DOCSLIB.ORG

An Outbreak of Toxoplasmosis in Squirrel Monkeys (Saimiri Sciureus) in South Korea

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An Outbreak of Toxoplasmosis in Squirrel Monkeys (Saimiri Sciureus) in South Korea Accepted: 10 March 2018 DOI: 10.1111/jmp.12344 ORIGINAL ARTICLE An outbreak of toxoplasmosis in squirrel monkeys (Saimiri sciureus) in South Korea Hanseul Oh1 | Kyung-Yeon Eo2 | Sanjeev Gumber3 | Jung Joo Hong4 | C-Yoon Kim1 | Hyun-Ho Lee2 | Young-Mok Jung2 | Jin Kim1 | Gyu-Whan Whang2 | Ji-Min Lee1 | Yong-Gu Yeo2 | Bokyeong Ryu1 | Ji-Sook Ryu2 | Seul-Kee Lee2 | Ukjin Kim1 | Sin-Geun Kang2 | Jae-Hak Park1 1Department of Laboratory Animal Medicine, College of Veterinary Abstract Medicine, Seoul National University, Seoul, Background: Toxoplasma gondii (T. gondii) is an intracellular protozoan parasite that Korea can infect warm- blooded animals including humans. New World monkeys, such as 2Conservation and Health Center, Seoul Zoo, Gwacheon, Gyonggido, Korea squirrel monkeys, are more susceptible to T. gondii than Old World monkeys, often 3Division of Pathology, Yerkes National developing fatal disease. Primate Research Center, Emory University, Methods: In this study, seven of thirteen dead squirrel monkeys at Seoul Grand Park Atlanta, GA, USA 4National Primate Research Center were tested to find the cause of sudden death. (NPRC), Korea Research Institute of Results: The main histopathological findings included interstitial pneumonia, ne- Bioscience and Biotechnology (KRIBB), Cheongju, Korea crotizing hepatitis, and splenitis. Periodic acid- Schiff staining of liver, spleen, and lung revealed cyst structures consistent with bradyzoites. Amplification of the B1 gene Correspondence Jae-Hak Park, Laboratory Animal Medicine, was detected in the liver or spleen of all monkeys. Additionally, a restriction fragment College of Veterinary Medicine and length polymorphism assay and phylogenetic analysis of the GRA6 amplicon revealed Research Institute for Veterinary Science, Seoul National University, Seoul, Korea. a consistent clustering with the type II strain of T. gondii. Email: [email protected] Conclusions: This study is the first report of T. gondii infection of squirrel monkeys in Funding information Korea, and the first report of type II T. gondii based on GRA6 analysis in Korea. BK21 PLUS Program for Creative Veterinary Science Research; The Research Institute of KEYWORDS Veterinary Science East Asia, genotyping, New World monkey, Toxoplasma gondii, zoo 1 | INTRODUCTION contaminated with oocysts.3 Oocysts are mainly excreted in feces by Felidae infected with T. gondii.3 The coccidian Toxoplasma gondii (T. gondii) is characterized by intra- Interestingly, New World monkeys, such as squirrel monkeys, cellular parasitism, which contributes to chronic infection through- woolly monkeys, and howler monkeys, are more susceptible to out the life of intermediate and definitive hosts.1,2 In good health toxoplasmosis than Old World monkeys, and often develop fatal 4 5 conditions, even if hosts are infected with T. gondii, clinical symp- disease. Cunningham et al reported an outbreak of toxoplasmo- toms do not appear. However, in immunosuppressed hosts, T. gondii sis with 100% morbidity and 30% mortality in a captive colony of can be activated, leading to severe symptoms such as damage to the squirrel monkeys. In this species of New World monkeys, toxoplas- 6 eyes and brain.1,2 Toxoplasma gondii infects a wide variety of warm- mosis is usually asymptomatic before sudden death. Some animals blooded animals, including humans, via ingestion of food and water exhibit nonspecific clinical manifestations, such as lethargy, depres- sion, anorexia, and diarrhea.6 Therefore, T. gondii infection is diffi- Oh and Eo equally contributed to this work. cult to diagnose based solely on clinical symptoms. On postmortem 238 | © 2018 John Wiley & Sons A/S. wileyonlinelibrary.com/journal/jmp J Med Primatol. 