SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficientsmallcelllungcancer Adrian C

SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficientsmallcelllungcancer Adrian C

Imaging, Diagnosis, Prognosis SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-DeficientSmallCellLungCancer Adrian C. Moss,1, 2 , 3 Gregory M. Jacobson,1Lauren E.Walker,1Neil W. Blake,2 Ernie Marshall,3 and Judy M. Coulson1 Abstract Purpose: Specific markers of circulating tumor cells may be informative in managing lung cancer. Because the RE-1silencing transcription factor (REST/NRSF) is a transcriptional repressor that is inactivated in neuroendocrine lung cancer, we identified REST-regulated transcripts (CHGA, CHGB, SCG3,VGF, and PCSK1) for evaluation as biomarkers in peripheral blood. Experimental Design: Transcripts were screened across lung cancer and normal cell lines. Candidates were assessed by reverse transcription-PCR and hybridization of RNA extracted from the peripheral blood of 111lung cancer patients obtained at clinical presentation and from 27 cancer-free individuals. Results: Expression profiling revealed multiple chromogranin transcripts were readily induced on RESTdepletion, most notably SCG3 was induced >500-fold. The SCG3 transcript was also over- expressed by 12,000-fold in neuroendocrine compared with nonneuroendocrine lung cancer cells. In peripheral blood of lung cancer patients and cancer-free individuals, we found that SCG3 was more tumor-specific and more sensitive than other chromogranin transcripts as a biomarker of circulating tumor cells. Overall, 36% of small cell lung cancer (SCLC) and 16% of non-SCLC patients scored positively for normalized SCG3 transcript. This correlated with worse survival among SCLC patients with limited disease (n =33;P = 0.022) but not extensive disease (n =29;P = 0.459). Interestingly, the subcohort of 6 SCLC patients with resistance to platinum/ etoposide chemotherapy all scored positively for peripheral blood SCG3 transcript (P = 0.022). Conclusions: SCG3 mRNA, a component of the REST-dependent neurosecretory transcrip- tional profile, provides a sensitive prognostic biomarker for noninvasive monitoring of neuro- endocrine lung cancer. Lung cancer is the leading cancer killer in the United States and progression through autocrine growth loops or paracrine the United Kingdom, accounting for 22% of all UK cancer signaling (1, 2). Unlike NSCLC, SCLC are frequently metastatic deaths and ranking highest for both incidence and mortality at presentation so not generally amenable to surgical resection throughout most of the world. It is classified into small cell and, while initially chemosensitive and radiosensitive, the lung cancer (SCLC)or non-SCLC (NSCLC).Thirty-two percent majority rapidly recur. Although multimodality therapies have of lung tumors show a spectrum of neuroendocrine differen- improved the control of this disease (3), the UK 5-year survival tiation, comprising mainly SCLC, together with carcinoids and rate remains at 6%. Biomarkers for SCLC could be exploited to neuroendocrine NSCLC. They express and secrete a variety of characterize primary or metastatic tumor samples but might neuropeptides and hormones that can contribute to tumor more usefully be developed to assay blood or other body fluids to monitor tumors noninvasively. Potential applications include early detection of disease, initial diagnosis, clinical staging, prognosis, prediction of response to specific therapy, or Authors’ Affiliations: 1Physiological Laboratory, School of Biomedical Sciences, monitoring remission and disease progression. and 2Division of Medical Microbiology, University of Liverpool, Liverpool, United The neuroendocrine phenotype of SCLC distinguishes them 3 Kingdom and Clatterbridge Centre for Oncology NHSTrust,Wirral, United Kingdom from most other normal or neoplastic cells in the lung. Received 5/6/08; revised 8/11/08; accepted 9/7/08. Grant support: Clatterbridge Cancer Research Trust grant CCO 2003/01 (A.C. Although routine pathologic diagnosis of SCLC from broncho- Moss, J.M. Coulson, N.W. Blake, and E. Marshall) and Cancer Research UK project scopic biopsies relies on morphologic criteria, there are grant C8737/A3246 (J.M. Coulson and G.M. Jacobson). established immunohistochemical markers like neuron-specific The costs of publication of this article were defrayed in part by the payment of page enolase and neuronal cell adhesion molecule. Serum markers charges. This article must therefore be hereby marked advertisement in accordance for SCLC include the secreted neuropeptides neuron-specific with 18 U.S.C. Section 1734 solely to indicate this fact. Note: Supplementary data for this article are available at Clinical Cancer Research enolase (4, 5), arginine vasopressin (6), gastrin-releasing pep- Online (http://clincancerres.aacrjournals.org/). tide precursors (5), and chromogranin A (CHGA; refs. 5, 7). Requests for reprints: Judy M. Coulson, Physiological Laboratory, School of However, their utility is limited by serum peptide stability, the Biomedical Sciences, University of Liverpool, Crown Street, Liverpool L69 3BX, variability in neuropeptides secreted by individual tumors, and United Kingdom. Phone: 44-151-794-5850; Fax: 44-151-794-4434; E-mail: [email protected]. the secretion of multiple processed peptides. Thus, there are F 2009 American Association for Cancer Research. currently no established serum markers used in prognosis or doi:10.1158/1078-0432.CCR-08-1163 treatment of SCLC patients. Importantly though, shed lung Clin Cancer Res 2009;15(1) January 1, 2009 274 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 26, 2021. © 2009 American Association for Cancer Research. SCG3 mRNA in CTC from Neuroendocrine Lung Cancer with ANP, could contribute to hyponatremia in some SCLC Translational Relevance patients (23). We recently undertook expression profiling in nonneuroendocrine lung cancer cells experimentally depleted There are presently no well-established prognostic or of REST to better annotate the REST regulome in lung cancer.5 predictive biomarkers in SCLC and all patients receive stan- We reasoned that SCLC-associated transcripts, whose elevated dard chemotherapy for what is a heterogeneous disease. expression is triggered by loss of REST, would be potential Although initially chemosensitive, recurrence is often rapid markers of SCLC tumors and should not be expressed in and survival rates are poor. Only a minority of patients with normal blood cells. We therefore screened for several genes limited disease are currently eligible for concurrent chemo- induced in our model5 (CHGA, CHGB, SCG3, VGF and PCSK1) radiotherapy. The ability to detect SCLC biomarkers, such as candidate biomarkers. Despite transcriptional coregulation as SCG3 transcript, in the peripheral blood or other acces- by REST, we found surprisingly diverse expression profiles for sible body fluids could be used for minimally invasive lon- these mRNAs among lung cancer cell lines and in blood of gitudinal monitoring of disease. These have potential cancer-free individuals (CFI). We identified SCG3 as the most applications in early detection, diagnosis, staging, progno- sensitive and specific of these transcripts as a marker for CTC in sis, predicting response to specific therapy, or monitoring SCLC. Furthermore, we found that it is prognostic of worse response, remission, relapse, and disease progression for survival and was evident in patients with poor response to clinical management. Putative predictive factors may aid chemotherapy. clinical trial development around emerging therapies; for example, biomarkers might be useful to monitor the sub- group of patients who would have de novo chemoresist- ance to standard therapy (20-30%). A predictor of poor Materials and Methods response for limited disease patients might advocate alter- native (nonplatinum) chemotherapy; for example, current Cell culture, small interfering RNA treatment, and immunoblotting. trials suggest a role for Amrubicin (anthracycline activity COR-L47, NCI-H727, NCI-H322, NCI-H647, NCI-H2170, MRC5VA (Cancer Research UK Cell Services), SV40 immortalized human and topoisomerase inhibitor) in chemorefractory SCLC at keratinocytes (SVK), HeLa, NCI-H460, A549, and other SCLC (16) relapse. Furthermore, a prognostic factor would arm clini- were cultured in RPMI 1640 or DMEM (Autogen Bioclear)with 10% cians and patients with essential information on individual- bovine calf serum (Pierce)at 37 jC and 5% CO2. Normal human ized treatment options and the required intensity of bronchial epithelial cells (Cambrex BioScience)and BEAS-2B were therapy. We therefore believe that the data reported here maintained in complete small airway growth medium (Cambrex). NCI- have identified SCG3 as a blood biomarker with the poten- H460 cells were transfected by electroporation (Biorad GenepulserII) tial for future development in clinical practice. with 600 pmol of the small interfering RNA (siRNA)sequences: siREST1 (CAACGAAUCUACCCAUAUUUU), siREST5 (CAUCCUA- CUUGUCCUAAUAUU), siCON1 (UAGCGACUAAACACAUCAA), or siCON2 (UAAGGCUAUGAAGAGAUAC; Dharmacon)or no siRNA cancer cells appear in peripheral blood as circulating tumor (mock)as described elsewhere. 5 Cells were harvested at 3 days post- cells (CTC)or micrometastases. CTC mRNA can be extracted transfection for preparation of either protein or RNA. Protein was from the nucleated cell fraction of peripheral blood and the extracted by direct cell lysis in 2Â Laemmli sample buffer and distinct transcriptional profile of SCLC provides candidate quantified by BCA assay (Pierce). DTT was then added and samples mRNAs for development of specific

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    11 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us