UNIVERSITE TOULOUSE III – PAUL SABATIER

U.F.R. Sciences

T H E S E

Pour obtenir le grade de

DOCTEUR DE L’UNIVERSITE TOULOUSE III

Discipline : Physiopathologie moléculaire, cellulaire et intégrée

Présentée et soutenue par

Chrystelle Bonnart

Le 20 novembre 2007

Etude fonctionnelle de LEKTI et de sa nouvelle cible,

l’élastase 2 pancréatique

Directeur de thèse : Pr Alain Hovnanian

JURY

Pr Alain Hovnanian, Président Pr Pierre Dubus, rapporteur Pr Michèle Reboud-Ravaux, rapporteur Dr Heather Etchevers, examinateur 2 Heureux sont les fêlés, car ils laissent passer la lumière…

Michel Audiard

3 REMERCIEMENTS

Tout d’abord, mes remerciements s’adressent à mon directeur de thèse, Alain Hovnanian, pour m’avoir accueillie dans son équipe, pour m’avoir rapidement fait confiance en me laissant une grande autonomie et pour m’avoir encouragée à participer à des congrès internationaux. Je tiens à remercier Pr Pierre Dubus et Pr Michèle Reboud-Ravaux pour m’avoir fait l’honneur d’évaluer ce travail de thèse. Je remercie également Dr Heather Etchevers pour sa présence dans le jury de thèse. Je remercie vivement les enseignant-chercheurs et professeurs de l’UPS que j’ai eu l’occasion de croiser pendant mon monitorat. Tout d’abord, merci à Estelle Espinos, tu as assumé ton rôle de tutrice avec brio, tu as été à mes côtés dans mes débuts hésitants, merci pour ta disponibilité. Merci à Martine Briet et Pascale Bélenguer, qui m’ont fait bénéficier de leur grande expérience de l’enseignement. Un merci particulier à Nathalie Ortega, que j’ai eu la chance de rencontrer dans ma dernière année de monitorat. Nathalie, j’ai été ravie de partager ces longs moments de discussion avec toi, merci pour tes précieux conseils. Marie, je te remercie pour ton obstination pour identifier la fameuse protéase inconnue… Elle nous a tenues en haleine pendant une année entière, mais on l’a finalement démasquée ! Ce fut un plaisir et une chance inouïe de pouvoir travailler avec toi, puisque tu es avant tout une véritable amie ! J’en profite pour remercier Bernard Monsarrat et toute son équipe, en particulier Carine. Je tiens à remercier vivement Anne et Sylvie du service de transgenèse pour leur grande implication dans le projet qui nous a réunis, pour leurs compétences de haute voltige qu’elles dissimulent sous leurs combinaisons intégrales. Merci à Florence Capilla, qui, à elle toute seule, effectue un travail remarquable. Mes remerciements s’adressent aussi à Sophie Allart pour sa gentillesse et sa disponibilité, ainsi qu’à Isabelle Fourquaux et Nacer Benmeradi de la plate-forme de microscopie électronique de Rangueil. Un grand merci aux personnes de l’étage bleu : Delphine, Léon, vous formez un duo irremplaçable ! Heureusement que Valérie est là pour vous remettre dans le droit chemin. Heather, merci pour ta bonne humeur et nos discussions scientifiques… Idem pour Jean-Claude ! Merci Dominique pour ton dévouement pour la communauté. Pep, vérifies toujours que tu n’aies pas de peignes dans la poche ! Zulma, que la cosa siga bien! Courage aux thésards actuels, Olivier, Audrey, Marilena, Marie-Laure… une pensée à ceux que j’ai côtoyés jadis (Pascal, Pierre, Bruno, Céline…). Merci à celles et ceux plus récemment arrivés, Magalie, Stéphane (attention à la surconsommation de pizza), Angélique, Alexandra. Lucette, merci pour ton sourire enjoué qui met de bonne humeur… Gilbert, boire du café empêche de dormir, par contre, dormir empêche de boire du café (Philippe Geluck). J’espère un jour aller marcher sur vos traces au Mali, et vous envoyer une carte de là-bas moi aussi ! Je vous souhaite une excellente fin de carrière puis une bonne retraite bien méritée. Audrey, un grand merci pour ton temps passé à me couper des lames. D’ailleurs, si j’oublie, rappelle-moi que je te dois un pot de nutella ! Valérie, merci pour ton calme apaisant et ta bonne humeur.

4 Gégé, présidente ! Avec Gégé, plus de voiture dans les rues, tous à vélo. Avec Gégé, pas d’hypocrisie, on se parle avec franchise. Gégé, tu iras loin avec tes qualités humanistes, toi, tu penses vraiment à la planète. Je voterai pour toi ! Matthias, tu m’as aidée plus d’une fois à sortir de l’obscurantisme informatique. Je te remercie une fois de plus (mais jamais assez) pour ces nombreux sacrifices ! Je te souhaite la meilleure des carrières de chercheur, tu la mérites tellement. José, mais quel est ton secret ? Ta patience est impressionnante. Merci pour tes précieux conseils en biologie moléculaire et pour le support informatique 24h/24 ! Laure, la reine de la pipette ! Discrète, tu caches un dévouement certain pour l’aide à la communauté. Grâce à ton sourire permanent, tu remplis de quiétude tout l’étage bleu ! J’ai beaucoup apprécié de travailler en ta compagnie. Laetitia, tu es le pilier de notre équipe. Nous avons une chance ENORME de t’avoir à nos côtés. Bonne vie en cocc’ ! Matthieu, tu es arrivé peu de temps avant que je ne termine, mais je dois m’incliner devant tes compétences en post-production vidéo… Ravie de t’avoir rencontré ! Anaïs, merci pour tes fabuleux origamis, certains m’ont observée pendant de longs moments, suspendus en haut des étagères, je les conserverai précieusement. J’espère que le SID 2008 te donnera l’occasion de découvrir un pays qui te tient à cœur! Courage pour la poursuite de ta thèse, je suis sûre que tout se déroulera bien. Aurélie, tu ne gagneras pas ta course contre le temps. Ce qu’il faut, c’est l’apprivoiser. Et m’dis pas que c’est pas vrai !… Merci pour ta bonne humeur, ton humour, ton dévouement à la science, et surtout, nos expériences partagées sur nos chats respectifs… Céline B, la tornade ambulante… Où trouves-tu l’énergie nécessaire à tes prouesses journalières ? C’est peut-être dans l’eau naturelle des montagnes d’Auvergne ? Merci pour ton sourire au quotidien, tes expressions bien de chez toi, ton investissement à corps perdu dans cette belle histoire scientifique… Tu iras loin, me prédit ma boule de cristal ! L'expérience est une lanterne qu'on porte dans le dos et qui n'éclaire jamais que le chemin parcouru disait Oscar Wilde. Céline, dès notre rencontre, ta lanterne n’a cessé de m’éclairer tout au long de ces cinq années. Elle m’a tellement appris que je ne sais comment te remercier. Je garde un souvenir indélébile de nos conversations aussi scientifiques qu’extra-professionnelles sur la terrasse ensoleillée à l’odeur de souris, du temps où l’accès y était permis… Tout ce que j’espère, c’est que nos chemins se recroisent car c’est un plaisir de travailler à tes côtés ! Merci pour tout, vraiment. Avec toi, j’ai gravi des cols, j’ai franchi des rivières, j’ai traversé la Corse de la mer à la mer, j’ai dormi aux bords de lacs sauvages, j’ai assisté au spectacle magique d’un tournoiement de vautour dans le silence des hauteurs pyrénéennes, j’ai entendu des avalanches, j’ai affronté des tempêtes de neige glaciales, j’ai appris à voyager dans un petit coucou et je suis toujours vivante, plus que jamais ! Merci Vincent, car supporter une thésarde n’a pas dû être facile tous les jours…

5 AVANT-PROPOS

Lors de mon premier entretien avec celui qui allait devenir mon directeur de thèse, j’ai appris une chose importante qui m’a profondément marquée : les patients souffrant de maladies rares sont plus nombreux que ceux qui sont atteints de maladies fréquentes…

Une maladie est qualifiée de rare ou orpheline lorsqu’elle affecte moins d’une personne sur 2000. Actuellement, environ 8000 maladies rares sont recensées mais de nouvelles sont décrites régulièrement dans la littérature médicale. Elles constituent un groupe hétérogène de pathologies qui peuvent affecter pratiquement toutes des fonctions vitales de l’organisme. Si certaines maladies rares sont relativement bénignes, d’autres sont extrêmement graves voire invalidantes sur les plans physique et/ou psychologique. Mais surtout, face au nombre élevé de maladies rares et le peu de patients affectés par chacune d’entre elles, c’est à pas de fourmi que les chercheurs progressent.

Lorsque l’on s’intéresse à une maladie génétique rare, la première étape consiste à en identifier le gène causal. Ensuite, il est nécessaire d’étudier la fonction de la protéine codée par le gène afin de comprendre dans quelle voie biologique elle est impliquée. Enfin, il est important de comprendre comment l’altération de l’expression protéique peut expliquer les anomalies phénotypiques observées chez les patients. A ce niveau de l’étude, les modèles animaux mimant des maladies humaines sont extrêmement informatifs. A plus long terme, une connaissance précise des dérégulations moléculaires impliquées dans la physiopathologie de la maladie peut déboucher sur des stratégies thérapeutiques adaptées pour les patients. C’est dans ce contexte que s’inscrivent les thématiques du laboratoire, qui s’intéresse à plusieurs génodermatoses (maladies génétiques de la peau) dont le syndrome de Netherton.

6 Le syndrome de Netherton (SN) est une maladie génétique rare de la peau classée dans le groupe des ichtyoses. La période néonatale est particulièrement critique en raison de la déshydratation importante et du risque d’infections qui menacent sérieusement le pronostic vital des nouveau-nés. Une étape primordiale a

été franchie avec l’identification du gène par l’équipe d’Alain Hovnanian en 2000. Les sept années qui ont suivi ont permis de décortiquer les événements physiopathologiques principaux impliqués dans le SN et grâce à ces avancées, des solutions thérapeutiques plus adaptées pour les patients commencent aujourd’hui à se dessiner.

7 TABLE DES MATIERES

LISTE DES FIGURES ET TABLEAUX ...... 10 LISTE DES ABRÉVIATIONS...... 11 GLOSSAIRE DES TERMES DERMATOLOGIQUES OU MÉDICAUX ...... 12 INTRODUCTION ...... 13

PARTIE A - L’ÉPIDERME : STRUCTURE ET FONCTION ...... 15 I - Généralités...... 15 II - Les cellules constitutives de l’épiderme: nature, structure et fonction...... 16 II-1 Les kératinocytes ...... 16 II-2 Les mélanocytes...... 16 II-3 Les cellules de Langherans...... 18 II-4 Les cellules de Merkel...... 18 II-5 Les fibres nerveuses...... 19 III - Stratification épidermique...... 20 III-1 La couche basale...... 20 III-2 La couche épineuse...... 21 III-3 La couche granuleuse ...... 21 III-4 La couche cornée...... 22 IV - Les mécanismes moléculaires de la différenciation épidermique...... 23 V - Les annexes épidermiques...... 27 V-1 Les follicules pilo-sébacés...... 27 V-2 Les glandes sébacées ...... 31 V-3 Les glandes sudoripares...... 32 VI - La fonction barrière de l’épiderme ...... 32 VI-1 Systèmes d’adhésion intercellulaire ...... 35 VI-2 L’enveloppe cornée...... 38 VI-3 Les lamelles lipidiques intercornéocytaires ...... 43 VI-4 Défense antimicrobienne...... 50 VI-5 Pathologies liées à une perte de la fonction barrière de l’épiderme...... 52

PARTIE B – ACTIVITÉ PROTÉASIQUE DANS L’ÉPIDERME ...... 59 I - Les protéases ...... 59 I-1 Définition...... 59 I-2 Activité des protéases...... 59 I-3 Les différentes classes de protéase : Mécanisme catalytique – Fonction biologique...... 60 I-4 Régulation de l’activité protéasique ...... 67 II - Les inhibiteurs de protéase...... 67 II-1 Les inhibiteurs de protéases à sérine de type Kazal ...... 68 II-2 Paramètres cinétiques d’interaction et d’inhibition des complexes protéases / inhibiteurs...... 71 III - La balance protéases - inhibiteurs de protéases dans l’homéostasie épidermique...... 75 III-1 La desquamation...... 75 III-2 Cornification...... 76 III-3 Immunité cutanée innée...... 79 III-4 Conclusion ...... 80

PARTIE C - LE SYNDROME DE NETHERTON ...... 83 I - Clinique du syndrome de Netherton ...... 83 II - Histologie de la peau des patients SN...... 89 III - Analyse ultrastructurale de la peau de patient SN...... 90 IV - Traitements du SN...... 92 V - Physiopathologie...... 94 VI - LEKTI ...... 96 VI-1 Structure biochimique ...... 96 VI-2 Fonctions inhibitrices de LEKTI ...... 98 VII - SPINK5 et la dermatite atopique ...... 99

OBJECTIFS DE LA THÈSE...... 101

8 RÉSULTATS...... 103

CHAPITRE A : MATURATION PROTÉOLYTIQUE DES PRÉCURSEURS DE LEKTI ET CAPACITÉ INHIBITRICE DES FRAGMENTS...... 105 Article 1 ...... 105 Article 2 ...... 107 CHAPITRE B : IDENTIFICATION DES PROTÉASES-CIBLES DE LEKTI...... 109 Article 3 ...... 109 CHAPITRE C : CARACTÉRISATION D’UNE NOUVELLE PROTÉASE ÉPIDERMIQUE ...... 111 Article 4 ...... 111 DISCUSSION GENERALE ...... 113

CHAPITRE 1 - DIVERSITÉ STRUCTURALE ET FONCTIONNELLE DES FRAGMENTS DE LEKTI...... 114 I - Diversité de transcrits ...... 114 II - Diversité structurale des fragments protéolytiques...... 117 III - Diversité fonctionnelle des fragments protéolytiques ...... 120 IV - D1, le mystère reste entier...... 124 V- Conclusion...... 126 CHAPITRE 2 - QUELS SONT LES RÔLES BIOLOGIQUES POTENTIELS DE LEKTI ?...... 127 I - LEKTI contrôle le processus de desquamation...... 127 II - LEKTI contrôle la morphogenèse du follicule pilo-sébacé...... 128 III - LEKTI est un acteur de l’immunité innée...... 129 III-1 LEKTI contrôle la maturation de la cathélicidine...... 130 III-2 Rôle antimicrobien direct de LEKTI : une hypothèse… ...... 131 IV - LEKTI joue un rôle anti-inflammatoire / anti-allergique ...... 132 IV-1 Un rôle anti-inflammatoire / anti-allergique direct ?...... 132 IV-2 Un rôle anti-inflammatoire indirect ?...... 136 IV – LEKTI joue un rôle dans le développement du système immunitaire ...... 137 V – LEKTI régule la maturation protéolytique de l’hormone de croissance ...... 137 VI – Conclusion...... 138 CHAPITRE 3 - IDENTIFICATION D’UNE NOUVELLE PROTÉASE ÉPIDERMIQUE HYPERACTIVE EN L’ABSENCE DE LEKTI ...... 139 I - Une identification difficile, pourquoi ? ...... 139 II- Ela2 : une nouvelle cible (indirecte) de LEKTI...... 140 III – Rôle de l’élastase 2 in vivo et contribution dans le développement du phénotype SN...... 141 III-1 La surexpression de l’Ela2 induit des anomalies cutanées sévères...... 141 III-2 Quelles sont les cibles de l’Ela2 ?...... 142 III-3 Ela2 est-elle impliquée dans d’autres pathologies cutanées ? ...... 142 IV – Conclusion...... 144 CHAPITRE 4 - STRATÉGIES THÉRAPEUTIQUES DU SYNDROME DE NETHERTON : PERSPECTIVES...... 145 I – Choix de la cible thérapeutique ...... 146 I-1 KLK5 ...... 146 I-2 KLK7 ...... 147 I-3 KLK14 ...... 147 I-4 Ela2 ...... 148 I-5 Conclusion...... 148 II – Identification d’inhibiteur de protéase pour une thérapie de substitution du SN...... 149 II-1 Criblage à haut débit et « docking »...... 149 II-2 Criblage secondaire et validation in vivo...... 150 III – Conclusion...... 152 CONCLUSION GENERALE ...... 155 BIBLIOGRAPHIE...... 157 ANNEXES...... 169

ANNEXE 1 ...... 171 ANNEXE 2 ...... 173 ANNEXE 3 ...... 175 ANNEXE 4 ...... 177 ANNEXE 5 ...... 179 ANNEXE 6 ...... 181

9 Liste des figures et tableaux

Figure 1 – Schéma de la peau humaine...... 14 Figure 2 – Stratification épidermique ...... 17 Figure 3 - Le follicule pilo-sébacé (FP) : Structure schématique et histologie ...... 26 Figure 4 - Morphogénèse et cycle du follicule pilo-sébacé (FP)...... 29 Figure 5 - Représentation schématique des jonctions intercellulaires de l’épiderme..34 Figure 6 - Ultrastructure d’un desmosome et d’un cornéodesmosome...... 36 Figure 7 - Formation séquentielle de l’enveloppe cornée ...... 40 Figure 8 - Céramides de la couche cornée ...... 45 Figure 9 - Structure des lamelles lipidiques intercornéocytaires...... 46 Figure 10 - Structure lipidique en double-feuillet dans les corps lamellaires ...... 49 Tableau 1– Anomalies de la kératinisation ...... 54 Tableau 2 – Modèles murins présentant un défaut de barrière cutanée ...... 56 Figure 11 - Représentation schématique des résidus impliqués dans l’interaction protéase - substrat...... 58 Figure 12 - Mécanisme catalytique des protéases à sérine...... 61 Figure 13 - Poche catalytique des sous-classes de protéase à sérine ...... 62 Figure 14 - Niveaux de régulation de l’activité protéasique ...... 66 Figure 15 - Séquence et structure tridimensionnelle du domaine 3 de l’ovomucoïde.69 Figure 16 - Structure tridimensionnelle du complexe PSTI - trypsinogène...... 70 Figure 17 - Balance des protéases et des inhibiteurs de protéase dans l’homéostasie épidermique...... 74 Figure 18 - Caractéristiques cliniques du syndrome de Netherton...... 82 Figure 19 - Pathogenèse du cheveu Bambou...... 84 Figure 20 - Histologie de la peau des patients SN et immunodétection de LEKTI.....88 Figure 21 - Ultrastructure de l’épiderme des patients SN...... 91 Figure 22 - Organisation de SPINK5 et LEKTI...... 95 Figure 23 - Structures tridimensionnelles des domaines D1 et D6 de LEKTI et du domaine D3 de l’ovomucoïde...... 97 Figure 24 - Les trois précurseurs de LEKTI...... 115 Tableau 3 – Propriétés inhibitrices des fragments de LEKTI ...... 121 Figure 25 - Représentation tridimensionnelle des domaines D1, D1-caméléon et D6 de LEKTI ...... 125 Figure 26 - Conséquences de l’altération de la barrière chez les patients SN...... 134 Figure 27 - Structure de GR143783 et représentation tridimensionnelle du complexe entre l’élastase 2 pancréatique porcine et GR143783 ...... 151 Figure 28 - Cascades protéolytiques régulées par LEKTI dans l’épiderme...... 154

10 Liste des abréviations

CC : Couche Cornée

CG : Couche Granuleuse

CL : Cellules de Langhérans

CM : Cellules de Merkel

DA : Dermatite Atopique

EC : Enveloppe Cornée

EIC : Erythodermie Ichtyosiforme Congénitale

Ela2 : Elastase 2 pancréatique

FP : Follicule Pilo-sébacé (ou Follicule Pileux)

GK : Grains de Kératohyaline

ILC : Ichtyose Linéaire Circonflexe

IP : Inhibiteur de Protéase

KLK : Kallikréine

KO : Knock Out

LEKTI : Lympho-Epithelial Kazal Type Inhibitor

PAR : Protease-Activated Receptor

SCCE : Stratum Corneum Chymotrypsin-like Enzyme

SCTE : Stratum Corneum Trypsin-like Enzyme

SKALP : SKin-Derived AntiLeucoProteinase

SLPI : Secretory Leucocyte Protease Inhibitor

SPC : Subtilisin-like Proprotein Convertase

SPINK5 : Serine Protease INhibitor Kazal Type 5

TGase-1 : TransGlutaminase 1

TI : Trichorrhexis Invaginata

Wnt : Wingless-type MMTV integration site family member

11 Glossaire des termes dermatologiques ou médicaux

Acanthose : épaississement de la couche épineuse de l’épiderme

Atopie : prédisposition génétique à développer une hypersensibilité allergique qui s’accompagne d’un taux sanguin d’IgE élevé

Érythème : rougeur cutanée disparaissant à la vitropression

Érythrodermie : rougeur diffuse de la peau, de type inflammatoire

Hyperkératose : épaississement de la couche cornée

Ichtyose : peau sèche caractérisée par une desquamation visible de la couche cornée

Orthokératose : caractère normal de la couche cornée (antonyme : parakératose)

Parakératose : par opposition à l’orthokératose, la parakératose est un terme histologique décrivant la persistance anormale de noyaux dans la couche cornée

Papillomatose : élongation des papilles dermiques et formation de longues invaginations de l’épiderme dans le derme

Spongiose : dilatation des espaces intercellulaires

Trichorrhexie : anomalies morphologiques d’un poil ou d’un cheveu

12 INTRODUCTION

13 Pore sudoral Epiderme

Membrane basale Glande sébacée Muscle pilo-arrecteur Derme Canal excréteur de glande sudoripare

Follicule pileux Racine pilaire

Glande sudoripare Fibre nerveuse Vaisseaux sanguins Hypoderme

Figure 1 - Schéma de la peau humaine La peau comporte deux feuillets contigus, l’épiderme en surface et le derme sous-jacent, qui reposent sur un tissu adipeux, l’hypoderme. L’épiderme est un épithélium pluri-stratifié kératinisé qui comprend des annexes épidermiques dont une partie importante est logée dans le derme. Le corps humain est recouvert de follicule pileux excepté au niveau des régions palmo-plantaires (paume des mains et plante des pieds). Le follicule pilo-sébacé inclut un follicule pileux associé à une glande sébacée. Les glandes sébacées sécrètent du sébum qui assure la lubrification du poil. Chaque follicule pileux est relié à un muscle pilo-arrecteur qui contrôle le mouvement du poil. Les glandes sudoripares servent à évacuer la transpiration via le canal excréteur qui débouche au niveau des pores sudoraux à la surface de la peau. Le derme est richement vascularisé, et contient des fibres nerveuses qui se prolongent jusque dans l’épiderme. Ces différentes structures permettent à la peau d’assurer des fonctions protectrices, sensitives et thermorégulatrices. (Schéma modifié à partir de http://bio.m2osw.com/index.htm).

14 Partie A - L’épiderme : structure et fonction

I - Généralités

La peau est l’organe le plus étendu et le plus lourd du corps humain (15 % du poids total d’un adulte). La peau recouvre la totalité du corps et est en continuité avec les muqueuses au niveau des orifices naturels. Elle associe différentes structures tissulaires (épithéliales, conjonctives, vasculaires, musculaires et nerveuses) qui assurent de nombreuses fonctions indispensables à la vie terrestre

(sensitives, protectrices, thermorégulatrices, immunitaires et métaboliques) (1).

La peau comprend deux compartiments distincts, l’épiderme et le derme, séparés par une membrane basale (figure 1). L’épiderme, d’origine ectodermique, est un épithélium pluristratifié en contact direct avec l’environnement, et dont la fonction fondamentale est d’assurer une barrière de protection semi-perméable entre l’extérieur et l’intérieur de l’organisme. L’épiderme comprend des annexes

épidermiques logées en grande partie dans le derme et l’hypoderme : les follicules pileux (FP), associés étroitement aux glandes sébacées, et les glandes sudoripares.

Le derme est un tissu conjonctif innervé et vascularisé composé de fibroblastes dont le rôle est la synthèse de fibres de collagène et d’élastine responsables de la résistance mécanique et de l’élasticité de la peau. Grâce à une communication moléculaire importante, le derme joue un rôle important dans l’homéostasie

épidermique.

La peau repose sur un tissu adipeux profond, l’hypoderme, caractérisé par la présence d’adipocytes, cellules spécialisées dans le stockage des lipides. Ce tissu joue un rôle de réserve énergétique et d’isolant thermique.

15 II - Les cellules constitutives de l’épiderme: nature, structure et fonction

II-1 Les kératinocytes

L’épiderme est un épithélium pluristratifié et kératinisé où différents types cellulaires coexistent, les kératinocytes étant largement majoritaires (90%). Comme leur nom l’indique, ces cellules sont spécialisées dans la synthèse des kératines, protéines fibreuses de la famille des filaments intermédiaires. Elles sont organisées en tonofilaments qui s’associent avec les microfilaments d’actine et les microtubules pour former le cytosquelette intracellulaire. Au cours de la différentiation

épidermique, les kératinocytes migrent de la profondeur vers la superficie, au sein des quatre couches cellulaires successives que sont la couche basale, la couche

épineuse, la couche granuleuse et la couche cornée. Au cours de leur migration, les propriétés structurales et fonctionnelles des kératinocytes se modifient et concourent

à la formation de la couche cornée, selon le processus de cornification (figure 2A).

II-2 Les mélanocytes

Dérivant de la crête neurale, les mélanocytes représentent 3 à 5% de la population cellulaire épidermique. Leur fonction est la synthèse du pigment naturel de la peau, la mélanine, dont l’organite de stockage est le mélanosome. Les mélanocytes sont localisés dans la couche basale de l’épiderme, où ils interagissent avec les kératinocytes par l’intermédiaire de leurs dendrites, qui peuvent se prolonger entre les kératinocytes suprabasaux (2). Les mélanocytes transfèrent leurs mélanosomes aux kératinocytes avoisinants, où ils forment une calotte supranucléaire protégeant le matériel génétique des effets mutagènes des rayonnements ultraviolets (effet protecteur contre le développement de cancers cutanés). Les mélanocytes présents dans le FP sont responsables de la pigmentation du poil ou du cheveu. Le degré de pigmentation cutané, déterminé par

16 A

Cornéocyte Lipides intercellulaires Couche cornée Cornéodesmosome Grain de kératohyaline Couche granuleuse Jonction serrée Corps lamellaire Desmosome

Couche épineuse

Filaments intermédiaires de Kératines

Jonction adhérente

Couche basale

Noyau

Hémidesmosome

Lame basale

B Grains de C kératohyaline

Couche cornée Couche granuleuse Epiderme Couche épineuse Couche basale

Couche basale Derme

Figure 2 - Stratification épidermique (A) Schéma des différentes couches de l’épiderme et des éléments structuraux essentiels des kératinocytes. (B) Histologie d’une coupe de peau humaine après coloration à l’hématoxyline et à l’éosine, permettant la coloration du cytoplasme en rouge et des noyaux en bleu. Les quatre couches épidermiques sont indiquées sur la gauche. Les flèches montrent les mélanocytes logés entre les kératinocytes basaux. L’agrandissement montre les grains de kératohyaline caractéristiques de la couche granuleuse. (C) Modèle de division symétrique (gauche) ou asymétrique (droite) des cellules basales de l’épiderme. (A) et (C) : modifiés à partir de Fuchs (2007) ; (B) : modifié à partir de Lin and Fisher (2007).

17 la teneur en mélanine, représente un outil de prédiction performant pour évaluer le risque de cancer cutané dans la population générale. Ceci justifie de mieux connaître la biologie du mélanocyte pour la prévention des cancers et le développement de traitement anti-tumoral (3).

II-3 Les cellules de Langherans

Les cellules de Langherans (CL) sont des cellules dendritiques mobiles qui représentent 3 à 5% des cellules épidermiques. Issues de précurseurs hématopoïétiques CD34+ de la moelle osseuse, les CL sont des cellules présentatrices d’antigène qui forment un réseau de sentinelles surveillant en permanence le compartiment épidermique (4). Leur fonction est de capter, d’apprêter et de présenter les antigènes exogènes pénétrant dans l’épiderme aux lymphocytes

T, via le complexe d’immunohistocompatibilité de classe II (CMH II). Le contact avec un antigène exogène permet d’activer les CL immatures en cellule matures qui relaient l’information antigénique au système immunitaire adaptatif. Au plan moléculaire, les CL épidermiques expriment les antigènes CD1a, CD207 (langérine) de manière spécifique. Enfin, les CL contiennent un élément structural cytoplasmique spécifique, le granule de Birbeck qui se présentent sous la forme d’un petit bâtonnet se terminant quelquefois par une petite vésicule (aspect de raquette)

(1 , 2 , 5).

II-4 Les cellules de Merkel

Les cellules de Merkel (CM), découvertes en 1875 par Friedrich-Sigmund

Merkel, constituent la population cellulaire minoritaire de l’épiderme, et sont localisées au niveau de la couche basale de l’épiderme (2). Les CM dérivent de la crête neurale de l’épiderme (6). Elles possèdent à la fois des caractéristiques

épithéliales comme l’expression spécifique de la cytokératine 20 ou la formation de

18 desmosomes avec les kératinocytes voisins, et des caractéristiques neuronales comme la présence de vésicules neuro-sécrétoires cytoplasmiques. Les CM sont généralement considérées comme des mécanorécepteurs, capables de détecter la déformation tissulaire. Les CM libèrent alors des neurotransmetteurs qui agissent sur les terminaisons nerveuses adjacentes. Certaines CM sont associées à la région du bulge du follicule pileux, et exerceraient une fonction endocrine jouant un rôle dans le développement du poil (7). Une meilleure connaissance de la biologie des CM devrait permettre de mieux comprendre les mécanismes de leur transformation maligne qui peut conduire à des carcinomes très agressifs (8).

II-5 Les fibres nerveuses

Longtemps controversée, la présence de fibres nerveuses dans l’épiderme a

été mise en évidence grâce à des techniques immunohistochimiques et en microscopie électronique. L’innervation de l’épiderme permet de transmettre des signaux sensoriels de la perception du toucher, des variations de température, et de la douleur. Ces trois sensations sont assurées par différentes populations de neurones sensoriels : les mécanorécepteurs, les thermorécepteurs, et les nocicepteurs, respectivement. On peut observer une ramification des fibres nerveuses afférentes au niveau des follicules pileux, des couches épineuse et granuleuse ainsi qu’au niveau des CM. La capacité des kératinocytes à sécréter des substances chimiques modulant l’activité neuronale et à exprimer des récepteurs impliqués dans la sensation de douleur ou de chaleur suggère leur implication dans la transmission du signal sensoriel (9). Enfin, des fibres nerveuses ont été observées en contact avec les cellules de Langherans, dont elles pourraient moduler la fonction de présentation antigénique (10).

19 III - Stratification épidermique

La stratification épidermique repose sur la migration des kératinocytes au sein de quatre couches successives : la couche basale, la couche épineuse, la couche granuleuse et la couche cornée (figure 2A,B).

III-1 La couche basale

La couche basale est une monocouche de kératinocytes prolifératifs qui permettent le renouvellement constant de l’épiderme. De forme cuboïdale, les cellules basales synthétisent spécifiquement le couple de kératines 5 et 14, lesquelles sont reliées aux desmosomes (jonctions d’adhésion intercellulaire) des cellules adjacentes ou aux hémidesmosomes qui ancrent les cellules à la membrane basale. La division des cellules basales permet l’entrée en différenciation des kératinocytes dans la couche immédiatement supérieure, selon deux modèles qui coexistent (11) (figure 2C). Le premier modèle implique une division symétrique des cellules, où les deux cellules-filles se retrouvent adjacentes sur un plan horizontal dans la couche basale après division. L’une d’elles serait capable de se détacher de la membrane basale sous-jacente pour rejoindre le compartiment supérieur, entrant alors en différenciation, alors que l’autre resterait dans la couche basale en conservant son pouvoir prolifératif. Le second modèle s’appuie sur la capacité des progéniteurs à se diviser asymétriquent, en orientant leur fuseau mitotique de manière à ce qu’une des cellules-filles se localise dans le compartiment épineux alors que la première est maintenue dans la couche basale. Dans la peau adulte,

85% des divisions cellulaires observées sont asymétriques (12).

20 III-2 La couche épineuse

La couche épineuse est composée de cinq à dix strates de kératinocytes.

Dès l’entrée dans la couche épineuse, les kératinocytes cessent de se diviser. La couche épineuse (ou malpighienne) doit son nom aux nombreux desmosomes qui joignent les cellules et qui leur donnent un aspect épineux sur coupe histologique. La morphologie des cellules épineuses se modifie au cours de leur migration, avec un accroissement de leur taille dans les couches les plus superficielles. Les kératinocytes épineux sont caractérisés par la synthèse des kératines 1 et 10, qui remplacent les kératines basales 5 et 14 (13). Les connexions kératines - desmosomes garantissent aux kératinocytes une cohésion importante et leur confèrent une forte résistance mécanique (11). D’autres types jonctionnels (jonctions adhérentes), renforcent davantage cette cohésion cellulaire. Les cellules épineuses progressent vers la couche granuleuse par la poussée des cellules sous-jacentes.

III-3 La couche granuleuse

La couche granuleuse (CG) est la dernière couche vivante de l’épiderme. Elle est formée d’une à trois couches de kératinocytes aplatis, disposés parallèlement à la surface cutanée. Les kératinocytes granuleux renferment des granules cytoplasmiques particuliers, les grains de kératohyaline (GK), très facilement identifiable sur coupe histologique après coloration conventionnelle à l’hématoxyline et éosine (figure 2B). Dépourvus de membrane et de taille variable (0,5 à 2 μm), les

GK correspondent à des agrégats protéiques hautement insolubles. En microscopie

électronique, ils apparaissent comme des structures amorphes aux formes irrégulières, denses aux électrons. Chez les rongeurs, il existe deux types de GK qui se distinguent par leur morphologie et leur contenu protéique : les grains de grande taille, de type F, contiennent la profilaggrine, alors que les grains de petite taille, de type L, renferment la loricrine. Contrairement au rongeur, il n’existe que des grains

21 de type F chez l’homme, la loricrine étant majoritairement dispersée dans le cytoplasme des cellules granuleuses (14).

De nombreuses réactions biochimiques de natures très diverses se produisent dans le cytoplasme des cellules granuleuses, afin d’assurer la formation des structures essentielles de la couche cornée, c’est-à-dire l’enveloppe cornée et les lamelles lipidiques extracellulaires. L’enveloppe cornée correspond à une macrostructure protéique très rigide qui va renforcer la membrane plasmique des cellules de la couche cornée. Cette structure repose sur l’expression de précurseurs protéiques (involucrine, loricrine et profilaggrine) qui seront déposés le long de la face interne de la membrane avant d’être liés de manière covalente par l’action de la transglutaminase-1 essentiellement (15).

Synthétisés dans la partie supérieure de la couche épineuse, les corps lamellaires ou kératinosomes sont des structures vésiculaires qui occupent une grande partie du cytoplasme des kératinocytes granuleux. Ils contiennent un ensemble de molécules de natures protéique et lipidique qui sont sécrétées par exocytose dans l’espace intercellulaire à l’interface entre la couche granuleuse et la couche cornée (16). La transition entre ces deux couches se caractérise par la dissolution du noyau et des organelles, ainsi que l’agrégation du réseau de filaments de kératine en macrofibrilles.

III-4 La couche cornée

Les dernières étapes de la différenciation terminale donnent naissance à des cellules anucléées et dépourvues d’organelles appelées cornéocytes. La couche cornée (CC), ou stratum corneum (SC), est composée de cinq à dix assises de cornéocytes. Ces cellules très aplaties renferment une matrice fibreuse de kératine séquestrée à l’intérieur des cornéocytes grâce à l’enveloppe cornée. Les lipides intercellulaires dérivés des corps lamellaires sont maturés enzymatiquement afin de

22 former des structures lamellaires parallèles en continuité avec la membrane plasmique.

L’ultime étape de la différenciation épidermique correspond à l’élimination des cornéocytes les plus superficiels, par le processus de desquamation. Certaines enzymes protéolytiques déversées dans l’espace intercornéocytaire par les corps lamellaires vont progressivement digérer les cornéodesmosomes, systèmes jonctionnels reliant les cornéocytes entre eux. L’intensité de cette action enzymatique est d’autant plus importante que l’on s’approche de la superficie, et permet l’élimination des cornéocytes les plus superficiels uniquement. Ce processus de desquamation est invisible à l’œil nu dans une peau normale (16).

IV - Les mécanismes moléculaires de la différenciation épidermique

L’homéostasie épidermique repose sur un contrôle finement régulé de la balance entre la prolifération et la différenciation. Une diminution de la prolifération entraîne l’amincissement de l’épiderme et une perte de fonction protectrice ; inversement, une augmentation de la prolifération peut conduire à des états pathologiques comme le psoriasis ou le cancer.

Des études in vitro ont permis de montrer le rôle primordial du calcium dans l’activation de la différenciation des kératinocytes primaires. Cultivés en faible concentration de calcium (< 0,07 mM), les kératinocytes prolifèrent, ne forment pas de contacts intercellulaires, ne présentent pas de stratification, et produisent peu d’enveloppes cornées. L’augmentation du calcium à 1,2 mM dans le milieu de culture induit une redistribution rapide des protéines desmosomales (cadhérines, desmoplakine, plakoglobine…) du cytoplasme à la membrane plasmique, permettant l’assemblage fonctionnel des desmosomes, et donc la formation de contacts intercellulaires. Les kératinocytes initient la synthèse des kératines K1 et K10 au détriment des kératines basales K5 et K14. L’expression des marqueurs de la

23 différenciation comme la profilaggrine, l’involucrine, la loricrine et la transglutaminase

1 est augmentée, et l’enveloppe cornée devient apparente (17 , 18).

D’un point de vue mécanistique, le calcium extracellulaire se fixe sur les récepteurs transmembranaires sensibles au calcium (type récepteurs couplés aux protéines G). Cela induit l’activation de la voie de la phospholipase C (PLC), qui clive un lipide membranaire, le phosphatidylinositol 4,5 biphosphate (PIP2) en diacylglycérol (DAG) et Inositol triphosphate (IP3). L’IP3 induit le relargage de calcium

à partir des stocks du réticulum endoplasmique et de l’appareil de Golgi, augmentant ainsi le calcium intracytoplasmique. Ceci a pour effet d’ouvrir des canaux calciques membranaires, permettant un flux entrant de calcium augmentant encore davantage la concentration calcique intracellulaire. Le DAG ainsi que le calcium intracellulaire vont conduire à l’activation de la protéine kinase C (PKC). Celle-ci peut activer par phosphorylation des facteurs de transcription de la famille fos et jun capables de se fixer sur les sites AP-1 des régions promotrices des gènes de la différenciation. In vivo, il existe un gradient positif de calcium de la couche basale à la couche granuleuse, qui concorde parfaitement avec l’état de différenciation des kératinocytes (19). Le gradient de calcium épidermique joue donc un rôle majeur dans le contrôle de la différenciation terminale de l’épiderme. Le psoriasis est une pathologie cutanée caractérisée par un déséquilibre de la balance prolifération/différenciation. L’épiderme psoriasique présente un gradient de calcium anormal avec une concentration très faible dans la couche basale et très élevée dans les couches suprabasales (20).

