
Accepted: 10 March 2018 DOI: 10.1111/jmp.12344 ORIGINAL ARTICLE An outbreak of toxoplasmosis in squirrel monkeys (Saimiri sciureus) in South Korea Hanseul Oh1 | Kyung-Yeon Eo2 | Sanjeev Gumber3 | Jung Joo Hong4 | C-Yoon Kim1 | Hyun-Ho Lee2 | Young-Mok Jung2 | Jin Kim1 | Gyu-Whan Whang2 | Ji-Min Lee1 | Yong-Gu Yeo2 | Bokyeong Ryu1 | Ji-Sook Ryu2 | Seul-Kee Lee2 | Ukjin Kim1 | Sin-Geun Kang2 | Jae-Hak Park1 1Department of Laboratory Animal Medicine, College of Veterinary Abstract Medicine, Seoul National University, Seoul, Background: Toxoplasma gondii (T. gondii) is an intracellular protozoan parasite that Korea can infect warm- blooded animals including humans. New World monkeys, such as 2Conservation and Health Center, Seoul Zoo, Gwacheon, Gyonggido, Korea squirrel monkeys, are more susceptible to T. gondii than Old World monkeys, often 3Division of Pathology, Yerkes National developing fatal disease. Primate Research Center, Emory University, Methods: In this study, seven of thirteen dead squirrel monkeys at Seoul Grand Park Atlanta, GA, USA 4National Primate Research Center were tested to find the cause of sudden death. (NPRC), Korea Research Institute of Results: The main histopathological findings included interstitial pneumonia, ne- Bioscience and Biotechnology (KRIBB), Cheongju, Korea crotizing hepatitis, and splenitis. Periodic acid- Schiff staining of liver, spleen, and lung revealed cyst structures consistent with bradyzoites. Amplification of the B1 gene Correspondence Jae-Hak Park, Laboratory Animal Medicine, was detected in the liver or spleen of all monkeys. Additionally, a restriction fragment College of Veterinary Medicine and length polymorphism assay and phylogenetic analysis of the GRA6 amplicon revealed Research Institute for Veterinary Science, Seoul National University, Seoul, Korea. a consistent clustering with the type II strain of T. gondii. Email: [email protected] Conclusions: This study is the first report of T. gondii infection of squirrel monkeys in Funding information Korea, and the first report of type II T. gondii based on GRA6 analysis in Korea. BK21 PLUS Program for Creative Veterinary Science Research; The Research Institute of KEYWORDS Veterinary Science East Asia, genotyping, New World monkey, Toxoplasma gondii, zoo 1 | INTRODUCTION contaminated with oocysts.3 Oocysts are mainly excreted in feces by Felidae infected with T. gondii.3 The coccidian Toxoplasma gondii (T. gondii) is characterized by intra- Interestingly, New World monkeys, such as squirrel monkeys, cellular parasitism, which contributes to chronic infection through- woolly monkeys, and howler monkeys, are more susceptible to out the life of intermediate and definitive hosts.1,2 In good health toxoplasmosis than Old World monkeys, and often develop fatal 4 5 conditions, even if hosts are infected with T. gondii, clinical symp- disease. Cunningham et al reported an outbreak of toxoplasmo- toms do not appear. However, in immunosuppressed hosts, T. gondii sis with 100% morbidity and 30% mortality in a captive colony of can be activated, leading to severe symptoms such as damage to the squirrel monkeys. In this species of New World monkeys, toxoplas- 6 eyes and brain.1,2 Toxoplasma gondii infects a wide variety of warm- mosis is usually asymptomatic before sudden death. Some animals blooded animals, including humans, via ingestion of food and water exhibit nonspecific clinical manifestations, such as lethargy, depres- sion, anorexia, and diarrhea.6 Therefore, T. gondii infection is diffi- Oh and Eo equally contributed to this work. cult to diagnose based solely on clinical symptoms. On postmortem 238 | © 2018 John Wiley & Sons A/S. wileyonlinelibrary.com/journal/jmp J Med Primatol. 2018;47:238–246. Published by John Wiley & Sons Ltd OH ET AL. | 239 examination, multifocal necrotic lesions are observed in several 2.3 | Histopathology analysis organs, including liver, spleen, lymph nodes, and lungs, along with interstitial pneumonia and pulmonary edema.7 All Samples were fixed in 10% neutral formalin for 24 hours and The occurrence of toxoplasmosis has been reported worldwide embedded in paraffin. Sections were prepared at 3 μm and stained in many animal species, reflecting its wide host range.8 Sporadic with hematoxylin and eosin (HE). To identify tissue cysts of T. gondii, cases of toxoplasmosis in squirrel monkeys have been reported in sectioned slides were stained with Periodic acid- Schiff stain (PAS). zoos and sanctuaries worldwide, including the United Kingdom,5 Stained slides were examined under a light microscope (Olympus France,9 Israel,6 Brazil,10 Mexico,7 and Japan.11 In Korea, T. gondii in- AX70, Tokyo, Japan). fections have not been reported in non- human primates, including squirrel monkeys. There have been sporadic reports of toxoplas- 2.4 | Molecular diagnosis mosis in cats,12 cattle,13 wild boars,14 horses,15 goats,16 pigs,17 and humans.18 The genotype of the pathogen in Korea has rarely been DNA containing T. gondii was obtained from several tissues in- reported as follows: The only Korean isolates are KI- 1 (isolated from