2018;47:238–246. Published by John Wiley & Sons Ltd OH ET AL. | 239 examination, multifocal necrotic lesions are observed in several 2.3 | Histopathology analysis organs, including liver, spleen, lymph nodes, and lungs, along with interstitial pneumonia and pulmonary edema.7 All Samples were fixed in 10% neutral formalin for 24 hours and The occurrence of toxoplasmosis has been reported worldwide embedded in paraffin. Sections were prepared at 3 μm and stained in many animal species, reflecting its wide host range.8 Sporadic with hematoxylin and eosin (HE). To identify tissue cysts of T. gondii, cases of toxoplasmosis in squirrel monkeys have been reported in sectioned slides were stained with Periodic acid- Schiff stain (PAS). zoos and sanctuaries worldwide, including the United Kingdom,5 Stained slides were examined under a light microscope (Olympus France,9 Israel,6 Brazil,10 Mexico,7 and Japan.11 In Korea, T. gondii in- AX70, Tokyo, Japan). fections have not been reported in non- human primates, including squirrel monkeys. There have been sporadic reports of toxoplas- 2.4 | Molecular diagnosis mosis in cats,12 cattle,13 wild boars,14 horses,15 goats,16 pigs,17 and humans.18 The genotype of the pathogen in Korea has rarely been DNA containing T. gondii was obtained from several tissues in- reported as follows: The only Korean isolates are KI- 1 (isolated from cluding spleen, liver, lung, heart, and brain tissues of six dead humans) and type I (identified in stray cats).18,19 monkeys. For the detection of T. gondii in rodents, their brains This study was conducted initially to investigate the cause of and livers were used. DNA was extracted using the Hybrid- R™ sudden death of squirrel monkeys in a zoo. After toxoplasmosis was extraction kit (GeneAll, Deajon, Korea) according to the manu- diagnosed, the influence on each organ of infection with toxoplasma facturer’s protocol. One μL of each DNA sample was used for was evaluated by histological and PCR analyses. Finally, we demon- amplification of B1 gene, which encodes an unknown serum re- strated the genotype and genetic diversity of toxoplasmosis in squir- active protein.20 The B1 primer pairs which reported by Homan rel monkeys in Korea. et al21 were B1F: CGCTGCAGGGAGGAAGACGAAAGTTG and B1R: CGCTGCAGACACAGTGCATCTGGATT. In the rodent samples, nested PCR was conducted. The inner primers of B1 gene were B1 2 | MATERIALS AND METHODS inner F: AGCCGAAGTGCGTTTTCTT, and B1 inner R: AATTCTCTC CGCCATCACC. For further confirmation in the rodents, GRA6 gene 2.1 | Environment was evaluated using GRA6 outer F: ATTTGTGTTTCCGAGCAGGT, Squirrel monkeys are exhibited at the children’s zoo in Seoul Grand GRA6 outer R: GCACCTTCGCTTGTGGTT and GRA6 inner F: Park. The animals had been exhibited in a 626 m2 outside enclo- TTTCCGAGCAGGTGACCT, GRA6 inner R: TCGCCGAAGAGT sure in one colony. For their environmental enrichment, an 8- m TGACATAG. The reactions using AccuPower® HotStart PCR wide, 10- m long, and 5- m high artificial rockwork is built in the en- PreMix kit (BIONEER, Deajon, Korea) were performed on a closure. The rockwork is covered with ropes such as web- net. The thermocycler (Bio- Rad, Hercules, CA, USA). The initial step animals use the ropes for moving and playing. The 70- m circum- of amplification took 7 minutes at 94°C, followed by 35 cy- ference enclosure is surrounded by a wet moat. There are cages cles of denaturation at 94°C for 1 minute, annealing at 55°C inside the rockwork to be used at night and winter time, so that the for 1 minute (B1 gene) or 60°C for 1 minute (GRA6 gene), and animals can move freely between the inside cage and the outside extension at 72°C for 1 minute, with a final extension at 72°C enclosure through small openings in the rockwork. The animals for 10 minutes. The PCR amplification was confirmed by run- are fed twice per day with Zupreem Primate Diet canned food ning the product on ethidium bromide stained 1.5% agarose gel (Zupreem, Shawnee, KS, USA), primate biscuits (ZuPreem Primate and visualization of the amplicon