dysregulated in REST-depleted NSCLC cells.5 There- should be noted that SCG3 was more frequently detected in fore, one or more genes within this transcriptional profile may SCLC patients with ED, who were statistically underrepresented increase the aggressive potential of the tumor or modulate the in this study cohort compared with the larger patient population drug sensitivity of REST-depleted tumors. For example, the cell presenting in the Merseyside and Cheshire Cancer Network. adhesion molecule CD24 is associated with more aggressive The frequency of SCG3 scoring in NSCLC patients (16%) disease in a range of tumor types including SCLC (46)and was would be consistent with the percentage of tumors expected to significantly induced by REST depletion.5 Furthermore, the show neuroendocrine differentiation, although diagnostic transcriptional response to carboplatin treatment of drug- biopsies were not available for confirmatory immunohisto- resistant ovarian cancer cell lines includes modulation of the chemical staining of neuroendocrine markers in this study. In REST corepressor RCOR1 (47)and recent expression profiling fact, studies using sensitive immunohistochemical staining of cisplatin-resistant breast cancer cell lines identified eight suggest that up to 45% of NSCLC may express one or more significantly induced transcripts (48), two of which, DUSP4 neuroendocrine marker (40). Thus, SCG3 transcript may also and SLC7A1, were also significantly increased by conditional be able to identify those patients with neuroendocrine NSCLC REST depletion in NSCLC.5 and CTC. Although the clinical significance of neuroendocrine SCG3 is just one component of the neurosecretory and differentiation in NSCLC remains contentious, some recent oncogenic transcriptional profile that characterizes lung tumors studies report a worse prognosis (41, 42). where transcriptional repression by REST is lost. However, Most interestingly, the SCG3 transcript correlated with because of the extremely high level of SCG3 transcript survival among LD SCLC patients, suggesting that it may help expression in REST-deficient lung cancer cells, coupled with to identify those with more aggressive disease. In contrast, there relatively tight transcriptional restriction in other cell types, it was no significant correlation among SCLC patients with ED, provides a useful marker of SCLC and perhaps other perhaps because the number of circulating tumor cells may neuroendocrine tumors. We show here that not only can have less effect on survival in patients who already have overt SCG3 mRNA be used as sensitive biomarker in the peripheral metastases. In previous studies, other SCLC-associated tran- blood for noninvasive monitoring of neuroendocrine lung scripts in peripheral blood have not proven useful for cancer but also that its detection might be of prognostic prognostication. Although neuromedin B receptor-positive significance in patients with LD. patients showed a trend toward worse survival, by log-rank test, this was not significant in their cohort of 44 SCLC patients Disclosure of Potential Conflicts of Interest or among the 21 patients with LD (11). Furthermore, although CHGA transcript was reported to be associated with an J. Coulson: inventor for related patent application. increased lethal risk, patients positive for CHGA exhibited a better mean survival than CHGA mRNA-negative patients (8). Acknowledgments Although the extent of disease at diagnosis is important in determining survival, this is only used to group SCLC patients We thank Dr. HelenWong for statistical analysis of data.

Clin Cancer Res 2009;15(1)January 1,2009 282 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 mRNA in CTC from Neuroendocrine Lung Cancer