La vitamine D (forme 1,25 dihydroxy) est un autre régulateur bien connu de la différenciation des kératinocytes. Localisée dans le cytoplasme, elle peut activer les récepteurs transmembranaires sensibles au calcium et induire ainsi des effets similaires à ceux du calcium seul. De plus, la vitamine D peut avoir un rôle direct sur l’activation génique en se fixant sur les éléments de réponse VDRE (Vitamin D

Response Element) présents sur les promoteurs des gènes des marqueurs de la

24 différenciation. Ainsi , le calcium et la vitamine D peuvent agir de manière synergique sur l’induction de la différenciation des kératinocytes (17).

D’autres facteurs, tels que le TGF- et l’acide rétinoïque, sont connus pour moduler la différenciation épidermique. Le TGF- inhibe la prolifération des kératinocytes basaux tout en induisant une différenciation anormale (de type cicatrisation), alors que l’acide rétinoïque régule négativement la différenciation en réprimant l’expression de certains marqueurs de la différenciation (21).

Différentes études ont mis en évidence le rôle primordial du facteur de transcription p63 dans le contrôle de la prolifération et de la différenciation

épidermique. p63 est un membre de la famille de protéines p53 qui code deux isoformes différant par la présence (isoforme TAp63) et ou l’absence (isorforme

Np63) d’une séquence peptidique N-terminale. Les souris invalidées pour p63 ont révélé un rôle crucial de ce facteur de transcription dans la morphogenèse des membres et de la région cranio-faciale, ainsi que dans la formation des épithéliums stratifiés, dont la peau (22 , 23). En outre, la sous-expression de p63 abolit la capacité des kératinocytes basaux à proliférer et à entrer en différenciation (24).

Un des gènes cibles bien connu de p53, Perp (p53 effector related to PMP-

22), est également activé par p63. Perp est une protéine membranaire localisée dans les jonctions desmosomales. Son invalidation dans un modèle murin conduit à un défaut d’assemblage des desmosomes qui perturbe considérablement l’homéostasie épidermique (25). Le facteur de transcription p63 semble donc orchestrer un ensemble de mécanismes nécessaires à la stratification épidermique.

25 Infundibulum Muscle pilo-arrecteur Isthme Glande sébacée

Bulge Gaine épithéliale externe (GEE)

Gaine épithéliale interne (GEI)

Tige pilaire

Bulbe

GEE GEI Tige pilaire Figure 3 - Le follicule pilo-sébacé (FP) : Structure CCo HuHe Cu Cu Co Me schématique et histologie Chaque FP comporte un poil et une glande sébacée associés à un muscle pilo-arrecteur. L’infundibulum correspond à une petite cavité formée par la sortie de la tige pilaire. Le bulge est un renflement qui sert de réservoir de cellules souches. La partie visible du poil correspond à la tige pilaire. Elle est entourée de deux gaines : la gaine épithéliale interne, (GEI); et la gaine épithéliale externe (GEE)). Ces gaines permettent à la tige d’être maintenue et guidée vers l’extérieur. A l’extrémité inférieure, un renflement détermine la localisation du bulbe pileux. Son agrandissement met en évidence la matrice qui contient des cellules matricielles en prolifération. Le bulbe pilaire a une structure en pelure d’oignons qui comprend de nombreuses couches concentriques successives : les couches de la tige pilaire (Me=Médulla, Co=Cortex, Cu=Cuticule), les couches de la GEI (Cu=Cuticule, He=Couche de Henle, Hu=Couche de Matrice Huxley), la couche compagnon (Cco) entourée de la GEE. Le bulbe est creusé d’une cavité de tissu conjonctif, la Papille dermique papille dermique. Les différentes couches du bulbe sont caractérisées par l’expression spécifique de kératines (K5, K14, K6, K16), de facteurs de transcription (GATA- 3, -cat, Lef-1 et de marqueurs de prolifération (Ki67). (Schéma modifié à partir de Fuchs et al. (2007), histologie modifiée à partir de http://education.vetmed.vt.edu/Curriculum/VM8054/La bs/Lab15/IMAGES/INTEGL16.jpg)).

26 V - Les annexes épidermiques

V-1 Les follicules pilo-sébacés

V-1.1 Structure

On peut distinguer deux types d’épiderme : l’épiderme palmo-plantaire

(localisé à la paume de la main et à la plante des pieds), et l’épiderme non palmo- plantaire, recouvrant le reste de la surface du corps et caractérisé par la présence de follicules pilo-sébacés (FPs).

La figure 3 montre la structure d’un FP. Chaque FP comporte un poil (tige pilaire) associé à une glande sébacée au niveau de la région de l’isthme. Au-dessus de l’isthme se trouve l’infundibulum, une petite cavité en contact avec la surface de la peau et bordée par un épithélium en continuité avec l’épiderme interfolliculaire.

Juste en dessous de l’isthme se situe le bulge, un renflement dans lequel a été démontré la présence d’un réservoir de cellules souches à haut pouvoir de régénération (26). Un muscle pilo-arrecteur inséré sur le FP est responsable du phénomène d’horripilation. Dans la région plus profonde du FP se situent la gaine

épithéliale externe, et la gaine épithéliale interne, qui sont disposées concentriquement autour de la tige pilaire centrale, lui servant ainsi de guide. La tige pilaire se décline en régions appelées cuticule, cortex, et médulla de la superficie vers le centre. A l’extrémité inférieure, un renflement détermine la localisation du bulbe pileux, constitué de cellules matricielles en prolifération et de nombreux mélanocytes. Le bulbe est creusé par une cavité, la papille dermique, formée d’un tissu conjonctif vascularisé et innervé (2). Les différentes couches concentriques du bulbe sont caractérisées par l’expression spécifique de kératines, de facteurs de transcription, et de marqueurs de prolifération (figure 3, agrandissement).

27 V-1.2 Morphogenèse et cycle du follicule pileux

Chez l’homme, les FPs se développent dès le 3ème mois de vie embryonnaire

à partir d’une placode ectodermique, qui se met en place suite à l’activation de voies de signalisation particulières (figure 4). L’épiderme embryonnaire est initialement constitué d’une monocouche de kératinocytes qui expriment constitutivement les molécules de la voie de signalisation Wnt. L’action conjointe de la voie Wnt et des messagers dermiques oriente les kératinocytes vers l’élaboration des placodes folliculaires (27). En revanche, certains kératinocytes échappant à la signalisation

Wnt et répondant à l’activation par les BMPs (Bone morphogenetic proteins) et à la signalisation via le récepteur Notch vont initier la formation de l’épiderme interfolliculaire. En conséquence, la résultante des différentes voies de signalisation mises en jeu dans l’épiderme ainsi que dans le derme prédestine les kératinocytes à former un épiderme interfolliculaire ou un FP (11).

Le FP subit des phases de dégénérescence et régénération pendant la vie entière. Le cycle pilaire peut se décomposer en 3 phases distinctes : la phase anagène (croissance), catagène (régression) et télogène (quiescence). Pendant la phase anagène (3 ans chez l’homme, 2 semaines chez la souris), le follicule pileux est le siège d’une intense activité proliférative des cellules matricielles. Ainsi, les cellules des différentes couches concentriques du follicule se différencient, et produisent des fibres de kératine assurant la pousse de la tige pilaire du poil ou du cheveu. La phase catagène (3 semaines chez l’homme, 3 jours chez la souris), correspond à la dégradation des deux tiers inférieurs du follicule pileux, associée à une forte activité apoptotique. Enfin, la phase télogène (3 mois chez l’homme, 2 semaines chez la souris), est une phase de repos qui se termine par l’ascension de la papille dermique, événement-clé nécessaire au redémarrage du cycle en phase anagène pour la régénération du follicule (11).

Le cycle pilaire est finement contrôlé au niveau moléculaire par différents acteurs. La kératine 17 a été proposée comme un régulateur de la transition entre la

28 Début des cycles folliculaires

Glande sébacée

épiderme Tige placode Papille pilaire dermique Mélanocytes

Morphogenèse du FP Tige pilaire en régression CATAGENE

TELOGENE Glande ANAGENE sébacée GEE Papille bulge GEI dermique Tige pilaire

Germe d’une bulge nouvelle tige Papille dermique pilaire

Nouvelle tige pilaire

Figure 4 - Morphogénèse et cycle du follicule pilo-sébacé (FP) L’épiderme embryonnaire monocouche est soumis à l’action de messagers moléculaires épidermiques et dermiques qui contrôle le développement des follicules pileux. Chaque follicule pileux suit ensuite un cycle pilaire qui comprend 3 phases: la phase catagène (régression), télogène (quiescence) et anagène (croissance). La phase catagène est caractérisée par une forte activité apoptotique qui résulte en la dégradation de la partie inférieure du FP. La phase télogène est une phase de repos dont l’ascension de la papille dermique marque la fin. Cet événement est crucial à l’entrée en phase anagène. Ce stade est caractérisé par une forte activité proliférative des cellules matricielles qui permettent la différenciation des différentes couches concentriques du follicule et la production de fibres de kératine nécessaire à la pousse du poil. (Schéma modifié à partir de Fuchs et al. (2007)).

29 phase anagène et catagène. Elle induirait l’entrée en apoptose des cellules de manière dépendante à la signalisation par le TNF (28). En outre, il a été montré un rôle important de la protéine Hairless dans le contrôle du cycle pilaire. Exprimé dans la gaine épithéliale externe et la matrice, Hairless est un répresseur transcriptionnel dont l’absence bloque l’ascension de la papille dermique nécessaire à l’entrée en phase anagène (29 , 30). Il a été montré que des mutations du gène hairless entraînaient des désordres capillaires congénitaux, comme l’alopecia universalis et l’atrichose papulaire (31 , 32).

V-1.3 Rôle du follicule pileux dans la régénération de l’épiderme et de

ses annexes

De nombreuses recherches ont porté sur la localisation de la niche des cellules souches épidermiques. Pendant longtemps, la communauté scientifique pensait que ces cellules souches étaient localisées dans la région germinative profonde du FP. Or, des expériences de rétention de colorant par les cellules (label retaining cells) ont permis d’identifier la région du bulge du follicule pilo-sébacé comme étant le véritable réservoir de cellules souches (26). Se divisant lors de la phase anagène du cycle pilaire, les cellules souches engendrent des progéniteurs à amplification transitoire (transit amplifying cells) qui migrent du bulge vers la papille dermique, où ils se divisent un nombre limité de fois avant de se différencier pour régénérer le FP. Le maintien de la population de cellules-souches dans la niche est rendu possible grâce à la capacité d’auto-renouvellement de ces cellules. Ce processus encore mal compris dépend de l’expression de facteurs de transcription comme c-myc, qui joue un rôle dans l’activation des cellules-souches, et LHX2 (33), qui au contraire favorise leur quiescence1.

1 La quiescence est un état de « dormance » cellulaire temporaire, caractérisé par un arrêt du cycle cellulaire.

30 En plus de leur capacité à renouveler les follicules pilo-sébacés, des progéniteurs à amplification transitoire de la matrice sont capables de migrer vers l’épiderme interfolliculaire et d’en assurer également la régénération. Ces résultats ont été observés non seulement dans un épiderme murin nouveau-né normal et dans un épiderme murin adulte en condition cicatrisante (34). Des études supplémentaires ont confirmé la capacité des cellules souches folliculaires à régénérer l’épiderme interfolliculaire murin après agression par dermabrasion.

Cependant, les auteurs ont démontré que la contribution des cellules souches folliculaires dans la régénération de l’épiderme interfolliculaire était transitoire (trois semaines). Ainsi, en condition normale, dans une peau adulte, les cellules souches folliculaires ne contribuent pas à la régénération de l’épiderme interfolliculaire, prouvant l’existence d’une population de cellules souches extra-folliculaire (35).

Très récemment, il a été montré que l’invalidation chez la souris de Rac-1, un membre de la famille Rho des petites GTPases associée au compartiment des cellules souches épidermiques, conduisait à un défaut de développement des FPs sans affecter l’épiderme interfolliculaire. Ceci suggère l’existence de deux populations distinctes de cellules souches contrôlant le renouvellement épidermique

(36). Cependant, cette étude est en contradiction avec une étude antérieure qui montrait que le défaut d’expression de Rac-1 entraînait également une absence de stratification épidermique (37). Ainsi, ces deux publications contradictoires, suggérant l’existence d’une seule ou de deux populations de cellules souches

épidermiques, soulignent les deux courants de pensée de la communauté scientifique.

V-2 Les glandes sébacées

Les glandes sébacées sont localisées juste au-dessus de la région du bulge et du muscle pilo-arrecteur (figure 3) (11). Elles contiennent des sébocytes qui produisent du sébum, une matière huileuse dont le relargage dans le canal pilaire

31 permet la lubrification de l’épiderme et la protection contre les infections bactériennes.

V-3 Les glandes sudoripares

Les glandes sudoripares sont abondantes au niveau des régions palmo- plantaires et des aisselles. Elles prennent naissance dans le derme profond où elles sécrètent un liquide constitué d’eau, d’acide lactique, d’urée, de toxines et de petits antibiotiques peptidiques. L’évacuation de la sueur se produit à travers un canal excréteur qui débouche sur l’extérieur au niveau du pore sudoral (figure 1). La fonction principale des glandes sudoripares est d’évacuer l’excès de chaleur afin de thermoréguler l’organisme lors des efforts physiques ou lors de fortes chaleurs.

VI - La fonction barrière de l’épiderme

En contact direct avec l’environnement, l’épiderme est continuellement l’objet d’agressions de natures physique, chimique, biologique et mécanique. De plus, il doit réguler la perte en eau de l’organisme pour éviter la déshydratation dont les conséquences peuvent être fatales. L’ensemble de ces fonctions sont assurées par la dernière couche de l’épiderme, le stratum corneum, dont les éléments structuraux uniques lui confèrent la fonction de barrière. L’efficacité de la barrière repose essentiellement sur les capacités de cohésion, de résistance et d’imperméabilité de la couche cornée. Ces trois propriétés sont respectivement dues aux systèmes jonctionnels intercellulaires, à l’enveloppe cornée et aux lamelles lipidiques extracellulaires.

32 33 Jonctions serrées

Jonctions adhérentes

Desmosomes

Jonctions communicantes

Figure 5 - Représentation schématique des jonctions intercellulaires de l’épiderme L’épiderme comprend quatre types de jonctions cellule-cellule qui diffèrent par leur structure et par leur fonction. Les jonctions serrées forment un anneau ceinturant les membranes latérales des kératinocytes au niveau de la couche granuleuse. Elles empêchent le passage des solutés de taille supérieure à 600 Da. Les jonctions adhérentes sont localisées dans toutes les couches vivantes de l’épiderme, et servent de point d’ancrage aux filaments d’actine du cytosquelette. Les desmosomes assurent une forte cohésion entre les kératinocytes, grâce aux propriétés adhésives de leur protéines extracellulaires. Enfin, les jonctions communicantes sont impliquées dans le couplage ionique et métabolique entre cellules ajacentes, en autorisant le passage d’ions (calcium) et de petites molécules (AMPc) inférieures à 1,5 kDa. (Schéma modifié à partir de http://www.unifr.ch/anatomy/elearningfree/francais/epithel/epithel05.html).

34 VI-1 Systèmes d’adhésion intercellulaire

Les kératinocytes comportent quatre types de jonctions intercellulaires que sont les (cornéo)desmosomes, les jonctions serrées, les jonctions communicantes

(Gap) et les jonctions adhérentes (figure 5).

Les desmosomes sont des jonctions adhésives intercellulaires abondantes dans les tissus soumis aux forces mécaniques (peau, muscle cardiaque). Ils sont présents dans toutes les couches épidermiques, et prennent le nom de cornéodesmosomes dans la CC. En microscopie électronique, ils apparaissent comme des structures caractéristiques denses aux électrons (figure 6). Les molécules desmosomales appartiennent à trois familles distinctes de protéine : les cadhérines (desmogléine, desmocolline), les protéines armadillo (plakoglobine, plakophiline) et les plakines (desmoplakine). Les cadhérines desmosomales sont des molécules d’adhésion transmembranaires, qui possèdent cinq sous-domaines extracellulaires qui forment des homo- ou hétéro-dimères en présence de calcium.

La région intercellulaire du desmosome est appelée desmoglea, dont la structure centrale correspond à la ligne dense médiane. La plakoglobine est une molécule adaptatrice liant les cadhérines, la desmoplakine et la plakophiline. La desmoplakine est responsable de la liaison entre les protéines armadillo et les filaments intermédiaires de kératine (38).

Au cours de la cornification, les desmosomes s’enrichissent en cornéodesmosine, une glycoprotéine qui est incorporée au niveau des cadhérines desmosomales après avoir été sécrétée par les corps lamellaires à la transition entre

CG et CC. La présence de la cornéodesmosine rend la ligne dense médiane des cornéodesmosomes plus épaisse (figure 6b) (39). Les cornéodesmosomes constituent des points d’attache très puissants entre les cornéocytes, assurant ainsi leur cohésion. Les molécules extracellulaires des cornéodesmosomes (desmogléine, desmocolline, cornéodesmosine) sont ensuite

35 A

B

Membrane Ligne dense Plaque dense Plaque dense plasmique médiane externe interne Filaments intermédiaires

Desmoglea

Desmoplakine Desmogléine Desmocolline Plakophiline Plakoglobine

Figure 6 - Ultrastructure d’un desmosome et d’un cornéodesmosome (A) Un desmosome comprend une partie extracellulaire, la desmoglea, composée de la desmogléine et de la desmocolline. Ces deux cadhérines s’hétérodimérisent en présence de calcium ce qui permet l’adhésion de deux cellules adjacentes. Les domaines intracellulaires des cadhérines se lient à la plakoglobine, la plakophiline et une région de la desmoplakine qui forme une structure dense aux électrons appelée plaque dense externe. La région plus profonde de la desmoplakine forme la plaque dense interne sur laquelle s’ancre les filaments intermédiaires de kératine. (B) Ultrastructure d’un cornéodesmosome, avec une densification de la desmoglea caractéristique, due à la présence de la cornéodesmosine dans l’espace extracellulaire de la jonction. (Schéma modifié à partir de Green et al. (2000)).

36 progressivement dégradées par les enzymes de la desquamation, afin de libérer les cornéocytes superficiels qui se détachent naturellement de l’épiderme.

D’autres jonctions intercellulaires, absentes de la couche cornée mais présentes dans les couches inférieures, viennent renforcer la fonction barrière de l’épiderme. C’est le cas des jonctions serrées, dont la présence dans l’épiderme a longtemps été controversée. Il est maintenant admis que de telles jonctions se localisent le long des membranes latérales de la couche granuleuse et participent à la protection contre la perte en eau trans-épidermique comme le démontre le modèle de souris invalidé pour Cldn-1, codant la claudine-1, une protéine constitutive essentielle des jonctions serrées (40).

Les jonctions communicantes (Gap) consistent en l’assemblage de connexines en anneaux entre deux cellules adjacentes, et forment ainsi des tunnels intercellulaires qui assurent le transport de petites molécules (41). Il a été montré que la surexpression de la connexine 26 chez la souris induisait un épiderme hyperprolifératif avec une perturbation de la barrière cutanée (42). En outre, des mutations dans le gène de la connexine 26 (GJB2) sont responsables de plusieurs maladies de la kératinisation, dont le syndrome de Vohwinkel, la kératodermie palmoplantaire avec surdité et le syndrome KID (43). La formation de jonctions GAP fonctionnelles apparaît donc essentielle au contrôle de la barrière cutanée.

Les jonctions adhérentes sont des jonctions intercellulaires présentes dans les couches vivantes de l’épiderme. Elles servent de points d’ancrage aux filaments d’actine du cytosquelette (44). Des mutations du gène codant la P-cadhérine, une protéine des jonctions adhérentes, entraînent des anomalies des cheveux mais pas de défauts cutanés (45). En revanche, des mutations de la -caténine, l’un des composants intracellulaires de ces jonctions, sont associées à l’apparition de tumeurs cutanées chez l’homme (46).

37 En conclusion, les jonctions intercellulaires de l’épiderme assurent une grande cohésion des kératinocytes, contribuant ainsi au maintien de l’intégrité de la barrière cutanée.

VI-2 L’enveloppe cornée

La résistance mécanique de la peau est conférée par une structure spécialisée de la couche cornée, l’enveloppe cornée (EC), véritable coque qui renforce la membrane plasmique des cornéocytes. L’EC comprend deux structures distinctes par leur localisation, leur composition et leur fonction : une structure intracellulaire protéique extrêmement rigide et insoluble, qui garantit la séquestration des macrofibrilles de kératine à l’intérieur du cornéocyte ; et une structure lipidique extracellulaire constituée d’une monocouche de céramides, qui sert d’ancrage aux lipides intercornéocytaires.

La structure protéique rigide et insoluble de l’EC résulte d’un assemblage covalent entre plusieurs précurseurs protéiques, grâce à l’action de transglutaminases (TGase), la TGase-1 principalement. Les TGases sont des enzymes calcium-dépendantes qui catalysent la formation de liaisons covalentes entre les résidus glutamine et lysine des protéines. La TGase-1 est exprimée dans la couche granuleuse de l’épiderme. Sa localisation membranaire stratégique favorise l’assemblage des protéines de l’EC. L’absence de TGase 1 entraîne une perte d’EC associée à une perte de fonction barrière cutanée, létale chez la souris (47). Chez l’homme, des mutations dans le gène de la Tgase 1, TGM1, sont responsables d’une ichtyose sévère, l’ichtyose lamellaire (48). Ces anomalies témoignent du rôle capital de la TGase-1 dans la formation de l’enveloppe cornée et de la barrière cutanée.

L’assemblage de l’EC est un processus séquentiel, finement régulé par l’augmentation du calcium intracellulaire qui induit d’une part l’expression génique

38 39 Couche épineuse Couche granuleuse Couche cornée

Etape 2 - Formation de Etape 3 - Phase de Etape 1 - Phase initiale l’enveloppe lipidique renforcement

Figure 7 - Formation séquentielle de l’enveloppe cornée L’augmentation du calcium intracellulaire induit l’expression génique des précurseurs de l’EC. Dans la phase initiale, les deux précurseurs, l’envoplakine et la périplakine, s’hétérodimérisent et se localisent sur la face interne de la membrane plasmique, rapidement rejoint par l’involucrine et les TGase-5 et TGase-1. Cette enzyme amorce la formation d’un réseau covalent d’involucrine et d’envoplakine, qui forme une armature protéique primaire particulièrement solide. Durant l’étape 2, les corps lamellaires contenant les précurseurs des lipides extracellulaires fusionnent leur membrane à la membrane plasmique. Les céramides -hydroxylés à longue chaîne (structure en figure 8A) présents dans la membrane fusionnée des corps lamellaires deviennent accessibles à la TGase-1 qui les lie aux protéines de l’EC (essentiellement à l’involucrine). L’alignement de la partie extracellulaire des céramides le long de la surface extérieure forme ainsi l’enveloppe lipidique, essentielle pour la fixation des lipides extracellulaires. De manière concomitante à la formation de l’enveloppe lipidique, il se produit une phase de renforcement de l’EC, qui repose sur l’expression et la polymérisation de la loricrine, composant majeur de l’EC (80%), qui forme des homodimères et des hétérodimères avec les SPR (small- proline rich). Ces polymères sont alors transférés en périphérie avant d’être liés à l’armature protéique primaire par la TGase-1. (Schéma modifié à partir de Candi et al. (2005)).

40 des précurseurs de l’EC, et d’autre part l’activation d’enzymes ou de processus moléculaires dépendants du calcium (figure 7). La majorité des gènes codant les précurseurs de l’EC sont regroupés au niveau du locus chromosomique 1q21, appelé le complexe de différenciation épidermique (49).

Les événements initiaux se déroulent dans les kératinocytes épineux superficiels, avec l’expression de deux précurseurs précoces, l’envoplakine et la périplakine. Ceux-ci s’hétérodimérisent et se localisent sur la face interne de la membrane sous l’effet de l’augmentation de la concentration calcique. L’involucrine et la TGase-1 sont synthétisées et migrent également à la membrane. Cette dernière amorce la formation d’un réseau covalent d’involucrine et d’envoplakine, qui forme une armature protéique primaire particulièrement solide.

Dans une deuxième étape, les corps lamellaires contenant les précurseurs des lipides extracellulaires fusionnent leur membrane à la membrane plasmique, déversant leur contenu entre la couche granuleuse et cornée. Les céramides à longue chaîne (céramide -hydroxylés à longue chaîne) présents dans la membrane fusionnée des corps lamellaires deviennent accessibles à la TGase-1 qui les lie aux protéines de l’EC (essentiellement à l’involucrine) par réaction de transestérification.

L’alignement de la partie extracellulaire des céramides le long de la surface extérieure forme ainsi l’enveloppe lipidique.

De manière concomitante à la formation de l’enveloppe lipidique, il se produit une phase de renforcement de l’EC, qui repose sur l’expression et la polymérisation de différentes classes de protéines. La loricrine, composant majeur de l’EC (80%), se distingue par son contenu en résidus glycine particulièrement élevé et sa nature insoluble. Les molécules de loricrine s’associent entre elles ou se lient à d’autres protéines comme les SPRs (small proline-rich proteins) grâce à l’activité enzymatique de la TGase-3. Ces polymères sont alors transférés en périphérie avant d’être liés à l’armature protéique primaire par la TGase-1 (50).

41 Un autre composé protéique de l’EC est le complexe filaggrine-kératine. La profilaggrine est une protéine de très haut poids moléculaire (500 kDa chez l’homme), dont l’insolubilité oblige à l’agrégation pour former des macrostructures granuleuses, les grains de kératohyaline. La séquence de la profilaggrine consiste en une région N-terminale qui précède une succession de motifs monomériques répétés de filaggrine de 35 kDa, séparés par des séquences peptidiques de liaison riches en résidus tyrosine. Pendant la différenciation terminale, la profilaggrine est déphosphorylée puis protéolysée progressivement jusqu’à l’unité monomérique mature de 35 kDa (51). La région N-terminale de la filaggrine est transloquée dans le noyau, suggérant son implication dans les événements nucléaires associés à la différenciation terminale épidermique (52). La filaggrine tire son nom de la contraction filament aggregating protein, en raison de sa capacité à agréger les filaments intermédiaires de kératine. Leur compactage en amas parallèle à la surface cutanée entraîne un effondrement cellulaire qui est à l’origine de l’aplanissement des kératinocytes dans les couches granuleuse et cornée. Après compactage, une partie des complexes filaggrine-kératine est également liée à l’EC de manière covalente.

Lors de la cornification, les monomères de filaggrine sont modifiés par déimination

(transformation des résidus arginines en résidus citrullines par l’action d’une peptidylarginine déiminase), ce qui a pour effet d’acidifier la filaggrine qui se détache alors des filaments de kératine. La filaggrine est ensuite complètement protéolysée en acides aminés libres hygroscopiques qui contribuent à la rétention d’eau dans la

CC. Ce mélange d’acides aminés constitue le facteur naturel d’hydratation (53).

L’expression d’une filaggrine anormale ou non maturée dans des modèles murins perturbe profondément l’homéostasie épidermique (54 , 55 , 56). En 2006, l’équipe d’Irwin McLean a identifié Flg (filaggrine) comme étant le gène causal de l’ichtyose vulgaire, une pathologie fréquente de la kératinisation (57).

L’enveloppe cornée contient de nombreuses autres protéines de diverse nature, telles que la cystatine  et SKALP, qui sont des inhibiteurs de protéase ; les

42 protéines d’enveloppe tardives (LEP), les protéines de la famille S100 qui possèdent des domaines de liaison au calcium, la trichohyaline, etc… L’ensemble des éléments structuraux de ce macro-réseau protéique contribuent à former une assise extrêmement résistante sur laquelle s’ancre l’enveloppe lipidique externe. Il s’agit d’une véritable plate-forme où se fixent les lipides extracellulaires de la couche cornée, encore appelés lamelles lipidiques.

VI-3 Les lamelles lipidiques intercornéocytaires

VI-3.1 Origine et composition

Lors de la transition entre couche granuleuse et couche cornée, des modifications biochimiques importantes sont responsables d’une composition et d’une organisation lipidique uniques dans l’espace intercornéocytaire. Les lipides majoritaires de la couche cornée sont les céramides, les acides gras et le cholestérol, en proportion équimolaire approximativement. Cette composition, qui diffère profondément de celle des membranes biologiques en raison de l’absence de phospholipide, est la clé de l’organisation des lipides en lamelles lipidiques ou lamellae (16).

Dans les kératinocytes épineux superficiels, on observe la présence d’organites ovoïdes dérivant de l’appareil de Golgi, les corps lamellaires. Ceux-ci renferment des enzymes cataboliques et les lipides précurseurs des lamelles lipidiques : le glucosylcéramide, le cholestérol et des phospholipides. Les corps lamellaires, dont la migration est polarisée vers la surface supérieure des kératinocytes granuleux, fusionnent leur membrane avec celle de la cellule à l’interface de la couche granuleuse et cornée, et déversent ainsi leur contenu dans l’espace extracellulaire par exocytose (58). Bien que les mécanismes moléculaires contrôlant l’exocytose des corps lamellaires soient encore mal connus, on sait qu’elle est accélérée en réponse à une perte de barrière cutanée provoquée par « tape

43 stripping », procédé qui consiste à détacher par arrachement les couches superficielles de cornéocytes. De plus, des études in vivo ont montré que l’exocytose

était accélérée par un influx d’ions chlorures, et retardée par un influx d’ions calciques (59). Enfin, une sécrétion accélérée des corps lamellaires a été mise en

évidence dans un modèle animal invalidé pour PAR-2 (Protease-activated receptor, récepteur activé par les protéases de type 2), suggérant que l’activation de PAR-2 régule négativement la sécrétion des corps lamellaires (60).

Les précurseurs lipidiques déversés par les corps lamellaires subissent des transformations enzymatiques majeures dans l’espace intercornéocytaire, grâce au déversement simultané de lipases. La -glucocérébrosidase et la sphingomyélinase acide synthétisent les céramides, respectivement par déglycosylation du glucosylcéramide et par clivage de la sphingomyéline. Un céramide correspond à l’association d’un acide gras sur une base sphingoïde, lié par liaison amide entre le groupement carboxyle de l’acide gras et l’amine de la base sphingoïde (figure 8A).

Neuf sous-classes de céramides (céramide 1 à céramide 9) ont été identifiées dans la CC humaine à ce jour (figure 8B). Elles diffèrent par la longueur de la chaîne hydrocarbonée et par la nature de la base sphingoïde (sphingosine pour les céramides 1, 2 et 5 ; phytosphingosine pour les céramides 3, 6 et 9 ; et 6- hydroxysphingosine pour les céramides 4, 7 et 8) (61). Le céramide 1, qui contient un ester d’acide linoléique lié à un AG à longue chaîne, a un rôle particulièrement important pour l’arrangement moléculaire des lamelles lipidiques de la CC (58). Les céramides transmembranaires de l’enveloppe lipidique (céramides -hydroxylés à longue chaîne) sont déterminants puisqu’ils créent une cohésion entre l’enveloppe protéique interne des cornéocytes et les lipides extracellulaires dont ils permettent l’arrangement moléculaire unique (62).

Les acides gras libres, issus de l’hydrolyse des précurseurs phospholipidiques par la phospholipase A2 sécrétée sont majoritairement saturés, avec une chaîne généralement composée de 22 à 24 carbones (58). Un déficit

44 A Chaîne hydrocarbonée (acide gras) B

Base sphingoïde

Figure 8 - Céramides de la couche cornée (A) - Stucture du céramide -hydroxylé à longue chaîne hydrocarbonée, céramide transmembranaire majeur de l’enveloppe lipidique, crucial pour l’arrangement spatial des lipides libres du SC. La base sphingoïde est liée à l’acide gras par une liaison amide. (B) - Céramides libres des espaces intercornéocytaires du SC Il existe neuf sous-classes de céramides (céramide 1 à céramide 9) identifiées dans le SC humain. Elles varient par la longueur de la chaîne hydrocarbonée ainsi que par la nature de la base sphingoïde (sphingosine pour les céramides 1, 2 et 5; phytosphingosine pour les céramides 3, 6 et 9; et 6-hydroxysphingosine pour les céramides 4, 7 et 8). N.B. : Une autre nomenclature peut être employée pour nommer ces différents céramides (EOS, NS…) : E : Liaison à l’acide linoléique par liaison ester O : AG -hydroxylé S : Sphingosine P : Liaison à la phytosphingosine par liaison amide N : AG non hydroxylé A : AG -hydroxylé

45 Cornéocyte

Enveloppe lipidique

Cornéocyte

EL Lamelles Lamelles lipidiques lipidiques intercornéo- intercornéo- -cytaires -cytaires EL

Cornéocyte

P

AP Enveloppe lipidique

Cornéocyte

Figure 9 - Structure des lamelles lipidiques intercornéocytaires Visualisation de lamelles lipidiques intercornéocytaires en microscopie électronique après post-fixation au tétroxyde de Ruthénium. Les bandes denses et claires aux electrons sont schématisées. Les lipides sont disposés perpendiculairement à la surface des cornéocytes, alignés et parallèles les uns aux autres de part et d’autre des enveloppes lipidiques de deux cornéocytes adjacents. L’alignement des groupements polaires (P) ou apolaires (AP) des lipides correspondent respectivement aux lignes denses ou claires aux électrons. (EL : Enveloppe lipidique) (Photographie et schéma modifié à partir de Swartzendruber et al. (1989)).

46 alimentaire en acides gras essentiels (acide linolénique, -3 ou l’acide linoléique, -

6) peut entraîner une ichtyose (peau sèche caractérisée par une desquamation visible de la couche cornée, cf. chapitre VI-5.1) (63).

Le cholestérol représente le troisième composé majeur des lamelles lipidiques. Le cholestérol provient en grande partie du matériel sécrété par les corps lamellaires, mais une fraction plus faible est issue de l’hydrolyse du sulfate de cholestérol, présent en faible quantité dans la couche cornée (2 à 5%). Ce lipide joue un rôle important dans le processus de desquamation puisqu’une pathologie humaine correspondant à une accumulation de sulfate de cholestérol, l’ichtyose récessive liée à l’X, conduit à une forte cohésion de la CC associée à une persistence des structures cornéodesmosomales (63).

Le sébum des glandes sébacées contient des esters de cholestérol, des diglycérides, des triglycérides qui sont relargués par le canal pilaire à la surface de l’épiderme où ils se mêlent aux lipides majoritaires de la couche cornée.

VI-3.2 Formation des lamelles lipidiques

La connaissance de l’organisation des lipides en lamelles lipidiques dans la couche cornée a évolué en même temps que les progrès technologiques. Les premières données ont été publiées dans les années 60 avec l’utilisation de la diffraction aux rayons X (64). L’observation des lipides épidermiques a été facilitée par la technique de microscopie électronique « cryo-fracture », et surtout avec l’utilisation du tétroxide de ruthénium, un agent post-fixateur préservant et contrastant les lipides pendant la procédure de préparation tissulaire (16). Les lamellae correspondent à une succession de lignes denses et claires aux électrons, parallèles à la surface des cornéocytes, et en étroite continuité avec l’enveloppe lipidique. Des expériences in vitro de reconstitution de lamellae à partir de mélange de lipides en proportion définie ont démontré que seule la composition lipidique

47 spécifique de la CC jouait sur cette organisation particulière (65). Un modèle d’arrangement spatial des lipides a été proposé sur la base de ces observations

(figure 9). Selon ce modèle, les lipides sont disposés perpendiculairement à la surface des cornéocytes, alignés et parallèles les uns aux autres de part et d’autres des enveloppes lipidiques de deux cornéocytes adjacents. Les têtes polaires des céramides ainsi que les groupements hydroxyles des acides gras ou du cholestérol s’alignent dans un plan parallèle à la surface des cornéocytes et correspondent aux lignes denses aux électrons. De même, les lignes claires correspondraient à l’alignement des chaînes hydrophobes lipidiques (66). D’après ce modèle, l’orientation organisée des lipides les uns par rapport aux autres rendrait compte non seulement de la succession des bandes denses et claires mais aussi de leur espacement.

Comme le démontrent les images de microscopie électronique, la disposition des lipides dans les corps lamellaires n’est pas aléatoire (figure 10). Les lipides sont sous forme de double feuillets membranaires empilés les uns sur les autres. Après leur sécrétion, ils fusionneraient bout à bout pour former les lamelles lipidiques de la

CC (16).

La nature hydrophobe des lipides lamellaires permet de limiter le déplacement des solutions aqueuses à travers la couche cornée. Cette propriété est cruciale pour lutter contre la déshydratation de l’organisme et permet aussi de stopper la pénétration de molécules exogènes hydrophiles.

48 Empilement de Membrane double-feuillets membranaires

B A

Figure 10 - Structure lipidique en double-feuillet dans les corps lamellaires (A) Visualisation d’un corps lamellaire en microscopie électronique après post-fixation au tétroxyde de Ruthénium. Les deux flèches montrent la délimitation de la membrane du corps lamellaire. (B) Le schéma illustre l’arrangement des lipides sous forme de piles de double feuillets membranaires. Après leur sécrétion, ils fusionneraient bout à bout pour former les lamelles lipidiques du SC. (Schéma modifiés à partir de Madison et al. (2003)).

49 VI-4 Défense antimicrobienne

La structure du stratum corneum joue un rôle primordial dans la protection anti-microbienne de l’épiderme, en constituant une barrière infranchissable. En plus de cette protection physique, l’épiderme a la capacité de lutter contre l’infection grâce au pH du stratum corneum et à la synthèse de peptides antimicrobiens naturels.

VI-4.1 Le pH

NHE-1 (Echangeur sodium-proton, type 1) est un transporteur ionique transmembranaire qui contrôle l’efflux de protons et l’afflux d’ions sodium au niveau de la membrane apicale de la couche granuleuse. L’activité de ce transporteur résulte en la formation d’un gradient de pH depuis la couche cornée profonde (pH =

7,5) jusqu’à la couche cornée superficielle (pH = 4,5). Le corps humain est ainsi recouvert d’un manteau acide qui semble jouer un rôle essentiel dans la défense antimicrobienne de l’organisme. L’acidité de la surface cutanée favorise le développement de la microflore naturelle tout en inhibant la croissance de certaines bactéries pathogènes (staphylocoques dorés) qui se divisent mieux à pH neutre (67).