on a transilluminator under Dry Biscuit no. 6985, Shawnee Mission, KS. U.S.A.), apples, toma- UV light. PCR products of 529 base pair (bp) B1 gene in the gel toes, grapes, oranges, bananas, bread, peanuts, mealworms, and were analyzed sequence by commercial company (MACROGEN, super mealworms. Seoul, Korea). To identify infection of encephalomyelitis virus (EMCV) and lym- phocytic choriomeningitis virus (LCMV) in squirrel monkeys, RNA 2.2 | Sampling of the spleen, liver, lungs, heart, and brain were extracted using Four squirrel monkeys were found dead in the morning on June the Ribospin™ extraction kit (GeneAll, Deajon, Korea) according to 4th, 2017. There were no previous clinical signs before death. Nine the manufacturer’s protocol. The extracted RNA was analyzed by more squirrel monkeys were died within a month after June 4th, reverse transcription and nested PCR. The VP1 primers used for 2017. All the animals were adult and ranked higher in the hierarchy EMCV detection were outer F: GCCTCAGTTTGACCCTGCTTATG, among the colony. The deceased squirrel monkeys were kept in a outer R: CGGCTCTCGGAGTCATGTCAATC, and inner F: CGTC freezer at −20°C for postmortem examination. A complete nec- TCACAGAAATTTGGGGCAAC, inner R: CCAGGCTTCCTGTGTTG ropsy was performed at the Animal Health Center of the zoo to TCAAATC.22 In addition, the primers for LCMV detection were identify the cause of death. A mouse (Mus musculus) and two rats outer F: CWATRTANGGCCAICCITCICC, outer R: TNRWYAAYCA (Rattus rattus) were caught in the squirrel monkey enclosure using RTTYGGIWCIRTKCC and inner F: CANANYTTRTANARNAIRTTYTC capture traps. RTAIGG, inner R: AGYYTNKNNGCNGCIGTIAARGC.23 240 | OH ET AL. method based on the Kimura 2- parameter model and bootstrap 2.5 | Genotyping test with 1000 replicates, using MEGA6.24-27 The GenBank acces- To genotype the T. gondii from squirrel monkeys, a conven- sion number, origin, and strain type of reference strains are listed tional PCR- Restriction Fragment Length Polymorphism (RFLP) in Table 1. assay was performed. The genomic sequence of the GRA6 gene was amplified by PCR with a pair of primers designated 3 | RESULTS GRA6F: GTAGCGTGCTTGTTGGCGAC and GRA6R: TACAA GACATAGAGTGCCCC. The reactions using AccuPower® HotStart 3.1 | Gross findings PCR PreMix kit (BIONEER, Deajon, Korea) were performed in a thermocycler (Bio- Rad, Hercules, USA).
Load more

Recommended publications
  • Black Capped Capuchin (Cebus Apella)
    Husbandry Manual For Brown Capuchin/Black-capped Capuchin Cebus apella (Cebidae) Author: Joel Honeysett Date of Preparation: March 2006 Sydney Institute of TAFE, Ultimo Course Name and Number: Captive Animals. Lecturer: Graeme Phipps TABLE OF CONTENTS 1 Introduction............................................................................................................................. 4 2 Taxonomy ............................................................................................................................... 5 2.1 Nomenclature ................................................................................................................. 5 2.2 Subspecies ...................................................................................................................... 5 2.3 Recent Synonyms ........................................................................................................... 5 2.4 Other Common Names ................................................................................................... 5 3 Natural History ....................................................................................................................... 7 3.1 Morphometrics ............................................................................................................... 7 3.1.1 Mass And Basic Body Measurements ....................................................................... 7 3.1.2 Sexual Dimorphism ..................................................................................................