References 1. Coulson JM, Ocejo-Garcia M, Woll PJ. Neuroendo- von Knebel Doeberitz M. Reduced expression of the Wold B. Comparative genomics modeling of the crine phenotype of small cell lung cancer. Methods neuron restrictive silencer factor permits transcription NRSF/RESTrepressor network: from single conserved Mol Med 2003;74:61 ^ 73. of glycine receptor a1subunit in small-cell lung cancer sites to genome-wide repertoire. Genome Res 2006; 2. Tallett A, Chilvers ER, Hannah S, et al. Inhibition of cells. Oncogene 2003;22:5636 ^ 45. 16 :120 8 ^ 21. neuropeptide-stimulated tyrosine phosphorylation 18. Neumann SB, Seitz R, Gorzella A, Heister A, 34. Johnson R, Gamblin RJ, Ooi L, et al. Identification and tyrosine kinase activity stimulates apoptosis in Doeberitz MK, Becker CM. Relaxation of glycine of the RESTregulon reveals extensive transposable el- small cell lung cancer cells. Cancer Res 1996;56: receptor and onconeural gene transcription control in ement-mediated binding site duplication. Nucleic 4255 ^ 63. NRSF deficient small cell lung cancer cell lines. Brain Acids Res 2006;34:3862 ^ 77. 3. Ciombor KK, Rocha Lima CM. Management of Res Mol Brain Res 2004;120:173 ^ 81. 35. Bruce AW, Krejci A, Ooi L, et al. The transcriptional small cell lung cancer. Curr Treat Options Oncol 19. Spencer EM, Chandler KE, Haddley K, et al. Regula- repressor REST is a critical regulator of the neurose- 2006;7:59 ^ 68. tion and role of REST and REST4 variants in modula- cretory phenotype. J Neurochem 2006;98:1828^ 40. 4. Carney DN, Marangos PJ, Ihde DC, et al. Serum neu- tion of gene expression in in vivo and in vitro in 36. Bruce AW, Donaldson IJ, Wood IC, et al. Genome- ron-specific enolase: a marker for disease extent and epilepsy models. Neurobiol Dis 2006;24:41 ^ 52. wide analysis of repressor element 1 silencing tran- response to therapy of small-cell lung cancer. Lancet 20.Watanabe H, MizutaniT, HaraguchiT, et al. SWI/SNF scription factor/neuron-restrictive silencing factor 19 82;1:5 8 3 ^ 5. complex is essential for NRSF-mediated suppression (REST/NRSF) target genes. Proc Natl Acad Sci U S A 5. Lamy P, GrenierJ, KramarA, Pujol JL. Pro-gastrin-re- of neuronal genes in human nonsmall cell lung carci- 2004;101:10458^63. leasing peptide, neuron specific enolase and chro- noma cell lines. Oncogene 2006;25:470 ^ 9. 37. Liew CC, Ma J, Tang HC, Zheng R, Dempsey AA. mogranin A as serum markers of small cell lung 21. Coulson JM, Fiskerstrand CE,Woll PJ, Quinn JP.Ar- The peripheral blood transcriptome dynamically cancer. Lung Cancer 2000;29:197 ^ 203. ginine vasopressin promoter regulation is mediated by reflects system wide biology: a potential diagnostic 6. Hansen M, Hammer M, Hummer L. ACTH, ADH, and a neuron-restrictive silencer element in small cell lung tool. J Lab Clin Med 2006;147:126^ 32. calcitonin concentrations as markers of response and cancer. Cancer Res 1999;59:5123^ 7. 38. Kowalewska M, Chechlinska M, Markowicz S, relapse in small-cell carcinoma of the lung. Cancer 22. Ocejo-Garcia M, Ahmed SI, Coulson JM, Woll PJ. Kober P,Nowak R.The relevance of RT-PCR detection 19 8 0;46 :20 62 ^ 7. Use of RT-PCR to detect co-expression of neuropep- of disseminated tumour cells is hampered by the ex- 7. DegorceF,GoumonY,JacquemartL,etal.Anewhu- tides and their receptors in lung cancer. Lung Cancer pression of markers regarded as tumour-specific in ac- man chromogranin A (CgA) immunoradiometric as- 2001;33:1^ 9. tivated lymphocytes. EurJ Cancer 2006;42:2671 ^4. say involving monoclonal antibodies raised against 23. Chute JP, Taylor E, Williams J, Kaye F, Venzon D, 39.WestbrookTF, Martin ES, Schlabach MR, et al. A ge- the unprocessed central domain (145-245). BrJ Can- Johnson BE. A metabolic study of patients with lung netic screen for candidate tumor suppressors identi- cer 1999;79:65^71. cancer and hyponatremia of malignancy. Clin Cancer fies REST. Cell 2005;121:837 ^ 48. 8. Begueret H,Vergier B, Begueret J, et al. Detection of Res 2006;12:888 ^ 96. 40. Sorhaug S, Steinshamn S, Haaverstad R, Nordrum circulating cells expressing chromogranin A gene tran- 24. Coulson JM, Ahmed SI, Quinn JP,Woll PJ. Detec- IS,MartinsenTC,WaldumHL.Expressionofneuroen- scripts in patients with lung neuroendocrine carcino- tion of small cell lung cancer by RT-PCR for neuropep- docrine markers in non-small cell lung cancer. APMIS ma. Eur J Cancer 2002;38:2325^ 30. tides, neuropeptide receptors, or a splice variant of the 2007;115:152 ^ 63. 9. SaitoT,KobayashiM,HaradaR,UemuraY,TaguchiH. neuron restrictive silencer factor. Methods Mol Med 41. Ab’ Saber AM, Massoni Neto LM, Bianchi CP, et al. Sensitive detection of small cell lung carcinoma cells 2003;75:335^52. Neuroendocrine and biologic features of primary by reverse transcriptase-polymerase chain reaction 25. Otto SJ, McCorkle SR, HoverJ, et al. A new binding tumors and tissue in pulmonary large cell carcinomas. for prepro-gastrin-releasing peptide mRNA. Cancer motif for the transcriptional repressor RESTuncovers AnnThorac Surg 2004;77:1883 ^ 90. 