De plus, une prédisposition aux infections cutanées a été observée dans différentes pathologies associées à une alcalinisation de la couche cornée (68). Le pH de la couche cornée joue donc un rôle important de défense contre l’infection en créant un environnement propice ou non à la croissance des microbes sur la surface de la peau.

VI-4.2 Les peptides antimicrobiens

L’épiderme synthétise un ensemble de peptides cationiques antimicrobiens spécialisés dans l’élimination active d’un large spectre de microorganismes

(bactéries, champignons, virus). En plus de leur propriété antibiotique, ces peptides

50 antimicrobiens modulent les réponses inflammatoires locales et conduisent ainsi à la mise en place d’une réponse immunitaire adaptative. Les défensines et la cathélicidine sont les deux grandes familles connues de peptides antimicrobiens cutanés (69).

Les défensines humaines exprimées par les kératinocytes regroupent les - défensines 1 à 3 (hBD-1 à hBD3). hBD1 est exprimée de manière constitutive dans les tissus épithéliaux, alors qu’hBD2 et hBD3 sont surexprimées respectivement dans la peau enflammée et dans les zones cutanées atteintes de psoriasis.

La cathélicidine est synthétisée de manière constitutive par les neutrophiles, les glandes sudoripares, et l’épithélium du follicule pileux, alors que les kératinocytes l’expriment de manière inductible en réponse à une agression cutanée. Son inactivation chez la souris désarme l’épiderme de ses propriétés anti-bactériennes vis-à-vis du streptocoque de groupe A (70). La cathécidine est donc un élément majeur du système de défense innée cutanée contre l’infection.

Au-delà des deux familles les plus connues, il existe d’autres molécules pour lesquelles des propriétés antimicrobiennes ont été mises en évidence. Il s’agit d’inhibiteurs de protéase, de chimiokines, ou de neuropeptides, etc.) (69).

L’ensemble des peptides antimicrobiens constituent des éléments importants de l’immunité cutanée innée.

51 VI-5 Pathologies liées à une perte de la fonction barrière de l’épiderme

VI-5.1 Les ichtyoses et autres anomalies de la kératinisation

Les ichtyoses regroupent un ensemble de pathologies de la cornification dont la cause est le plus souvent génétique. Ces maladies sont caractérisées par une desquamation anormale visible à l’œil nu sur l’ensemble du corps, qui s’accompagne d’une altération plus ou moins sévère de la barrière cutanée. Le terme ichtyose

(dérivant du grec « ichthys », qui signifie poisson) qualifie ce type de pathologies cutanées en raison de l’aspect sec et rugueux de la peau rappelant les écailles d’un poisson. D’un point de vue étiologique et clinique, les ichtyoses sont extrêmement hétérogènes. Elles peuvent apparaître dès la naissance ou plus tard, et être isolées ou associées à une pathologie plus complexe. L’identification des gènes causals permet d’établir un classement des ichtyoses sur la base moléculaire (tableau 1)

(71 , 72). Comme indiqué dans le tableau, de nombreuses ichtyoses sont dues à des mutations dans les gènes de la différenciation terminale. Cependant, des mutations de la loricrine n’entraînent pas d’ichtyose, mais une pathologie cutanée qui fait partie des kératodermies palmo-plantaires. Ce groupe de maladies génétiques de la kératinisation est caractérisé par un épaississement de l’épiderme qui affecte seulement la paume des mains et la plante des pieds.

VI-5.2 - Pathologie de la barrière chez les modèles animaux

Ces dix dernières années ont été marquées par le développement de nombreux animaux transgéniques ou déficients pour différentes protéines. Certains de ces modèles, caractérisés par une perte de barrière cutanée mesurée par l’augmentation de la perte en eau trans-épidermique (TEWL), sont particulièrement précieux pour la compréhension des mécanismes moléculaires contrôlant la mise en place d’une barrière cutanée efficace (tableau 2). Dans la majorité des cas, la perte de barrière est accompagnée d’anomalies majeures de synthèse, de structure, ou de

52 modifications biochimiques des lipides de la couche cornée et/ou de défauts importants dans la formation de l’enveloppe cornée. Un cas intéressant échappe à cette règle, il s’agit des souris invalidées pour Cldn-1 (Claudine-1) pour lesquelles aucune anomalie des lamelles lipidiques ou de l’enveloppe cornée n’a pu être notée

(40). Ces résultats démontrent que chez ces souris Cldn-1-/-, le défaut de barrière ne provient pas d’une anomalie de la couche cornée, mais d’une perte de fonction des jonctions serrées de la couche granuleuse. De manière surprenante, les souris invalidées pour la loricrine ou l’involucrine présentent un phénotype cutané normal avec des anomalies minimes de l’EC, indiquant la possible redondance de fonction de certaines protéines de l’EC chez la souris (73 , 74).

Comme indiqué dans le tableau 2, les protéines impliquées dans l’homéostasie de la barrière cutanée sont de nature très diverse, incluant des protéases, des inhibiteurs de protéase, des protéines des jonctions desmosomales, serrées ou GAP, des enzymes du métabolisme lipidique, des facteurs de transcription, et des récepteurs. Chacune de ces protéines joue un rôle spécifique et indispensable pour le contrôle de l’homéostasie cutanée.

53 Gènes - Protéines Locus Pathologies Pathogenèse

(1) TGM1 – Transglutaminase 1 1q21 (1) Absence d’enveloppe cornée (2) ABCA12 – ATP-binding cassette 2q34-q35 Ichtyose lamellaire (2) Anomalies de transport des lipides des transporter (faux-sens) corps lamellaires Absence de compactage de la kératine, FLG - Filaggrine 1q21 Ichtyose vulgaire Absence de facteur naturel d’hydratation Accumulation de sulfate de cholestérol SSase - Stéroïde sulfatase Xp22.32 Ichtyose récessive liée à l’X Inhibition des enzymes de la desquamation 12q12- Anomalies du cytosquelette de kératine KRT1 – Kératine 1 Erythrodermie ichtyosiforme q13 Anomalies de sécrétion des corps lamellaires KRT10 - Kératine 10 congénitale bulleuse 17q21 – fragilité cytosolique 12q11- Agrégats de tonofilaments dans couches KRT2e – Kératine 2e Ichtyose bulleuse de Siemens q13 épineuses supérieures et couche granuleuse Anomalies des corps lamellaires ABCA12 – ATP-binding cassette 2q34-q35 Syndrome du fœtus Arlequin Défaut de sécrétion des corps lamellaires transporter (non sens) Absence de barrière lipidique Ichtyoses isolées Absence de modification des lipides ALOXE3 – Lipoxygénase 3 Erythrodermie ichtyosiforme Diminution de la sécrétion des corps ALOX12B – 12R-Lipoxygénase congénitale lamellaires TGM5 – Transglutaminase 5 15q15 Peeling-skin syndrome Anomalie de formation de l’EC ? 19p12- FLJ39501 – cytochrome P450 Ichtyose lamellaire de type 3 Défaut dans la voie de la 12(R)-lipoxygénase q12 Ichthyin - Ichthyin 5 q33 Ichtyose congénitale Anomalie du métabolisme lipidique ? Ichtyose avec cholangite Perte de fonction des jonctions serrées CLDN1 – Claudine 1 3q28-q29 sclérosante intercellulaires

Suractivité protéasique SPINK5 – LEKTI 5q32 Syndrome de Netherton Desquamation prématurée FALDH – Déshydrogénase 17p11 Syndrome de Sjögren-Larsson Anomalie du métabolisme lipidique d’aldéhydes gras Syndrome de Dorfman-Chanarin Défaut d’oxydation des AG à longue chaîne CGI-58 – famille Estérase-lipase- 3p21 (maladie de stockage des lipides Accumulation de lipides neutres thioestérase neutres) Anomalies des corps lamellaires Absence de maturation des lipides GBA - -glucocérébrosidase 1q21 Maladie de Gaucher intercornéocytaires PAHX – Phytanyl-CoA hydroxylase 10pter- Maladie de Refsum Accumulation d’acide phytanique PEX7 – Péroxine 7 p11.2 Défaut de modifications post-traductionnelles SUMF1 – Fgly generating enzyme 3p26 Déficit en sulfatase multiple des sulfatases

Ichtyoses syndromiques NSDHL – 3 hydroxystéroïde Défaut dans la voie de biosynthèse du Xq28 Syndrome CHILD déshydrogénase cholestérol 13q11- GJB2 – Connexine 26 Syndrome KID (Kératite – q12 Défaut fonctionnel des jonctions GAP GJB6 – Connexine 30 Ichtyose – Surdité) 13q12

Tableau 1. Anomalies de la kératinisation

54 Gènes - Protéines Locus Pathologies Pathogenèse

Variant ichtyosique du syndrome de Vohwinkel ; Localisation nucléaire anormale de la LOR – Loricrine 1q21 Erythrokératodermie symétrique loricrine mutée progressive Défaut de formation de l’EC 12q12- KRT1 – Kératine 1 q13 Anomalie du cytosquelette KPP épidermolytique KRT9 – Kératine 9 17q12- Diminution de la résistance cellulaire q21 Anomalie du cytosquelette KRT6a – Kératine 6a 12q13 Pachyonychie congénitale Diminution de la résistance cellulaire 12q13 KRT5 – Kératine 5 Epidermolyse bulleuse simple Anomalie du cytosquelette 17q12- KRT14 – Kératine 14 avec KPP Diminution de la résistance cellulaire q21 DSG1 – Desmogléine 1 17q12 KPP striées Anomalie de l’adhésion intercellulaire DPK – Desmoplakine 6p24 PKG – Plakoglobine 17q21 Syndrome de Naxos Anomalie de l’adhésion intercellulaire Dysplasie ectodermique / PKP1 – Plakophiline 1q32 Anomalie de l’adhésion intercellulaire Syndrome de la peau fragile Anomalie de formation de l’enveloppe EVPL – Envoplakine 17q25 KPP adénocarcinome colique cornée 13q11- Syndrome de Vohwinkel Kératodermies Palmoplantaires (KPP) GJB2 – Connexine 26 Défaut fonctionnel des jonctions GAP q12 KPP avec surdité Dysplasie ectodermique GJB6 – Connexine 30 13q12 Défaut fonctionnel des jonctions GAP hydrotique GJB4 – Connexine 30,3 1p35,1 Erythrodermie variable Défaut fonctionnel des jonctions GAP GJB3 – Connexine 31 1p35,1 CTSC – Cathepsine C 11q14,1 Syndrome de Papillon-Lefèvre Déficit enzymatique SLURP-1 – SLURP1 8qter Kératodermie de Meleda Défaut de signalisation cellulaire

Tableau 1. Anomalies de la kératinisation (suite)

KPP : Kératodermie palmo-plantaire

55 MODELES FONCTION DE LA MURINS PATHOGENESE / ANOMALIES REF. PROTEINE GENE-PROTEINE KO Spink5 -Lekti Inhibiteur de protéase à - clivage des cornéodesmosomes Article 3 sérine de type Kazal -  maturation protéolytique de la filaggrine Hewett - Létalité post-natale < 1 jour 2005, Yang 2004 ichq/ichq : mutations Inhibiteur de protéase à -  activité de la légumaïne, protéase cible de la cystatine M/E Zeeuwen dans Cst6 - Cystatine cystéine -  activité de la TGase 3 ( maturation de la pro-TGase 3 par 2004 M/E légumaïne) - Accélération de l’agrégation de la loricrine KO Tmprss6 - Protéase à sérine - Défaut de maturation de la profilagrine List 2003 Matriptase membranaire - Anomalie de formation de l’enveloppe lipidique - Désorganisation des lipides des corps lamellaires - Surface de l’enveloppe cornée augmentée KO Caspase-14 – Protéase à aspartate - Défaut de maturation de la filaggrine en acide aminés hygroscopiques Denecker Caspase 14 - Défaut de la protection anti-UVB de la couche cornée 2007 Tg Klk7 – KLK7 Protéase à sérine de la - Présence de fines squames sur le dos Hansson desquamation - Perte de barrière minime 2002 KO Prss8- Channel- Protéase à sérine - Composition lipidique du SC anormale Leyvraz activating serine membranaire activant des - Altération du processing de la profilaggrine, absence du monomère 2005 protease canaux -  taille des cornéocytes - Létalité post-natale <60h KO Cldn1 - Protéine structurale des -  perméabilité des jonctions serrées dans la couche granuleuse Furuse Claudine-1 jonctions serrées - Létalité post-natale < 1 jour 2002 - (Enveloppe cornée et lamellae normaux) Tg Cldn6 - Claudine- Protéine structurale des -  maturation protéolytique de la filaggrine Turksen 6 jonctions serrées -  expression de Klf4 et protéines SPR (small proline rich) 2002 - Fragilité de l’enveloppe cornée KO Dsp - Protéine structurale des - Anomalies des desmosomes : absence de la plaque dense interne, absence de Vasioukhin Desmoplakine desmosomes connexions aux filaments de kératine 2001 - Clivage intercellulaire entre couche basale et couche épineuse et perte d’adhésion des cellules suprabasales - (Lamellae normaux) KO Dsc1 - Protéine structurale des - Présence de fines squames sur le corps entier Chidgey Desmocolline -1 desmosomes - Décollement de la couche cornée 2001 Tg Cx26 - Connexine Protéine structurale des - Relargage d’ATP via les canaux GAP => perturbation de la concentration Djalilian 26 jonctions GAP calcique => perturbation de la prolifération / différenciation et mise en place de 2006 réponses inflammatoires KO Pig-a – Permet l’ancrage - Défaut de maturation de la profilaggrine (absence de monomère) Hara- Glycosylphosphatidy membranaire de type GPI - Désorganisation des lipides des corps lamellaires et des lamellae Chikuma linositol (GPI) des protéines 2004 KO Tgm1 – Transglataminase qui - Absence d’enveloppe cornée Kuramoto Tranglutaminase 1 catalyse la liaison - Absence d’enveloppe lipidique 2002 covalente entre les - Lamelles lipidiques désorganisées molécules de l’enveloppe - Létalité post-natale < 1 jour cornée KO Ugcg – Enzyme catalysant la - Anomalies de l’arrangement lipidique dans les corps lamellaires Jennemann Glucosylcéramide synthèse du - Décollement de la couche cornée 2007 synthase glucosylcéramide KO Fatp4 – Fatty Protéine de transport des - Composition épidermique en acides gras anormale Herrmann acid transport protein acides gras à longue et -  taille des grains de kératohyaline de type F 2003 4 très longue chaîne KO Evovl4 – Enzyme d’élongation des - Absence de céramide -hydroxylé à longue chaîne Vasireddy Elongation of very acides gras à très longue - Désorganisation des lipides des corps lamellaires et des lamelles lipidiques 2007 long chain fatty acid chaîne - Létalité post-natale < 1 jour - 4 KO Alox12b -12R- Enzyme de conversion de - Fragilité de l’enveloppe cornée Epp Lipoxygénase l’acide arachidonique - Composition épidermique en céramides anormale 2007 KO Klf4 – Kruppel- Facteur de transcription - Altération de l’enveloppe cornée Segre 1999 like factor 4 - Lamelles lipidiques désorganisées - Activation transcriptionnelle de gène (SPR, Répétine, PAI2) - (Maturation de la profilaggrine normale)

56 MODELES FONCTION DE LA PATHOGENESE / ANOMALIES REF. MURINS PROTEINE KO Gata-3 – Facteur de transcription - Composition des lipides épidermiques anormale De GATA-3 - Désorganisation des lipides des corps lamellaires Guzman - Absence de filaments entre les grains de kératohyaline Strong 2006 KO Grainy head Facteur de transcription - Absence d’enveloppe cornée Ting - Anomalie dans l’enveloppe lipidique 2005 - Lamelles lipidiques désorganisées -  expression de TGase1 KO Arnt – Aryl Facteur de transcription - Composition des céramides épidermiques anormale Geng hydrocarbon -  expression de précurseur de l’enveloppe cornée (S100, SPR) et d’inhibiteur 2006 receptor nuclear de protéase (SLPI, Serpines) translocator - Anomalie de l’enveloppe cornée KO Ikk1 – Inhibiteur de kinase - Composition lipidique du SC anormale Gareus Inhibitor of NF-B -  expression de la claudin-23, et de l’occludine (jonctions serrées) 2007 Kinase 1 Ki RAR403 Récepteur à l’acide - Altération du processing lipidique ( phospholipides et glucosylcéramides dans Attar (dominant negatif) rétinoïque la couche cornée) 1997

Tableau 2 . Modèles murins présentant un défaut de barrière cutanée

57 Substrat Liaison peptidique cible

N C

Protéase

Figure 11 - Représentation schématique des résidus impliqués dans l’interaction protéase - substrat La nomenclature permettant de décrire l’interaction d’une protéase pour son substrat a été introduite en 1967 par Schechter et Berger. Par convention, les résidus du substrat sont appelés avec la lettre P pour «peptide» et ceux de la protéase sont nommés S pour «subsite». Le clivage d’une liaison peptidique par une protéase s’effectue entre les résidus notés P1 et P1’ localisés respectivement du côté N-terminal et C-terminal du substrat. Les résidus s’éloignant du résidus P1 vers la région N- terminale sont notés P2 à Pn alors que les résidus s’éloignant du résidus P1’ vers la région C-terminale sont notés P2’-Pn’. Les résidus Pn et Pn’ du substrat interagissent respectivement avec les sous-sites Sn et Sn’ de la protéase. (Schéma modifié à partir de Turk et al. (2006))

58 Partie B – Activité protéasique dans l’épiderme

I - Les protéases

I-1 Définition

Les protéases sont des enzymes capables de catalyser le clivage des protéines par hydrolyse des liaisons peptidiques. Elles ont longtemps été considérées comme des enzymes « agressives », ayant pour seul but la dégradation non spécifique des protéines alimentaires ou le turn-over des protéines intracellulaires. Aujourd’hui, on sait que leurs fonctions sont loin d’être aussi restrictives. En effet, les protéases assurent la régulation de très nombreux processus physiologiques vitaux : développement embryonnaire, digestion, coagulation, cicatrisation, défense immunitaire, contrôle du cycle cellulaire, différenciation, migration, et apoptose. Une analyse bio-informatique a permis l’identification de 553 protéases chez l’homme (ce qui représente 2% du génome) et

628 chez la souris (75).

I-2 Activité des protéases

Les protéases se répartissent en endopeptidases ou exopeptidases selon qu’elles hydrolysent les liaisons peptidiques à l’intérieur de la séquence protéique, ou qu’elles clivent les acides aminés à partir des extrémités. Le clivage protéolytique n’est pas aléatoire, il est guidé par des interactions locales non covalentes qui s’établissent entre la protéase, en particulier au niveau du site actif, et son substrat.

Selon la nomenclature de Schechter et Berger, la liaison peptidique hydrolysée est la liaison P1-P1’; P1 correspondant au résidu N-terminal par rapport à la liaison peptidique hydrolysée, et P1’ au résidu C-terminal. P1 et P1’ interagissent avec les résidus S1 et S1’ du site catalytique de la protéase, respectivement (figure 11) (76).

De nombreuses interactions supplémentaires se forment de part et d’autre de la

59 liaison peptidique centrale, entre les résidus Pn ou Pn’ du substrat et Sn ou Sn’ de l’enzyme. L’ensemble des interactions qui s’établissent entre la protéase et son substrat avant l’hydrolyse définissent ainsi la spécificité de l’enzyme. Enfin, l’activité catalytique des protéases dépend également de facteurs environnementaux comme la température, le pH, la force ionique et la présence de cofacteurs.

Dans la littérature, on distingue quatre grandes classes de protéases : les protéases

à sérine, à cystéine, à aspartate, et les métalloprotéases, qui diffèrent par la nature du résidu essentiel impliqué dans l’hydrolyse.

I-3 Les différentes classes de protéase : Mécanisme catalytique –

Fonction biologique

I-3.1 Les protéases à sérine

Les protéases à sérine se caractérisent par la présence de trois acides aminés conservés (sérine en position S1, histidine et acide aspartique) impliqués dans la formation du site actif de l’enzyme. Leur alignement forme la « triade catalytique ». Le mécanisme protéolytique d’une protéase à sérine repose sur l’attaque nucléophile de la liaison peptidique cible d’un substrat par la sérine S1. Ce mécanisme est illustré par l’exemple de la chymotrypsine en figure 12. La trypsine, la chymotrypsine et l’élastase sont les trois enzymes typiques représentant trois sous- classes de protéases à sérine. Malgré un mécanisme catalytique commun, leur spécificité envers les résidus clivés (P1) est variable. Cette spécificité est guidée par la taille et la nature des résidus impliqués dans la « poche catalytique » de chacune des sous-classes (figure 13). La trypsine possède une poche catalytique étroite, profonde, et chargée négativement, qui accepte des résidus arginine ou lysine, dont la chaîne latérale est longue et chargée positivement. Au contraire, la chymotrypsine possède une large poche hydrophobe qui accueille le groupement aromatique des

60 ABC

S1 Enzyme : Triade catalytique

P1’ P1 Substrat

Liaison peptidique cible

F E D

G HI

Figure 12 - Mécanisme catalytique des protéases à sérine (A) Dans une première étape, le résidu P1 du substrat se positionne en face du résidu S1 (Ser-195) de la chymotrypsine prise comme exemple. (B,C) Un J déplacement des charges électroniques induit l’attaque nucléophile par la sérine active (Ser-195) du carbone du carbonyle de la liaison peptidique avec formation d’un intermédiaire tétraédrique chargé négativement (C). La rupture de l’intermédiaire tétraédrique aidée par la pronotation de l’azote par l’ion imidazolium de l’His-57 conduit à la libération de la chaîne peptidique (côté N-terminal) et à la formation d’un acyl-enzyme (D,E). L’hydrolyse de l’acyl-enzyme est réalisée par l’attaque par une molécule d’eau du carbonyle aidée par l’imidazole de l’His-57 jouant le rôle de catalyseur général basique (F-H). La rupture de l’intermédiaire tétraédrique formé, aidé par l’ion imidazolium de l’His-57 protonée conduit à la libération de la partie C-terminale du substrat protéique (I-J). L’oxygène de la sérine capture un proton, et la triade catalytique retrouve son état initial. L’enzyme devient disponible pour une nouvelle hydrolyse peptidique. (Schéma modifié à partir de http://www.bio.cmu.edu/courses/03231/Protease/SerPro.htm)

61 Résidus P1 du substrat

A -Trypsine B - Chymotrypsine C - Elastase

Figure 13 - Poche catalytique des sous-classes de protéase à sérine (A) La trypsine possède un résidu aspartate (charge négative) en position 189 localisé au fond d’une poche catalytique étroite et profonde. Ainsi, les résidus arginine et lysine du substrat, dont la chaîne latérale est chargée positivement, vont pouvoir interagir avec Asp-189. (B) La chymotrypsine possède au contraire une large poche hydrophobe qui va plutôt lier un groupement aromatique (phénylalanine, tryptophane, tyrosine). (C) Enfin, l’élastase possède une poche réduite qui permet d’accueillir des résidus courts et non chargés (alanine, valine, glycine). (Schéma modifié à partir de http://perso.orange.fr/jean-jacques.auclair/enzserine/schemas.htm)

62 résidus phénylalanine, tryptophane, ou tyrosine. Enfin, l’élastase possède une poche réduite, permettant de loger des résidus courts et non chargés (alanine, glycine).

Caractérisées par un pH optimal d’activité neutre, les protéases à sérine sont impliquées dans un grand nombre de processus physiologiques : la trypsine, la chymotrypsine et l’élastase pancréatiques jouent un rôle important dans la digestion des protéines alimentaires. Par ailleurs, il existe des voies physiologiques qui reposent sur des activations en cascade de protéases à sérine. Deux exemples bien connus sont la coagulation sanguine et le système du complément.

I-3.2 Les protéases à cystéine

Les protéases à cystéine (ou thiol protéase) ont un mode de fonctionnement analogue aux protéases à sérine, dépendant de la triade catalytique formée par les résidus asparagine, histidine et cystéine (S1) (77). En revanche, les protéases à cystéine fonctionnent à pH acide. La papaïne, une protéase du latex de papayer, est la protéase à cystéine la mieux caractérisée. Les cathepsines B, H, L, S et K sont des protéases à cystéine lysosomales qui dégradent les protéines intracellulaires ainsi que certaines protéines exogènes captées lors de la digestion alimentaire. Au niveau cytoplasmique, on trouve les calpaïnes, enzymes ubiquitaires dépendantes du calcium, dont la fonction serait d’activer un nombre important de protéines intracellulaires par protéolyse limitée. Certaines caspases font également partie de la classe des protéases à cystéine, et jouent un rôle essentiel dans le déclenchement du processus d’apoptose (78).

I-3.3 Les protéases à aspartate

Les protéases à aspartate sont des enzymes actives à pH acide caractérisées par la présence de deux acides aspartiques formant le site catalytique.

63 Le clivage peptidique par les protéases à aspartate repose sur un mécanisme acide- base.

Les protéases à aspartate incluent la pepsine, une enzyme digestive et la rénine, une protéase synthétisée par le rein qui intervient dans la régulation de la pression sanguine. La protéase du virus de l’immunodéficience humaine (VIH) responsable du SIDA, qui appartient aussi à cette classe, est une cible thérapeutique qui fait l’objet de nombreuses recherches afin d’identifier des inhibiteurs efficaces limitant le développement de résistance virale (79).

I-3.4 Les métalloprotéases

Les métalloprotéases présentent un mécanisme catalytique différent des classes précédentes. Celui-ci implique l’activation d’une molécule d’eau par un ion métallique divalent, Zn2+, maintenu en place dans le site actif de l’enzyme au moyen de liaisons de coordination établies avec des acides aminés de l’enzyme. La molécule d’eau activée sert d’agent nucléophile pour attaquer la liaison peptidique.

Parmi les différentes familles de métalloprotéases, les MMP, métalloprotéases matricielles, jouent un rôle primordial dans la dégradation des protéines de la matrice extracellulaire (collagène, laminine, fibronectine…), créant ainsi des interstices pour faciliter la migration cellulaire. De nombreuses études ont montré la surexpression des MMPs dans les cancers. Leur implication dans la croissance tumorale et la progression des métastases a été révélée grâce à la détection de MMPs actives au front de migration des tumeurs (80). Cependant, certaines MMPs pourraient avoir, au contraire, une action répressive sur la progression tumorale, comme la MMP-8 dont l’inactivation chez la souris conduit à une augmentation de la survenue de cancers cutanés (81). La multiplication des

études sur les MMPs a permis de montrer la diversité des rôles de ces enzymes, incluant la digestion de la matrice extracellulaire (MEC), le relargage de facteurs de

64 65 Transcription Traduction

Zymogène propeptide

Activation par protéolyse

Protéase mature Inhibiteur de protéase

P1 P1’ pH Force ionique Température Substrat protéique

Figure 14 - Niveaux de régulation de l’activité protéasique L’activité protéasique est régulée par deux mécanismes spécifiques. D’une part, les protéases sont synthétisées sous la forme de précurseurs inactifs, les zymogènes. Ils sont ensuite activés grâce à l’élimination par protéolyse d’une dizaine d’acides aminés dans la région N-terminale (propeptide), ce qui aboutit à la formation de protéases matures. D’autre part, il existe une régulation directe de l’activité protéasique par les inhibiteurs de protéase (IP), dont le rôle est de se fixer à la protéase afin d’empêcher son activité protéolytique. Les activités protéolytiques des protéases et inhibitrices des IP sont modulées par les facteurs environnementaux (pH, force ionique, température, cofacteurs…).

66 croissance emprisonné dans la MEC, comme l’IGF (Insulin growth factor) ou le FGF

(fibroblast growth factor). Certaines MMPs sont capables de protéolyser le récepteur au LPS CD14, influencant ainsi l’immunité innée (82).

I-4 Régulation de l’activité protéasique

Par leur nombre et la diversité de leur fonction, il semble évident que les protéases jouent un rôle capital dans le maintien de l’homéostasie tissulaire et cellulaire. Cependant, afin de limiter les effets délétères d’un excès d’activité protéolytique, il est essentiel que l’activité des protéases soit parfaitement contrôlée dans l’espace et le temps. La compartimentation subcellulaire de l’enzyme dans l’organisme est le premier élément de régulation qui rentre en compte. En plus de la régulation du niveau de synthèse et de dégradation protéique, la nature a mis en place deux mécanismes majeurs spécifiques pour le contrôle de l’activité protéolytique (figure 14). Tout d’abord, les protéases sont synthétisées sous forme de précurseurs inactifs ou très faiblement actifs, les zymogènes, afin d’assurer la protection cellulaire lors de la synthèse de la protéase. L’élimination de la région N- terminale du zymogène (propeptide) permet l’activation du précurseur en enzyme mature active. De plus, une régulation directe de l’activité des protéases est assurée par un ensemble de molécules particulières qui ont co-évolué avec les protéases : les inhibiteurs de protéase (IP).

II - Les inhibiteurs de protéase

Les inhibiteurs de protéase sont présents dans tous les organismes vivants connus, et sont parfois en très grande quantité, comme l’ovomucoïde du blanc d’œuf

(10% des protéines totales). Les inhibiteurs utilisent différents mécanismes pour inhiber leur(s) protéase(s)-cible(s). Une classification basée sur des identités de séquences protéiques permet l’organisation des IP en 48 familles (83). En général,

67 une famille d’inhibiteur est spécifique d’une classe de protéase. Cependant, certains

IP de type serpine, la plus grande famille d’IP avec plus de 500 représentants, présentent des réactivités croisées entre les protéases à sérine et à cystéine. Une base de données évolutive accessible sur Internet regroupe un grand nombre d’informations sur les protéases et leurs inhibiteurs (http://merops.sanger.ac.uk/).

Le nombre élevé de protéases à sérine et de leurs inhibiteurs est certainement lié à leur importance dans les processus biologiques. Nous détaillerons les caractéristiques structurales et fonctionnelles des inhibiteurs de protéases à sérine de type Kazal, puisque notre équipe s’intéresse au syndrome de Netherton, une maladie génétique causée par l’absence d’expression d’un IP Kazal particulier,

LEKTI.

II-1 Les inhibiteurs de protéases à sérine de type Kazal

Le premier inhibiteur de type Kazal identifié est l’inhibiteur de la trypsine pancréatique, pancreatic secretory trypsin inhibitor (PSTI), qui fut décrit par Kazal

(84) et dont les mutations génétiques entraînent la pancréatite chronique (85).

Concentré dans des granules du pancréas exocrine, il est sécrété en même temps que le trypsinogène (précurseur de la trypsine) dans le suc pancréatique afin de contrôler son auto-activation prématurée éventuelle. Cet inhibiteur possède un seul domaine d’inhibition, alors que d’autres inhibiteurs comportent plusieurs domaines

Kazal en tandem. C’est le cas de l’ovomucoïde du blanc d’oeuf, un inhibiteur de 3 domaines Kazal. Le domaine 3 de l’ovomucoïde a été très étudié et représente l’archétype du domaine Kazal. Sa séquence primaire contient le motif consensus typique d’un domaine Kazal, dans lequel les cystéines (C) sont positionnées selon le schéma : C1-(X)n-C2-(X)7-C3-(X)10-C4-(X)2/3-C5-(X)m-C6. Les six cystéines sont engagées dans la formation de 3 ponts disulfures (C1-C5 ; C2-C4 ; C3-C6 ) qui permettent la formation d’une boucle réactive canonique exposée au solvant, grâce à

68 A C Pont disulfure

N P1’ P1

B Feuillet

P1’ Hélice  Boucle inhibitrice P1

Figure 15 - Séquence et structure tridimensionnelle du domaine 3 de l’ovomucoïde (A) Séquence protéique du domaine 3 de l’ovomucoïde. La flèche rouge indique la position du site réactif de l’inhibiteur (P1-P1’). Les positions de contact consensus entre l’ovomucoïde et ses enzymes cibles sont représentées en couleur, parmi lesquels les résidus en vert (cystéine P3) et (asparagine P15’) sont très conservés. Des mutations dans les résidus en contact avec l’enzyme entraînent des modifications de l’affinité entre l’ovomucoïde et sa cible. En revanche, des modifications dans les résidus représentés en blanc ont peu d’effet sur l’interaction. (Schéma modifié à partir de Lu et al. (2001)). (B) Représentation tridimensionnelle du domaine 3 de l’ovomucoïde à partir d’études cristallographiques. Le domaine 3 de l’ovomucoïde est un domaine Kazal qui comporte des repliements en hélice  et en feuillet . Les 3 ponts disulfures intramoléculaires sont représentés en jaune. Ils permettent la formation de la boucle inhibitrice, sur laquelle sont positionnés les résidus P1-P1’ (Leu- Glu) impliqués dans la fonction inhibitrice du domaine.

69 PSTI

Trypsinogène

Triade catalytique

Boucle inhibitrice

Figure 16 - Structure tridimensionnelle du complexe PSTI - trypsinogène Le trypsinogène est représenté en bleu (région N-terminale) et en jaune (région C-terminale). Les trois acides aminés de la triade catalytique sont représentés en structure tige et boule au niveau du site actif de l’enzyme (Ser, his, asp). L’inhibiteur de la trypsine sécrétoire pancréatique (PSTI) est coloré en rouge. Sa boucle inhibitrice se positionne en vis-à-vis du site actif enzymatique et bloque ainsi l’accès des substrats de l’enzyme. (Image modifiée à partir de Whitcomb et al. (1996))

70 laquelle l’inhibiteur exerce sa fonction vis-à-vis de protéases à sérine selon un mécanisme d’inhibition compétitif (figure 15) (86).

Par analogie, la même nomenclature que celle du substrat est utilisée pour nommer les résidus de l’inhibiteur (Pn, Pn’). La liaison P1-P1’, en se localisant en vis-à-vis du site actif de l’enzyme, va mimer la liaison peptidique d’un substrat, à la différence que l’hydrolyse est ici extrêmement lente, voire nulle. La nature du résidu

P1 constitue le principal déterminant de la spécificité d’inhibition d’un inhibiteur Kazal pour une protéase. Par exemple, la présence d’une arginine ou d’une lysine en position P1 d’un inhibiteur va lui conférer une spécificité vis-à-vis de la trypsine. Au- delà de cette interaction primaire impliquant le résidu P1, les inhibiteurs Kazal

établissent des interactions secondaires entre les résidus de la boucle (P9 à P4’) et des acides aminés à proximité du site actif de l’enzyme. L’ensemble de ces interactions permettent un ajustement moléculaire très fin entre l’inhibiteur et sa cible protéasique, et contribuent à la stabilité du complexe (figure 16) (87).

II-2 Paramètres cinétiques d’interaction et d’inhibition des complexes

protéases / inhibiteurs

Le pouvoir inhibiteur d’un domaine Kazal réside dans la capacité d’interaction de sa boucle inhibitrice avec le site actif des protéases à sérine. L’affinité globale d’un inhibiteur pour sa protéase cible dépend de sa facilité à s’associer avec elle, et de sa capacité à y rester fixer. Ces deux paramètres correspondent respectivement

-1 -1 à la constante de vitesse d’association (ka, exprimée en M s ) et à la constante de

-1 vitesse de dissociation (kd ,exprimée en s ). La technologie du BIAcore permet de mesurer les paramètres cinétiques des interactions protéines-protéines, et est applicable aux interactions protéase / inhibiteur. L’inverse de l’affinité d’un inhibiteur pour sa cible est mesurée par le rapport KD, (exprimé en M):

71 []E []I k K = = d D []EI k a L’affinité d’un inhibiteur pour sa cible est d’autant plus grande que la valeur de la constante KD est faible (constante de vitesse de dissociation faible et / ou constante de vitesse d’association élevée). Une vitesse de dissociation extrêmement faible traduit une incapacité de l’inhibiteur à se décrocher, on le qualifie alors d’inhibiteur irréversible.

La force de l’interaction entre protéase et inhibiteur peut aussi être évaluée en déterminant par des mesures cinétiques la constante d’inhibition Ki du complexe protéase-inhibiteur.

[]E []I K = i [] EI

Ces mesures peuvent être conduites classiquement dans des conditions michaéliennes ([I]0

>> [E]0), ou bien, pour de très bonnes inhibitions, dans des conditions où [I]0  [E]0.

L’utilisation des lois cinétiques correspondantes permet la détermination de la constante d’inhibition Ki dont l’inverse rend compte de l’affinité de l’enzyme pour son inhibiteur. Dans le cas d’une inhibition compétitive, on peut utiliser l’équation suivante :

IC K = 50 i []S 1 + K M

Le paramètre IC50 représente la concentration d’inhibiteur conduisant à 50% d’inhibition, le pourcentage d’inhibition étant calculé grâce à l’équation suivante :

v  v % inhibition =100  0 i v0 vi et v0 sont respectivement les vitesses intiales en présence et en absence d’inhibiteur.

La constante de Michaelis KM qui représente l’inverse de l’affinité apparente de l’enzyme pour son substrat doit alors être déterminée en utilisant la loi de

Michaelis :

72 V  []S v = m 0 K + []S M 0 dans laquelle v est la vitesse intiale déterminée à différentes concentrations initiales de substrat [S]0 et Vm la vitesse initiale maximum.

L’efficacité d’un inhibiteur est d’autant plus importante que la valeur du Ki est faible. Lorsque la concentration en substrat est suffisamment faible (<< KM), le Ki est

égal à l’IC50.

Un IP peut fonctionner selon plusieurs modes d’inhibition. Lorsque l’inhibiteur se positionne à la place du substrat dans le site actif enzymatique, l’inhibiteur et le substrat entrent en compétition, d’où le mode d’inhibition compétitif de l’IP. Ce mécanisme est classiquement rencontré pour les IP de type Kazal. En revanche, lorsque l’IP inhibe l’enzyme en se fixant sur un site à distance du site actif, il s’agit alors d’un mode d’inhibition non compétitif. Enfin, le mode d’inhibition mixte concerne des IP qui combinent les modes compétitifs et non compétitifs. Les serpines sont des inhibiteurs naturels de grande taille (environ 400 acides aminés) qui présentent un mode d’action très particulier. A l’état natif, les serpines existent sous une forme instable S (“stressed”). Leur boucle réactive, étendue et très mobile, agit comme un appât pour les protéases cibles. Une fois dans le site actif de l’enzyme, cette boucle inhibitrice est clivée comme un substrat, ce qui entraîne un réarrangement structural très important de l’inhibiteur conduisant à une structure plus stable R (“relaxed”) mais qui encombre le site actif de l’enzyme qui est alors bloqué. L’action d’une serpine est irréversible en raison de la grande stabilité de la boucle dans son état clivé, alors insérée dans un feuillet  (88).