    [Show full text]
  • The Survival of the Central American Squirrel Monkey
    SIT Graduate Institute/SIT Study Abroad SIT Digital Collections Independent Study Project (ISP) Collection SIT Study Abroad Fall 2005 The urS vival of the Central American Squirrel monkey (Saimiri oerstedi): the habitat and behavior of a troop on the Burica Peninsula in a conservation context Liana Burghardt SIT Study Abroad Follow this and additional works at: https://digitalcollections.sit.edu/isp_collection Part of the Animal Sciences Commons, and the Environmental Sciences Commons Recommended Citation Burghardt, Liana, "The urS vival of the Central American Squirrel monkey (Saimiri oerstedi): the habitat and behavior of a troop on the Burica Peninsula in a conservation context" (2005). Independent Study Project (ISP) Collection. 435. https://digitalcollections.sit.edu/isp_collection/435 This Unpublished Paper is brought to you for free and open access by the SIT Study Abroad at SIT Digital Collections. It has been accepted for inclusion in Independent Study Project (ISP) Collection by an authorized administrator of SIT Digital Collections. For more information, please contact [email protected]. The Survival of the Central American Squirrel monkey (Saimiri oerstedi): the habitat and behavior of a troop on the Burica Peninsula in a conservation context Liana Burghardt Carleton College Fall 2005 Burghardt 2 I dedicate this paper which documents my first scientific adventure in the field to my father. “It is often necessary to put aside the objective measurements favored in controlled laboratory environments and to adopt a more subjective naturalistic viewpoint in order to see pattern and consistency in the rich, varied context of the natural environment” (Baldwin and Baldwin 1971: 48). Acknowledgments This paper has truly been an adventure and as is common I have many people I wish to thank.
    [Show full text]
  • NO2N Import Into Containment Any New Organism That Is Not Genetically Modified
    NO2N Import into containment any new organism that is not genetically modified Application title: Importation of specified “new” mammal species into containment at Wellington Zoo, and other zoos, to aid conservation though sustainable display, captive breeding and / or the conservation of genetic material Applicant organisation: Wellington Zoo Trust, 200 Daniell Street, Newtown, Wellington Please provide a brief summary of the purpose of the application (255 characters or less, including spaces) To import into containment 28 mammal species for captive breeding, display, educational presentations and to contribute to conservation by exposing visitors to conservation issues and the conservation of genetic material through breeding PLEASE CONTACT ERMA NEW ZEALAND BEFORE SUBMITTING YOUR APPLICATION Please clearly identify any confidential information and attach as a separate appendix. Please check and complete the following before submitting your application: All sections completed Yes Appendices enclosed NA Confidential information identified and enclosed separately NA Copies of references attached Yes Application signed and dated Yes Electronic copy of application e-mailed to Yes ERMA New Zealand Signed: Date: 20 Customhouse Quay Cnr Waring Taylor and Customhouse Quay PO Box 131, Wellington Phone: 04 916 2426 Fax: 04 914 0433 Email: [email protected] Website: www.ermanz.govt.nz NO2N: Application to import into containment any new organism that is not genetically modified Section One – Applicant details Name and details of the organisation