2003;97:2504 ^ 11. large gene networks devoted to neuronal functions. 42. Jungraithmayr W, Kayser G, Passlick B, Eggeling S. 10. Lacroix J, Becker HD, Woerner SM, Rittgen W, J Neurosci 2007;27:6729 ^ 39. Neuroendocrine differentiation and neuroendocrine Drings P,von Knebel Doeberitz M. Sensitive detection 26. Johnson DS, Mortazavi A, Myers RM, Wold B. morphology as two different patterns in large-cell of rare cancer cells in sputum and peripheral blood Genome-wide mapping of in vivo protein-DNA inter- bronchial carcinomas: outcome after complete resec- samples of patients with lung cancer by preproGRP- actions. Science 2007;316:1497 ^502. tion.World J Surg Oncol 2006;4:61. specific RT-PCR. Int J Cancer 2001;92:1^ 8. 27. North WG, Du JL. Key peptide processing enzymes 43. Hosaka M, Suda M, Sakai Y, Izumi T, Watanabe 11. Bessho A,Tabata M, Kiura K, et al. Detection of oc- are expressed by a variant form of small-cell carcino- T, Takeuchi T. Secretogranin III binds to cholesterol cult tumor cells in peripheral blood from patients with ma of the lung. Peptides 1998;19:1743 ^ 7. in the secretory granule membrane as an adapter small cell lung cancer by reverse transcriptase-poly- 28. Benatar M, Blaes F, Johnston I, et al. Presynaptic for chromogranin A. J Biol Chem 2004;279: merase chain reaction. Anticancer Res 2000;20: neuronal antigens expressed by a small cell lung carci- 3627 ^ 34. 114 9 ^ 5 4 . noma cell line. J Neuroimmunol 2001;113:153 ^ 62. 44. Hosaka M, Watanabe T, Sakai Y, Kato T,Takeuchi T. 12. Chong JA, Tapia-Ramirez J, Kim S, et al. REST: a 29. Patel PD, Bochar DA, Turner DL, Meng F, Mueller Interaction between secretogranin III and carboxy- mammalian silencer protein that restricts sodium HM, Pontrello CG. Regulation of tryptophan hydroxy- peptidase E facilitates prohormone sorting within se- channel gene expression to neurons. Cell 1995;80: lase-2 gene expression by a bipartite RE-1silencer of cretory granules. J Cell Sci 2005;118:4785 ^ 95. 949^57. transcription/neuron restrictive silencing factor 45. Ho s a k a M, Wa t a n a b e T, Sa k ai Y, Uchi y a m a Y, 13. Schoenherr CJ, Anderson DJ. The neuron-restric- (REST/NRSF) binding motif. J Biol Chem 2007;282: Takeuchi T. Identification of a chromogranin A domain tive silencer factor (NRSF): a coordinate repressor of 26717^ 24. that mediates binding to secretogranin IIIand targeting multiple neuron-specific genes. Science 1995;267: 30. Zhang C, Xuan Z, Otto S, et al. A clustering property to secretory granules in pituitary cells and pancreatic 13 6 0 ^ 3. of highly-degenerate transcription factor binding sites h-cells. Mol Biol Cell 2002;13:3388 ^ 99. 14. Coulson JM. Transcriptional regulation: cancer, neu- in the mammalian genome. Nucleic Acids Res 2006; 46. Kristiansen G, Sammar M, Altevogt P.Tumour bio- rons and the REST. Curr Biol 2005;15:R665 ^ 8. 34:2238^46. logical aspects of CD24, a mucin-like adhesion mole- 15. Majumder S. REST in good times and bad: roles in 31.Wu J, Xie X. Comparative sequence analysis reveals cule. J Mol Histol 2004;35:255^ 62. tumor suppressor and oncogenic activities. Cell Cycle an intricate network among REST, CREB and miRNA 47. Peters D, Freund J, Ochs RL. Genome-wide tran- 2006;5:1929 ^ 35. in mediating neuronal gene expression. Genome Biol scriptional analysis of carboplatin response in chemo- 16. Coulson JM, Edgson JL,Woll PJ, Quinn JP. A splice 2006;7:R85. sensitive and chemoresistant ovarian cancer cells. Mol variant of the neuron-restrictive silencer factor repres- 32. Pance A, Livesey FJ, Jackson AP. A role for the CancerTher 2005;4:1605 ^ 16. sor is expressed in small cell lung cancer: a potential transcriptional repressor REST in maintaining the phe- 48.Watson MB, Lind MJ, Smith L, Drew PJ, Cawkwell role in derepression of neuroendocrine genes and a notype of neurosecretory-deficient PC12 cells. J Neu- L. Expression microarray analysis reveals genes asso- useful clinical marker. Cancer Res 2000;60:1840 ^ 4. rochem 2006;99:1435^44. ciated with in vitro resistance to cisplatin in a cell line 17. Gurrola-Diaz C, Lacroix J, Dihlmann S, Becker CM, 33. Mortazavi A,Thompson EC, Garcia ST, Myers RM, model. Acta Oncol 2007;46:651 ^ 8.

www.aacrjournals.org 283 Clin Cancer Res 2009;15(1) January 1, 2009 Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficient Small Cell Lung Cancer

Adrian C. Moss, Gregory M. Jacobson, Lauren E. Walker, et al.

Clin Cancer Res 2009;15:274-283.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/15/1/274

Supplementary Access the most recent supplemental material at: Material http://clincancerres.aacrjournals.org/content/suppl/2009/01/07/15.1.274.DC1

Cited articles This article cites 47 articles, 14 of which you can access for free at: http://clincancerres.aacrjournals.org/content/15/1/274.full#ref-list-1

Citing articles This article has been cited by 3 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/15/1/274.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/15/1/274. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.