Une protéase peut être inhibée par plusieurs inhibiteurs, et réciproquement, un inhibiteur peut inhiber différentes protéases, avec des spécificités variables. Les notions de spécificité et d’affinité sont importantes pour identifier des cibles protéasiques physiologiques des IP. Comme l’interaction entre une protéase et son

73 KLK5 cathélicidine LEKTI Dégradation des LL-37 KLK7 NE composants des SKALP KLK14 Protéinase 3 SCTP cornéodesmosomes NE Cat D microbes KLK7 Desquamation SLPI Cathepsine G chymase Immunité innée

Cornéocyte Espace intercornéo- -cytaire

Cornification

PEP-1 μ-calpaïne Furine ProFilaggrine / Filaggrine Matriptase Caspase 14 CAP-1 Pro-TGase-1 Cat D TGase-1

Cystatine ProTGase-3 M/E Légumaïne TGase-3

Figure 17 - Balance des protéases et des inhibiteurs de protéase dans l’homéostasie épidermique Liste des principales protéases (en violet) et inhibiteurs de protéase (en rouge) ayant un rôle dans les processus de cornification, de desquamation, et/ou dans le contrôle de l’immunité innée. SCTP : Stratum Corneum Thiol Protease ; Cat : Cathepsine ; PEP : Profilaggrin-EndoPeptidase ; CAP : Channel- Activating Proteinase ; TGase : Transglutaminase ; SKALP : SKin-Derived AntiLeucoProteinase ; SLPI : Secretory

74 substrat, l’interaction entre une protéase et son inhibiteur est favorisée par un environnement propice en termes de pH, force ionique et température.

III - La balance protéases - inhibiteurs de protéases dans l’homéostasie

épidermique

De nombreuses protéases exerçant leur activité à divers niveaux cellulaires jouent un rôle important dans le maintien de l’homéostasie épidermique (figure 17).

III-1 La desquamation

Un des processus protéolytiques le mieux caractérisé dans l’épiderme est le processus de desquamation lors duquel les cornéocytes les plus superficiels se détachent progressivement de l’épiderme, permettant le maintien d’une épaisseur

épidermique constante. La desquamation épidermique est caractérisée par la dégradation progressive des constituants externes des cornéodesmosomes, soient la desmogléine-1, la desmocolline-1 et la cornéodesmosine. En microscopie

électronique, ce phénomène se traduit par un raccourcissement des structures cornéodesmosomales au cours des strates de la couche cornée, jusqu’à leur disparition complète dans la couche la plus superficielle. Il a été montré que deux protéases à sérine purifiées à partir de CC humaine, les kallikréines 5 (SCTE, Stratum

Corneum Tryptic Enzyme) et 7 (SCCE, Stratum Corneum Chymotryptic Enzyme),

étaient capables de dégrader les structures cornéodesmosomales in vitro à pH 5,6, un pH proche de celui des cornéocytes supérieurs (89). Ces enzymes de la famille des kallikréines sont exprimées dans la couche granuleuse de l’épiderme et sécrétées par les corps lamellaires à l’interface CG/CC où elles se localisent à proximité de leurs cibles cornéodesmosomales (Annexe 2). La KLK5 a la propriété d’activer le zymogène de la KLK7, et de s’autoactiver. En outre, les kallikréines 1, 4, 6, 8, 9, 10, 11, 13 et 14

7574 sont détectées au niveau transcriptionnel et/ou protéique dans la CG (90). Parmi elles, les kallikréines 6, 8, 11, 13 et 14 ont été quantifiées dans la CC (91 , 92). La KLK8 ou neuropsine est capable de dégrader la desmogléine-1 et la cornéodesmosine, suggérant son rôle dans la desquamation épidermique (93). La KLK14, une kallikréine

à double spécificité de types trypsine et chymotrypsine, est présente en très faible quantité en comparaison avec la KLK5 et la KLK7, mais son faible niveau d’expression est compensé par son efficacité catalytique élevée (94). Sa capacité à activer et à être activée par la KLK5 suggère fortement son implication dans la cascade protéolytique de la desquamation (95). La dégradation très efficace de la desmogléine-1 par la

KLK14 in vitro renforce cette hypothèse (96). En outre la famille des kallikréines, des protéases à cystéine (SCTP, stratum corneum thiol protease) et à aspartate

(cathepsine D) sont présentes dans la couche cornée. Leur pH d’activité optimal acide favorise la dégradation cornéodesmosomale dans les dernières couches de la CC (97 ,

98).

Pour conclure, la desquamation repose sur une dégradation protéolytique des cornéodesmosomes médiée par des protéases de différentes classes et dont l’activité protéolytique est dépendante du pH. Ainsi, la quantité d’enzymes libres présentes et actives dans chacune des strates de la CC régule le niveau de digestion des composants des cornéodesmosomes, ce qui assure un degré de desquamation normal de l’épiderme.

III-2 Cornification

Le processus de cornification (formation de la couche cornée) repose sur l’activité de plusieurs protéases qui sont impliquées dans la maturation de différentes protéines essentielles pour la différentiation terminale de l’épiderme.

La filaggrine, qui sert à compacter les filaments de kératine et à générer des acides aminés hygroscopiques constituant le facteur d’hydratation naturel, est produite

76 sous la forme d’un précurseur de haut poids moléculaire. La profilaggrine comporte une région N-terminale S100-like de liaison au calcium, suivie d’une succession d’unités monomériques de filaggrine reliées par des régions de liaison au niveau desquelles une maturation protéolytique séquentielle se produit (51) (99). La protéolyse de la profilaggrine engendre deux produits majeurs, le peptide N-terminal et les unités monomériques. Cette réaction implique plusieurs protéases : la profilaggrine endoproteinase-1 (PEP-1), une protéase à sérine de type chymotrypsine caractérisée en 1995 par l’équipe de Resing (100), la μ-calpaïne, une protéase à cystéine dépendante du calcium (101), et la furine, une protéase à sérine de la famille des convertases (102). Un modèle murin a permis d’étendre cette liste à la matriptase, une protéase à sérine transmembranaire, exprimée dans la couche granuleuse de l’épiderme. Son inactivation chez la souris conduit à la perte de maturation protéolytique de la profilaggrine, et perturbe également la formation des lamelles lipidiques dans l’espace intercornéocytaire. Ces souris meurent rapidement de déshydratation en période néonatale (55). De même, les souris invalidées pour la caspase 14, une protéase à aspartate, montrent une maturation incomplète de la filaggrine, associée à une déshydratation transépidermique accrue. La caspase-14 serait impliquée dans la protéolyse terminale de la filaggrine en acides aminés hygroscopiques (56). Enfin, les souris invalidées pour CAP-1 (Channel-activating serine protease), une protéase à sérine membranaire activant des canaux ioniques, meurent rapidement après la naissance, en raison d’un défaut important de la barrière cutanée impliquant une maturation aberrante de la profilaggrine et une composition lipidique anormale (103).

Les TGase-1 et -3 sont des enzymes essentielles de la cornification grâce à leur fonction d’agrégation des protéines de l’enveloppe cornée. Alors que les souris délétées du gène de la Tgase3 ont un phénotype cutané mineur, des mutations dans le gène de la Tgase-1, TGM1, sont responsables de l’ichtyose lamellaire chez l’homme

(48). Les zymogènes de ces deux enzymes subissent une maturation protéolytique

77 respectivement par la cathepsine D, une protéase à aspartate et la légumaïne, une protéase à cystéine. Ainsi, une réduction d’activité de la TGase-1 est mesurée chez les souris invalidées pour la cathepsine D, dans lesquelles on observe aussi une diminution d’expression de l’involucrine et de la loricrine (104). De plus, des souris présentant des mutations ponctuelles dans le gène de la cystatine M/E, un inhibiteur de la légumaïne normalement localisé dans l’enveloppe cornée, entraînent une suractivation de la TGase-3 associée à une agrégation de loricrine accélérée. Ceci a pour conséquence d’altérer la fonction barrière épidermique de ces souris (105). Les activités protéolytiques de la cathepsine D et de la légumaïne sont donc directement impliquées dans la formation d’une enveloppe cornée fonctionnelle.

La cathepsine L est une protéase à cystéine lysosomale exprimée de manière ubiquitaire. Son inactivation chez la souris entraîne des défauts cutanés majeurs, incluant une perte de poil périodique, une hyperplasie épidermique, et un

épaississement de la couche cornée. Ces travaux ont permis de révéler la première protéase lysosomale impliquée dans l’homéostasie épidermique et le contrôle du cycle pilaire (106 , 107).

Chez l’homme, il a été montré que des mutations dans le gène de la cathepsine C, une protéase à cystéine étaient responsables du syndrome de

Papillon-Lefèvre (108). Cette kératodermie palmo-plantaire est associée à une inflammation caractéristique des tissus de soutien des dents (périodontite).

En conclusion, de nombreuses protéases participent à l’élaboration de la couche cornée de l’épiderme, en contrôlant notamment la formation d’une enveloppe cornée efficace. La dérégulation de leurs activités entraîne des pathologies de la kératinisation qui peuvent être sévères chez l’homme.

78 III-3 Immunité cutanée innée

L’immunité cutanée innée est primordiale pour la défense de l’hôte vis-à-vis des pathogènes. Elle est assurée par l’expression in situ de peptides antimicrobiens capables d’éliminer rapidement les pathogènes déposés sur l’épiderme.

La cathélicidine, un peptide antimicrobien cutané majeur, est synthétisée sous la forme d’un précurseur comprenant un peptide signal en région N-terminale, un domaine cathéline hautement conservé, et le domaine cathélicidine appelé LL-37 chez l’homme. Le clivage protéolytique du précurseur permet la libération de LL-37, qui est lui-même clivé à différents sites pour engendrer un panel de peptides, possédant des capacités antimicrobiennes et immunomodulatrices différentes (109).

SLPI (secretory leucocyte protease inhibitor) et SKALP (Skin-derived antileucoproteinase) sont des peptides antimicrobiens de faible poids moléculaire

(10 kDa) synthétisés de manière constitutive par les épithéliums non kératinisés. En revanche, leur expression est induite dans les kératinocytes granuleux lors d’une agression de l’épiderme (inflammation, infection). Ce sont des protéines bifonctionnelles par leurs capacités anti-protéasiques et anti-microbiennes. Elles appartiennent à la famille des trappines car en plus de leur domaine inhibiteur de protéase à sérine en région C-terminale, elles possèdent un domaine N-terminal substrat des transglutaminases (motif protéique GQDPVK) qui peut expliquer leur localisation dans l’enveloppe cornée. SLPI a été caractérisé dans la peau humaine et murine alors que SKALP, initialement isolé à partir de peau atteinte de psoriasis chez l’homme, n’a pas d’homologue murin connu à ce jour. SLPI et SKALP possèdent une boucle inhibitrice très similaire qui justifie l’existence de cibles communes que sont l’élastase du neutrophile et la protéinase 3. Cependant, le spectre d’inhibition de SLPI est plus large et inclut la chymase du mastocyte et la cathepsine G, ce qui fait de lui un anti-inflammatoire cutané majeur. Sa cible préférentielle semble être l’élastase du neutrophile en raison de la constante

79 d’inhibtion (Ki) de l’ordre du nanomolaire. L’expression de SLPI est activée par des stimuli pro-inflammatoires primaires (TNF-, Interleukine-1), ainsi que par sa propre cible, l’élastase du neutrophile (110). L’invalidation de Slpi chez la souris entraîne une augmentation du nombre des neutrophiles et macrophages dans la peau en cicatrisation, associé à une activation accrue de TGF-1 (transforming growth factor-

1), un puissant chemoattractant des cellules inflammatoires (111).

Ces exemples montrent l’importance des capacités anti-inflammatoires et antimicrobiennes dont sont pourvus certains inhibiteurs de protéase, et grâce auxquelles ils jouent un rôle essentiel dans la défense cutanée innée.

III-4 Conclusion

Les exemples évoqués ci-dessus illustrent bien l’importance d’un contrôle fin de la balance protéases – inhibiteurs de protéase dans l’homéostasie épidermique, et indique que l’excès ou le défaut d’activité protéolytique peuvent être préjudiciables aux fonctions essentielles de l’épiderme, voire être létales.

80 81 A B C

D E F

Figure 18 - Caractéristiques cliniques du syndrome de Netherton (A) Dès la naissance ou peu après, les enfants développent une érythrodermie congénitale exfoliative. De fines squames translucides se détachent par lambeau du corps du nouveau-né. (B) Souvent absent en période néonatale, le cheveu bambou (Trichorrexhis invaginata) est une manifestation clinique spécifique au SN, qui permet un diagnostic univoque. (C) Le troisième élément de la triade clinique du SN est le développement de manifestations atopiques (dermatite atopique, etc…). Le faciès de l’enfant présente un érythème périoral marqué par la macération. (D) Le phénotype desquamatif généralisé pendant l’enfance tend à s’améliorer en un phénotype moins sévère, l’ichtyose linéaire circonflexe (ILC). L’ILC correspond à des lésions serpigineuses bordées de squames en double collerette. (E,F) Tout au long de la vie, les cheveux des patients SN présentent des anomalies de croissance. Généralement clairsemés, les cheveux sont courts, secs, et cassants. Leur fragilité entraîne souvent l’apparition de zones alopéciques.

82 Partie C - Le syndrome de Netherton

I - Clinique du syndrome de Netherton

Le Syndrome de Netherton (SN, OMIM 256500) est une maladie génétique cutanée sévère transmise selon le mode autosomique récessif. On estime l’incidence de cette maladie rare à 1/100000, avec un sex-ratio équilibré.

La triade clinique du SN comprend une érythrodermie ichtyosiforme congénitale, une dysplasie pilaire spécifique et des manifestations atopiques importantes (figure 18A-C).

Dès la naissance ou durant le premier mois de vie, les enfants développent une

érythrodermie ichtyosiforme congénitale (EIC) non bulleuse d’une sévérité variable.

L’érythrodermie est accompagnée d’une forte exfoliation à l’origine de fines squames translucides recouvrant l’ensemble du corps et qui se détachent facilement par lambeau. L’érythrodermie desquamative, sévère pendant l’enfance, tend à s’améliorer lors de l’adolescence (112). Elle peut perdurer tout au long de la vie dans les cas les plus sévères ou bien évoluer vers un phénotype moins sévère, l’ichtyose linéaire circonflexe (ILC), qui se caractérise par la présence de lésions cutanées serpigineuses bordées de squames en double collerette (63). Ces lésions migrantes

épisodiques se déplacent d’environ 0,5 mm par jour (113) (Figure 18D). Le faciès des enfants est caractéristique, due à la présence d’un érythème périoral marquée par la macération (112).

Les cheveux et poils des patients SN présentent des anomalies de croissance et de structure (Figure 18E,F). Généralement clairsemés, les cheveux sont courts, secs et cassants, et prennent un aspect épineux caractéristique (112).

Les frottements répétés et la fragilité pilaire entraînent souvent l’apparition de zones alopéciques, notamment dans la région occipitale. L’analyse en microscopie optique de cheveux ou de poils montre la présence de plusieurs défauts morphologiques de la tige pilaire (114), dont certains sont communs à de nombreuses pathologies

83 123

Zone corticale

Zone distale

Prolifération des cellules matricielles

Figure 19 - Pathogenèse du cheveu Bambou (1) La tige pilaire se compose d’une zone corticale centrale et d’une zone distale périphérique. Les cellules corticales sont fragilisées par le défaut de liaisons disulfures dans certaines régions de la tige pilaire . (2) Les cellules corticales altérées ne résistent pas à la pression ascendante due à la prolifération des cellules matricielles et provoquent une déformation de la zone distale de la tige pilaire. (3) Par simple phénomène mécanique, il en résulte la formation d’un bourrelet autour de la tige, qui correspond au nœud du cheveu bambou.

84 cutanées, telles que pili torti (tige pilaire tordue), et Trichorrhexis nodosa

(trichorrhexie noueuse). Par contre, Trichorrhexis invaginata (TI), qui correspond à l’invagination de la partie distale de la tige pilaire dans sa partie proximale est une dysplasie pilaire unique au SN qui affecte toutes les parties pileuses du corps. On l’appelle également cheveux bambous à cause de la ressemblance des noeuds à la jointure des tiges de bambous. L’analyse en microscopie électronique des nœuds de

TI montre des invaginations symétriques ou asymétriques de la cuticule de la tige pilaire dans la zone corticale centrale, ainsi que la présence de clivages profonds en périphérie du nœud. Ces anomalies s’accompagnent d’une torsion importante des fibres de kératine, mais aussi du noyau et du cytoplasme des cellules corticales

(115). La pathogenèse du TI reste encore mal comprise, bien que certaines hypothèses aient été proposées. D’après plusieurs études, l’apparition des nœuds se produit toujours au-dessus de la zone kératogénique de la tige pilaire (115, 116 ).

Or, dans cette même zone d’un cheveu normal, il se produit une conversion des groupements sulfhydryles –SH en liaisons disulfures S-S. Dans le cheveu TI, un marquage histochimique spécifique permet de mettre en évidence la persistance anormale des groupements –SH le long de la tige pilaire, et en particulier dans la zone corticale des nœuds. Il est probable que la réduction des liaisons disulfures au sein des fibres de kératine du cortex affaiblisse l’architecture des cellules corticales.

D’après les auteurs, ces cellules corticales seraient fragilisées et altérées par la pression ascendante créée par la prolifération des cellules matricielles. Sous l’effet de la pression, la zone corticale altérée déformerait la zone distale pour former un bourrelet autour de la tige par simple phénomène mécanique (figure 19) (115).

Souvent absent en période néonatale, le cheveu bambou est une manifestation clinique pathognomonique du SN qui permet un diagnostic différentiel excluant la possibilité d’autres érythrodermies / ichtyoses (ichtyose lamellaire, peeling-skin syndrome de type B, acrodermatitis enteropathica, maladie de Leiner, syndrome de Refsum, érythrodermie psoriasiforme).

85 L’atopie est le troisième élément de la triade diagnostique du SN. L’atopie qualifie une prédisposition aux maladies allergiques. Chez les patients SN, les manifestations atopiques les plus fréquentes sont la dermatite atopique, la rhinite allergique (rhume des foins), l’asthme allergique, l’urticaire, et les allergies alimentaires (lait, œuf, arachide, maïs…). Ces manifestations atopiques sont toujours accompagnées d’un taux élevé d’immunoglobulines E (IgE) sériques pouvant atteindre 15000 IU/mL (taux normal : <180 IU/mL) (112). Les patients présentent un nombre d’éosinophiles circulant élevé. Enfin, le prurit est un symptôme qui peut affecter le corps entier, et qui contribue à l’irritabilité de l’enfant.

A ce tableau clinique s’ajoutent des complications fréquentes en période néonatale, qui peuvent menacer le pronostic vital. Le défaut de barrière cutanée entraîne une déshydratation hypernatrémique associée à une perte de poids rapide et une hypothermie. Des infections cutanées et pulmonaires sont fréquentes et peuvent entraîner la septicémie dans les cas les plus extrêmes. Les infections cutanées peuvent être de nature bactérienne (Staphyloccocus aureus), fongique

(Candida albicans), ou virale (herpex simplex, papillomavirus). L’infection par le papillomavirus est d’ailleurs associée à la survenue de cancers cutanés agressifs chez les patients SN, comme l’ont décrit plusieurs équipes (117 , 118). Le développement de carcinomes spino-cellulaires dans différentes régions du corps

(dos de la main, avant-bras, vulve) a également été reportée (119 , 120). Cependant, la survenue de cancers chez les patients SN n’est pas un événement fréquent.

Pendant la première année, il est courant d’observer un retard de développement qui peut être attribué à l’intense déshydratation et à des problèmes nutritionnels (diarrhées chroniques, malabsorption, allergies alimentaires).

L’ensemble de ces complications en période néonatale peuvent entraîner plus tard un retard des acquisitions chez une minorité de patients (112).

86 87 A Couche cornée décollée B éosinophile et parakératosique

Hyperkératose

Infiltrat inflammatoire sous-corné Agranulose Acanthose

Papillomatose sain SN

C D

sain SN

Figure 20 - Histologie de la peau des patients SN et immunodétection de LEKTI L’examen des coupes de peau SN après coloration à l’hématoxyline et éosine révèle de nombreuses anomalies. L’épiderme est acanthosique (augmentation du nombre de couches). Les crêtes épidermiques sont accentuées, et l’épiderme forme de profondes invaginations dans le derme (papillomatose). La couche cornée éosinophile est épaisse (hyperkératose) et contient de nombreux noyaux (parakératose). Souvent décollée du reste de l’épiderme, elle s’accompagne d’une agranulose (absence de couche granuleuse). (C,D) L’immunodétection de LEKTI sur une coupe de peau humaine normale montre un marquage spécifique de la couche granuleuse et une absence d’expression dans l’épiderme de patient SN. Grossissement A,B: x100; C,D : x200.

88 II - Histologie de la peau des patients SN

L’analyse histologique des coupes de peau de patient SN permet de mettre en évidence de nombreuses anomalies de la différenciation terminale de l’épiderme, qui sont identiques chez les patients présentant une érythrodermie ichtyosiforme congénitale (EIC) ou une ichtyose linéaire circonflexe (ILC) (figure 20). L’examen des coupes après coloration conventionnelle en hématoxyline/éosine met en évidence une forte hyperplasie des couches suprabasales (acanthose). L’épiderme des patients SN montre une accentuation des crêtes épidermiques et une papillomatose

(forte invagination de l’épiderme dans le derme) qui évoquent un épiderme psoriasiforme. Selon les zones, il est possible d’observer la présence d’une couche cornée éosinophile (très rouge) hyperkératosique (épaissie), parakératosique

(persistance anormale des noyaux) et qui s’accompagne d’une agranulose (absence de couche granuleuse). Parfois, la couche cornée complètement détachée n’est plus visible sur la coupe, et laisse place à une couche granuleuse focale qui est généralement très mince (63).

Des infiltrats inflammatoires périvasculaires sont souvent observés dans le derme. Surtout chez les patients atteints d’EIC, cette réaction inflammatoire dermique est associée à la présence d’une forte spongiose dans les couches basale et épineuse de l’épiderme (dilatation des espaces intercellulaires sans détachement des cellules les unes des autres). Dans la CC, la présence d’amas de granulocytes aux noyaux pycnotiques1 formant des clivages intracornés est parfois observée (63).

Cet afflux de neutrophiles, de macrophages et de lymphocytes en région sous- cornée peuvent entraîner la formation de pustules ou micro-abcès qui rappellent les micro-abcès de Munro caractéristiques du psoriasis (113 , 121 , 122).

1 Un noyau pycnotique est un noyau en dégénérescence, fortement rétracté, et caractérisé par une condensation de sa chromatine. Le noyau altéré se colore fortement par les colorants basiques.

89 III - Analyse ultrastructurale de la peau de patient SN

L’analyse ultrastructurale d’un épiderme de patient SN (CIE ou ILC) confirme l’altération majeure de la différenciation terminale (figure 21). La couche cornée renferme des résidus de noyaux (parakératose) et d’organelles ainsi que de nombreuses gouttelettes lipidiques intracellulaires (123 , 124). Des séparations intercellulaires associées à des clivages des desmosomes sont visibles au sein des couches granuleuses et cornées, et expliquent le détachement de la partie supérieure de l’épiderme chez les patients.

La couche granuleuse, quand elle est présente, est anormale par la réduction en nombre et en taille des grains de kératohyaline et des filaments de kératine qu’elle contient (123). Les corps lamellaires sont réduits en nombre et peu structurés, et leur contenu est prématurément déversé par exocytose jusqu’à la 4ème couche antérieure à l’interface CG-CC. La transformation des bicouches lipidiques en lamelles lipidiques matures reste incomplète dans la partie inférieure de la couche cornée, certainement perturbée par l’accumulation de matériel granuleux amorphe dense aux électrons dans les espaces intercellulaires. Par conséquent, les bicouches lipidiques restent dans une configuration globulaire qui dilate les espaces intercornéocytaires (124 , 125 , 126). Parfois, le nombre insuffisant de corps lamellaires entraîne une absence complète de lipides dans les espaces intercornéocytaires, ce qui provoque inévitablement la perte de barrière de l’épiderme (122). Dans la partie inférieure de la couche épineuse, les espaces intercellulaires élargis sans rupture des jonctions desmosomales témoignent de la présence d’une forte spongiose (122).

90 A B C

CC CC

CG CG

D CC E F

CG

H G

I

Figure 21 - Ultrastructure de l’épiderme des patients SN (A) Un épiderme humain normal présente une couche cornée adhérente à la couche granuleuse dans laquelle de nombreux grains de kératohyaline sont visibles (pointes de flèche vertes). (B,C) Dans un épiderme SN, la couche cornée renferme des résidus nucléaires ainsi que de nombreuses gouttelettes lipidiques intracellulaires (pointes de flèche rouges). Les grains de kératohyaline sont réduits en nombre et en taille (pointes de flèche vertes). (C) Des décollements d’une partie ou de la totalité de la couche cornée sont présents (flèches). (D) Epiderme normal montrant l’exocytose des corps lamellaires à la transition entre couche granuleuse et couche cornée, et formation subséquente des lamelles lipidiques (flèches). (E) Présence de lamelles lipidiques dans toute l’épaisseur de la couche cornée (flèche) dans un épiderme normal. (F, G) Epiderme SN : perturbation de la maturation des lipides des corps lamellaires qui restent sous forme globulaire dans l’espace intercornéocytaire, en présence d’un matériel amorphe dense aux électrons. (H) Dans un épiderme SN, des micro-clivages sont visibles, associés à la rupture asymétrique des desmosomes. (I) Desmosome intact dans un épiderme normal. Echelle : A : 2μm ; B : 5μm ; C : 2μm : ; D, E : 0,1 μm ; F, G : 1 μm; H, I : 0,25 μm (A ; B-C ; D-G et H modifiés à partir de Prost (2006) ; Muller et al. (2002); Fartash et al. (1999); et Descargues et al. (2006), respectivement).

91 IV - Traitements du SN

En période néonatale, les patients SN sont particulièrement vulnérables à la déshydratation hypernatrémique, ce qui était à l’origine d’un grand nombre de décès.

Avec l’amélioration de la prise en charge des nouveaux-nés dans les maternités, le pronostic vital des nourrissons a fortement progressé. Les premiers soins consistent d’une part, à protéger le nourrisson de la perte en eau, et d’autre part, à éviter les survenues d’infections cutanées et systémiques. L’application de lotions émollientes sur la surface du corps permet, grâce à leur composition lipidique, de former un film protecteur hydrophobe qui se substitue à la barrière cutanée défectueuse des nouveau-nés SN. Les émollients sont utilisés au-delà de la période néonatale par les patients, pour l’amélioration significative de l’aspect cutané et l’absence d’effets indésirables à long terme connus. Une lotion émolliente à base de lactate d’ammonium (Lac-Hydrin 12%) a été utilisée avec succès comme l’affirment plusieurs publications (127 , 128 , 129).

L’utilisation d’antibiotiques en application topique ou systémique est nécessaire pour lutter contre les infections récurrentes, qui touchent aussi bien la peau que les poumons.

De nombreux agents thérapeutiques ont été administrés par voie topique ou systémique aux patients SN, avec une efficacité et des effets secondaires variables.

Les applications locales de corticostéroïde comme l’hydrocortisone, ou le valérate de bétaméthasone sur les zones eczémateuses de plusieurs patients SN ont conduit à l’apparition d’un phénotype cushingoïde (faciès oedémacié), qui a disparu avec l’arrêt du traitement (112, 130 ). On attribue l’apparition du syndrome de Cushing au passage incontrôlé des corticostéroïdes dans la circulation sanguine à travers la barrière cutanée hautement perméable des patients. Par conséquent, ces agents thérapeutiques sont actuellement contre-indiqués pour traiter le SN. Le traitement de plusieurs patients par rétinoïdes oraux pendant une période d’un à six mois a

92 entraîné une aggravation cutanée et les traitements antihistaminiques se sont révélés inefficaces (112).

La photochémothérapie PUVA, qui correspond à une irradiation par UVA après application topique de psoralène, a permis une disparition des lésions cutanées chez une patiente, avec une période de rémission de deux mois.

Cependant, comme toute photothérapie, l’inconvénient majeur de la méthode PUVA réside dans l’augmentation du risque de carcinogenèse (131).

Le calcipotriol, un analogue synthétique de la vitamine D3 qui favorise la différenciation kératinocytaire, a été utilisé avec succès et sans effet secondaire chez un enfant qui présentait des lésions de type ILC. Cependant, il est nécessaire d’administrer ce traitement à une cohorte de patients afin de valider l’efficacité thérapeutique du calcipotriol pour le SN (132).

Par ailleurs, un essai thérapeutique avec le tacrolimus, un immunosuppresseur qui bloque l’activation des lymphocytes T, a permis une amélioration clinique significative sans effet indésirable chez trois enfants SN.

Cependant, l’altération de la barrière cutanée des enfants a provoqué une absorption importante du tacrolimus dans le sang, où la concentration dépassait le seuil autorisé

(133). Suite à cet essai, une molécule anti-inflammatoire dérivé du tacrolimus mais présentant des propriétés lipophiles différentes (pimécrolimus) a été utilisée dans une étude récente : le traitement d’un enfant par le pimécrolimus a conduit à une résorption spectaculaire des lésions cutanées et à l’absence d’absorption systémique du médicament. Cet agent thérapeutique développé par la société

Novartis fait l’objet de divers essais cliniques aux Etats-Unis, en cours ou à venir pour le traitement du SN mais également de diverses pathologies inflammatoires cutanées (dermatite atopique, dermatite sébhorréique, lupus érythémateux, lichen plan). Bien que le pimécrolimus offre des perspectives thérapeutiques intéressantes pour les patients, aucun traitement spécifique du SN n’existe à ce jour.

93 V - Physiopathologie

En 2000, l’équipe du Pr Hovnanian a localisé le gène responsable du syndrome de Netherton en 5q32 par étude de liaison génétique et homozygosity mapping (134). Quelques mois plus tard, en utilisant une stratégie de clonage positionnel de gène candidat, l’équipe démontrait que la maladie était due à des mutations du gène SPINK5 (Serine Protease INhibitor Kazal type 5), conduisant à l’apparition de codons STOP prématurés prédisant une dégradation accélérée de l’ARNm muté (135). Les Northern blots réalisés à partir des kératinocytes de patients en culture révèlent une réduction significative d’expression transcriptionnelle de

SPINK5 (136).

SPINK5 s’étend sur 61 kb et comprend 33 exons (135) (figure 22). SPINK5 code la protéine LEKTI (Lympho-Epithelial Kazal-Type Inhibitor), dont l’étude de l’expression tissulaire chez des sujets sains révèle une localisation spécifique dans l’épiderme, les muqueuses orale et vaginale, la trachée, ainsi que dans les corpuscules de Hassal du thymus, les amygdales et les glandes parathyroïdiennes

(137, 138) (Annexe 1). Dans l’épiderme, LEKTI est exprimée dans la couche granuleuse, ainsi que dans la gaine épithéliale interne et les cellules matricielles des follicules pileux, et le canal excréteur des glandes sébacées (90) (Annexe 1).

Dans les cultures de kératinocytes primaires humains, l’expression de LEKTI est maximale dans des conditions favorisant la différenciation (concentration en calcium de 1,2 mM), ce qui est en accord avec sa localisation dans la couche granuleuse de l’épiderme.

L’analyse immunohistochimique avec un anticorps dirigé contre LEKTI sur coupe de peau de patient SN confirme l’absence d’expression de la protéine chez la majorité des patients, ce qui constitue un outil diagnostique majeur (figure 20). Ainsi, la localisation tissulaire de LEKTI et les anomalies de différenciation épidermique

94 A

SPINK5

LEKTI 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Peptide signal Région linker

P1 P1’ B C1 C2 C3 C4 C5 C6 D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 D11 D12 D13 D14 D15

Régions linkers Domaines Kazal ou Kazal-like

Figure 22 - Organisation de SPINK5 et LEKTI (A) SPINK5 est localisé en 5q32. D’une longueur de 61 Kb, il est constitué de 33 exons (rectangles violets). SPINK5 code LEKTI, une protéine de 145 kDa comportant 15 domaines potentiels d’inhibition de type Kazal (D1 à D15) codés par les exons impairs. Les domaines sont séparés les uns des autres par des régions linker codées par les exons pairs. Les domaines D2 et D15 représentés en orange sont des domaines kazal classiques, alors que les domaines représentés en bleu sont des domaines Kazal-like renfermant un pont disulfure en moins. (B) Alignement des domaines de LEKTI. Les 15 domaines sont alignés selon la position des cystéines (C1 à C6) caractéristiques des domaines Kazal. Les domaines D1 et D3 à D14 possèdent 4 des 6 cystéines (C1, C2, C4 et C5). Le peptide signal est indiqué en vert. Les régions linkers sont riches en résidus basiques (K, R) sensibles au clivage protéolytique par les convertases. (Schéma modifié à partir de Mägert et al. (1999)).

95 observées chez les patients SN suggèrent que LEKTI joue un rôle prépondérant dans la différenciation terminale de l’épiderme et l’élaboration de la barrière cutanée.

VI - LEKTI

VI-1 Structure biochimique

LEKTI est une protéine glycosylée de 1064 acides aminés comprenant un peptide signal de 22 acides aminés à son extrémité N-terminale. Elle est organisée en 15 domaines (D1 à D15) particulièrement conservés, dont la séquence protéique primaire prédit un rôle d’inhibiteur de protéase à sérine (figure 22) (137). Ces domaines sont séparés par des régions « linkers ». Les domaines D2 et D15 présentent une forte identité de séquence avec le motif consensus d’un domaine

Kazal dans lequel 6 résidus cystéines sont engagés dans la formation de 3 ponts disulfures (C1-C5 ; C2-C4 ; C3-C6). Les 13 autres domaines, nommés « Kazal-like » n’ont que 4 des 6 résidus cystéines (C1, C2, C4, C5) mais une étude basée sur des expériences de Résonance Magnétique Nucléaire (RMN) indique que leur structure tridimensionnelle n’est pas différente de celle d’un domaine Kazal typique, avec notamment le maintien de la boucle inhibitrice (139). Seul le domaine D1 possède une structure tridimensionnelle particulière totalement différente de celle d’un inhibiteur de type Kazal, ce qui suggère une absence de fonction inhibitrice de ce domaine (figure 23) (139).

Les régions linkers séparant chacun des domaines de LEKTI sont des régions riches en résidus dibasiques, qui constituent des sites sensibles de clivage par les Subtilisin-like Proprotein Convertase (SPC) (140). Les SPC sont des endoprotéases responsables de la maturation par clivage de nombreuses proprotéines en une forme biologiquement active. La furine, PACE4, PC5/6 et PC7/8 sont des SPCs exprimées dans l’épiderme, et seraient donc susceptibles de libérer certains fragments protéolytiques à partir du précurseur de LEKTI. La maturation

96 NH2

COOH

Ovomucoïde-D3 LEKTI-D6 LEKTI-D1

Figure 23 - Structures tridimensionnelles des domaines D1 et D6 de LEKTI et du domaine D3 de l’ovomucoïde Ces représentations sont basées sur des analyses cristallographiques réalisées pour chacun des domaines. Malgré l’absence d’un pont disulfure, la structure tridimensionnelle du domaine D6 de LEKTI met en évidence une boucle inhibitrice proche de celle de l’ovomucoïde (flèches). En revanche, la structure du domaine D1 de LEKTI n’adopte pas de structure tridimensionnelle proche de celle d’un inhibiteur de type Kazal. (Images modifiées à partir de Lauber et al. (2003)).

97 protéolytique de pro-LEKTI en fragments actifs est concordante avec l’isolement des domaines D1, D5 et D6 de LEKTI à partir d’hémofiltrat humain (141). De plus, un fragment de 30 kDa dont l’extrémité N-terminale correspond au domaine D8 a été identifié dans le milieu de culture de kératinocytes humains primaires.

L’alignement des séquences protéiques humaines et murines de LEKTI montre un pourcentage d’identité de 60%. La protéine murine diffère de la protéine humaine par la présence de 14 domaines d’inhibition (d1 à d14), due à l’absence de domaine homologue au domaine 6 humain. De plus, la forme murine de Lekti possède 30 résidus supplémentaires en amont du domaine d13 (142).

Chez la souris, le profil d’expression de Lekti dans l’épiderme suprabasal, les follicules pileux, les muqueuses de la langue et du vagin ainsi que dans les corpuscules de Hassall du thymus prédit un rôle identique de la protéine chez l’homme et chez la souris (142).

VI-2 Fonctions inhibitrices de LEKTI

Le premier test fonctionnel de LEKTI a été réalisé avec le domaine D6, initialement isolé et purifié en grande quantité à partir d’hémofiltrat humain (137). D6 possède des capacités inhibitrices vis-à-vis de la trypsine pancréatique (IC50 = 100-

150 nM), mais est inefficace vis-à-vis de la chymotrypsine, l’élastase du neutrophile, la thrombine, l’activateur du plasminogène tissulaire (t-PA), la tryptase, la plasmine, la chymase, le facteur Xa, la kallikréine tissulaire, la kallikréine plasmatique et l’urokinase (141 , 143). En 2003, il a été montré qu’une forme recombinante du précurseur de LEKTI (D1 à D15) possédait des capacités d’inhibition vis-à-vis de la trypsine (Ki = 849 nM), l’élastase du neutrophile (Ki = 317 nM), la cathepsine G (Ki =

67 nM), la plasmine (Ki = 27 nM), et la subtilisine A (Ki = 49 nM) (144). En revanche, aucune inhibition de la chymotrypsine n’a été mise en évidence dans cette étude.

Cette étude montre que la forme entière de LEKTI est capable d’inhiber plusieurs

98 protéases avec des spécificités d’inhibition différente. De plus, son spectre d’inhibition est plus large que celui du domaine D6 isolé, suggérant des fonctionnalités différentes de chacun des domaines de LEKTI.

Cependant, la forme entière de LEKTI inhibe la trypsine avec une capacité d’inhibition plus faible que le domaine D6, ce qui confirme l’hypothèse selon laquelle la forme entière de LEKTI correspond à un précurseur nécessitant une activation par protéolyse pour être pleinement fonctionnel.

VII - SPINK5 et la dermatite atopique

La dermatite atopique (DA) est une maladie cutanée inflammatoire chronique caractérisée par de l’eczéma, un prurit, et une hyperéactivité exacerbée face à des stimuli allergiques, irritants ou encore microbiens. Le développement subséquent de l’asthme est souvent observé. La survenue de la DA s’établit dans les six premiers mois de la vie dans 50% des cas, et avant l’âge d’un an dans 90% des cas (145). La

DA est une manifestation clinique toujours présente chez les patients SN, suggérant que LEKTI puisse jouer un rôle de protection contre la survenue de cette réponse allergique cutanée. Il est intéressant de noter que plusieurs études génétiques ont rapporté une association significative entre différents polymorphismes de SPINK5 et la DA (Glu420Lys, Asn368Ser, Asp386Asn) (146 , 147 , 148).