    [Show full text]
  • The New World Monkeys
    The New World Monkeys NEW WORLD PRIMATE TAG Husbandry WORKSHOP Taxonomy of New World primates circa 1980’s Suborder Anthropoidea Infraorder Platyrrhini SuperFamily Ceboidea Family Callitrichidae Cebidae Aotus Leontopithecus Owl Monkeys Lion Tamarins Callicebus Saguinus Titi Monkeys Tamarins Cebus Cacajao Capuchin Monkeys Uakaris Callithrix Marmosets Chiropotes Saimiri Bearded Sakis Cebuella Squirrel Monkeys Pygmy Marmosets Pithecia Sakis Alouatta Howler Monkeys Callimico Goeldi’s Monkey Ateles Spider Monkeys Brachyteles Woolly Spider Monkeys (Muriqui) Lagothrix Woolly Monkeys Taxonomy of New World primates circa 1990’s Suborder Anthropoidea Infraorder Platyrrhini SuperFamily Ceboidea Family Callitrichidae Atelidae Aotus Leontopithecus Owl Monkeys Lion Tamarins Cebidae Callicebus Saguinus Titi Monkeys Tamarins Cebus Cacajao Capuchin Monkeys Uakaris Callithrix Marmosets Chiropotes Saimiri Bearded Sakis Cebuella Suirrel Monkeys Pygmy Marmosets Pithecia Sakis Alouatta Howler Monkeys Callimico Goeldi’s Monkey Ateles Spider Monkeys Brachyteles Woolly Spider Monkeys (Muriqui) Lagothrix Woolly Monkeys Taxonomy of New World primates circa 1990’s Suborder Anthropoidea Infraorder Platyrrhini SuperFamily Ceboidea Family Callitrichidae Atelidae Aotus Leontopithecus Owl Monkeys Lion Tamarins Cebidae Callicebus Saguinus Titi Monkeys Tamarins Cebus Cacajao Capuchin Monkeys Uakaris Callithrix Marmosets Chiropotes Saimiri Bearded Sakis Cebuella Suirrel Monkeys Pygmy Marmosets Pithecia Sakis Alouatta *DNA analysis Howler Monkeys Callimico suggested that
    [Show full text]
  • Hooded Capuchin • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Sapajus Apella Caythrough Human Understanding
    Hooded Capuchin • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Sapajus apella caythrough human understanding Classification What groups does this organism belong to based on characteristics shared with other organisms? Class: Mammalia (all mammals) Order: Primates (prosimians, monkeys, apes, humans) Family: Cebidae (new world monkey capuchin, squirrel monkey) Genus: Sapajus Species: apella Distribution Where in the world does this species live? They live in South America, specifically Southeastern Bolivia, Northern Argentina, Brazil and Paraguay. Habitat What kinds of areas does this species live in? Hooded capuchins live in sub-tropical humid and semi-deciduous forests. In Bolivia and Argentina they live in seasonal subtropical laurel and montane forests up to 5000 ft. In Paraguay, they live in dense humid semi-deciduous forest and gallery forests in areas of thorn scrub and savannah. Physical Description How would this animal’s body shape and size be described? • Hooded capuchins are 12-22 inches (30-56 cm) long with a 15-22 inch (38-56 cm) tail. • Adults weigh six to eight pounds (3-4 kg). • Hooded Capuchin are not sexually dimorphic but males may have darker appearing fur.. • They have a brownish crown with two tuft-like horns of fur. • They are overall quite pale, and differ from other tufted capuchin because the hair on the back of the neck and dorsal part of the tail is burnt brown, with a greyish brown dorsal body, shoulders, front upper arms, saddle, rump and thighs and black forearms and legs, black hands, wrists and feet. Diet What does this species eat? In their historic range: They are omnivores eating mostly fruit, young leaves including succulent leaf bases, insects, small animal prey and flower nectar.