cluding spleen, liver, lung, heart, and brain tissues of six dead humans) and type I (identified in stray cats).18,19 monkeys. For the detection of T. gondii in rodents, their brains This study was conducted initially to investigate the cause of and livers were used. DNA was extracted using the Hybrid- R™ sudden death of squirrel monkeys in a zoo. After toxoplasmosis was extraction kit (GeneAll, Deajon, Korea) according to the manu- diagnosed, the influence on each organ of infection with toxoplasma facturer’s protocol. One μL of each DNA sample was used for was evaluated by histological and PCR analyses. Finally, we demon- amplification of B1 gene, which encodes an unknown serum re- strated the genotype and genetic diversity of toxoplasmosis in squir- active protein.20 The B1 primer pairs which reported by Homan rel monkeys in Korea. et al21 were B1F: CGCTGCAGGGAGGAAGACGAAAGTTG and B1R: CGCTGCAGACACAGTGCATCTGGATT. In the rodent samples, nested PCR was conducted. The inner primers of B1 gene were B1 2 | MATERIALS AND METHODS inner F: AGCCGAAGTGCGTTTTCTT, and B1 inner R: AATTCTCTC CGCCATCACC. For further confirmation in the rodents, GRA6 gene 2.1 | Environment was evaluated using GRA6 outer F: ATTTGTGTTTCCGAGCAGGT, Squirrel monkeys are exhibited at the children’s zoo in Seoul Grand GRA6 outer R: GCACCTTCGCTTGTGGTT and GRA6 inner F: Park. The animals had been exhibited in a 626 m2 outside enclo- TTTCCGAGCAGGTGACCT, GRA6 inner R: TCGCCGAAGAGT sure in one colony. For their environmental enrichment, an 8- m TGACATAG. The reactions using AccuPower® HotStart PCR wide, 10- m long, and 5- m high artificial rockwork is built in the en- PreMix kit (BIONEER, Deajon, Korea) were performed on a closure. The rockwork is covered with ropes such as web- net. The thermocycler (Bio- Rad, Hercules, CA, USA). The initial step animals use the ropes for moving and playing. The 70- m circum- of amplification took 7 minutes at 94°C, followed by 35 cy- ference enclosure is surrounded by a wet moat. There are cages cles of denaturation at 94°C for 1 minute, annealing at 55°C inside the rockwork to be used at night and winter time, so that the for 1 minute (B1 gene) or 60°C for 1 minute (GRA6 gene), and animals can move freely between the inside cage and the outside extension at 72°C for 1 minute, with a final extension at 72°C enclosure through small openings in the rockwork. The animals for 10 minutes. The PCR amplification was confirmed by run- are fed twice per day with Zupreem Primate Diet canned food ning the product on ethidium bromide stained 1.5% agarose gel (Zupreem, Shawnee, KS, USA), primate biscuits (ZuPreem Primate and visualization of the amplicon on a transilluminator under Dry Biscuit no. 6985, Shawnee Mission, KS. U.S.A.), apples, toma- UV light. PCR products of 529 base pair (bp) B1 gene in the gel toes, grapes, oranges, bananas, bread, peanuts, mealworms, and were analyzed sequence by commercial company (MACROGEN, super mealworms. Seoul, Korea). To identify infection of encephalomyelitis virus (EMCV) and lym- phocytic choriomeningitis virus (LCMV) in squirrel monkeys, RNA 2.2 | Sampling of the spleen, liver, lungs, heart, and brain were extracted using Four squirrel monkeys were found dead in the morning on June the Ribospin™ extraction kit (GeneAll, Deajon, Korea) according to 4th, 2017. There were no previous clinical signs before death. Nine the manufacturer’s protocol. The extracted RNA was analyzed by more squirrel monkeys were died within a month after June 4th, reverse transcription and nested PCR. The VP1 primers used for 2017. All the animals were adult and ranked higher in the hierarchy EMCV detection were outer F: GCCTCAGTTTGACCCTGCTTATG, among the colony. The deceased squirrel monkeys were kept in a outer R: CGGCTCTCGGAGTCATGTCAATC, and inner F: CGTC freezer at −20°C for postmortem examination. A complete nec- TCACAGAAATTTGGGGCAAC, inner R: CCAGGCTTCCTGTGTTG ropsy was performed at the Animal Health Center of the zoo to TCAAATC.22 In addition, the primers for LCMV detection were identify the cause of death. A mouse (Mus musculus) and two rats outer F: CWATRTANGGCCAICCITCICC, outer R: TNRWYAAYCA (Rattus rattus) were caught in the squirrel monkey enclosure using RTTYGGIWCIRTKCC and inner F: CANANYTTRTANARNAIRTTYTC capture traps. RTAIGG, inner R: AGYYTNKNNGCNGCIGTIAARGC.23 240 | OH ET AL. method based on the Kimura 2- parameter model and bootstrap 2.5 | Genotyping test with 1000 replicates, using MEGA6.24-27 The GenBank acces- To genotype the T. gondii from squirrel monkeys, a conven- sion number, origin, and strain type of reference strains are listed tional PCR- Restriction Fragment Length Polymorphism (RFLP) in Table 1. assay was performed. The genomic sequence of the GRA6 gene was amplified by PCR with a pair of primers designated 3 | RESULTS GRA6F: GTAGCGTGCTTGTTGGCGAC and GRA6R: TACAA GACATAGAGTGCCCC. The reactions using AccuPower® HotStart 3.1 | Gross findings PCR PreMix kit (BIONEER, Deajon, Korea) were performed in a thermocycler (Bio- Rad, Hercules, USA).
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages9 Page
-
File Size-