En outre, certaines régions chromosomiques contrôlant la susceptibilité à la

DA ont été identifiées par criblage entier du génome. Parmi ces régions, le locus

1q21 a suscité une vive attention car il comporte le complexe de différenciation

épidermique, un ensemble de gènes impliqués dans le processus de différentiation terminale de l’épiderme (149).

Une publication récente a permis de révéler une association significative entre les mutations récurrentes R501X et 2282del4 du gène de la filaggrine (FLG) et l’ichtyose vulgaire, une maladie de la kératinisation à laquelle est fréquemment associée la dermatite atopique (57). Une étude ultérieure a montré une association

99 significative entre ces mutations de la FLG et la DA (150). Des mutations rares de la filaggrine (R2447X, S3247X et 3702delG) sont également associées à la DA d’après une étude récente (151).

De manière encore plus intéressante, une étude cas-contrôle prospective a mis en évidence une association significative des mutations R501X et 2282del4 avec l’asthme, mais seulement chez les patients déjà atteints de DA. Une étude d’association menée sur 476 familles allemandes a confirmé ces résultats (152).

L’ensemble de ces études révèlent que les mutations R501X et 2282del4 de la FLG sont des mutations causales de l’ichtyose vulgaire et représentent un facteur de risque majeur du développement de la DA. De plus, elles permettent d’établir le phénotype asthmatique comme étant un événement secondaire à la DA. Ceci met en relief qu’un défaut primaire de nature épidermique pourrait favoriser le développement de la DA, puis jouer un rôle dans la sensibilisation allergique à distance de la zone cutanée altérée, et ainsi transformer la nature cutanée de l’allergie en allergie par voie respiratoire.

Ces résultats récents suscitent un intérêt grandissant pour l’implication des défauts cutanés dans les voies physiopathologiques des maladies allergiques.

100 Objectifs de la thèse

L’identification du gène responsable du SN en 2000 permet aujourd’hui de proposer un diagnostic moléculaire prénatal, ce qui représente une avancée médicale majeure pour les familles à risque. En revanche, à ce jour, les patients SN ne bénéficient d’aucun traitement spécifique, ce qui justifie de porter nos efforts dans cette direction. Une étape préalable au développement d’outils thérapeutiques spécifiques repose sur une compréhension précise de la physiopathologie de la maladie. Pour cela, il est nécessaire de caractériser la protéine déficiente chez les patients, LEKTI, sur des plans structural et fonctionnel afin de comprendre son rôle biologique à travers l’identification de ses cibles. C’est donc dans cette optique que se sont orientés mes travaux de thèse.

Objectif 1

LEKTI est produit sous la forme de précurseurs de haut poids moléculaire qui sont clivés par protéolyse au niveau de certains sites sensibles pour libérer des formes biologiquement actives. Le premier objectif de ma thèse a été d’identifier la(les) protéase(s) responsable(s) de la maturation protéolytique de LEKTI, et de caractériser l’ensemble des fragments protéolytiques générés à partir des différents précurseurs de LEKTI. Certains fragments de LEKTI ont ensuite été produits et testés vis-à-vis d’un panel de protéases à sérine épidermiques ou inflammatoires.

Objectif 2

Un modèle murin du syndrome de Netherton a été généré au laboratoire afin de comprendre les mécanismes moléculaires mis en jeu dans le développement de la maladie. Dans un deuxième objectif, mon travail a été de participer à la caractérisation fonctionnelle des souris Spink5-/- et en particulier à l’identification des protéases hyperactives en l’absence de LEKTI. Les résultats de ce travail m’ont

101 conduite à l’identification par spectrométrie de masse d’une nouvelle protéase

épidermique suractivée chez les animaux déficients pour Spink5.

Objectif 3

Une troisième partie de mon travail a porté sur la caractérisation biochimique in vitro de cette nouvelle protéase épidermique. Enfin, j’ai développé et analysé des souris transgéniques conditionnelles surexprimant cette protéase, afin de connaître son rôle dans l’homéostasie épidermique et d’évaluer son implication dans le développement du phénotype SN.

102 Résultats

103 104 Chapitre A : Maturation protéolytique des précurseurs de LEKTI et capacité inhibitrice des fragments

Article 1

SPINK5, the defective gene in Netherton syndrome, encodes multiple LEKTI isoforms derived from alternative pre-mRNA processing.

LEKTI représente le plus grand inhibiteur de type Kazal connu à ce jour. Il est constitué de 15 domaines potentiellement inhibiteurs de protéase à sérine. Cette protéine est issue de la traduction d’un transcrit de 3,5 kb, LEKTI full-length (LEKTIf-l ; Genbank

NM_006846). Cet article porte sur l’identification des transcrits alternatifs de SPINK5, qui sont

à l’origine de plusieurs isoformes de LEKTI dans les kératinocytes primaires humains. Ce travail nous a permis de mettre en évidence deux autres transcrits de SPINK5 grâce au criblage d’une banque d’ADNc de kératinocytes différenciés humains. Un transcrit de 3 kb code une isoforme courte, LEKTI short (LEKTIsh ; Genbank DQ149929) délétée des domaines 14 et 15. Un transcrit de 3,7 kb diffère du transcrit full-length par l’insertion de 90 pb en aval de l’exon 28, créant ainsi un ajout de 30 acides aminés dans la région linker entre les domaines D13 et D14. L’isoforme de LEKTI correspondante est nommée LEKTI long

(LEKTIl ; Genbank DQ149928). Nos résultats indiquent que chacun des transcrits possède le même profil d’expression tissulaire. Dans les kératinocytes humains primaires, les trois transcrits de SPINK5 sont exprimés selon un rapport quantitatif de 7 : 2,3 : 1, respectivement pour SPINK5f-l, SPINK5l et SPINK5sh. Des expériences de transfection transitoire montrent que les précurseurs de LEKTI sont clivés au niveau d’un site de clivage identique qui engendre des fragments C-terminaux différents en fonction du précurseur. Ces résultats soulignent la complexité de régulation de LEKTI au niveau transcriptionnel et post- traductionnel, et suggèrent des spécificités fonctionnelles de chacune des isoformes de

LEKTI.

105 106 ORIGINAL ARTICLE

SPINK5, the Defective Gene in Netherton Syndrome, Encodes Multiple LEKTI Isoforms Derived from Alternative Pre-mRNA Processing Alessandro Tartaglia-Polcini1,4, Chrystelle Bonnart2,4, Alessia Micheloni1, Francesca Cianfarani1, Alessandra Andre`1, Giovanna Zambruno1, Alain Hovnanian2,3 and Marina D’Alessio1

The multidomain serine protease inhibitor lymphoepithelial Kazal-type related inhibitor (LEKTI) represents a key regulator of the proteolytic events occurring during epidermal barrier formation and hair development, as attested by the severe autosomal recessive ichthyosiform skin condition Netherton syndrome (NS) caused by mutations in its encoding gene, serine protease inhibitor Kazal-type 5 (SPINK5). Synthesized as a proprotein, LEKTI is rapidly cleaved intracellularly, thus generating a number of potentially bioactive fragments that are secreted. Here, we show that SPINK5 generates three classes of transcripts encoding three different LEKTI isoforms, which differ in their C-terminal portion. In addition to the previously described 15 domain isoform, SPINK5 encodes a shorter LEKTI isoform composed of only the first 13 domains, as well as a longer isoform carrying a 30-amino-acid residue insertion between the 13th and 14th inhibitory domains. We demonstrate that variable amounts of SPINK5 alternative transcripts are detected in all SPINK5 transcriptionally active tissues. Finally, we show that in differentiated cultured human keratinocytes all SPINK5 alternative transcripts are translated into protein and that the LEKTI precursors generate distinct secreted C-terminal proteolytic fragments from a similar cleavage site. Since several data indicate a biological role for the pro-LEKTI-cleaved polypeptides, we hypothesize that the alternative processing of the SPINK5 pre-messenger RNA represents an additional mechanism to further increase the structural and functional diversity of the LEKTI bioactive fragments. Journal of Investigative Dermatology advance online publication, 22 December 2005; doi:10.1038/sj.jid.5700015

INTRODUCTION Netherton syndrome (NS, OMIM 266500) (Chavanas et al., Proteases and their natural cognates, the protease inhibitors, 2000a), which is characterized by ichthyosiform erythroder- constitute a very large group of molecules that participate and ma, a specific hair shaft defect known as trichorrhexis regulate a wide range of physiological reactions in cells and invaginata or bamboo hair, and atopic manifestations tissues (Laskowski and Kato, 1980). Among them, the serine (Come`l, 1949; Netherton, 1958). protease inhibitor lymphoepithelial Kazal-type related in- Strongly expressed in the granular and uppermost spinous hibitor (LEKTI) is of special interest because of its pathophy- layers of the epidermis and in the most differentiated layers of siological importance. Defective expression of this molecule all stratified epithelia (Bitoun et al., 2003), LEKTI has recently causes the severe autosomal recessive skin disorder, been shown to represent a key regulator of epidermal proteases involved in the barrier formation and its physiolo- 1Laboratory of Molecular and Cell Biology, Istituto Dermopatico dell’Imma- gical renewal. Indeed, LEKTI deficiency causes, both in colata, IDI-IRCCS, Rome, Italy; 2INSERM U563, Paul Sabatier University, humans and mice, abnormal desmosome cleavage at the Toulouse, France and 3Department of Medical Genetics, Purpan Hospital, granular layer–stratum corneum transition (Yang et al., 2004; Toulouse, France Descargues et al., 2005; Hewett et al., 2005; Ishida- 4 These authors contributed equally to this work. Yamamoto et al., 2005). This leads to defective stratum Correspondence: Dr Marina D’Alessio, Laboratory of Molecular and Cell corneum adhesion, which in turn, results in the loss of skin Biology, Istituto Dermopatico dell’Immacolata, IDI-IRCCS, Via dei Monti di Creta 104, Rome 00167, Italy. E-mail: [email protected] barrier function, accounting for many of the NS clinical Abbreviations: BFA, brefeldin A; cDNA, complementary DNA; LEKTI, features and complications, including bacterial infections as lymphoepithelial Kazal-type related inhibitor; LEKTIf-l, full-length LEKTI; well as failure to thrive (Yang et al., 2004; Descargues et al., LEKTIsh, LEKTI short; mRNA, messenger RNA; NHK, normal human 2005; Hewett et al., 2005). keratinocyte; NS, Netherton syndrome; nt, nucleotide; RACE, rapid amplifi- Kazal-type serine protease inhibitors comprise a family of cation of cDNA ends; SPINK5, serine protease inhibitor Kazal-type 5; proteins defined by the presence of three conserved disulfide SPINK5f-l, SPINK5 long; SPINK5l, SPINK5 long; SPINK5sh, SPINK5 short Received 2 August 2005; revised 9 September 2005; accepted 12 September bonds and a reactive site loop in each inhibitory domain 2005 (Roberts et al., 1995). Named Kazal after the discoverer of the

& 2005 The Society for Investigative Dermatology www.jidonline.org 1 A Tartaglia-Polcini et al. LEKTI Novel Isoforms

pancreatic secretory trypsin inhibitor, the prototype of this are generated by alternative processing of the SPINK5 pre- family (Kazal et al., 1948), these proteins are usually mRNA. We also report the detection of a third B148 kDa composed of only one inhibitory domain (Roberts et al., LEKTI precursor in NHKs, and formally demonstrate that the 1995). However, in avian and other organisms, Kazal-type B148, 145, and 125 kDa LEKTI precursors correspond to the serine protease inhibitors may contain up to seven inhi- translation products of the three distinct SPINK5 mRNAs. bitory domains with different target specificities (Johansson Finally, by transfecting the different cDNA forms into et al., 1994; van de Locht et al., 1995; Saxena and Tayyab, mammalian cells, we validate the LEKTI proteolysis observed 1997). in NHKs and demonstrate that the B65 and 42 kDa LEKTI, initially identified as the precursor protein of two proteolytic fragments detected in NHKs represent the peptides isolated from human blood filtrate, was thought to C-terminal portions of LEKTIf-l and LEKTIsh precursor forms, be a multidomain Kazal-type serine protease inhibitor respectively, generated from the use of the same cleavage site because of its structural relation with other inhibitors of this present on both precursors. family (Magert et al., 1999). However, LEKTI, as deduced from the nucleotide (nt) sequence of the cloned B3.5 kb RESULTS complementary DNA (cDNA) (GenBank NM_006846), here- Isolation of SPINK5 alternative transcripts in named serine protease inhibitor Kazal-type 5 full-length To date only a B3.5 kb SPINK5 transcript has been described (SPINK5f-l), is a large polypeptide (1,064 amino acids) that (Magert et al., 1999) (GenBank NM_006846). However, we contains as many as 15 potential inhibitory domains found evidence for the presence of two LEKTI precursors in (D1–D15), preceded by a signal peptide (Magert et al., differentiated NHK (Bitoun et al., 2003). To investigate 1999). Only two of the inhibitory domains, D2 and D15, whether this finding could be ascribed to the existence of match the typical Kazal motif with six cystein residues at different SPINK5 mRNAs, a l phage cDNA library from fixed positions, while the other 13 domains exhibit a Kazal- differentiated NHK was screened. Interestingly, sequence type-derived four cystein residue pattern. Since some analysis of the selected clones revealed the presence of two proteolytic fragments of LEKTI have been detected in human novel SPINK5 mRNAs in addition to the published one. One blood (Magert et al., 1999; Ahmed et al., 2001), cultured of them is a B3 kb polyadenylated transcript with an open epidermal keratinocytes (Bitoun et al., 2003), and human hair reading frame identical to the previously characterized roots (Raghunath et al., 2004), full-length LEKTI (LEKTIf-l)is SPINK5f-l mRNA up to the lysine 913 codon (Figure 1a). thought to be a proprotein, the proteolytic process of which Thereafter, three novel in-frame codons (gtt-att-tat) are would generate a number of biologically active fragments. followed by a termination codon TAA and a 91 bp Moreover, the demonstration of an LEKTIf-l recombinant 30untranslated region in which a potential polyadenylation protein inhibitory activity versus a battery of natural proteases signal (AATAAA) is identifiable (Figure 1b). The second novel such as plasmin, trypsin, subtilisin A, cathepsin G, and mRNA, as compared to the full-length transcript, carries a elastase suggests a multiple inhibitory function for LEKTI 90 bp in-frame insertion between lysine 913 and aspartate (Magert et al., 2002; Mitsudo et al., 2003; Jayakumar et al., 914 codons (Figure 1c). 2004; Kreutzmann et al., 2004). To date, the nature of the To determine the mechanism underlying the production of LEKTI targets is still uncertain. The recent characterization of the novel SPINK5 mRNAs, a computer-based analysis of the Spink5 null mice has shown that LEKTI plays a crucial role in SPINK5 genomic sequences (GenBank NT_029289.10) was epidermal desquamation, keratinization, barrier formation, carried out using the NCBI BLAST search program (http:// and hair morphogenesis, and has also allowed the identifica- www.ncbi/blast.com). This analysis revealed that the full- tion of the serine proteases stratum corneum tryptic enzyme length and the shorter cDNA species diverge after the last nt and stratum corneum chymotryptic enzyme as potential of exon 28 (GenBank NT_029289.10, nt 8,667,936) and that LEKTI-interacting proteins (Yang et al., 2004; Descargues the three in-frame additional codons and the 30untranslated et al., 2005; Hewett et al., 2005). However, the phenotype of region portion of the shorter transcript correspond to the 50 NS patients supports the involvement of LEKTI also in other portion of intron 28 in which a cryptic polyadenylation signal biological pathways relevant to inflammation and antimicro- and a GT-rich element are recognizable (GenBank bial defense. NT_029289.10, nts 8,667,937—8,221). As these motifs are The human SPINK5 gene, which resides on chromosome 5 important for mRNA 30-end formation and cleavage (Birnstiel (5q32), is a single-copy gene composed of 33 exons et al., 1985), we concluded that the B3 kb transcript (Chavanas et al., 2000b). The encoded protein, LEKTIf-l,is represents an alternatively processed form of the SPINK5 predicted to have a molecular weight of B120 kDa pre-mRNA and was designated SPINK5sh (SPINK5 short) (GeneBank Q9NQ38). However, we have recently reported (GenBank DQ149929). the detection of two LEKTI glycosylated precursors, a For the third mRNA species, analysis of the SPINK5 B145 kDa full-length protein (LEKTIf-l) and a shorter isoform genomic sequences revealed that the 90 bp insertion was of B125 kDa (LEKTI short, LEKTIsh) as well as of three generated from the activation of cryptic splice junction C-terminal fragments of B68, 65, and 42 kDa, in differentiated sequences located within intron 28, downstream of the normal human keratinocytes (NHK) (Bitoun et al., 2003). above-mentioned polyadenylation signal (GenBank Here, we report the characterization and expression NT_029289.10, nts 8,668,121–218). Therefore, this addi- analysis of two novel SPINK5 messenger RNAs (mRNAs) that tional SPINK5 exon has been therefore named exon 28a

2 Journal of Investigative Dermatology (2005) A Tartaglia-Polcini et al. LEKTI Novel Isoforms

a 890−915

916−941

942−955

b 890−915

916

c 890−915

916−941

942−967

968−985

Figure 1. Partial nucleotide sequence of SPINK5 cDNAs derived from NHK and predicted amino-acid sequences of LEKTI isoforms. (a) SPINK5f-l transcript;

(b) SPINK5sh; and (c) SPINK5l. The nucleotide sequence common to all transcript forms is in green, while the portion common only to SPINK5f-l and SPINK5l and not present in SPINK5sh is in blue. The three novel in-frame codons of SPINK5sh are in yellow. The cryptic polyadenylation site utilized by SPINK5sh is in bold. The 90 bp insertion of SPINK5l is in pink. The encoded amino acids are numbered from the translation initiation site. *, indicates the stop codon TAA.

and the corresponding transcript SPINK5l (SPINK5 long) found in the tonsils, duodenum, bladder, rectum, stomach, (GenBank DQ149928). colon, and thymus and, to a lesser extent, in the ilocecum, Given that cDNA libraries often contain a range of cDNA ileum, and jejunum (Figure 2b). No SPINK5 expression could with anomalous structures because of cloning artifacts, the be detected in the bone marrow, lymphnode, leukocytes, results obtained were verified by 30 and 50 rapid amplification spleen, and liver. Subsequently, with primer pairs that of cDNA ends (RACE) using total RNA extracted from specifically amplify SPINK5sh and SPINK5l, we analyzed differentiated NHK. The outcome of sequence analysis of their expression pattern (Figure 2a). By this means, we could the cDNA fragments obtained confirmed the diversity of the establish that all SPINK5 transcripts share an analogous tissue alternative transcripts in their 30-end portions (data not distribution pattern, thus indicating that the SPINK5 pre- shown) and showed that all SPINK5 mRNA species utilize mRNA undergoes alternative processing in all SPINK5 the same transcription start site, which is located 73 bp transcriptionally active tissues (Figure 2c and d). upstream to the ATG codon (GenBank NT_029289.10, nt 8,606,471). Computational analysis of the nt sequence of the The expression of SPINK5 alternative transcripts is regulated 50 portion of SPINK5 gene, using the Promoterscan program during keratinocyte differentiation in vitro (http://www.Ifti.org), further substantiated the localization of Since several reports described a single SPINK5 transcript the transcription initiation site, and showed the presence of a form (Magert et al., 1999, Chavanas et al., 2000a), we TATA box 22 bp upstream of the transcription start site hypothesized that the moderate differences in size among the (GenBank NT_029289.10, nts 8,606,449–54). SPINK5 transcripts did not allow their discrimination by conventional Northern blot analysis. Total RNA from The SPINK5 alternative transcripts are not specific to NHKs proliferating and differentiated cultured NHK was therefore Previous studies have reported high SPINK5 transcription allowed to extensively separate (see Materials and Methods) levels in lymphoepithelial tissue such as the epidermis, oral and was thereafter analyzed with a probe complementary to mucosa, vaginal epithelium, thymus, tonsils, and Bartolini’s all SPINK5 mRNAs. As expected, the sizes of the SPINK5f-l and parathyroid glands (Magert et al., 1999, 2002; Komatsu and SPINK5l transcripts being very similar, this analysis et al., 2002). Therefore, in order to specifically evaluate the resulted in the detection of two transcript bands with an expression pattern of the different SPINK5 mRNAs, real-time apparent molecular weight of B3.7 (corresponding to both reverse transcriptase-PCR on cDNA from several human SPINK5f-l and SPINK5l) and B3 kb (corresponding to tissues was carried out. At first, by using a primer pair that SPINK5sh) in all the samples analyzed (Figure 3). In keeping allowed the amplification of all SPINK5 transcripts, we with the SPINK5/LEKTI mRNA expression in the uppermost established that the SPINK5 gene displays its greatest differentiated layers of the epidermis (Komatsu et al., 2002; expression level in the skin, tongue, and esophagus (Figures Bitoun et al., 2003), the expression level of all transcripts 2a and b). Noticeable amounts of SPINK5 mRNAs were also significantly increased as cells differentiated, in vitro

www.jidonline.org 3 A Tartaglia-Polcini et al. LEKTI Novel Isoforms

1234 5 a AUG UGA SPINK5f-1 1F 1R 3.7 kb AUG UAA 3.0 kb SPINK5sh 1F 1R 2F 2R AUG UGA

SPINK5l 1F 1R 2F 3R GAPDH b All SPINK5 transcripts 60,000 Figure 3. Northern blot analysis of SPINK5 transcription level in prolifer- ating and differentiated NHK and NS keratinocytes. The high-resolution 40,000 electrophoretic separation of total RNA from proliferating (lane 1) and differentiated (lanes 2–4) NHK allows the visualization of two SPINK5

xpression units transcript bands of B3.7 and B3 kb. None of these bands was detected in 20,000 e differentiated NS keratinocytes (lane 5). Cell differentiation was induced by the addition of 1.2 mM calcium to the cell media for 24 (lane 2), 48 (lane 3),

Relativ 0 and 72 (lanes 4 and 5) hours. Sample loading has been normalized to the w er um um us transcriptional level of glyceraldehyde-3-phosphate dehydrogenase erse Skin ym onsil Liv IIeum ongue T ocytes RectumCecum T BladderTh Spleenphnode ansv IIocecum Jejen Stomach m (GAPDH). Duoden Esophagus Ly Leuk Bone marro Colon ascending ColonColon descending tr Tissues 123

c SPINK5sh 1,500 587 bp

540 1,000

xpression units 504 SPINK5l

e 500

SPINK5sh

Relativ 458 0 w er um um us erse Skin ym onsil Liv SPINK5f-1 IIeum ongue T ocytes RectumCecum T BladderTh Spleen 424 ansv IIocecum Jejen Stomach ymphnode Duoden Esophagus L Leuk Bone marro Colon ascending ColonColon descending tr Tissues d !-Actin SPINK5 1,500 l Figure 4. RNase protection assay (RPA) analysis of SPINK5 transcripts in

differentiated NHK. Lane 2: RPA with a probe able to protect SPINK5sh and 1,000 SPINK5f-l. The RNA probe used allows discrimination between the SPINK5sh and SPINK5f-l splice variants (462 and 426 bp, respectively); lane 3: RPA with xpression units a probe able to protect SPINK5l and SPINK5f-l generating a 490 and a 426 bp

e 500 fragment, respectively. In the latter experiments, the SPINK5f-l protected fragment shows a migration rate lower than expected (estimated length Relativ 0 B440 bp). This fact could be ascribed to the almost identical base w er um um us composition between the first portion of the SPINK5 -specific riboprobe and erse Skin ym onsil Liv l IIeum ongue T ocytes RectumCecum T BladderTh Spleenphnode ansv IIocecum Jejen Stomach m the SPINK5f-l transcript. Bands corresponding to the protected mRNA Duoden Esophagus Ly Leuk Bone marro fragments are indicated to the right. Sample loading has been normalized to Colon ascending ColonColon descending tr Tissues the b-actin transcript.

Figure 2. Transcription level of SPINK5 mRNAs in different human tissues, as determined by real time reverse-PCR. (a) Schematic representation of SPINK5 cDNAs with the location of primers used for real-time reverse-PCR; (b) transcription level of all SPINK5 transcripts, as determined using the The 3.5 kb SPINK5 transcript is predominant in differentiated primer pair 1F–1R; (c) transcription level of SPINK5 , as determined using the f-l sh NHK primer pair 2F–2R; and (d) transcription level of SPINK5l, as determined using the primer pair 2F–3R. All expression levels are relative to liver. Each value Next, we assessed the relative amount of the three SPINK5 represents the mean of three independent amplifications, with the error bars transcripts in differentiated NHKs by RNase protection being the standard error of the mean. assays. As shown in Figure 4, significant amounts of all transcript species are present in these cells. However, (Figure 3, lanes 1–4). Neither the B3.7 nor the B3 kb mRNAs densitometric analysis of the protected bands revealed that were visualized in NS patient cells (Figure 3, lane 5), which is the full-length transcript is B7 times more abundant than the consistent with the process of nonsense-mediated mRNA short transcript, while the molar ratio between SPINK5f-l and decay associated with NS mutations. SPINK5l is B3:1.

4 Journal of Investigative Dermatology (2005) A Tartaglia-Polcini et al. LEKTI Novel Isoforms

abNHK D15 D15 D15 D15

!-D14−D15 − − − − LEKTI f-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 -D13 -D14 -D13 -D14 N C BFA+ ! ! BFA− ! ! 160 97.4 LEKTI 68 l 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 66.2 N C 148 65 145 !-D14−D15 45.0 LEKTIsh 1 2 3 4 5 6 7 8 9 10 11 12 13 42 N C 125 120 35.8 !-Actin

1 2 34 56

cdIntracellular Extracellular !-C sh sh f-1 f-1 N C 145 LEKTI LEKTI --LEKTI LEKTI N C 125 160.0 145 120.0 125 97.4 C 65 66.2 65 C 42

45.0 42

123456

Figure 5. Molecular detection of LEKTI precursors and C-terminal proteolytic fragments in differentiated NHK- and CHO-transfected cells. (a) Schematic representation of the three LEKTI isoforms, with specific regions recognized by a-C (a-D13–D15) and a-D14–D15 antibodies. a-C antibody is able to detect both isoforms, whereas a-D14–D15 is able to detect LEKTIl and LEKTIf-l isoforms but not LEKTIsh isoform; (b) Western blot analysis of differentiated NHKs cultured with (lanes 1 and 2) or without (lanes 3–6) BFA. Total cell extracts were analyzed using a-C (a-D13–D15) (lanes 1 and 4) and a-D14–D15 (lanes 2 and 5) antibodies, or using the corresponding preimmune serum (lanes 3 and 6); (c) Western blot of intracellular (lanes 1–3) and extracellular (lanes 4–6) fractions of CHO cells transiently transfected with the empty pEFDEST-51 vector ( ) (lanes 1 and 4), pEF-DEST51-SPINK5 (LEKTI ) (lanes 2 and 5), and pEF-DEST51- À f-l f-l SPINK5sh (LEKTIsh) (lanes 3 and 6) with a-C antibody. The B145 and B125 kDa precursors detected in the intracellular extracts, and the B65 and B42 kDa proteolytic forms detected in the media are indicated on the right. Note the presence of a minor band of B80 kDa in the media of both LEKTIf-l and LEKTIsh CHO-transfected cells, probably resulting from a proteolytic process occurring specifically in these cells. The same volume of intracellular and extracellular extracts was loaded in order to compare the protein level in each compartment. (d) Proposed model of full- and short-length LEKTI proteolysis in cultured NHKs.

The three LEKTI isoforms are expressed in differentiated NHK B145 and 125 kDa bands but also revealed a higher In addition to the previously described 1,064-amino-acid molecular weight isoform (B148 kDa), consistent with a LEKTI isoform (Magert et al., 1999) (GeneBank Q9NQ38), glycosylated form of LEKTI encoded by the SPINK5l mRNA translation of SPINK5sh and SPINK5l transcripts is expected to (Figure 5b, lane 1). In keeping with our previous results, produce a shorter 916-amino-acid form and a longer treatment of the cell extracts with the peptide N-glycosidase F polypeptide carrying a 30 residue insertion in the linker resulted in a molecular weight shift of B10 kDa for all protein region between D13 and D14, respectively (Figure 5a). bands, thus confirming the glycosylated state of all LEKTI However, only two glycosylated precursor forms of B145 isoforms (data not shown). and 125 kDa were previously detected in brefeldin A (BFA)- As deduced from the nt sequence of the SPINK5sh treated differentiated NHKs (Bitoun et al., 2003), using transcript, the shorter LEKTI isoform is expected to consist polyclonal antibodies directed against D13–D15 (a-C anti- in only the first 13 inhibitory domains (D1–D13). These data body), which should have recognized all LEKTI isoforms prompted us to demonstrate that the B125 kDa LEKTI lacks (Figure 5a). To test whether this discrepancy could be caused the last two inhibitory domains. Thus, a novel polyclonal by the size similarity between the full-length protein and the antibody, directed against D14–D15 (a-D14–D15), that isoform harboring the 30-amino-acid insertion, total cell should specifically recognize only the full-length protein extracts from BFA-treated differentiated NHK were subjected and the LEKTI isoform carrying the 30-amino-acid insertion to a high-resolution electrophoretic separation, before encoded by exon 28a, was generated (Figure 5a). As Western from analysis with the a-C antibody (Bitoun et al., compared to the results discussed above, the immunodetec- 2003). Using these experimental conditions, LEKTI detection tion of LEKTI by Western blot analysis using the a-D14–D15 in these cells not only showed the previously described polyclonal antibody did not reveal the B125 kDa band

www.jidonline.org 5 A Tartaglia-Polcini et al. LEKTI Novel Isoforms

(Figure 5b, lane 2). This result strongly suggests that the corresponding to the first 28 exons. Thereafter, the splicing of shorter LEKTI isoform detected by the a-C antibody represents exon 28 to exon 29 generates the previously described the translation product of the SPINK5sh transcript lacking D14 SPINK5f-l mRNA, which is encoded by 33 exons. A shorter and D15. Finally, in differentiated NHKs in which LEKTI SPINK5 transcript, which contains an open reading frame of intracellular cleavage was not prevented by BFA treatment, only 2,748 bp, instead, results from the usage of an internal the a-C polyclonal antibody detected three C-terminal polyadenylation site and of a 30-end cleavage site present proteolytic fragments of B68, 65, and 42 kDa with no larger within intron 28. Finally, SPINK5l, the third mRNA species precursor form, while the novel a-D14–D15 polyclonal identified, is encoded by 34 exons and contains, as compared antibody revealed only the B68 and 65 kDa bands (Figure to the full-length transcript, a 90 bp insertion encoded by a 5b, lanes 4 and 5). This result indicates that the B42 kDa cryptic exon (exon 28a) located within intron 28. band does not contain the LEKTI inhibitory domains D14 and Alternative splicing and utilization of intronic polyadeny- D15, and thus strongly suggests that this fragment represents lation signals are quite common mechanisms used to regulate the C-terminal cleaved portion of the LEKTI shorter isoform. gene expression. In some instances, the production of Conversely, the B68 and 65 kDa bands, detected by both different forms of mRNA by controlled usage of alternatively antibodies, are likely to represent the C-terminal proteolytic spliced exons or intronic polyadenylation sites constitutes a fragments of the B148 and 145 kDa LEKTI precursors, mechanism that allows the synthesis of tissue-specific respectively. None of the above-mentioned signals detected isoforms (Liu and Johnson, 2002; Garcia-Sacristan et al., using preimmune sera and the specificity of the bands was 2005; Ule et al. 2005). In other instances, such as the further confirmed by competition experiments (data not synthesis of the secreted or membrane-bound forms of shown). immunoglobulin m heavy chain from a single-copy gene, In order to definitely establish the identity of the LEKTI the recognition and use of the intronic polyadenylation signal precursors and proteolytic fragments detected in keratino- is developmentally regulated as part of the maturation cytes, constructions of mammalian expression vectors carry- process of B cells (Galli et al., 1988). In our case, through ing LEKTIf-l cDNA (145 kDa precursor) and short-length the analysis of a wide panel of human tissues, we cDNA (125 kDa precursor) were carried out. Chinese hamster demonstrated that the alternative processing of the SPINK5 ovary (CHO) cells were transiently transfected with the two pre-mRNA occurs in all SPINK5 transcriptionally active recombinant vectors, and the intracellular and extracellular tissues, thus excluding a tissue-specific regulated process. extracts were analyzed by Western blot using the a-C Although we have no element to evaluate whether the antibody (Figure 5c). A B145 kDa band was seen in the alternative processing of the SPINK5 pre-mRNA represents a intracellular extract of CHO transfected with LEKTIf-l (Figure developmentally regulated process and establish how the 5c, lane 2), while a B65 kDa band was visualized in the structural differences of the SPINK5 mRNAs affect mRNA medium of these cells (Figure 5c, lane 5). Similarly, a stability and/or translational efficiency, an important implica- B125 kDa band was detected in the intracellular extract of tion of our results is that, like many other genes, the human CHO transfected with LEKTI short-length (Figure 5c, lane 3), SPINK5 gene is capable of producing various LEKTI isoforms and a 42 kDa band was seen in the medium of these cells with related but distinct structures and for which, a different (Figure 5c, lane 6). function can be postulated. In CHO cells, it is interesting to note that LEKTI proteolytic Mammalian Kazal-type serine protease inhibitors are very fragments are mostly found in the medium and are in low small proteins generally containing only one inhibitory abundance (B65 kDa) or absent (B42 kDa) in the intracel- domain, the specificity of which depends on the nature of lular fraction. This result indicates that, following cleavage of the reactive amino acids. LEKTI, instead, is a long protein LEKTI precursors, proteolytic fragments are rapidly secreted composed of an extraordinarily high number of potential in the medium where no degradation products are visible, bioactive domains (Magert et al., 1999). Based on the indicating a high stability of these C-terminal fragments at colocalization of SPINK5 transcripts and various subtilisin- 371C. All together, these results clearly demonstrate that the like proprotein convertases in the granular layer of the C-terminal fragments originate from the proteolysis of LEKTI epidermis, intracellular processing of the inactive precursor/s precursors, and are likely to arise from the use of cleavage by these endoproteases has been postulated (Komatsu et al., sites within the same linker region (Figure 5d). 2002). The number of consensus sequences for subtilisin-like proprotein convertases cleavage identified within LEKTI DISCUSSION linker sequences could generate at least 14 polypeptides The results presented here demonstrate that, in humans, (Komatsu et al., 2002). However, by transfecting the SPINK5f-l alternative processing of the SPINK5 pre-mRNA generates and SPINK5sh cDNAs in mammalian CHO cells, we three classes of transcripts encoding three isoforms of LEKTI demonstrated that the B65 and 42 kDa proteolytic fragments differing in their COOH-terminal amino-acid sequence. The detected in NHKs represent the C-terminal portion of the three isoform-specific mRNAs are produced from the same B145 and 125 kDa LEKTI precursors, respectively. These structural gene through a combination of polyadenylation site proteolytic fragments correspond to several domains linked selection during 30-end formation and alternative splicing. All together, and are most likely originating from the same transcripts share the same transcription start site, 73 bp of cleavage site of the two precursors (Figure 5d). Thus, while 50untranslated sequence and a 2,739 bp coding sequence each linker, very rich in dibasic residues, can potentially be

6 Journal of Investigative Dermatology (2005) A Tartaglia-Polcini et al. LEKTI Novel Isoforms

cleaved by subtilisin-like proprotein convertases, a preferen- some machinery (Wessagowit et al., 2005). It might also be tially cleavage site is used in both LEKTIf-l and LEKTIsh postulated that this 30-amino-acid region is essential for precursors. mouse LEKTI function, while it appears of less importance in Whereas single domains D1, D5, and D6 have been humans. This sequence does not correspond to a Kazal isolated from human blood filtrate (Magert et al., 1999, domain nor to a dibasic residue-rich linker region. It is then 2002), such individual domains have not been reported so far difficult to evaluate the biological importance of this in cultured keratinocytes (Bitoun et al., 2003). Instead, a sequence. 30 kDa protein with an N-terminal sequence matching to D8 Interestingly, all NS patients characterized to date at the was purified from the medium of differentiated keratinocytes molecular level carry premature termination codon mutations (Ahmed et al., 2001). In our study, we found no evidence for within the transcript region common to the three SPINK5 the presence of C-terminal small LEKTI fragment of B10 kDa, mRNA forms. The identification and subsequent analysis of which could correspond to a single domain, in the media of NS patients harboring the defect of a specific LEKTI isoform NHKs or transfected CHO cells. This suggests that the active would allow a better understanding of the multiple biological forms of LEKTI in keratinocytes include C-terminal multi- roles of LEKTI isoform. It could be especially useful for domain fragments. This hypothesis is further supported by the evaluating potential compensatory events between the three Western blotting detection of high molecular weight (B110, LEKTI isoforms. 90, and 60 kDa) LEKTI proteolytic fragments in human hair In conclusion, the results presented here highlight roots, while no small LEKTI forms were reported in this study the complicated regulation of LEKTI at both transcriptional (Raghunath et al., 2004). and post-transcriptional levels. This degree of comple- To date, the identity of the LEKTI bioactive fragments as xity supports a key role of this Kazal-type inhibitor in well as the nature of their targeted proteinases are still largely skin biology and raises the question of the specific function unknown. Many aspects of LEKTI biological functions still of each isoform in the skin and other LEKTI-expressing remain a matter of speculation. Several findings make stratum tissues. corneum tryptic enzyme and stratum corneum chymotryptic enzyme the most suitable candidate targets of LEKTI. These MATERIALS AND METHODS two enzymes are involved in the epidermal cornification and Materials desquamation processes as well as in hair development (Yang All reagents and chemicals were purchased from Sigma (Milan, Italy et al., 2004; Descargues et al., 2005; Hewett et al., 2005). and Toulouse, France), unless otherwise stated. Cell culture media However, the existence of other proteases regulated by LEKTI were obtained from Invitrogen (Milan, Italy and Toulouse, France). in additional biological pathways has been postulated. Since Spink5 null mice replicate skin and hair key pathological Cell culture features of NS, some of the LEKTI targets are most likely to be Normal and NS human primary keratinocytes were isolated and similar in both humans and mice, and the NS mouse model cultured as described previously (Bitoun et al., 2003). CHO cells will help in elucidating their nature. Some others, instead, were grown in Dulbecco’s modified Eagle’s Medium supplemented might be peculiar to humans and be related to the existence with 10% fetal calf serum, and 100 U/ml penicillin/streptomycin. of multiple LEKTI isoforms. Indeed, although the genomic BFA and peptide N-glycosidase F keratinocyte treatments have been organization and the expression pattern of the mouse SPINK5 described before (Bitoun et al., 2003). gene are very similar to the human counterpart, this single- copy gene encodes a sole murine LEKTI isoform. Although RNA extraction, reverse transcriptase-PCR, and cDNA probes lacking human LEKTI domain 6, the mouse protein shares Total RNA, extracted by lysis of differentiated NHK cultures in the many structural features with the longest human isoform. In presence of guanidine isothiocyanate, was reverse-transcribed using particular, it consists in 14 domains and interspacing linker the SuperScript RNase H free reverse transcriptase and random regions and contains the 30-amino-acid insertion encoded by hexamers (Invitrogen, Carlsbad, CA). The cDNA product was then exon 28a in humans. However, in humans, this exon is used as a template for PCR amplifications using specific oligonu- alternatively spliced in or out, while in the mouse, the cleotides. To amplify the 660 bp region of SPINK5 cDNA comprising corresponding exon (mouse exon 27) is constitutively nts 1,799–2,458 (GenBank NM_006846), PCR conditions were as expressed (Galliano et al., 2005). Thus, the alternative described below with an annealing temperature of 601C, and processing of the SPINK5 pre-mRNA represents a mechanism primers used were as follows: 50-GATCCTATTGAGGGTCTAGAT-30 that has arisen after mouse–human divergence. Exon recogni- and 50-ATTACCATGTGTCTTGCCATC-30. To produce the 280 bp tion being strictly dependent on sequence elements residing probe specific for the B3.5 kb mRNA, the following primers were in the immediate vicinity of the exon–intron borders, used: 50-CAGGAAGATTGTTGAAAGCCAT-30 and 50-ATTGAA computational analyses of the mouse and human genomic CAGGCAGTTGGACAG-30, which amplify part of the SPINK5f-l sequences surrounding the exon encoding the 30-amino-acid transcript 30untranslated region (GenBank NM_006846, nts insertion were carried out. Using an automated splice site 3,239–3,511). PCR cycling conditions were: 941C for 10 minutes, analyses tool (https://splice.cmg.edu), the in silico splicing 35 cycles comprising 941C for 30 seconds, 581C for 45 seconds, and prediction showed that, as compared to the mouse exon 27, 721C for 1 minute followed by a final extension at 721C for the human exon 28a had a weaker exon definition and it 10 minutes. All probes were 32P-labeled using the random priming could, therefore, sometimes not be detected by the spliceo- kit (Amersham Biosciences Europe, Cologno Monzese, Italy).