    [Show full text]
  • Responses to the Audio Broadcasts of Predator Vocalizations by Eight Sympatric Primates in Suriname, South America
    RESPONSES TO THE AUDIO BROADCASTS OF PREDATOR VOCALIZATIONS BY EIGHT SYMPATRIC PRIMATES IN SURINAME, SOUTH AMERICA A thesis submitted to Kent State University in partial fulfillment of the requirements for the degree of Master of Arts by Orin J. Neal August, 2009 Thesis written by Orin J. Neal B.A., Stony Brook University, 2003 M.A., Kent State University, 2009 Approved by: __________________________________________ Dr. Marilyn Norconk Advisor __________________________________________ Dr. Richard Meindl Chair, Department of Anthropology __________________________________________ Dr. Timothy Moerland Dean, College of Arts and Sciences ii TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………… v LIST OF TABLES……………………………………………………………….. vii ACKNOWLEDGEMENTS……………………………………………………… ix ABSTRACT……………………………………………………………………… 1 INTRODUCTION………………………………………………………………. 2 Predation risk in the neotropics…………………………………………… 4 Predation risk versus predation rate………………………………………. 8 Primate alarm vocalizations………………………………………………. 9 Vigilance………………………………………………………………….. 11 Habitat use………………………………………………………………… 12 Playback studies………………………………………………………….. 13 Hypotheses……………………………………………………………….. 13 METHODS………………………………………………………………………. 16 Study area………………………………………………………………… 16 Study subjects…………………………………………………………….. 17 Alouatta…………………………………………………………… 18 Ateles……………………………………………………………… 18 Cebus……………………………………………………………… 19 Chiropotes………………………………………………………… 20 Pithecia…………………………………………………………… 20 Saguinus………………………………………………………….. 21 Saimiri……………………………………………………………. 21 Predation
    [Show full text]
  • Zoo Ecology of a Primate Species: Squirrel Monkey
    ZOO ECOLOGY OF A PRIMATE SPECIES: SQUIRREL MONKEY ( SAIMIRI SP.) Except where reference is made to the work of others, the work described in this dissertation is my own or was done in collaboration with my advisory committee. This dissertation does not include proprietary or classified information. ___________________________________ Heather S. Zimbler-DeLorenzo Certificate of Approval: _____________________________ _____________________________ Troy L. Best F. Stephen Dobson, Chair Alumni Professor Professor Biological Sciences Biological Sciences _____________________________ _____________________________ Robert S. Lishak George T. Flowers Associate Professor Dean Biological Sciences Graduate School ZOO ECOLOGY OF A PRIMATE SPECIES: SQUIRREL MONKEY ( SAIMIRI SP.) Heather Susanne Zimbler-DeLorenzo A Dissertation Submitted to the Graduate Faculty of Auburn University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Auburn, Alabama May 09, 2009 ZOO ECOLOGY OF A PRIMATE SPECIES: SQUIRREL MONKEY ( SAIMIRI SP.) Heather Susanne Zimbler-DeLorenzo Permission is granted to Auburn University to make copies of this dissertation at its discretion, upon request of individuals or institutions and at their expense. The author reserves all publication rights. _________________________________ Signature of Author _________________________________ Date of Graduation iii DISSERTATION ABSTRACT ZOO ECOLOGY OF A PRIMATE SPECIES: SQUIRREL MONKEY ( SAIMIRI SP.) Heather S. Zimbler-DeLorenzo Doctor of Philosophy, May 09, 2009 (B.S., Emory University, 2001) 134 Typed Pages Directed by F. Stephen Dobson Understanding how captivity affects the behavioral and development traits of a species is important for management and conservation in zoos. The ecology of squirrel monkeys ( Saimiri sp.) may be different in captivity than in their natural environment. I investigated five common ecological aspects: reproduction, vigilant behaviors, life history traits, and generational changes in seasonality.