www.jidonline.org 7 A Tartaglia-Polcini et al. LEKTI Novel Isoforms

cDNA library screening Milan, Italy) and human skin, tongue, and bladder cDNAs The SPINK5 open reading frame probe encompassing nt synthesized from polyA þ RNA (BD Biosciences). Relative quantifi- 1,799–2,458 was used to screen 1 106 clones from a l ZAP cation of SPINK5 mRNAs was performed using the SYBRs Green  differentiated NHK cDNA library (kindly provided by E. Di Marco, PCR Master Mix (Applied Biosystem, Foster City, CA), following the Genova, Italy). Library screening, isolation, and purification of manufacturer’s instructions. To evaluate the expression level of all

positive clones were performed according to standard protocols. The SPINK5 transcripts, the primers used were SPINK5 1F 50-GACATC selected cDNA inserts were then analyzed by automated nt TAAGAGTACAGCTTCCTT-30 and SPINK5 1R 50-TGTTGCCATG sequencing (ABI PRISM, 377 DNA Sequencer, Perkin-Elmer Life CATTTTCCCATCTG-30, which are located on exons 14 and 15,

and Analytical Science, Milan, Italy). respectively. For the amplification of SPINK5sh and SPINK5l, the same oligonucleotide, SPINK5 2F 50-TGTCAGAGCATCTTTGATC 50- and 30-RACE GAGA-30 located on exon 28, was used in combination with the The existence of three distinct SPINK5 transcripts in differentiated primer SPINK5 2R 50 AAGCTGGAGAAGAATGCAAAATTC 30 NHK was further investigated by 30-RACE experiments. As target, located on the 30untranslated region region of the short transcript, 2 mg of total RNA from differentiated NHKs were reverse transcribed or with the oligonucleotide SPINK5 3R 50-GAACCTGTCTG and amplified using the 50/30-RACE kit, second generation (Roche CACTGGTCCTT-30, which lies within exon 28a, respectively. All Applied Science, Monza, Italy), following the manufacturer’s primer pairs were designed in order to minimize the possibility of protocol. The SPINK5-specific sense primer used was 50-TGCAG- genomic DNA amplifications. All reactions were normalized to GACATGGTTCCAGTG-30 (GenBank NM_006846, nts 2,113– glyceraldehyde-3-phosphate dehydrogenase, which was detected

2,132). using primers 50-GAAGGTGAAGGTCGGAGTC-30 and 50-GAA To determine the start site of transcription of the three SPINK5 GATGGTGATGGGATTTC-30 and quantification was performed transcripts, 50-RACE analysis, using antisense primers specific for using the comparative CT method (Pfaffl, 2001). For each SPINK5 each transcript, was carried out. Specifically, to determine the transcript, three independent amplifications were carried out. A transcription start site of the B3.5 kb mRNA, the antisense primer nontemplate control was run with every assay and all determinations 50-CTGCACTCATCCTTTGCATTA-30 (GenBank NM_006846, nts were performed in duplicate to achieve reproducibility. 2,773–2,793), which spans the junction between exons 28 and 29 on exons 28 and 29, was used. To analyze the shorter transcript RNase protection assay 50-end, the antisense primer was 50-GTAAAATGGTTATTTTGG Five micrograms of total RNA from differentiated NHKs and cultured TATC-30, corresponding to its 30untranslated region (GenBank human fibroblasts, as negative control, were hybridized overnight NT_029289.10, from nts 16 to 36 of SPINK5 intron 28). with specific radiolabeled riboprobes, treated with RNase A, RNase þ þ Finally, to ascertain the transcription start site of the SPINK5 T1, and proteinase K, and analyzed on a polyacrylamide gel, as transcript carrying the exon 28a insertion, the antisense primer was described (Micheloni et al., 2002).

50-CTGAACCTGTCTGCACTGGTC-30 (GeneBank NT_029289.10, To generate the SPINK5sh transcript-specific riboprobe, the from nts 687 to 707 of SPINK5 intron 28). following oligonucleotide primers, forward 5 -GATACATGTGAT þ þ 0 All cDNA products, tailed as depicted by the manufacturer GAGTTTAGAA-30 (GenBank NM_006846, nts 2,357–2,378) and (Roche Applied Science), were amplified using a SPINK5 reverse reverse 50-GTAAAATGGTTATTTTGGTATC-30 (GeneBank AC primer 50-CTTACTGGCAGCATCTTGTATG-30 placed between the 008722, from nts 16 to 36 of SPINK5 intron 28), were used þ þ first two exons (GenBank NM_006846, nts 91–112). The resulting 50- to amplify from human genomic DNA a 462 bp fragment encom- RACE products were purified on an agarose gel, ligated into the passing exons 25–28 and the first 36 bp of intron 28. The PCR plasmid vector pCR II Topo TA vector (Invitrogen), and sequenced. fragment, inserted in the dual promoter pCR II Topo TA vector (Invitrogen, San Giuliano Milanese, Milan, Italy), was subjected to in Northern blot and real-time reverse transcriptase-PCR vitro transcription using the Sp6 and T7 RNA polymerases (Promega To allow electrophoretic separation of the SPINK5 transcripts, 20 mg Corporation, Madison, WI) in the presence of [32P]UTP (Amersham of total RNA from normal and NS differentiated NHKs were Biosciences). The antisense product obtained allowed the discrimi- fractionated for 18 hours on a 1.2%. agarose/formaldehyde gel, nation between the short and the full-length transcripts (462 and transferred to Hybond N þ nylon membranes (Amersham Bios- 426 bp, respectively). The SPINK5 riboprobe specific for the splice ciences). Visualization of all transcripts was achieved using the same variant carrying the exon 28a insertion was produced by using the

radiolabeled probe used for library screening (nts 1,799–2,458). To same forward primer as above and the reverse primer 50- assess uniformity of RNA loading and transfer, membranes were AGGAACGCCCAGGTTGTC-30 (GenBank NT_029289.10, from nts further hybridized with a probe corresponding to the ubiquitously 733–750 of SPINK5 intron 28), which amplified from NHK cDNA a expressed gene glyceraldehyde-3-phosphate dehydrogenase 490 bp fragment spanning exons 25–28 and the first 64 bp of exon (GenBank NM002046). Quantification of the hybridization signals 28a. The RNA probe, generated by transcription of the PCR-cloned

was performed by densitometric scanning using the GS-750 fragment, produces on SPINK5f-l and SPINK5l a 426 and 490 bp densitometer (BioRad Laboratories, Hercules, CA). protected fragment, respectively. The length of the protected RNA To evaluate the transcription level of the three SPINK5 transcripts bands was estimated using radiolabeled RNA molecular weight in different human organs, real-time reverse transcriptase-PCR was markers (Roche Applied Science). To verify equal sample loading, a performed using an ABI PRISM 7000 instrument (Perkin-Elmer Life 160 bp b-actin riboprobe was used. Relative intensity of bands on and Analytical Science). Templates were: Human Digestive and autoradiograms was quantified using a GS-670 densitometer (Biorad Human Immune System MTCTM cDNA Panels (BD Biosciences, Laboratories).

8 Journal of Investigative Dermatology (2005) A Tartaglia-Polcini et al. LEKTI Novel Isoforms

Anti D14–D15–LEKTI polyclonal antibody production phenylmethylsufonyl fluoride, 10 mg/ml leupeptine, 10 mg/ml pep- The SPINK5 cDNA fragment encoding the protein domains statin A, 1 mg/ml antipaı¨ne. Lysates were clarified from insoluble D14–D15 (nts 2,781–3,241) was amplified by PCR using the forward material by centrifugation at 13,000 g, 41C for 5 minutes. The  primer 50-CGGGATCCAGGATGAGTGCAGTGAAT-30 and the D15 conditioned medium was concentrated by overnight acetone antisense primer (Bitoun et al., 2003). PCR cycling conditions were precipitation. Proteins were recovered by centrifugation at 941C for 10 minutes, 35 cycles comprising 941C for 30 seconds, 13,000 g, 41C for 30 minutes and resuspended in 30 ml of the lysis  551C for 45 seconds, and 721C for 1 minutes, followed by a final buffer. Proteins were quantified by Bradford protein assay kit (Biorad extension at 721C for 10 minutes. The amplified cDNA product, Laboratories). analyzed by direct sequencing, was subcloned into the glutathione- S-transferase gene fusion vector pGEX-3X (Amersham Biosciences) CONFLICT OF INTEREST using the EcoRI/BamHI restriction sites. The recombinant vector was The author states no conflict of interest. then transformed into competent TOP10 E. coli cells (Stratagene, Amsterdam, The Netherlands), and selected clones were checked by ACKNOWLEDGMENTS DNA sequencing. Expression and purification of the glutathione-S- We thank M. Teson for technical assistance, and M. Inzillo for artwork. C. Bonnart was a recipient of a Ministry of Education and Research fellowship transferase–D14–D15 fusion protein were essentially performed as (France). This work was supported by grants from: Ministero della Sanita` described previously (Bitoun et al., 2003). Immunization of rabbits (Italy) and Foundation pour la Recherche Me´dicale (France). with the recombinant antigen glutathione-S-transferase–D14–D15 was performed by Primm (Milan, Italy) and crude antiserum was purified by affinity chromatography, using the AminoLink Plus REFERENCES Immobilization Trial purification procedure (Pierce, Rockford, IL), Ahmed A, Kandola P, Ziada G, Parenteau N (2001) Purification and partial was performed following the manufacturer’s instructions. The amino acid sequence of proteins from human epidermal keratinocyte antibodies were termed a-D14–D15. conditioned medium. J Protein Chem 20:273–8

Birnstiel ML, Busslinger M, Strub K (1985) Transcription termination and 30 Western blotting processing: the end is in site!. Cell 41:349–59 Protein sample quantification and LEKTI detection with a-C (a-LEKTI Bitoun E, Micheloni A, Lamant L, Bonnart C, Tartaglia-Polcini A, Cobbold C D13–D15) polyclonal antibodies were carried out, as described et al. (2003) LEKTI proteolytic processing in human primary keratino- cytes, tissue distribution and defective expression in Netherton (Bitoun et al., 2003). LEKTI polyclonal a-D14–D15 antibodies were syndrome. Hum Mol Genet 12:2417–30 used at the final concentration of 1 mg/ml. To allow electrophoretic Chavanas S, Bodemer C, Rochat A, Hamel-Teillac C, Ali M, Irvine AD et al. separation of the B148/145 kDa LEKTI isoforms, protein samples (2000a) Mutations in SPINK5, encoding a serine protease inhibitor, from BFA-treated cell lysates were fractionated on a 5% SDS-PAGE cause Netherton syndrome. Nat Genet 25:141–2 (Biorad Laboratories). To test the signal specificity, competition Chavanas S, Garner C, Bodemer C, Ali M, Teillac DH, Wilkinson J et al. experiments were performed as described previously (Bitoun et al., (2000b) Localization of the Netherton syndrome gene to chromosome 5q32, by linkage analysis and homozygosity mapping. Am J Hum Genet 2003). 66:914–21 Come`l M (1949) Ichthyosis linearis circumflexa. Dermatologica 98:133–6 Cloning of LEKTI cDNAs into pEF-DEST51 expression vector Descargues P, Deraison C, Bonnart C, Kreft M, Kishibe M, Ishida-Yamamoto A LEKTIf-l cDNA (GenBank NM_006846) and short-length cDNA et al. (2005) Spink5-deficient mice mimic Netherton syndrome through (GenBank DQ149929) were amplified by long-range PCR (PfU degradation of desmoglein 1 by epidermal protease hyperactivity. Nat Turbo, Stratagene, Milan, Italy) from a vector containing the full- Genet 37:56–65 length cDNA as a template. The PCR products were subcloned into Galli G, Gruise J, Tucker PW, Nevins JR (1988) Poly(A) site choice rather than splice site choice governs the regulated production of IgM heavy-chain the pDEST8 vector by homologous recombination and transferred RNAs. Proc Natl Acad Sci USA 85:2439–43 into the mammalian expression vector pEF-DEST51 using the Galliano MF, Roccasecca RM, Descargues P, Micheloni A, Levy E, Zambruno Gateway technology, according to the manufacturer’s instructions G et al. (2005) Characterization and expression analysis of the Spink5

(Invitrogen). pEF-DEST51-LEKTI and pEF-DEST51-LEKTIsh constructs gene, the mouse ortholog of the defective gene in Netherton syndrome. were fully sequenced using the Big Dye Terminator Sequencing Kit Genomics 85:483–92 and an ABI 3100 automated sequencer (Applied Biosystem). Garcia-Sacristan A, Fernandez-Nestosa MJ, Hernandez P, Schvartzman JB, Krimer DB (2005) Protein kinase clk/STY is differentially regulated during erythroleukemia cell differentiation: a bias toward the skipped CHO cell transfections splice variant characterizes postcommitment stages. Cell Res 15: One day prior to transfection, CHO cells were plated at 5 104 cells 495–503 Â per well of a six-well plate. The day of the transfection, cells at 70% Hewett DR, Simon AL, Mangan NE, Jolin HE, Green SM, Fallon PG et al. (2005) Lethal, neonatal ichthyosis with increased proteolytic processing confluence were transiently transfected with 1 mg of pEF-DEST51, of filaggrin in a mouse model of Netherton syndrome. Hum Mol Genet pEF-DEST51-LEKTI, or pEF-DEST51-LEKTIsh plasmid DNA, using the 15:335–46 TM FuGENE 6 Transfection Reagent, according to the manufacturer’s Ishida-Yamamoto A, Deraison C, Bonnart C, Bitoun E, Robinson R, O’Brien TJ recommendations (Roche Applied Science). Twenty-four hours after et al. (2005) LEKTI is localized in lamellar granules, separated from KLK5 transfection, medium was replaced with serum-free medium and and KLK7, and is secreted in the extracellular spaces of the superficial stratum granulosum. J Invest Dermatol 124:360–6 cells were maintained in culture for an additional 24 hours. Both intracellular and extracellular protein extracts were prepared for Jayakumar A, Kang Y, Mitsudo K, Henderson Y, Frederick MJ, Wang M et al. (2004) Expression of LEKTI domains 6–90 in the baculovirus expression Western blot analysis. Cells were lysed in a solution containing Tris- system: recombinant LEKTI domains 6–90 inhibit trypsin and subtilisin A. Cl 50 mM, pH 8, 150 mM NaCl, EDTA 5 mM, pH 8, 1% NP40, 1 mM Protein Expr Purif 35:93–101

www.jidonline.org 9 A Tartaglia-Polcini et al. LEKTI Novel Isoforms

Johansson MW, Geyser P, Soderhall K (1994) Purification and cDNA cloning Mitsudo K, Jayakumar A, Henderson Y, Frederick MJ, Kang Y, Wang W et al. of a four-domain Kazal proteinase inhibitor from crayfish blood cells. Eur (2003) Inhibition of serine proteinases plasmin, trypsin, subtilisin A, J Biochem 223:389–94 cathepsin G, and elastase by LEKTI: a kinetic analysis. Biochemistry Kazal LA, Spicer DS, Brahinsky RA (1948) Isolation of a crystalline trypsin 42:3874–81 inhibitor–anticoagulant protein from pancreas. J Am Chem Soc Netherton EW (1958) A unique case of trichorrhexis nodosa – ‘bamboo hairs’. 70:3034–40 Arch Dermatol 78:483–7 Komatsu N, Takata M, Otsuki N, Ohka R, Amano O, Takehara K et al. (2002) Pfaffl MW (2001) A new mathematical model for relative quantification in Elevated stratum corneum hydrolytic activity in Netherton syndrome real-time RT-PCR. Nucleic Acids Res 29:e45 suggests an inhibitory regulation of desquamation by SPINK5-derived Raghunath M, Tontsidou L, Oji V, Aufenvenne K, Schurmeyer-Horst F, peptides. J Invest Dermatol 118:436–43 Jayakumar A et al. (2004) SPINK5 and Netherton syndrome: novel Kreutzmann P, Scultz A, Standker L, Forssmann WG, Magert HJ (2004) mutations, demonstration of missing LEKTI, and differential expression of Recombinant production, purification and biochemical characterization transglutaminases. J Invest Dermatol 123:474–83 of domain 6 of LEKTI: a temporary Kazal type-related serine proteinase Roberts RM, Mathialagan N, Duffy JY, Smith GW (1995) Regulation and inhibitor. J Chromatogr B 803:75–81 regulatory role of proteinase inhibitors. Crit Rev Eukaryot Gene Expr Laskowski Jr M, Kato I (1980) Protein inhibitors of proteinases. Annu Rev 5:385–436 Biochem 49:593–626 Saxena I, Tayyab S (1997) Protein proteinase inhibitors from avian egg whites. Liu H, Johnson EM (2002) Distinct proteins encoded by alternative transcripts Cell Mol Life Sci 53:13–23 of the PURG gene, located contrapodal to WRN on chromosome 8, Ule J, Ule A, Spencer J, Willliams A, Hu JS, Cline M et al. (2005) Nova determined by differential termination/polyadenylation. Nucleic Acids regulates brain-specific splicing to shape the synapse. Nat Genet Res 30:2417–26 37:844–52 Magert HJ, Kreutzmann P, Drogemuller K, Standker L, Adermann K, Walden van de Locht A, Lamba D, Bauer M, Huber R, Friedrich T, Kroger B et al. M et al. (2002) The 15-domain serine proteinase inhibitor LEKTI: (1995) Two heads are better than one: crystal structure of the insect biochemical properties, genomic organization, and pathophysiological derived double domain Kazal inhibitor rhodniin in complex with role. Eur J Med Res 7:49–56 thrombin. EMBO J 14:5149–57 Magert HJ, Standker L, Kreutzmann P, Zucht HD, Reinecke M, Sommerhoff Wessagowit V, Nalla VK, Rogan PK, McGrath JA (2005) Normal and CP et al. (1999) LEKTI, a novel 15-domain type of human serine abnormal mechanisms of gene splicing and relevance to inherited skin proteinase inhibitor. J Biol Chem 274:21499–502 diseases. J Dermatol Sci 40:73–84 Micheloni A, Falcioni R, Zambruno G, D’Alessio M (2002) The human Yang T, Liang D, Koch PJ, Hohl D, Kheradmand F, Overbeek PA (2004) integrin b4B and b4C variants are not expressed in a tissue specific Epidermal detachment, desmosomal dissociation, and destabilization of manner. FEBS Lett 519:238–9 corneodesmosin in Spink5 / mice. Genes Dev 18:2354–8 À À

10 Journal of Investigative Dermatology (2005) Article 2

LEKTI fragments specifically inhibit KLK5, KLK7 and KLK14 and control desquamation through a pH-dependent interaction.

Dans cet article, nous mettons en évidence la présence de nombreux fragments protéolytiques de LEKTI dans l’épiderme humain ainsi que dans le milieu de culture de kératinocytes primaires humains. Ces fragments sont générés suite au clivage du précurseur par la furine, une convertase exprimée dans la couche granuleuse des kératinocytes. La combinaison de méthodes biochimiques et de données prédictives nous ont permis de proposer D1, D5, D6, D8-D11 et D9-D15 comme étant des fragments protéolytiques potentiels issus de la protéolyse de LEKTI dans l’épiderme. Des tests fonctionnels ont révélé l’absence d’activité anti-protéasique du domaine D1, à la différence des autres fragments qui présentent des spécificités d’inhibition spécifiques envers les kallikréines épidermiques KLK5,

KLK7 et KLK14. Nous avons mis en évidence le rôle primordial du pH dans l’interaction entre

LEKTI et ses cibles. Ces résultats indiquent que dans les couches les plus profondes de la couche cornée, la neutralité du pH permet une forte interaction entre LEKTI et ses cibles, empêchant ainsi le clivage des cornéodesmosomes. Avec l’acidification du pH vers la superficie de la couche cornée, LEKTI libère progressivement les kallikréines qui deviennent alors disponibles pour digérer les composants des cornéodesmosomes et assurer l’élimination contrôlée des couches superficielles du stratum corneum uniquemement. Nous mettons ainsi en évidence un nouveau mécanisme de l’homéostasie cutanée par lequel le gradient de pH de la couche cornée module la desquamation. Ce mécanisme permet d’expliquer qu’en l’absence de LEKTI, les kallikréines, déversées à l’interface entre la couche granuleuse et couche cornée, sont libres et immédiatement actives pour assurer la dégradation des structures cornéodesmosomales. La localisation de cette hyperactivité protéasique est en parfaite corrélation avec le degré de décollement de la couche cornée des patients SN.

107 108 Molecular Biology of the Cell Vol. 18, 3607–3619, September 2007 LEKTI Fragments Specifically Inhibit KLK5, KLK7, and KLK14 and Control Desquamation through a pH-dependent Interaction□D Celine Deraison,*†‡§ Chrystelle Bonnart,*†§ Frederic Lopez,ʈ Celine Besson,*† Ross Robinson,¶ Arumugam Jayakumar,# Fredrik Wagberg,@ Maria Brattsand,** Jean Pierre Hachem,†† Goran Leonardsson,@ and Alain Hovnanian*†‡

*Institut National de la Sante´et de la Recherche Me´dicale, U563, Toulouse, F-31300 France; †Universite´Toulouse III Paul-Sabatier, Unite´Mixte de Recherche-S563, Toulouse, F-31400 France; ‡Centre Hospitalier Universitaire de Toulouse, Hopital Purpan, Departement de Ge´ne´tique Me´dicale, Toulouse, F-31000 France; ʈUniversite´Toulouse III Paul-Sabatier, Faculte´deMe´decine Toulouse-Rangueil, Institut Louis Bugnard (IFR31), Toulouse, F-31400 France; ¶Wellcome Trust Centre for Human Genetics, Oxford OX3 7BN, United Kingdom; #Department of Head and Neck Surgery, M. D. Anderson Cancer Center, Houston, TX 77030; @Arexis AB/Biovitrum, 413 46 Gothenburg, Sweden; **Department of Public Health and Clinical Medicine, Section for Dermatology and Venereology, Umeå University, SE-901 87 Umeå, Sweden; and ††Department of Dermatology, Vrije Universiteit Brussels, 1090 Brussels, Belgium

Submitted February 14, 2007; Revised June 11, 2007; Accepted June 18, 2007 Monitoring Editor: M. Bishr Omary

LEKTI is a 15-domain serine proteinase inhibitor whose defective expression underlies the severe autosomal recessive ichthyosiform skin disease, Netherton syndrome. Here, we show that LEKTI is produced as a precursor rapidly cleaved by furin, generating a variety of single or multidomain LEKTI fragments secreted in cultured keratinocytes and in the epidermis. The identity of these biological fragments (D1, D5, D6, D8–D11, and D9–D15) was inferred from biochemical analysis, using a panel of LEKTI antibodies. The functional inhibitory capacity of each fragment was tested on a panel of serine proteases. All LEKTI fragments, except D1, showed specific and differential inhibition of human kallikreins 5, 7, and 14. The strongest inhibition was observed with D8–D11, toward KLK5. Kinetics analysis revealed that this interaction is rapid and irreversible, reflecting an extremely tight binding complex. We demonstrated that pH variations govern this interaction, leading to the release of active KLK5 from the complex at acidic pH. These results identify KLK5, a key actor of the desquamation process, as the major target of LEKTI. They disclose a new mechanism of skin homeostasis by which the epidermal pH gradient allows precisely regulated KLK5 activity and corneodesmosomal cleavage in the most superficial layers of the stratum corneum.

INTRODUCTION proteinase inhibitory domains (D1–D15) separated by 14 spacing segments. These linker regions are characterized by Lympho-epithelial Kazal type inhibitor (LEKTI), is encoded the presence of several dibasic residues, potentially sensitive to by SPINK5 (Serine Proteinase Inhibitor Kazal type 5) (Magert et the cleavage by the subtilisin-like proprotein convertases. Two al., 1999). LEKTI, belongs to the Kazal serine proteinase of these domains (D2 and D15) resemble typical Kazal-type inhibitor family whose numerous members generally bear serine proteinase inhibitors, as deduced from their primary 3–7 tandem kazal domains. Interestingly, LEKTI contains a structure and characteristic pattern of six cysteine residues. The signal peptide and exhibits as many as 15 potential serine other 13 domains share high homology with this class of in- hibitors but lack one of the three conserved typical disulfide bridges. Despite this difference, these sequences adopt a hair- This article was published online ahead of print in MBC in Press pin structure, creating an inhibitory binding loop (Lauber et al., (http://www.molbiolcell.org/cgi/doi/10.1091/mbc.E07–02–0124) 2003). Several authors have studied the inhibitory capacity of on June 27, 2007. different forms of LEKTI. The full-length LEKTI recombinant □ D The online version of this article contains supplemental material protein has been shown to inhibit trypsin, subtilisin A, plas- at MBC Online (http://www.molbiolcell.org). min, cathepsin G, and neutrophil elastase, but not chymotryp- § These authors contributed equally to this work. sin (Mitsudo et al., 2003). A partial recombinant form of LEKTI containing domains 6–9 (rLEKTI6–9) has been shown to in- Address correspondence to: Alain Hovnanian (alain.hovnanian@ toulouse.inserm.fr). hibit trypsin, subtilisin A, chymotrypsin, kallikrein 5 (KLK5, stratum corneum tryptic enzyme [SCTE]), and kallikrein 7 Abbreviations used: BIA, biomolecular interaction analysis; CHO, (KLK7, stratum corneum chymotryptic enzyme [SCCE]) but Chinese hamster ovary; GR, granular layer; HBS, HEPES-buffered not plasmin, cathepsin G, or elastase (Jayakumar et al., 2004; saline; KLK, kallikrein; LEKTI, Lympho-epithelial Kazal type inhib- Schechter et al., 2005). In addition, the single domain D6 was itor; LEKTIf-l, full-length LEKTI; LEKTIsh, short-length LEKTI; NHK, normal human keratinocytes; NS, Netherton syndrome; SC, shown to be a potent inhibitor of trypsin, KLK5, and KLK7, stratum corneum; SPINK5, serine proteinase inhibitor Kazal type 5. whereas D15 was not effective against these two kallikreins

© 2007 by The American Society for Cell Biology 3607 C. Deraison et al.

(Egelrud et al., 2005). Altogether, these results highlight the fact ing the controlled release of active proteinase in the most that each form of LEKTI exhibits its own inhibitory specificity. superficial layers of SC. LEKTI is expressed specifically in the most differentiated viable layers of stratified epithelial tissues and in the Hassal corpuscules of the thymus (Bitoun et al., 2003). In the epi- MATERIALS AND METHODS dermis, it is mainly restricted to the granular layer (GR), where critical biochemical and morphological changes that Antibodies, Proteinases, and Substrates occur during terminal differentiation lead to cornification Anti-LEKTI antibodies used in this study were as follows: a rabbit polyclonal antibody raised against D1–D6 LEKTI domains (Bitoun et al., 2003), a rabbit (stratum corneum [SC] formation). LEKTI is transported by polyclonal antibody raised against D8–D11 LEKTI domains (Ishida-Yamamoto et specific intracellular lamellar granule cargoes until its secre- al., 2005) and a rabbit polyclonal antibody raised against D13–D15 LEKTI do- tion in the extracellular space, between granular cells and mains (Bitoun et al., 2003). Trypsin, tryptase, chymotrypsin, plasmin, thrombin, cornified cells (Ishida-Yamamoto et al., 2005). neutrophile elastase, cathepsin G, and kallikreins 1 and 3 were purchased from Sigma-Aldrich (St. Louis, MO). KLK8 was purchased from R&D Systems (Min- In normal human keratinocytes (NHK), LEKTI is expressed neapolis, MN). Recombinant kallikreins KLK5, KLK7, and KLK14 were obtained as three precursors derived from alternative pre-mRNA pro- as previously described (Brattsand et al., 2005). All chromogenic substrates were cessing (Tartaglia-Polcini et al., 2006). In addition to the previ- commercially obtained (Sigma-Aldrich). ously described, full-length isoform of 15 domains (145 kDa), SPINK5 encodes a shorter LEKTI isoform (125 kDa) composed Human Epidermis and Cell Culture of the first 13 domains generated from the use of an alternative Normal and NS human primary keratinocytes were isolated from skin biop- polyadenylation signal, as well as a longer isoform (148 kDa) sies and cultured in Green medium containing 1.2 mM calcium as previously carrying a 30-amino acid residue insertion between the 13th described (Bitoun et al., 2003). Chinese hamster ovary (CHO) and furin- and the 14th inhibitory domains, generated from the activation deficient CHO cells were a generous gift of Dr. Leppla (Laboratory of Micro- bial Ecology, National Institute of Dental Research, NIH, Bethesda, MD of cryptic splice junction sequences. RNase protection assay 20892) (Gordon et al., 1995). Cells were grown in F12 medium (Invitrogen, experiments have identified the full-length transcript as the Carlsbad, CA) supplemented with 10% fetal calf serum and 100 U/ml peni- most abundant isoform in NHK (Tartaglia-Polcini et al., 2006). cillin/streptomycin. Human foreskin was obtained after medical surgery at LEKTI precursors are rapidly processed into proteolytic frag- Purpan Hospital (Toulouse, France). The epidermis was mechanically sepa- rated from the dermis after heating at 55°C for 15 min. The medical ethical ments in a postendoplasmic reticulum compartment (Bitoun et committee CCPPRB (Comite´consultatif de personnes se preˆtant a`des recher- al., 2003; Jayakumar et al., 2005). C-terminal LEKTI fragments have ches biome´dicales) of Toulouse hospitals approved all described studies been detected in the conditioned medium of NHK (Tartaglia- (research project no. 0102908). The study was conducted according to the Polcini et al., 2006). In addition, a 30-kDa polypeptide with an Declaration of Helsinki principles. N-terminal extremity, corresponding to D8, has also been pu- rified from NHK-conditioned medium (Ahmed et al., 2001). Cloning, Expression, and Purification of LEKTI Domains SPINK5 mutations lead to Netherton syndrome (NS; Chavanas Partial LEKTI cDNA fragments encoding the following human LEKTI frag- et al., 2000), a severe autosomal recessive skin disorder charac- ments: D1 (residues 23-77), D5 (residues 292-353), D6 (residues 356-423), and terized by congenital ichthyosiform erythroderma, a specific D8–D11 (residues 490-759) were amplified by PCR from a vector containing the full-length cDNA as a template; amino acid numbering is according to hair shaft defect (trichorrhexis invaginata) and atopic manifes- Magert et al. (1999). PCR products of D5 and D6 were cloned into pGEX in order tations (Traupe, 1989). To decipher the biological functions of to use glutathione S-transferase (GST) as a C-terminal tag. D1 and D8–D11 PCR LEKTI, we have genetically engineered mice with a targeted dis- products were cloned into pET22b, to introduce an in-frame N-terminal His6 tag. ruption of Spink5. Spink5-null mice faithfully replicate key features All the constructs were transformed into the Origami bacterial strain (Novagen, Madison, WI) in order to produce recombinant LEKTI fragments. Previous of Netherton syndrome, including abnormal desquamation, im- studies have demonstrated that similar prokaryotic expression systems are suit- paired keratinization, hair malformation, and a severe skin barrier able to obtain functional LEKTI fragments (Kreutzmann et al., 2004; Egelrud et al., defect. LEKTI deficiency causes abnormal desmosome cleavage 2005). in the upper GL through desmoglein 1 degradation due to the Production of recombinant LEKTI fragments was induced by adding 1 mM isopropyl-1-thio-␤-d-galactopyranoside (IPTG) to Origami cultures (Nova- hyperactivity of KLK5 and KLK7. This leads to accelerated SC gen). After3hat30°C, cells were harvested, lysed in PBS containing 0.1 mM shedding and consequent loss of skin barrier function (Yang et EGTA, 0.25% Tween 20, 100 ␮g/ml lysosyme, and subjected to sonication for al., 2004; Descargues et al., 2005; Hewett et al., 2005). This work optimal solubilization. For GST fusion proteins, the soluble fraction was loaded identified LEKTI as a key regulator of epidermal protease onto a glutathione Sepharose 4B column according to the recommendations of the MicroSpin GST purification module (GE Healthcare, Waukesha, WI). For activity. In addition, the presence of LEKTI domains (D1, D5, His-fusion proteins, the soluble fraction was subjected to nickel affinity (Chelat- and D6) in the blood circulation (Magert et al., 1999, 2002) ing Sepharose Fast Flow, GE Healthcare, Waukesha, WI). Elution was performed suggests that LEKTI could also have biological effects at a using a gradient of imidazole (0–500 mM in PBS) on fast protein liquid chroma- distance from the skin. The extent of atopic manifestations in tography (FPLC). Nickel-eluted fractions were subsequently loaded onto a cation exchange column (SP Sepharose High performance, GE Healthcare), for which a NS predicts a role for LEKTI as an inhibitor of proteases in- gradient of NaCl (0–2 M) was carried out to elute proteins. Finally, size exclusion volved in the inflammation process. chromatography (HiLoad 16/60 Superdex 75 pq, GE Healthcare) was used to To gain further insight into LEKTI functions, we studied obtain pure protein fractions, which were pooled for further experiments. Puri- the inhibitory properties of physiological LEKTI fragments. fied proteins were analyzed by SDS-PAGE after Coomassie Blue staining. HisD9–D15 was purified following the experimental procedures as previously The different LEKTI forms present in the epidermis, in NHK, described (Jayakumar et al., 2004). Proteins were dialyzed against a solution of as well as in a mammalian heterologous expression system HEPES 10 mM, pH 7.4, for inhibitory activity assay and Biacore analysis. were detected using three antibodies directed against the N-terminal, the internal and the C-terminal part of full- Cloning of LEKTI cDNAs into pEF-DEST51 Expression length LEKTI. We produced several of these physiological Vector LEKTI proteolytic fragments and characterized their inhi- LEKTI full-length cDNA (GenBank NM_006846) or LEKTI short-length (Gen- bitory properties against a large panel of serine proteinases Bank DQ149929) were amplified by long-range PCR (PfU Turbo, Stratagene, involved in skin homeostasis and inflammation. Kinetic pa- La Jolla, CA) from a vector containing the full-length cDNA as a template. The rameters of the interaction between LEKTI fragments and PCR products were subcloned into pDEST8 vector by homologous recombi- their proteinase targets were studied by surface plasmon nation and transferred into the mammalian expression vector pEF-DEST51 resonance (SPR). Using the same technology, we showed using the Gateway technology, according to the manufacturer’s instructions (Invitrogen). pEF-DEST51-SPINK5f-l and pEF-DEST51-SPINK5sh constructs that the pH gradient occurring through the SC controls the were fully sequenced using the Big Dye Terminator Sequencing Kit and an interaction strength between LEKTI and KLK5, thus allow- ABI 3100 automated sequencer (Applied Biosystems, Foster City, CA).