    [Show full text]
  • From Missiles to Malaria
    MODEL OF THE MONTH From missiles to malaria by Monica Harrington example, after it was discovered in the 1960s that squirrel monkeys SCIENTIFIC NAME naturally develop atherosclerosis3, they were used in research on Saimiri sciureus cardiovascular and metabolic disease. During the 1980s and 1990s, research on squirrel monkeys shifted to focus more on neurosci- TAXONOMY 4 PHYLUM: Chordata ence, pharmacology and behavior . CLASS: Mammalia For decades, the squirrel monkey has been used in studies of experi- mental infection with Creutzfeldt–Jakob disease5 because it is highly ORDER: Primates susceptible to transmissible spongiform encephalopathies4. This sus- FAMILY: Cebidae ceptibility seems to have a genetic basis; the prion protein sequence in squirrel monkeys shares 93.8% homology with the sequence in humans that is associated with increased susceptibility to infection6. Squirrel monkeys also share humans’ susceptibility Physical description to color blindness. About 5–8% of men are color- Squirrel monkeys are New World monkeys blind, as are most male squirrel monkeys. In native to the tropical rainforests of South 2009, scientists reported the successful use America. They are the smallest mem- of gene therapy to rescue color blind- bers of the Cebidae family, with a body ness in adult male squirrel monkeys7. length of 25–35 cm and tail length of These results challenge the idea that 35–42 cm. Males weigh 750–1,100 g modification of the brain’s abilities, and females weigh 500–750 g, like vision, is only possible during ­generally. Squirrel monkeys have a a critical period of development Nature America, Inc. All rights reserved. America, Inc.
    [Show full text]
  • Evaluating a Squirrel Monkey Troop in Natural Rehabilitation
    SIT Graduate Institute/SIT Study Abroad SIT Digital Collections Independent Study Project (ISP) Collection SIT Study Abroad Fall 2016 Evaluating a Squirrel Monkey Troop in Natural Rehabilitation: An Assessment of Population and Behavior of Saimiri sciureus in Preparation for Relocation from Sumak Allpa to Yasuní National Park Bria Riggs SIT Study Abroad Follow this and additional works at: https://digitalcollections.sit.edu/isp_collection Part of the Animal Studies Commons, Community-Based Research Commons, Latin American Studies Commons, Other Animal Sciences Commons, and the Zoology Commons Recommended Citation Riggs, Bria, "Evaluating a Squirrel Monkey Troop in Natural Rehabilitation: An Assessment of Population and Behavior of Saimiri sciureus in Preparation for Relocation from Sumak Allpa to Yasuní National Park" (2016). Independent Study Project (ISP) Collection. 2471. https://digitalcollections.sit.edu/isp_collection/2471 This Unpublished Paper is brought to you for free and open access by the SIT Study Abroad at SIT Digital Collections. It has been accepted for inclusion in Independent Study Project (ISP) Collection by an authorized administrator of SIT Digital Collections. For more information, please contact [email protected]. Riggs 1 Evaluating a Squirrel Monkey Troop in Natural Rehabilitation: An Assessment of Population and Behavior of Saimiri sciureus in Preparation for Relocation from Sumak Allpa to Yasuní National Park (“Diet/Foraging,” 2016. Monkeyworld.com) Riggs, Bria Academic Director: Silva, Xavier, PhD Project Advisor: Vargas, Héctor Bates College Environmental Studies South America, Ecuador, Orellana, Sumak Allpa Submitted in partial fulfillment of the requirements for Ecuador: Comparative Ecology and Conservation, SIT Study Abroad, Fall 2016 Riggs 2 ABSTRACT Natural rehabilitation and translocation of primate species provide the opportunity for recovery of individuals and repopulation of species in the wild.
    [Show full text]
  • Taking Better Care of Monkeys and Apes
    Taking Better Care of Monkeys and Apes Refinement of Housing and Handling Practices for Caged Nonhuman Primates by VIKTOR REINHARDT TAKING BEttER CARE OF MONKEYS AND APES Refinement of Housing and Handling Practices for Caged Nonhuman Primates by VIKTOR REINHARDT Animal Welfare Institute Table of Contents 1. Introduction ......................................................................................................... 1-2 2. Definitions 2.1. Refinement ....................................................................................................... 3 2.2. Distress ............................................................................................................ 3-6 2.3. Well-Being ....................................................................................................... 6 3. Signs of Refinement ........................................................................................... 7 4. Distressing Conditions ..................................................................................... 9-98 4.1. Barren Cage ..................................................................................................... 9-53 Animal Welfare Institute 4.1.1. Signs of Distress and Impaired Well-Being ........................................... 10-14 P.O. Box 3650 Washington, DC 20027 4.1.2. Refinement ............................................................................................. 14-53 www.awionline.org 4.1.2.1. Companionship ............................................................................