3608 Molecular Biology of the Cell pH Controls Protease Inhibition by LEKTI

CHO Cell Transfections emission using the Val-Pro-Arg-AMC (Amino 4 Methyl Coumarine) substrate (Ex, 355 nm; Em, 460 nm). One day before transfection, CHO cells were plated at 5 ϫ 104 cells per well of a six-well plate. The day of the transfection, cells at 70% confluence were ␮ Surface Plasmon Resonance Analysis transiently transfected with 1 g of pEF-DEST51, pEF-DEST51-SPINK5f-l,or pEF-DEST51-SPINK5sh plasmid DNAs, using the FuGENE 6 Transfection Reagent, according to the manufacturer’s recommendations (Roche Applied Principle. Binding events between two molecules are monitored in real time, Science, Indianapolis, IN). Twenty-four hours after transfection, the medium without the use of any label, using an optical phenomenon called SPR. Biomo- was replaced with serum-free medium, and cells were maintained in culture lecular binding events cause changes in the refractive index close to the surface for an additional 24 h. Both intracellular and extracellular protein extracts layer of a chip, which are detected as changes in the SPR signal. During a binding were prepared for Western blot analysis. analysis SPR changes occur as a solution is passed over the surface of a sensor- chip. To perform an analysis, one interactant (ligand) is immobilized over a Western Blotting carboxymethylated dextran matrix of a sensorchip. The sensor surface forms one wall of a flow cell. Sample containing the other interactant (analyte) is injected Epidermis was crushed in a protein extraction buffer (PEB) containing Tris-Cl over this surface in a precisely controlled flow. The progress of an interaction is 50 mM, pH 8, NaCl 150 mM, EDTA 5 mM, pH 8, 1% NP40, 1 mM PMSF, 10 monitored as a sensorgram that expresses resonance units (RU) as a function of ␮g/ml leupeptin, 10 mg/ml pepstatin A, and 1 mg/ml antipain with an time. Analyte binds to the surface-attached ligand during sample injection, Ultra-Turrax. Cultured cells were lysed in PEB. Lysates were clarified from resulting in an increase in signal. At the end of the injection, the sample is insoluble material by centrifugation at 13000 g, 4°C for 5 min. The conditioned replaced by a continuous flow of buffer, and the decrease in signal reflects medium was concentrated by overnight acetone precipitation. Proteins were dissociation of interactant from the surface-bound complex. recovered by centrifugation at 13000 g, 4°C for 30 min, and resuspended in lysis buffer. Proteins were quantified by Bradford protein assay kit (Bio-Rad Materials. All binding studies based on SPR phenomenon were performed on Laboratories, Hercules, CA). Protein fractions were mixed with Laemmli a four-channel BIACORE 3000 optical biosensor instrument (BIAcore AB, buffer (Bio-Rad Laboratories), incubated for 5 min at 65°C, and then separated Uppsala, Sweden). All experiments were performed on sensorchips CM5 by SDS-PAGE. After migration, proteins were transferred to Hybond-C extra obtained from Biacore AB. membranes (GE Healthcare). After incubation with primary and secondary antibodies, enhanced chemiluminescence detection was performed as recom- mended by the manufacturer. PNGase F (New England Biolabs, Beverly, MA), Immobilization of Recombinant LEKTI Domains. Both flow cells of a CM5 O-glycosidase, and ␣-(233,6,8,9)-neuraminidase (Sigma-Aldrich) treatments sensor chip were coated with recombinant proteins by amine coupling, allowing were performed at 37°C, according to the manufacturer’s instructions. immobilization of the proteins in the same orientation, independent of the tag fused to the protein. Various levels of RU were immobilized to take into account the differences in molecular weights: His-D1 (500 RU), GST-D5 (2100 RU), Proteinase Activity Assay GST-D6 (2100 RU), His-D8–D11 (2000 RU), and His-D9-D15 (3800 RU). Varying concentrations of substrates (Table 1) were incubated with a fixed amount of proteinase in a suitable buffer activity, and initial velocities were BIA Analysis. Binding analyses were performed with multiple injections of measured by monitoring the absorbance at 405 nm. Double reciprocal Lin- different protein concentrations over the immobilized surfaces at 15°C. All eweaver-Burke plots of 1/[V] versus 1/[S] were used to determine the Km of samples were diluted in HBS-EP buffer (HEPES 10 mM, NaCl 150 mM, EDTA each substrate for its partner enzyme. Affinity constant (Km) between an 3 mM, and polysorbate 0.005%) and were injected over the sensor surface for enzyme and a substrate is defined as the substrate concentrate at 1/2 maxi- 3 min at a flow rate of 30 ␮l/min. All diluted samples were injected at the mum velocity. Six separate mixtures of enzymes and inhibitors in various same time over the four channels (flow cells). A gradient of 0.05% to 0.5% SDS ratios were incubated for 5 min. The proteinase activity was initiated by in HBS-EP buffer was used to regenerate the chip. D1 was considered as a adding the appropriate synthetic substrate (Table 1), and the activity of free negative control according to its inability to affect proteinase activity. D1 enzyme was determined spectrophotometrically at 405 nm by monitoring the sensorgrams were subtracted from sensorgrams obtained with immobilized release of p-nitrophenyl acetate (pNA). All time courses were performed at fusion proteins to yield true binding responses. Kinetics constants (ka, kd, 25°C, during 15 min, in duplicate. Reaction velocities were linear over the ϭ KD kd/ka) were calculated using BIAevaluation 4.0.1 software and the 1/1 course of the reaction. Initial velocities were measured by monitoring absor- Langmuir binding model was chosen. This model determines the association bance at 405 nm, and IC was calculated by plotting [V /V ]-1 versus [I]. To 50 0 i constant (ka) and takes into account the dissociation occurring during the account for the effect of substrate Km on the inhibition constant, IC50 were association phase. Therefore, the calculated values do not necessary correlate converted to Ki using the formula (Morris et al., 2002): with apparent slope of the sensorgram.

IC50 K ϭ Casein Gel Zymography i [S] 1 ϩ Epidermis from wild-type (WT) and knockout (KO) animals was crushed in Km 1 M acetic acid solution with an Ultra-Turrax. After overnight extraction at 4°C, soluble proteins were lyophilized and resuspended in PBS. After acetone For KLK8, the proenzyme was activated following the manufacturer’s precipitation, proteins were assayed (Bradford, Bio-Rad), and 5 ␮g of soluble instructions and the initial velocity was measured by monitoring fluorescence fractions were mixed in a nondenaturing loading buffer (50 mM Tris-HCl, pH

Table 1. Enzymes, substrates, buffers, and Km

Proteinase Substrate Buffer Km hKLK (75 nM) Ile-Pro-Arg-pNA (1 mM) 0.1 M Tris, 0.5 M NaCl, pH 8 0.6 mM hKLK7 (180 nM) Arg-Pro-Tyr-pNa (1 mM) 137 mM NaCl, 27 mM KCl, 10 nM NaP, pH 7.4 1 mM hKLK14 (9.4 nM) Pro-Phe-Arg-pNA (1 mM) 0.1 M Tris, 0.5 M NaCl, pH 8 0.75 mM hKLK8 (3.2 nM) Val-Pro-Arg-AMC (0.1 mM) 0.1 M Tris, pH 9 1 mM hCatG (60 nM) (Ala)2-Pro-Phe-pNa (0.06 mM) 137 mM NaCl, 27 mM KCl, 10 mM NaP, pH 7.4 1.3 mM ␣ Bovine Trypsin (42 nM) N -Benzoyl-Arg-pNA (2.5 mM) 50 mM Tris, pH 8, 20 mM CaCl2 0.7 mM Bovine Chymotrypsin (2 nM) Suc-(Ala)2-Pro-Arg-pNA (0.2 mM) 50 mM Tris, pH 8, 20 mM CaCl2 0.01 mM hTryptase (8 nM) Z-Gly-Pro-Arg-pNA (0.2 mM) 50 mM HEPES, 120 mM NaCl 0.05 mM hElastase (15 nM) Suc-(Ala)3-pNA (1 mM) 50 mM Tris, pH 8 2 mM hPlasmin (22.5 pM) Tosyl-Gly-Pro-Lys-pNA (1 mM) 100 mM Tris, pH 7.6, 120 mM NaCl 3.8 mM Porcine KLK1 (20 nM) Val-Leu-Arg-pNA (0.375 mM) 50 mM Tris, pH 7.8, 200 mM NaCl 0.08 mM hKLK3 (20 nM) Tosyl-Gly-Pro-Lys-pNa (0.375 mM) 50 mM Tris, pH 9, 200 mM NaCl 0.1 mM hThrombin (410 nM) Phe-Val-Arg-pNA (1.5 mM) 100 mM Tris, pH 8, 100 mM NaCl 0.15 mM

For protease activity assay, concentrations of enzymes and their appropriate substrates are indicated, as well as buffer concentration. Affinity constants (Km) of the enzyme for its substrate have been calculated.

Vol. 18, September 2007 3609 C. Deraison et al.

Figure 1. LEKTI proteolytic fragments in the epidermis, normal human keratinocytes, and transfected CHO - Model of LEKTI proteolysis. Protein extracts from human foreskin epidermis (lane 1), cultured normal human keratinocytes (lane 2), or transfected CHO cells (lanes 3–5) were analyzed by Western-blot using three anti-LEKTI antibodies indicated on the left. CHO cells were transiently transfected with the empty pEF-DEST51 vector (Ϫ, lane 3); pEF-DEST51-SPINK5f-l (LEKTIf-l, lane 4); or pEF-DEST51-SPINK5sh (LEKTIsh, lane 5). Intracellular and extracellular fractions of cultured cells were analyzed. The molecular weights of the different bands obtained are indicated in kDa. In intracellular fractions of NHK and transfected CHO, precursors of 145 and 125 kDa are observed with each antibody. Conversely, in the epidermis and in extracellular fractions of NHK and CHO, only proteolytic fragments of LEKTI are visualized. For each antibody used, the molecular weight of these proteolytic LEKTI fragments is indicated. Note the absence of LEKTI precursors detected in human epidermis. Right, schematic representation of LEKTI processing in human epidermis and NHK. A schematic representation of LEKTI processing in human epidermis and NHK is proposed according to the results obtained with the different antibodies used. The two LEKTI precursors (145 and 125 kDa) are processed into several physiological LEKTI fragments. The identity of some LEKTI fragments was proposed according to several parameters, including the antibody used, the molecular weight of the unglycosylated forms (see Figure 3), and the existence of LEKTI fragments already published.

6.8, 2% SDS, 10% glycerol, and 0.1% bromophenol blue) were loaded onto West Chester, PA). The intensity of the fluorescence signals was coded as casein copolymerized with acrylamide gels (15% acrylamide, 0.05% ␣-casein, color gradient, ranging from 0 (dark) to 255 (white). Sigma-Aldrich) for electrophoresis. Gels were washed with 2.5% Triton X-100 for 1 h to remove SDS and incubated 24 h at 37°C in a reaction buffer containing 50 mM Tris, pH 8. Gels were stained with 1% Coomassie Brilliant RESULTS blue for 30 min. Areas of caseinolytic activity appeared as clear zones against a dark blue background. To assess inhibitory capacity of D8–D11 LEKTI Human Epidermis and Cultured Keratinocytes Secrete domain, a solution of D8–D11 fragment (5 ␮M) was added to the sample LEKTI Proteolytic Fragments after Intracellular before electrophoresis (15 min on ice), as well as in the reaction buffer. Processing of LEKTI Precursors To detect the presence of LEKTI precursors and proteolytic In Situ Zymography fragments in human epidermis, foreskin protein extracts Frozen sections of WT or Spink5Ϫ/Ϫ mouse skin (5-mm thickness) were rinsed were analyzed by Western blotting using three LEKTI anti- with a washing solution (2% Tween 20 in deionized water) and incubated at bodies (␣D1–D6, ␣D8–D11, and ␣D13–D15; Figure 1, lane 1). 37°C overnight with 100 ␮l of BODIPY FL casein using the EnzChek Ultra Protease Assay kit (Invitrogen) in 50 mM Tris-Cl, pH 8, in order to visualize The same analysis was carried out using intracellular and global protease activity. Cryostat sections were incubated in the same condi- extracellular fractions of differentiated normal human kera- tions with 100 ␮l of Boc-Val-ProArg-AMC or Suc-Leu-Leu-Val-Tyr-AMC tinocytes in culture (NHK; Figure 1, lane 2). Signal specifi- (Sigma-Aldrich) at 100 mM in Tris 50 mM, CaCl2 10 mM for the detection of city was confirmed using extracts of NS keratinocytes, which trypsin- and chymotrypsin-like activity, respectively. For some sections, LEKTI D8–D11 fragment (5 ␮M) was added to the substrate in order to assess do not express LEKTI (Bitoun et al., 2003; data not shown). its inhibitory capacity. All sections were rinsed with PBS solution and visu- Bands of 145 and 125 kDa were detected in the intracel- alized with the inverted high-end microscope Axiovert 200 (Zeiss, Thorn- lular fraction of NHK, with each of the three antibodies wood, NY) at an excitation wavelength of 485 and 400 nm and an emission (Figure 1, lane 2). These proteins correspond to the full- wavelength of 530 and 460 nm for BODIPY FL and AMC fluorescent dyes, respectively. Frozen sections from WT and KO skin were photographed at length (LEKTIf-l) and short-length (LEKTIsh) LEKTI precur- equal time points and exposure time. Images were captured and analyzed sors (Tartaglia-Polcini et al., 2006), respectively, and were not with Metamorph Imaging system software, version 3.6 (Universal Imaging, detected in human epidermal extracts.

3610 Molecular Biology of the Cell pH Controls Protease Inhibition by LEKTI

LEKTI fragments of 10, 11, 13, 15, and 20 kDa were de- with pEF-DEST51-LEKTIsh, as shown by Tartaglia et al. tected in human epidermis with ␣D1–D6 antibodies (Figure (2006).

1, lane 1). The same bands were detected only in the extra- As a result, heterologous expression of LEKTIf-l and LEKTIsh cellular fraction of NHK, which indicated that these LEKTI in CHO cells overall reproduces the proteolytic processing of N-terminal fragments are secreted (Figure 1, lane 2). Using LEKTI precursors seen in NHK and human epidermis. In ␣D8–D11 antibodies, 20-, 31-, 37-, 42-, and 65-kDa proteo- addition, it provides evidence that both precursors are submit- lytic fragments were detected in human epidermis and in ted to similar proteolytic processing, generating fragments of the conditioned medium of NHK (Figure 1, lanes 1 and 2). similar molecular weight. The only difference observed with In the epidermis and in the extracellular fraction of NHK, the C-terminal fragments is due to the lack of D14 and D15

␣D13–D15 antibodies detected two C-terminal fragments at domains in the shortest precursor LEKTIsh. ϳ65 and 42 kDa (Figure 1, lanes 1 and 2). Altogether, these results highlight a similar proteolytic processing of LEKTI in Furin Is a Key Enzyme for LEKTI Intracellular Proteolytic human epidermis in vivo and in NHK in vitro. They also Processing demonstrate the heterogeneity in molecular weights of Subtilisin-like proprotein convertases (SPCs) are a family of LEKTI proteolytic fragments. In the C-terminal part of endoproteinases involved in the processing of a variety of LEKTI, high-molecular-weight proteolytic fragments were proproteins. Among them, furin has been proposed as a produced (65 or 42 kDa) and were not cleaved in a larger good candidate for the proteolysis of LEKTI (Bitoun et al., extent, in contrast to N-terminal extremity, the proteolytic 2003). To demonstrate the involvement of furin in LEKTI processing of which produced several small LEKTI frag- processing, pEF-DEST51-LEKTIf-l and pEF-DEST51-LEKTIsh ments. vectors were used to transfect furin-deficient CHO cells. No LEKTI precursor could be detected in the epidermis Intracellular and extracellular fractions were analyzed by with any of the LEKTI antibodies used, suggesting that they Western blot using the three anti-LEKTI antibodies (Figure are rapidly processed into proteolytic fragments. The fact 2). In contrast to the various LEKTI proteolytic fragments that LEKTI precursors were detected only in the intracellular visualized in the extracellular fraction of transfected CHO fraction of NHK and that LEKTI proteolytic fragments were (Figure 2, lanes 1–3), no proteolytic fragment could be ob- observed exclusively in the extracellular fraction confirms served in the medium of transfected furin-deficient CHO that LEKTI processing takes place intracellularly (Bitoun et cells (Figure 2, lanes 4–6). Instead, the 145- and 125-kDa al., 2003) and suggests a rapid secretion of fragments upon LEKTI precursors were detected in the extracellular frac- cleavage of the precursors. These observations support the tions of furin-deficient CHO cells transfected with pEF- notion that secreted LEKTI fragments are the relevant LEKTI biologically active forms.

Heterologous Expression of LEKTI in CHO Cells Reproduces Physiological LEKTI Processing To discriminate LEKTI fragments deriving from the full-length LEKTI precursor from those deriving from the shorter LEKTI precursor, we developed an heterologous system for LEKTI expression. Transient transfection of CHO cells was performed with mammalian expression vectors carrying the full-length

(pEF-DEST51-LEKTIf-l) or short-length (pEF-DEST51-LEKTIsh) LEKTI cDNAs under the control of the Elongation Factor 1 promoter. Intracellular and extracellular fractions of trans- fected CHO cells were analyzed by Western blotting using the three anti-LEKTI antibodies (␣D1-D6, ␣D8–D11, and ␣D13– D15 antibodies; Figure 1, lanes 3–5). Bands of 145 and 125 kDa were detected in the intracellular fraction of CHO cells trans- fected with pEF-DEST51-LEKTIf-l and pEF-DEST51-LEKTIsh, respectively. These high-molecular-weight signals correspond to LEKTI precursors. They were not detected in the condi- tioned medium, indicating that proLEKTI is processed intra- cellularly, as observed in NHK. Using ␣D1–D6 antibodies, 10-, 13-, and 20-kDa fragments were detected in both the extracellular fraction of CHO transfected with pEF-DEST51-

LEKTIf-l and pEF-DEST51-LEKTIsh. These fragments are present in the NHK extracellular fraction (Figure 1, lane 2), and their size is consistent with LEKTI physiological clea- Figure 2. LEKTI processing involves a furin-dependant mechanism. vage. However, the 11- and 15-kDa fragments detected in Intracellular and extracellular extracts of CHO cells (lanes 1–3) and NHK were not visualized in CHO extracts. furin-deficient CHO cells (lanes 4–6) transiently transfected with the Using ␣D8–D11 antibodies, 20-, 31-, and 37-kDa bands empty pEF-DEST51 vector (Ϫ, lanes 1 and 4); pEF-DEST51-SPINK5f-l were detected in the medium of CHO transfected with pEF- (LEKTIf-l, lanes 2 and 5); or pEFDEST51-SPINK5sh (LEKTIsh, lanes 3 DEST51-LEKTI and pEF-DEST51-LEKTI (Figure 1, lanes and 6) were analyzed by Western-blotting using anti-LEKTI antibod- f-l sh ies indicated on the left. In both CHO cells and furin-deficient CHO 3–5). cells, the 145- and 125-kDa LEKTI precursors are detected with each In addition, ␣D8–D11 and ␣D13–D15 antibodies (Figure 1, of the three anti-LEKTI antibodies in the intracellular fraction. How- lanes 3–5) detected a 65-kDa fragment in the medium of ever, in the extracellular fraction, LEKTI proteolytic fragments are CHO transfected with pEF-DEST51-LEKTIf-l and a 42-kDa visualized in CHO cells, whereas only LEKTI precursors are detected fragment in the extracellular fraction of CHO transfected in furin-deficient CHO cells, with each of the antibody.

Vol. 18, September 2007 3611 C. Deraison et al.

DEST51-LEKTIf-l and pEF-DEST51-LEKTIsh, respectively, tracts and analyzed by Western blotting using the panel of with each of the three antibodies used. These results showed antibodies. For N-deglycosylation experiments, PNGase F was that furin-deficient CHO cells are unable to process LEKTI, incubated with NHK extracellular extracts (Figure 3B). O-de- and that unprocessed precursors are secreted even so. Ne- glycosylation of NHK extracellular protein extracts was per- vertheless, the furin-deficient CHO cells that we used were formed by adding neuraminidase and O-glycosidase to the generated by ethyl methane sulfonate mutagenesis, and it is sample (Figure 3C). indeed possible that mutations elsewhere than in the furin As predicted by the software, no molecular-weight dif- gene could have occurred. To eliminate the possibility that ference could be observed after any of these treatments such mutations were responsible for the lack of LEKTI pro- when ␣D1–D6 antibodies were used (data not shown). On cessing, pEF-DEST51-LEKTIf-l was transfected in furin-defi- the basis of their molecular weights, some of these un- cient CHO cells stably retransfected with a murine cDNA of glycosylated N-terminal fragments could correspond to sin- furin (Gu et al., 1995). Extracellular fractions were analyzed gle LEKTI domains D1, D5, or D6, previously identified by Western blot and revealed LEKTI processing rescue (Sup- (Magert et al., 1999; Figure 1, right panel). plementary Figure 1). All together, these results prove evi- In contrast, when ␣D8–D11 antibodies were used, a 2-kDa dence that furin plays a major role in LEKTI physiological shift of the 31- and 37-kDa bands was detected after N- processing. deglycosylation. This treatment had no effect on the 20-kDa band (Figure 3B). No shift was observed for any of these Identity of LEKTI Fragments Inferred from Biochemical three bands after O-deglycosylation (data not shown). The Analysis N-glycosylation result suggests that the 31-kDa fragment To gain further insights into the identity of the diverse LEKTI detected in epidermis and NHK correspond to LEKTI D8– fragments, we performed molecular weight analysis after degly- D11 fragment (predicted molecular weight of 30 kDa). This cosylation experiments. The glycosylation site prediction servers is consistent with the description of the ϳ30-kDa fragment NetNGly (http://www.cbs.dtu.dk/services/NetNGlyc/) and reported in NHK conditioned medium, the N-terminal of NetOGlyc (http://www.cbs.dtu.dk/services/NetOGlyc/) in- which corresponds to D8 (Ahmed et al., 2001). dicate the presence of two potential N-glycosylation sites on Finally, N-deglycosylation treatment resulted in a reduc- asparagine residues 505 and 763 located in D8 and D12 do- tion of ϳ4 kDa of the 65- and 42-kDa fragments detected mains, respectively, and five O-glycosylation sites on threonine with ␣D13–D15 antibodies, demonstrating that these C-ter- residues 1051, 1054, and 1055 and serine residues 1058, 1062, all minal fragments are N-glycosylated (Figure 3B). O-deglyco- located in the D15 domain (Figure 3A). N- and O-deglycosy- sylation reduced the molecular weight of the 65-kDa C- lation experiments were performed on NHK extracellular ex- terminal LEKTI fragment signal to 61 kDa, whereas the 42-kDa band was not affected (Figure 3C). This result is concordant with the O-glycosylation predicted sites on D15, which are absent from the shortest LEKTI isoform. Each of the N- and O-deglycosylation experiment showed a 4-kDa shift of the 65-kDa fragment, revealing that this fragment carries several glycosylated residues accounting for 8 kDa. The molecular weight of the unglycosylated frag- ment (57 kDa) is concordant with the one calculated for the primary sequence of the last seven C-terminal domains of LEKTI (D9–D15), which is 57.4 kDa. To summarize, degly- cosylation experiments lead us to propose that D1, D5, D6, D8–D11, and D9–D15 are physiological LEKTI domains derived from proteolytic processing of the full-length pre- cursor.

LEKTI Domains, Except D1, Inhibit Epidermal Kallikreins Based on the homology with other Kazal family members, LEKTI domains are predicted to inhibit serine proteases. In the Kazal family, the cognate protease is dictated by an amino acid occupying the P1 position.1 Among all LEKTI domains, only D1, D2, and D15 do not possess an arginine at Figure 3. N- and O-glycosylation status of LEKTI proteolytic frag- ments. (A) Schematic representation of predicted N- and O-glyco- this position. Kazal inhibitor bearing an arginine at P1 po- sition are known to inhibit trypsin. However, prediction is sylation sites on the full length (LEKTIf-l) and the short length (LEKTIsh) LEKTI precursors. N-glycosylation prediction involves not simple because interactions between the inhibitory loop two sites: one in the D8 domain, the other one in the D12 domain. of the inhibitor and the active site of the inhibited protease Five O-glycosylation sites are predicted in the D15 domain. (B) also depend on the microenvironment of the complex. More- Proteins from NHK conditioned medium were incubated in the over, the behavior of multidomain inhibitors toward their absence (Ϫ) or presence (ϩ) of PNGase F. After PNGase F treatment, targets is not easily predictable. the 31- and 37-kDa fragments recognized by the ␣D8–D11 antibody To study the anti-protease function of physiological migrate at 29 and 35-kDa, respectively, whereas the 20-kDa band LEKTI fragments, we expressed recombinant LEKTI do- remains unchanged. Using the ␣D13–D15 antibody, C-terminal fragments of 42 and 65 kDa migrate at 38 and 61 kDa, respectively, mains D1, D5, D6, D8–D11, and D9–D15. To provide evi- when N-deglycosylated. (C) To assess O-deglycosylation, extracel- dence for the formation of disulfide bridges in the LEKTI lular extracts of NHK were incubated at 37°C in the absence (Ϫ)or presence (ϩ) of neuraminidase (1 h) and O-glycosidase (3 h). This treatment had no effect on the 42-kDa bands, but reduced the 1 The amino acid residues involved in the reactive site loop are 65-kDa C-terminal fragment to a 61-kDa fragment. numbered following the Schechter and Berger (1967) nomenclature.

3612 Molecular Biology of the Cell pH Controls Protease Inhibition by LEKTI

Figure 4. Inhibition properties of LEKTI do- mains toward epidermal kallikreins. Proteinases were incubated with increased concentrations of inhibitors before addition of substrates (de- scribed in Table 1). The curves represent the percentage of resulting proteolytic activity ac- cording to the ratio [inhibitor]/[enzyme]. Inhi- bition constants Ki were calculated as described in Materials and Methods. As illustrated by the slope of the curves, the D8–D11 LEKTI frag- ment is the most potent inhibitor of KLK5, KLK7, and KLK14. In contrast, D6 has no inhib- itory property on KLK14, and neither has D9– D15 on KLK7. fragments produced in prokaryotic expression system, these Inhibition tests showed that the different LEKTI fragments fragments were submitted to SDS-PAGE under reducing or were not equally effective against target proteinases: D1 was nonreducing conditions (Supplementary Figure 2). After unable to inhibit any proteinase of the set, despite evidence Coomassie staining, a single band was observed at the ex- for the formation of disulfide bridges (Supplementary Fig- pected molecular weight with a slight difference between ure 2). In contrast, the other fragments inhibited trypsin, reducing and nonreducing conditions. This is consistent KLK5, KLK7, and KLK14 to various extents. The other pro- with the fact that the recombinant LEKTI fragments ex- teinases tested in the panel were not inhibited by LEKTI pressed in the Origami bacteria contained intramolecular fragments. The strongest inhibitory activity was observed disulfide bonds. with D8–D11 against KLK5 and KLK14 with Ki values of 3.7 The capacity of purified recombinant LEKTI fragments to and 3.1 nM, respectively (Figure 4). Despite a 68% sequence function in vitro as a serine protease inhibitor was then identity from the first to the fourth cysteine residues and an assessed against a large set of 13 serine proteinases involved identical cysteine connectivity pattern, D5 and D6 differen- in skin desquamation and inflammation: trypsin, tryptase, tially inhibited target proteinases. D6 appeared as a weaker chymotrypsin, plasmin, thrombin, neutrophile elastase, ca- inhibitor of trypsin, KLK5, and KLK7 than D5 and was not thepsin G, and kallikreins 1, 3, 5, 7, 8, and 14 (Table 1). effective against KLK14. Specificity and capacity of inhibi-

Table 2. Summarization of inhibition constants and affinity constants

Protease Substrate Constants D1 D5 D6 D8–D11 D9–D15

Ϫ9 Ϫ9 Ϫ9 Ϫ9 KLK5 HD-Ile-Pro-Arg-pNA Ki (M) — 32.8 ϫ 10 83.3 ϫ 10 3.7 ϫ 10 118.7 ϫ 10 Ϫ10 9 Ϫ12 Ϫ1 KD (M) — 9.3 ϫ 10 3.6 ϫ 10 1.1 ϫ 10 9.5 ϫ 10 Ϫ9 Ϫ9 Ϫ9 KLK7 MeO-Suc-Arg-Pro-Tyr-pNA Ki (M) — 77.2 ϫ 10 296.4 ϫ 10 34.8 ϫ 10 — Ϫ9 Ϫ8 Ϫ8 KD (M) — 6.2 ϫ 10 6.7 ϫ 10 3.2 ϫ 10 nd Ϫ9 Ϫ9 Ϫ9 KLK14 IlD-Pro-Phe-Arg-pNA Ki (M) — 17.6 ϫ 10 — 3.1 ϫ 10 52.3 ϫ 10 KD (M) —ndndndnd

For all LEKTI domains tested in this study, a summary of inhibition constants (Ki) and affinity constants (KD) calculated from inhibition tests and BiaCORE analysis, respectively, is reported in this table. This report concerns the inhibited epidermal proteinases KLK5, KLK7 and KLK14. nd, not determined; —, no inhibition/no interaction.

Vol. 18, September 2007 3613 C. Deraison et al.

Figure 5. Surface Plasmon Resonance analysis of target proteinase binding to LEKTI fragments. LEKTI domains were immobilized onto a sensorchip. Proteinase solutions were injected over the sensorchip at concentrations ranging from 1.25 to 100 nM. Sensorgrams reflect binding during the association phase followed by the dissociation phase at the end of the injection. Representative sensorgrams show dose-dependent interactions of KLK5, KLK7 and KLK14 on D5, D6, D8–D11, and D9-D15 LEKTI domains. Each curve represents the specific interaction between the considered LEKTI fragment and proteinase. Raw binding data were analyzed using the BIAevaluation 4.0.1 software and fitted to obtain kinetics parameters. The kinetics constants ka (association constant), kd (dissociation constant), and KD (affinity constant) are indicated on each graph. , stop of proteinase injection and replacement with buffer; RU, resonance units; Diff. Resp., differential response.

tion of D6 are concordant with previously published data Dynamics of Interaction between LEKTI Fragments and (Kreutzmann et al., 2004; Egelrud et al., 2005). Their Target Proteinases Despite the presence of an arginine at P1 position, which The interaction parameters between LEKTI fragments and is associated with trypsin inhibition, three active LEKTI their target proteinases were determined using the SPR fragments (D5, D6, and D8–D11) were also able to inhibit KLK7, belonging to the chymotrypsin superfamily. Al- (BIAcore) technology (see Materials and Methods). though full inhibition was achieved by adding D8–D11 at D1, D5, D6, D8–D11, and D9–D15 fragments were immo- twofold molar excess to KLK7, D9–D15 was inactive even at bilized onto a sensorchip, and their binding capacity toward 50-fold molar excess (data not shown). D8–D11 displayed a KLK5, KLK7, and KLK14 was tested in real time. The D1 LEKTI fragment, which was devoid of inhibitory capacity, 10-fold lower inhibition capacity for KLK7 (Ki ϭ 34.8 nM) was considered first. As expected, D1 was unable to bind compared with KLK5 (Ki ϭ 3.7 nM). D6 was a poor inhibitor of KLK7 (Ki ϭ 296 nM). Inhibition constants of each LEKTI any proteinase and was then considered to be a negative fragment toward these epidermal proteinases are reported control in each BIA experiment. in Table 2. The results obtained with pancreatic trypsin were Similarly to specific inhibition profiles of each LEKTI frag- of the same order of magnitude as the one obtained with ment, LEKTI fragments were not equally effective in their KLK5 (data not shown). interaction capacities toward the tested proteinases (Figure 5).

3614 Molecular Biology of the Cell pH Controls Protease Inhibition by LEKTI

As illustrated by sensorgrams, kinetics profiles and amounts of decreased during the association phase before the end of bound proteinase molecules were highly variable from one injection, indicating a proteolytic activity of KLK14 against LEKTI fragment to another for each proteinase. D9–D15. D9–D15 degradation was confirmed when KLK14 KLK5 exhibits different binding properties toward the was injected at 20 nM and showed a loss of ligand immobi- four LEKTI domains. With single domains D5 and D6, the lized during the dissociation phase, with a level of the SPR association phase as well as the dissociation phase occurs signal below the baseline. This phenomenon was less visible rapidly. This underlines a transient interaction between on the other sensorgrams but certainly occurred and pre- KLK5 and these single LEKTI domains. In contrast, the vented kinetic constant measurement. association phase between KLK5 and multidomain LEKTI fragments is slower, whereas the dissociation is less pro- nounced. Remarkably, after the injection of KLK5 is stopped, pH Dependent–binding of KLK5 and LEKTI Is a Key no dissociation from D8–D11 occurred. This reflects a high- Factor for the Regulation of the Desquamation Process Ϫ12 affinity (KD ϭ 1.11 ϫ 10 M) and irreversible binding of LEKTI and KLK5 are transported in different cargo vesicles this complex. In contrast to KLK5, KLK7 dissociates very before they are released into the extracellular space, at the rapidly from D8–D11, as illustrated on sensorgrams by the stratum granulosum–SC interface. Immunoelectron micros- decrease of bound molecules after the injection is stopped. copy experiments showed localization of the two molecules The interaction between single LEKTI domains D5 and D6 at this interface near corneodesmosomes in human skin with KLK7 is weaker than the one determined with KLK5, as (Ishida-Yamamoto et al., 2005). KLK5 is a major proteinase shown by their higher affinity constant (KD) for KLK7. This involved in the desquamation process, through the cleavage difference is not due to their dissociation constants (kd) toward of the corneodesmosomal components (Caubet et al., 2004). KLK5 and KLK7, which are similar, but instead, to their To allow the detachment of the superficial layers of SC, weaker association constant (ka) for KLK7 (KD ϭ kdϫ 1/ka). KLK5 activity must be tightly controlled, in a spatially and Sensorgrams of KLK14 interacting with different LEKTI temporally manner. Recent studies have suggested that the fragments showed very particular profiles, different from ultimate desquamation of corneocytes from the SC surface those previously described for KLK5 and KLK7. Specifically may be orchestrated by localized changes in pH (Elias, 2004; for KLK14/D9–D15 interaction, the SPR signal abnormally Hachem et al., 2004). In this context, we analyzed the influ-

Figure 6. Effects of pH on the interaction between D8–D11 LEKTI fragment and target kallikreins, KLK5 and KLK7. (A) D8–D11 LEKTI domains were immobilized onto a sen- sorchip, over which KLK5 was injected at 2.5 nM in HBS-EP buffer at pH 7.5. At the end of the injection, this buffer was replaced by HBS-EP adjusted at various pH conditions varying from pH 7.5 to pH 4.5. The curves show D8–D11/KLK5 dissociation in response to pH changes. kd values are indicated on the graph. (B and C) D8–D11 LEKTI domains were immobilized onto a sensorchip, over which 2.5 nM KLK5 (B) or 20 nM KLK7 (C) was injected in HBS-EP buffer at various pH values. Each curve represents the specific in- teraction between D8–D11 LEKTI fragment and the proteinase for each pH condition. The kinetic constants ka (association constant) and kd (dissociation constant) are indicated on the right of the sensorgrams. ␶, stop of proteinase injection and replacement with buffer; RU, resonance units; Norm. Diff. Resp., normal- ized differential response.

Vol. 18, September 2007 3615 C. Deraison et al. ence of pH on the stability of KLK5 and D8–D11 interaction using the BIAcore technology (Figure 6). Injection of KLK5 at 2.5 nM was performed at pH 7.5, a pH occurring at the GR-SC interface. At the end of the injection, a buffer adjusted at different pH was injected, and the dissociation phase was followed for various pH conditions (7.5–4.5), miming the pH gradient in the SC layers from the depth to the surface. The sensorgrams presented in Figure 6A clearly show that the interaction between the two partners is affected by pH variable conditions, with an acceleration of the dissociation phase concomitantly with pH decrease. On release, both partners are potentially able to reform a complex at lower pH values. Therefore, the interaction (association and disso- ciation) was evaluated for each pH value (Figure 6B). The calculated values showed that the association decreases, whereas dissociation increases with acidification (pH 7.4 to pH 4.5). The effect is much stronger on dissociation (10Ϫ8 to 10Ϫ4 sϪ1) than on association (104 to 103 MϪ1 sϪ1). Therefore, acidification decreases the strength of binding between LEKTI D8–D11 and KLK5, by favoring dissociation of the complex. To test whether the binding between LEKTI D8– D11 and KLK7 was also pH-sensitive, we performed a bin- ding experiment between these two partners at the same pH Figure 7. In situ zymography analysis. Protease activities were values (Figure 6C). Similarly, a decreased interaction was detected on skin cryosections from WT and Spink5Ϫ/Ϫ mice. The observed with acidification, with a high effect from pH 5.5. ability of D8–D11 LEKTI fragment to reduce these proteolytic ac- pH changes influence the affinity between D8–D11 LEKTI tivities was assessed on KO cryosections. (A) In WT epidermis, total protease activity detected by the degradation of the BODIPY FL fragment and its target proteinases. Therefore, we tested the casein substrate is mainly found in the SC. (B) In the epidermis of inhibition capacity of D8–D11 against KLK5 and KLK7 at Spink5Ϫ/Ϫ mice, the caseinolytic activity is increased in the SC. (C) different pH values (Supplementary Figure 3). KLK5 and KLK7 This activity is decreased in the presence of D8–D11 LEKTI frag- activities were markedly decreased with acidification, but were ment. (D and E) Trypsin-like activity detected by cleavage of the still detected (20% activity at pH 4.5 compared with pH 7.5). synthetic peptide Boc-Val-ProArg-AMC is increased in the SC of KO The highest inhibitory capacity for LEKTI D8–D11 was epidermis in comparison with normal epidermis. (F) Addition of obtained at pH 7.5 and declined at inferior pH values, to D8–D11 LEKTI fragment decreases trypsin-like activity on KO fro- become very weak at pH 4.5. This is concordant with the zen sections. (G and H) Incubation of frozen skin sections with the binding profile determined by BIA experiment and con- Suc-Leu-Leu-Val-Tyr-AMC peptide solution reveals that chymo- trypsin-like activity is also markedly enhanced in the stratum cor- firmed that the interaction and the inhibition capacity of neum of KO epidermis, compared with WT. (I) These activities are LEKTI D8–D11 are optimal at neutral pH, which corre- decreased in the presence of D8–D11 LEKTI fragment. The color sponds to the pH of the GR–SC interface. SC acidification gradient represents the intensity values of the fluorescence signals allows active proteinases to be released from their inhibitor ranging from dark to white. Bar, 50 ␮m. as a result of increased complex dissociation. LEKTI Fragments Inhibit Native Epidermal Proteinases of the Stratrum Corneum completely abolished KLK5 activity, whereas a residual ac- tivity of KLK7 persisted. A 28-kDa protease also overacti- To confirm the inhibitory capacity of D8–D11 toward dis- vated in KO epidermis was not affected by D8–D11. These regulated proteinase activities in NS, in situ zymography results confirmed the involvement of D8–D11 LEKTI do- was carried out on cryosections of Spink5Ϫ/Ϫ mouse skin. In main in the control of native KLK5 and KLK7 activities, situ zymography using fluorescein isothiocyanate (FITC)- conjugated casein as a substrate showed that proteinase activity was remarkably increased in the epidermis of Spink5Ϫ/Ϫ mice in comparison with WT epidermis (Figure 7B). This enzymatic activity mainly localized to the SC. Trypsin and chymotrypsin activities were then assessed with a synthetic substrate conjugated with AMC. Activities were markedly increased in the SC of KO mice compared with WT (Figure 7E,H). Addition of 5 ␮M D8–D11 LEKTI fragment on KO cryosection resulted in an important de- crease in signal intensity (Figure 7, C, F, and I). The sub- strates (for trypsin and chymotrypsin) used in this study are preferentially cleaved by KLK5 and KLK7 (Debela et al., 2006). However, we cannot exclude the possibility that other Figure 8. LEKTI D8–D11 inhibits native KLK5 and KLK7 activities proteinase activities may degrade these substrates on skin Ϫ/Ϫ cryosections. in Spink5 mouse epidermal extracts. Epidermal extracts from 2 WT and 2 Spink5Ϫ/Ϫ animals were analyzed by casein gel zymog- To confirm the effect of the LEKTI D8–D11 fragment onto raphy at pH 8 to detect proteolytic activity. Hyperactivity of KLK5, native KLK5 and KLK7, a casein gel zymography was per- KLK7, and an unknown 28-kDa proteinase is observed in KO ani- Ϫ/Ϫ formed (Figure 8). As already described in Spink5 epi- mals. Preincubation of the gel with D8–D11 LEKTI domain (5 ␮M) dermal extracts, KLK5 and KLK7 exhibited higher activities abolishes KLK5 activity and decreases KLK7 activity, and has little (Descargues et al., 2005). The addition of LEKTI D8–D11 effect on the 28-kDa proteinase.