    [Show full text]
  • Preparing New World Monkeys for Laboratory Research
    Preparing New World Monkeys for Laboratory Research Suzette Tardif, Karen Bales, Lawrence Williams, Elisabeth Ludlage Moeller, David Abbott, Nancy Schultz-Darken, Sally Mendoza, William Mason, Sabrina Bourgeois, and Julio Ruiz Abstract (Aotus sp.), and the titi monkey (Callicebus cupreus). Fea- tures both common to all species and unique to certain New World monkeys represent an important but often species are described. The text below begins with an over- poorly understood research resource. The relatively small view of life history, reproduction, basic social structure, and size and low zoonotic risk of these animals make them response to novelty for each species. appealing as research subjects in a number of areas. How- ever, historic portrayal of many of these species as difficult to manage and handle is one of the factors that has limited Overview of Species Downloaded from their use. Basic guidelines are provided on management and handling approaches for the New World monkeys most Marmosets commonly used in research: marmosets, squirrel monkeys, owl monkeys, and titi monkeys. Topics include transport Marmosets are members of the primate family Callitrichi- and acclimation to a new facility, location changes within a dae. The Callitrichidae is a species-rich family; however, http://ilarjournal.oxfordjournals.org/ facility, diet changes, removal from and return to social only the common marmoset (Callithrix jacchus) is routinely groups, capture and restraint, handling for anesthesia, post- used in laboratory research. Callitrichids are the smallest of procedural monitoring, and staff training. the anthropoid primates; on average, common marmosets weigh approximately 350 g. They are primarily arboreal Key Words: acclimation; husbandry; management; marmo- animals that have claws, allowing them to cling vertically.
    [Show full text]
  • Ocular Dominance Columns in New World Monkeys
    The Journal of Neuroscience, March 15, 1996, 76(6):2086-2096 Ocular Dominance Columns in New World Monkeys Margaret S. Livingstone Department of Neurobiology, Harvard Medical School, Boston, Massachusetts 02 115 Squirrel monkeys normally lack ocular dominance columns in monkeys also showed ocular dominance columns; normal owl Vl. This study shows that squirrel monkeys can exhibit clear monkeys showed variable expression. Because ocular domi- ocular dominance columns if they are made strabismic within a nance columns, when present in New World monkeys, tend to few weeks of birth. Columns were seen only in layer 4Cp and occur in later-maturing parts of layer 4C, I hypothesize that a were coarser than the overlying blob pattern in the same ani- difference in the relative timing of the maturation of geniculo- mal. In physiological recordings from layer 4C of a normal cortical inputs and intracortical lateral connectivity explains the squirrel monkey, single units were mostly monocular, but units variability of ocular dominance column expression in New driven by the two eyes were intermixed. These results suggest World monkeys. that in squirrel monkeys activity-dependent mechanisms do normally segregate geniculate inputs from the two eyes, but on Key words: ocular dominance columns; New World monkeys; a much finer scale than in Old World primates. Strabismic owl strabismus; owl monkeys; squirrel monkeys; Hebbian models All Old World primates, including humans, show sharp ocular The first hypothesis was addressed in a previous study from this dominance segregation in layer 4C of the primary visual cortex, laboratory (Livingstone et al., 1995). We measured evoked poten- but anatomical studies in various New World monkeys show tials in a squirrel monkey in response to depth-reversing random- robust, weak, or no ocular dominance columns (for review, see dot stereograms and found that the squirrel monkey showed Florence et al., 1986).
    [Show full text]