3616 Molecular Biology of the Cell pH Controls Protease Inhibition by LEKTI showing a stronger inhibition of KLK5, concordant with the proteases included in the panel studied, KLK5, KLK14, and inhibition data. KLK7 were the only proteinases inhibited by LEKTI frag- ments. Interestingly, these three proteinases are specifically DISCUSSION detected in the GR of the skin and colocalize with LEKTI (Brattsand et al., 2005; Ishida-Yamamoto et al., 2005; Komatsu et al., LEKTI is a Kazal-type multidomain protein composed of 15 2005). Each LEKTI fragment presents a specific inhibitory pro- potential proteinase inhibitor domains (Magert et al., 1999). file toward these three epidermal proteinases. D1 is devoid of It is specifically expressed in the GR of the epidermis (Bitoun inhibitory capacity as anticipated by its particular 3D structure et al., 2003). Absence of LEKTI expression is responsible for (Lauber et al., 2003). Except for this domain, the other frag- the severe skin disease NS. The study of NS patients as well ments appear to have a higher inhibitory capacity toward as the analysis of a mouse model of NS provided evidence trypsin-like proteases (KLK5, KLK14) compared with chymo- that LEKTI plays a key role in the control of the desquama- trypsin-like proteases (KLK7). Surprisingly, whereas D6 inhib- tion process (Descargues et al., 2005, 2006). To gain further its KLK5, it is not active against KLK14, although KLK5 and insights into the role of LEKTI in skin homeostasis, we first KLK14 belong to the same family and share 65% similarity. focused on the characterization of LEKTI active forms and This discloses a very fine specificity of interaction between carried out functional analysis of LEKTI fragments. In Kazal domains and kallikreins. NHKs, we showed that LEKTI precursors are rapidly pro- Our results show that all LEKTI fragments studied, except cessed intracellularly into several proteolytic fragments, the D1, inhibit KLK5. D8–D11 demonstrated the highest inhibi- molecular weights of which are concordant with single do- tory capacity with a Ki as low as 3 nM. This result correlates mains or several domains linked together. We showed that with the rapid and irreversible interaction occurring be- furin plays a major role in the generation of these proteolytic tween the two partners. Although SPR technology did not LEKTI fragments, which is concordant with immunoloca- allow determining the kinetics parameters of the interaction lization of furin in the GR (Pearton et al., 2001). In addition, between KLK14 and LEKTI fragments, D5, D8–D11, and the presence of 11- and 15-kDa N-terminal LEKTI fragments D9–D15 LEKTI domains displayed a high inhibitory capa- in the epidermis and in NHK that are not detected in CHO city toward this proteinase. Taken together, these results cells suggests that (an)other unidentified endoprotease(s) identify KLK5 and KLK14 as the major targets of LEKTI specifically expressed in keratinocytes could account for fragments and KLK7 to a lesser extent. Using zymography their production. analyses, we confirmed the inhibitory capacity of D8–D11 Once processed, all LEKTI proteolytic fragments are se- toward the native form of these epidermal proteinases. creted in the conditioned medium of NHK. In human fore- Despite a high sequence homology (68%) between D5 and skin epidermis, LEKTI precursors are not detectable, in con- D6, D5 inhibits KLK14, whereas D6 does not. Structural trast to the numerous proteolytic fragments. These results studies of Kazal domain complexes reveal that there are 12 indicate that LEKTI fragments, rather than LEKTI precur- contact positions (P6, P5, P4, P3, P2, P1, P1Ј,P2Ј,P3Ј, P14Ј, sors, are the biologically relevant LEKTI forms, which are P15Ј, and P18Ј) responsible for interactions between Kazal secreted at the GR-SC interface, as shown by immunoelec- domains and their cognate serine proteinases (Lu et al., tron microscopy (Ishida-Yamamoto et al., 2005). Our study 1997). Among these 12 contact positions, P4 and P6 are the provides evidence for N- and O-glycosylation of LEKTI only positions where the nature of residues differs between fragments. Protein glycans can play several roles (Lee et al., D5 and D6. At P6 position, a lysine is present in D5, whereas 2001), including promoting protein folding into proper an arginine is found in D6. These two amino acids are structure or protecting against proteolytic enzymes. The structurally close and are not likely to explain the functional glycans present on LEKTI could then prevent the molecule difference between the two domains. In contrast, the P4 from furin proteolytic action at sensitive sites in domain- position is occupied by a phenylalanine in D5 and by an linking regions. This could explain why LEKTI precursors alanine in D6. Interestingly, Empie and Laskowski (1982) are not processed into 15 domains as proposed (Komatsu found that substitution of a voluminous amino acid (Asp) in et al., 2002), but rather into several multidomain and single a small, and uncharged residue (Ala) at position P4 of Kazal domain fragments. ovomucoid third domain had a dramatic consequence on its Combination of Western blot analyses, molecular weight inhibitory capacity toward trypsin-like enzyme subtilisin. data, and glycosylation status lead us to propose the identity Therefore, the difference of only 1 amino acid at P4 position of some physiological LEKTI fragments. D1, D5, and D6 between D5 and D6 LEKTI domains could account for their have been isolated from human blood; however, no cellular selectivity toward different serine proteinases. blood compartment has been shown to express LEKTI so far This study highlights the specialization of LEKTI in the (Tartaglia-Polcini et al., 2006). Therefore, D1, D5, and D6 inhibition of epidermal proteinases KLK5, KLK7, and KLK14 circulating LEKTI fragments could originate from LEKTI- and is consistent with an increased desquamation in NS pa- expressing tissues such as the epidermis and correspond to tients. NS skin is also characterized by chronic inflammation, the smallest signals detected with ␣D1–D6 in the epidermis but the observation that inflammatory proteinases are not the and NHK extracts. In addition to these single LEKTI do- direct targets of the studied LEKTI fragments suggests that mains, using internal and C-terminal antibodies, other LE- KLK5 and KLK7 may have a proinflammatory role by activa- KTI signals detected in the epidermis and in NHK were ting PLA2 and IL1␤, as proposed by Egelrud et al. (2005). concordant with being new physiological LEKTI fragments Alternatively, it is also possible that additional physiological corresponding to D8–D11 (31 kDa) and D9–D15 (65 kDa). LEKTI fragments could have a direct activity against inflam- The physiological inhibition of proteinases depends on matory proteinases. several parameters, including temporal and spatial coloca- The Spink5Ϫ/Ϫ mice revealed that LEKTI is a key regulator lization of the protease and its inhibitor and binding kinetics of the desquamation process through the control of KLK5 between the partners involved. The goal of our study was to and KLK7 activities. In normal epidermis, LEKTI, KLK5, and analyze the inhibitory capacity of the proposed physiologi- KLK7 colocalize in the neighborhood of corneodesmosomes cal LEKTI fragments and to determine the associated kine- (Ishida-Yamamoto et al., 2005). This suggests a finely regu- tics parameters. In addition to pancreatic trypsin, among all lated interaction between these partners to allow the detach-

Vol. 18, September 2007 3617 C. Deraison et al.

ACKNOWLEDGMENTS

We are indebted to Dr. G. Zambruno (Laboratory of Molecular and Cell Biology, Instituto Dermopatico dell’Immacolata, IDI-IRCCS, Rome, Italy) for providing the anti-D13-D15 LEKTI antibody. We are grateful to Dr. S. Leppla for providing us with furin-deficient CHO cells and furin-transfected furin- deficient CHO cells. We thank Florence Capilla from the experimental histo- pathology platform of IFR30 (Ge´nopole Toulouse Midi-Pyre´ne´es) for techni- cal assistance, as well as Sophie Allart from the cellular imaging platform of IFR30, Toulouse. We are grateful to Heather Etchevers and Jose-Enrique Mejia for critical review of the manuscript. This work was supported by grants from the national agency for research (ANR maladies rares), the French Ministry of Research and Technology, the French Foundation for Medical Research (FRM), the European Center of Skin and Epithelia Research (CERPER, Tou- louse), and the European Geneskin coordination action project.

REFERENCES

Ahmed, A., Kandola, P., Ziada, G., and Parenteau, N. (2001). Purification and partial amino acid sequence of proteins from human epidermal keratinocyte conditioned medium. J. Protein Chem. 20, 273–278.

Figure 9. Model of desquamation: pH controls KLK activities by Bitoun, E. et al. (2003). LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syn- regulating their interaction with LEKTI. In the deep SC, neutral pH drome. Hum. Mol. Genet. 12, 2417–2430. allows a strong interaction between LEKTI and its KLK targets in the corneocyte interstices, thus preventing corneodesmosomes Brattsand, M., Stefansson, K., Lundh, C., Haasum, Y., and Egelrud, T. (2005). cleavage. As the pH acidifies along the SC, LEKTI, and KLK5 A proteolytic cascade of kallikreins in the stratum corneum. J. Invest. Der- dissociate, allowing proteinase to progressively degrade its cor- matol. 124, 198–203. neodesmosomal targets. In the most superficial layers of SC, pH is Caubet, C., Jonca, N., Brattsand, M., Guerrin, M., Bernard, D., Schmidt, R., low enough to ensure a strong dissociation between LEKTI and its Egelrud, T., Simon, M., and Serre, G. (2004). Degradation of corneodesmo- KLK targets. The release of KLK inhibition, together with other some proteins by two serine proteases of the kallikrein family, SCTE/KLK5/ proteinase activities, lead to complete degradation of corneodesmo- hK5 and SCCE/KLK7/hK7. J. Invest. Dermatol. 122, 1235–1244. somal components, resulting in the detachment of the most super- Chavanas, S. et al. (2000). Mutations in SPINK5, encoding a serine protease ficial corneocytes. inhibitor, cause netherton syndrome. Nat. Genet. 25, 141–142. Debela, M., Magdolen, V., Schechter, N., Valachova, M., Lottspeich, F., Craik, C. S., Choe, Y., Bode, W., and Goettig, P. (2006). Specificity profiling of seven ment of the SC superficial layers only. Previous studies have human tissue kallikreins reveals individual subsite preferences. J. Biol. Chem. demonstrated that pH is important for maintaining skin 281, 25678–25688. homeostasis and that transient increase in SC pH induces Descargues, P. et al. (2005). Spink5-deficient mice mimic Netherton syndrome abnormality in permeability barrier (Hachem et al., 2006). through degradation of desmoglein 1 by epidermal protease hyperactivity. Nat. Genet. 37, 56–65. We mimicked the pH gradient occurring in SC layers during binding studies between KLK5 and D8–D11. At pH 7.5, the Descargues, P., Deraison, C., Prost, C., Fraitag, S., Mazereeuw-Hautier, J., D’Alessio, M., Ishida-Yamamoto, A., Bodemer, C., Zambruno, G., and Hovna- complex is very stable, but BIAcore analysis demonstrated nian, A. (2006). Corneodesmosomal cadherins are preferential targets of stratum that dissociation increases with acidification. The same effect corneum trypsin- and chymotrypsin-like hyperactivity in Netherton syndrome. of acidification could be observed on the dissociation rate of J. Invest. Dermatol. 126, 1622–1632. LEKTI–KLK7 complexes. This result is consistent with the Egelrud, T., Brattsand, M., Kreutzmann, P., Walden, M., Vitzithum, K., Marx, possibility that during the passage of deep (pH 7.5) to su- U. C., Forssmann, W. G., and Magert, H. J. (2005). hK5 and hK7, two serine perficial SC (pH 4.5) (Elias, 2004), KLK5 and KLK7 gradually proteinases abundant in human skin, are inhibited by LEKTI domain 6. Br. J. dissociate from LEKTI. At acidic pH, KLK5 and KLK7 retain Dermatol. 153, 1200–1203. sufficient activity to degrade corneodesmosomal compo- Elias, P. M. (2004). The epidermal permeability barrier: from the early days at nents, desmoglein-1, desmocollin-,1 and corneodesmosin Harvard to emerging concepts. J. Invest. Dermatol. 122, xxxvi–xxxix. (Caubet et al., 2004). These results support the role of SC Empie, M. W., and Laskowski, M., Jr. (1982). Thermodynamics and kinetics of single residue replacements in avian ovomucoid third domains: effect on acidification in the control of the detachment of the most su- inhibitor interactions with serine proteinases. Biochemistry 21, 2274–2284. perficial corneocytes (Figure 9). The severity of the NS skin phenotype demonstrates the crucial need for a tight control of Gordon, V. M., Klimpel, K. R., Arora, N., Henderson, M. A., and Leppla, S. H. (1995). Proteolytic activation of bacterial toxins by eukaryotic cells is per- epidermal proteolytic activity. KLK5 and KLK7, as serine pro- formed by furin and by additional cellular proteases. Infect. Immun. 63, teinases, display optimal activities at neutral pH, which is 82–87. precisely the pH at the GR–SC interface. To prevent premature Gu, M., Rappaport, J., and Leppla, S. H. (1995). Furin is important but not desquamation at the GR–SC interface, KLK5 and KLK7 acti- essential for the proteolytic maturation of gp160 of HIV-1. FEBS Lett. 365, vities must be strongly inhibited. This is consistent with the 95–97. observation that the interaction between LEKTI and epidermal Hachem, J., M.-Q.M., Crumrine, D., Uchida, Y., Roseeuw, D., Brown, B. E., kallikreins is very strong at neutral pH. This highlights the Feigold, K. R., and Elias, P. M. (2004). Sustained increases in stratum corneum importance of skin pH balance in the control of desquamation, pH cause profound alterations in barrier functions and SC integrity. J. Invest. Dermatol. 122, a167. acting at two levels: the control of protease activity, and the control of the interaction between proteinases and their inhi- Hachem, J. et al. (2006). Serine protease signaling of epidermal permeability bitors. All together, the resultant ensures an apparent proteo- barrier homeostasis. J. Invest. Dermatol. 126, 2074–2086. lytic activity in a restricted environment. Hewett, D. R., Simons, A. L., Mangan, N. E., Jolin, H. E., Green, S. M., Fallon, P. G., and McKenzie, A. N. (2005). Lethal, neonatal ichthyosis with increased This study is a base for an exhaustive analysis of inhibi- proteolytic processing of filaggrin in a mouse model of Netherton syndrome. tory properties of all physiological LEKTI fragments. This Hum. Mol. Genet. 14, 335–346. will help to decipher the finely regulated balance between Ishida-Yamamoto, A. et al. (2005). LEKTI is localized in lamellar granules, proteinases and their inhibitors in the context of the desqua- separated from KLK5 and KLK7, and is secreted in the extracellular spaces of mation process. the superficial stratum granulosum. J. Invest. Dermatol. 124, 360–366.

3618 Molecular Biology of the Cell pH Controls Protease Inhibition by LEKTI

Jayakumar, A. et al. (2005). Consequences of C-terminal domains and N- Magert, H. J., Standker, L., Kreutzmann, P., Zucht, H. D., Reinecke, M., terminal signal peptide deletions on LEKTI secretion, stability, and subcellu- Sommerhoff, C. P., Fritz, H., and Forssmann, W. G. (1999). LEKTI, a novel lar distribution. Arch. Biochem. Biophys. 435, 89–102. 15-domain type of human serine proteinase inhibitor. J. Biol. Chem. 274, Jayakumar, A., Kang, Y., Mitsudo, K., Henderson, Y., Frederick, M. J., Wang, 21499–21502. M., El-Naggar, A. K., Marx, U. C., Briggs, K., and Clayman, G. L. (2004). Mitsudo, K., Jayakumar, A., Henderson, Y., Frederick, M. J., Kang, Y., Wang, Expression of LEKTI domains 6–9Ј in the baculovirus expression system: M., El-Naggar, A. K., and Clayman, G. L. (2003). Inhibition of serine protein- recombinant LEKTI domains 6–9Ј inhibit trypsin and subtilisin A. Protein ases plasmin, trypsin, subtilisin A, cathepsin G, and elastase by LEKTI: a Expr. Purif. 35, 93–101. kinetic analysis. Biochemistry 42, 3874–3881. Komatsu, N., Saijoh, K., Toyama, T., Ohka, R., Otsuki, N., Hussack, G., Takehara, K., and Diamandis, E. P. (2005). Multiple tissue kallikrein mRNA Morris, M. T., Coppin, A., Tomavo, S., and Carruthers, V. B. (2002). Functional and protein expression in normal skin and skin diseases. Br. J. Dermatol. 153, analysis of Toxoplasma gondii protease inhibitor 1. J. Biol. Chem. 277, 45259– 274–281. 45266. Komatsu, N., Takata, M., Otsuki, N., Ohka, R., Amano, O., Takehara, K., and Pearton, D. J., Nirunsuksiri, W., Rehemtulla, A., Lewis, S. P., Presland, R. B., Saijoh, K. (2002). Elevated stratum corneum hydrolytic activity in Netherton and Dale, B. A. (2001). Proprotein convertase expression and localization in syndrome suggests an inhibitory regulation of desquamation by SPINK5- epidermis: evidence for multiple roles and substrates. Exp. Dermatol. 10, derived peptides. J. Invest. Dermatol. 118, 436–443. 193–203. Kreutzmann, P., Schulz, A., Standker, L., Forssmann, W. G., and Magert, H. J. Schechter, I., and Berger, A. (1967). On the size of the active site in proteases. (2004). Recombinant production, purification and biochemical characteriza- I. Papain. Biochem. Biophys. Res. Commun. 27, 157–162. tion of domain 6 of LEKTI: a temporary Kazal-type-related serine proteinase inhibitor. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 803, 75–81. Schechter, N. M., Choi, E. J., Wang, Z. M., Hanakawa, Y., Stanley, J. R., Kang, Lauber, T., Schulz, A., Schweimer, K., Adermann, K., and Marx, U. C. (2003). Y., Clayman, G. L., and Jayakumar, A. (2005). Inhibition of human kallikreins Homologous proteins with different folds: the three-dimensional structures of 5 and 7 by the serine protease inhibitor lympho-epithelial Kazal-type inhibitor domains 1 and 6 of the multiple Kazal-type inhibitor LEKTI. J. Mol. Biol. 328, (LEKTI). Biol. Chem. 386, 1173–1184. 205–219. Tartaglia-Polcini, A., Bonnart, C., Micheloni, A., Cianfarani, F., Andre, A., Lee, Y. R., Yamazaki, M., Mitsui, S., Tsuboi, R., and Ogawa, H. (2001). Zambruno, G., Hovnanian, A., and D’Alessio, M. (2006). SPINK5, the defec- Hepatocyte growth factor (HGF) activator expressed in hair follicles is in- tive gene in netherton syndrome, encodes multiple LEKTI isoforms derived volved in in vitro HGF-dependent hair follicle elongation. J. Dermatol. Sci. 25, from alternative pre-mRNA processing. J. Invest. Dermatol. 126, 315–324. 156–163. Lu, W. et al. (1997). Binding of amino acid side-chains to S1 cavities of serine Traupe, H. (1989). The ichthyosis. A Guide to Clinical Diagnosis, Genetic proteinases. J. Mol. Biol. 266, 441–461. Counselling, and Therapy, Berlin: Springer-Verlag. Magert, H. J., Kreutzmann, P., Standker, L., Walden, M., Drogemuller, K., and Yang, T., Liang, D., Koch, P. J., Hohl, D., Kheradmand, F., and Overbeek, P. A. Forssmann, W. G. (2002). LEKTI: a multidomain serine proteinase inhibitor (2004). Epidermal detachment, desmosomal dissociation, and destabilization with pathophysiological relevance. Int. J. Biochem. Cell Biol. 34, 573–576. of corneodesmosin in Spink5Ϫ/Ϫ mice. Genes Dev. 18, 2354–2358.

Vol. 18, September 2007 3619 Supplemental figure 1

Supplemental figure 2

Supplemental figure 3 Supplemental Figure 1 - Rescue of LEKTI processing in furin-complemented furin- deficient CHO cells pEFDEST51-SPINK5fl was used to transfect furin-deficient CHO cells stably re-transfected with a murine cDNA of furin. Extracellular extracts was analysed in Western blot using !D1- D6 and !D8-D11 LEKTI antibodies. The same LEKTI fragments are detected in the extracellular fraction of furin-complemented furin-deficient CHO cells as in wild type CHO cells. Moreover, using !D1-D6 antibody, in addition to the expected 10-, 13- and 20 kDa, a band at 15 kDa is also detected. A band at the same molecular weight can be detected in NHK extracellular fraction as well as human epidermis, suggesting that LEKTI processing is almost complete inside these cells, possibly due to higher amount of furin in complemented furin-deficient CHO cells.

Supplemental Figure 2 - Presence of disulfide bridges in Origami-produced LEKTI fragments Disulfide status of rLEKTI fragments (D1, D5, D6, D8-D11) expressed in bacterial cells were examined using SDS-PAGE under reducing condition and non reducing condition. Samples in lanes 1, 3, 5, 7 were prepared under nonreducing condition; samples in lanes 2, 4, 6, and 8 were prepared under reducing conditions (5% "-mercaptoethanol, 95°C heat for 10 minutes). Proteins were visualized by Coomassie brilliant blue R-250 staining. Positions of molecular mass markers are noted to the left of the gels. After Coomassie blue staining, a single band was observed at the expected molecular weight with a slight difference between reducing and non reducing conditions. This is consistent with the fact that the recombinant LEKTI fragments expressed in the Origami bacteria contained intramolecular disulfide bonds. In addition, no higher molecular band representing rLEKTI intermolecular complexes was visible in the non reducing SDS-PAGE.

Supplemental Figure 3 - Effect of pH on KLK5 and KLK7 activity and LEKTI inhibition KLK5 or KLK7 were incubated in absence or presence of D8-D11 LEKTI for 5 min at pH 7.5, 6.5, 5.5 or 4.5. The proteinase activity was initiated by adding the appropriate synthetic substrate, and the activity of free proteinase was determined spectrophotometrically at 405 nm by monitoring the release of p-nitrophenol. All time courses were performed at 25ºC, during 15 min, in duplicate. Reaction velocities were linear over the course of the reaction. The activities were represented as a pourcentage of the maximal activity (pH7.5 without inhibitor). The proteinase activities decrease following the acidification of buffer but remain detectable at pH 4.5. Inhibition by LEKTI D8-D11 is efficient until pH7.5 for KLK5 and pH 6.5 for KLK7 and is strongly diminished under.

Chapitre B : Identification des protéases-cibles de LEKTI

Article 3

Spink5-deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease hyperactivity.

Afin de mieux comprendre le rôle physiologique de LEKTI dans l’homéostasie de l’épiderme, nous avons développé des souris Spink5–/– en invalidant le gène par recombinaison homologue. Quelques heures après la naissance, ces souris meurent rapidement de déshydratation en raison d’un défaut sévère de barrière cutanée. Dès la naissance, les souris Spink5–/– présentent des érosions cutanées superficielles résultant d’une perte d’adhérence de la couche cornée à la couche granuleuse sous-jacente.

L’absence de LEKTI chez les souris Spink5–/– conduit à l'augmentation de l’activité protéolytique des protéases épidermiques KLK5 (SCTE), KLK7 (SCCE) et d’une protéase de

28 kDa. Nous montrons que l’hyperactivité de ces enzymes dégrade des composants des desmosomes et entraîne ainsi le détachement de la couche cornée. De plus, les souris

Spink5–/– présentent des anomalies majeures de la différenciation terminale de l’épiderme, comme en témoigne l’augmentation de la maturation protéolytique de la profilaggrine en filaggrine. Ces souris Spink5-/- reproduisent fidèlement les caractéristiques majeures du SN, incluant une desquamation sévère, une différentiation anormale, une dysplasie pilaire et un défaut sévère de la fonction barrière cutanée. Notre travail révèle le rôle clé de LEKTI dans le contrôle de plusieurs protéases de l’épiderme, et met en évidence les événements moléculaires pathologiques à l’origine de l’érythrodermie exfoliative sévère présente chez les patients SN. Nos résultats sont la base du développement d’une stratégie thérapeutique de substitution visant à inhiber l’activité des protéases dérégulées KLK5 et KLK7, afin de proposer un traitement spécifique du SN.

109 110 ARTICLES

Spink5-deficient mice mimic Netherton syndrome enetics through degradation of desmoglein 1 by epidermal protease hyperactivity .com/natureg Pascal Descargues1,Ce´line Deraison1, Chrystelle Bonnart1, Maaike Kreft2, Mari Kishibe3, Akemi Ishida-Yamamoto3, Peter Elias4, Yann Barrandon5, Giovanna Zambruno6, .nature Arnoud Sonnenberg2 & Alain Hovnanian1,7

Mutations in SPINK5, encoding the serine protease inhibitor LEKTI, cause Netherton syndrome, a severe autosomal recessive http://www / genodermatosis. Spink5À À mice faithfully replicate key features of Netherton syndrome, including altered desquamation, impaired keratinization, hair malformation and a skin barrier defect. LEKTI deficiency causes abnormal desmosome cleavage in oup the upper granular layer through degradation of desmoglein 1 due to stratum corneum tryptic enzyme and stratum corneum Gr chymotryptic enzyme–like hyperactivity. This leads to defective stratum corneum adhesion and resultant loss of skin barrier function. Profilaggrin processing is increased and implicates LEKTI in the cornification process. This work identifies LEKTI as a key regulator of epidermal protease activity and degradation of desmoglein 1 as the primary pathogenic event in Netherton syndrome. lishing Pub Netherton syndrome (OMIM 256500) is a severe autosomal recessive detached from the underlying epidermis or entirely missing4,11, and the skin disorder characterized by congenital ichthyosiform erythroderma, granular layer is frequently absent4,11. Lamellar bodies, normally res-

Nature a specific hair shaft defect (trichorrhexis invaginata) and atopic ponsible for the accumulation and discharge of epidermal barrier lipids manifestations1–3. Infants with Netherton syndrome typically present at the granular layer–stratum corneum interface, are fewer in number 10 2005 with a generalized exfoliative erythroderma, which persists throughout and often poorly structured . Their contents are prematurely secreted

© life in the most severe cases or gradually evolves into a milder into intercellular spaces and their transformation into lamellar lipid condition known as ichthyosis linearis circumflexa1,4. Affected indi- bilayers is disturbed10. A moderate to severe perivascular inflammatory viduals have a broad range of allergic manifestations, such as atopic infiltrate has also been documented in the papillary dermis4,10,12. dermatitis and elevated serum IgE level, associated with chronic and We previously identified SPINK5 (serine protease inhibitor Kazal- severe skin inflammation5–7. Bacterial infection, hypernatremic dehy- type 5) as the gene defective in Netherton syndrome13. All causative dration, hypothermia and extreme weight loss are frequent complica- mutations reported so far create premature termination codons13–15. tions, probably caused by the severe alteration of skin barrier function, SPINK5 encodes the predicted serine protease inhibitor LEKTI resulting in a high postnatal mortality4. (lympho-epithelial Kazal-type related inhibitor)16, which is expressed In the normal epidermis, barrier function is conferred by the in the most differentiated viable layers of stratified epithelial tissue17.In stratum corneum, which consists of dead, keratin-filled corneocytes the epidermis, it is mainly restricted to the granular layer, where crucial embedded in a lipid matrix8. During the desquamation process, the biochemical and morphological changes that occur during terminal most superficial corneocytes are shed from the skin surface as a result differentiation lead to cornification (stratum corneum formation)17. of proteolytic degradation of specialized junctional structures (cor- The absence of LEKTI expression in the epidermis is a common neodesmosomes) by epidermal proteases9. feature of Netherton syndrome17. LEKTI consists of 15 potential Histological examination shows that individuals with Netherton Kazal-type serine proteinase inhibitory domains (D1–D15; ref. 16). syndrome have epidermal hyperplasia (acanthosis) with persistence of The full-length recombinant protein inhibits trypsin, plasmin, sub- nuclei in the corneocytes of the stratum corneum (parakeratosis)4,10. tilisin A, cathepsin G and elastase18. Domains D5 and D6 inhibit The stratum corneum in these individuals is usually thin, often trypsin only, and a partial recombinant form of LEKTI containing

1INSERM U563, Paul Sabatier University, Place du Dr Baylac, 31059 Toulouse, cedex 3, France. 2The Netherlands Cancer Institute, Plesmanlaan 121, 1066 CX Amsterdam, The Netherlands. 3Department of Dermatology, Asahikawa Medical College, Asahikawa 078-8510, Japan. 4Department of Dermatology, Veterans Affairs Medical Center, University of California, San Francisco, California 94121, USA. 5Laboratory of Stem Cell Dynamics, School of Life Sciences, Swiss Federal Institute of Technology, AAB building, 1015 Lausanne, Switzerland. 6Laboratory of Molecular and Cell Biology, Istituto Dermopatico dell’Immacolata, IRCCS Via Monti di Creta 104 00167 Roma, Italy. 7Department of Medical Genetics, Purpan Hospital, 31059 Toulouse, cedex 3, France. Correspondence should be addressed to A.H. ([email protected]). Published online 26 December 2004; doi:10.1038/ng1493

56 VOLUME 37 [ NUMBER 1 [ JANUARY 2005 NATURE GENETICS ARTICLES

Figure 1 Gene targeting of Spink5.(a) Strategy a 567 for targeting Spink5.(b) Southern-blot analysis Vector pTK Neo pA of SacI-digested genomic DNA hybridized with CC B H H the probe (P1) show the presence of a 5.5-kb 1 2 fragment in wild-type mice and a 1.8-kb fragment ATG / 1 2 345 67 in Spink5À À mice. Het, Spink5 heterozygous Wild-type mice; M, DNA ladder; pA, polyadenylation signal; pTK; thymidine kinase promoter. (c) PCR analysis S P1 S 5.5 kb using allele-specific primers of genomic DNA

1 3 of the indicated genotypes. Primer sets 1-2 and 5 6 7 8 9 10 1-3 correspond to wild-type allele and knockout Recombinant pA pTK Neo allele, respectively. (d) RT-PCR of skin RNA. S P1 S Spink5 primers were from exons 1 and 4, 1.8 kb enetics amplifying a 260-bp product in the wild-type bc allele. (e,f) Immunohistochemical analysis using –/– –/– e antibody to LEKTI of paraffin-embedded sections / of skin from wild-type (WT) and Spink5À À (KO) bp M WT Het Spink5 kb WT Het Spink5 newborn mice showing expression of LEKTI 8 500 in the granular layer of the epidermis in wild-type .com/natureg 6 mice and absence of LEKTI in knockout mice. 200 5 WT Scale bars: 40 mm. 4 .nature –/– 3 d f WT Het Spink5 2 http://www

Spink5 1

oup Actb KO Gr

lishing / domains D6–D9 inhibits trypsin and subtilisin A but not plasmin, Spink5À À mice have skin and vibrissae abnormalities 19 / cathepsin G or elastase . These results support the idea that LEKTI is Spink5À À newborns had very fragile skin with severe erosions leaving Pub involved in multiple biological pathways relevant to tissue home- large oozing areas of denuded erythrodermic skin (Fig. 2a,b). These ostasis, inflammation and antimicrobial defense. lesions were predominant at sites of trauma and friction, with /

Nature The biological function of LEKTI remains a matter of speculation. shedding of skin in sheets and ribbons. Spink5À À mice died within Individuals with Netherton syndrome have elevated levels of trypsin- afewhoursofbirth. like activity in the stratum corneum associated with overdesquama- Histological analysis of the mutant epidermis showed intercellular 2005 20

© tion of corneocytes . These findings, together with the data discussed separation at the granular layer–stratum corneum interface, leaving an above, suggest that LEKTI has a key role in the regulation of unprotected epidermis with loss of stratum corneum over large areas proteolytic events involved in barrier formation and maintenance. of the skin surface (Fig. 2d; compare with wild-type in Fig. 2c). Some Aberrant expression of transglutaminases 1 and 3 in the epidermis in corneocytes remained cohesive to the underlying granular layer, Netherton syndrome might also be involved in the impaired epider- indicating that the separation could also occur above the first mal barrier21. To investigate the biological function(s) of LEKTI, we corneocyte layer. Vibrissae were fully developed at birth in wild-type / genetically engineered mice with a targeted disruption of Spink5. pups but were scarce in all Spink5À À pups, indicating that Spink5 has / Spink5À À mice mimic key features of Netherton syndrome, resulting a role in hair morphogenesis (Fig. 2e,f). Examination of the facial area from desmosome cleavage at the granular layer–stratum corneum of mutant mice by scanning electron microscopy (SEM) showed that transition, through degradation of desmoglein 1 (Dsg1) due to the few erupted hair shafts were badly oriented and abnormally curved hyperactivity of stratum corneum tryptic enzyme (SCTE). This (Fig. 2h; compare with wild-type in Fig. 2g). Histological analysis of / work provides new insights into the molecular mechanisms of stratum longitudinal sections of whisker follicles from Spink5À À mice showed corneum desquamation, a key process in epidermal biology. loss of cell adhesion in the inner root sheath (IRS) and between the IRS and hair shaft, with remnants of IRS cells associated with the hair RESULTS shaft (Fig. 2j; compare with wild-type in Fig. 2i). We observed Generation of mice with a targeted disruption of Spink5 premature keratinization of the IRS and the hair shaft in the lower To inactivate Spink5, we constructed a targeting vector to delete the portion of the follicle (Fig. 2j,l). Histological analysis of cross-sections 5¢ end of the gene by homologous recombination, replacing the of whisker follicles from knockout mice confirmed the loss of translation initiation codon (ATG) and the first four coding exons intercellular contacts in the IRS and showed that hair shafts of mutant with a neomycin-resistance cassette (Fig. 1a). We intercrossed whisker follicles were shrunken and irregular in shape (Fig. 2l; heterozygous mice, which were phenotypically indistinguishable compare with wild-type in Fig. 2k). / from wild-type littermates, to generate Spink5À À mice. Southern / blotting and PCR analysis confirmed correct targeting of Spink5 Ichthyosiform phenotype of grafted skin from Spink5À À mice / (Fig. 1b,c). RT-PCR and immunohistochemical analysis of skin of Because Spink5À À newborns underwent rapid postnatal lethality mutant mice showed that expression of Spink5 mRNA and protein and because we wanted to follow the phenotypic changes in the was abolished (Fig. 1d–f). skin of mutant mice after a prolonged exposure to the environment,

NATURE GENETICS VOLUME 37 [ NUMBER 1 [ JANUARY 2005 57 ARTICLES

a b e fgh

WT KO KO WT KO WT KO c d ijkl

enetics SC GR SP BL De Hf Hf De WT KO WT KO WT KO

.com/natureg / / Figure 2 Anomalies in Spink5À À mice epidermis and vibrissae. (a,b) Spink5À À pups had large skin erosions. (c,d) Hematoxylin and eosin staining of skin from wild-type and knockout mice showing detachment between granular layer (GR) and stratum corneum (SC) in the mutant epidermis (arrowheads). BL, /

.nature basal layer; De, dermis; Hf, hair follicle; SP, spinous layer. Comparison of heads of wild-type (WT; e)andSpink5À À (KO; f) mice. (g,h) SEM of the facial / area of Spink5À À mice showed altered hair shafts (HS). (i,j) Longitudinal sections of whisker follicles showing loss of cell adhesion in the IRS and early separation between the hair shaft and the IRS in the mutant mice (arrow). Remnants of IRS cells were associated with the hair shaft (arrowheads) or appeared to float in the widened hair canal. The IRS had eosinophilic cells and few nuclei, indicative of premature keratinization. This defect was also seen in the hair shaft of the lower portion of the follicle, where premature disappearance of nucleated cells is visible. (k,l) Histological analysis of cross-sections http://www of whisker follicles from knockout mice confirmed the loss of intercellular contacts in the IRS (arrowheads) and premature separation between the IRS and the hair shaft (asterisk). Hair shafts of mutant whisker follicles are shrunken and irregular in shape compared with those of normal mice. The inset oup shows a higher magnification of the IRS and hair shaft of a whisker follicle in the lower dermis. ORS, outer root sheath. Scale bars: c,d,40mm;

Gr i,j,28mm; k,l,55mm. lishing / we transplanted whole skin from knockout mice and control litter- Loss of skin barrier function in Spink5À À mice Pub / mates onto nude mice. Five weeks after transplantation, the control To investigate epidermal barrier function in Spink5À À mice, we first grafts were covered with normal hair (Fig. 3a), whereas grafts from examined the ability of skin to prevent the penetration of an external

Nature knockout mice had large scales and marked erythema without any dye solution in a whole-mount assay. In agreement with other erupted hair shafts (Fig. 3b). The histology of control skin grafts was similar to that of normal adult mice skin (Fig. 3c). In contrast, skin 2005 / © grafted from Spink5À À neonates had an acanthotic epidermis with ab papillomatosis, prominent hypertrophy of the stratum corneum (hyperkeratosis), focal parakeratosis and hypogranulosis (Fig. 3d,e). These epidermal alterations were associated with a moderate to severe perivascular inflammatory infiltrate in the papillary dermis (Fig. 3d,e). In the transplanted skin, the stratum corneum was easily / detached from the underlying epidermis, as seen in Spink5À À neonates (Fig. 3d). Like vibrissae, the hair follicles of mutant skin grafts showed a pronounced disorganization (data not shown). WT KO Immunohistochemical analysis showed a marked increase of 5-bro- cde modeoxyuridine–positive basal keratinocytes in knockout mice as compared with wild-type mice, indicative of hyperproliferation of the epidermis (Fig. 3f,g).

/ Figure 3 Ichthyosiform phenotype of transplanted skin from Spink5À À mice. (a,b) Macroscopic morphology of skin from control (WT) and WT KO KO / Spink5À À (KO) mice grafted on nude mice for 5 weeks. Mutant grafted skin showed alopecia, massive scales and marked erythema. Hematoxylin and fg eosin staining of grafted skin cross-sections showed an acanthotic epidermis with papillomatosis, prominent hyperkeratosis (d) and focal parakeratosis and hypogranulosis (e). The stratum corneum was often detached form the underlying epidermis (d). (d,e) A perivascular inflammatory infiltrate is observed in the papillary dermis. (f,g) Immunohistochemistry analysis showing an increase of 5-bromodeoxyuridine–positive basal keratinocytes in / transplanted skin from Spink5À À mice, indicative of hyperproliferation of the mutant epidermis. Scale bars: 40 mm. WT KO

58 VOLUME 37 [ NUMBER 1 [ JANUARY 2005 NATURE GENETICS ARTICLES

Wild-type Figure 4 Skin barrier defect in Spink5 / mice. –/– À À abSpink5 (a) Skin barrier–dependent dye exclusion assay on / 20 100 Spink5À À mice showing large skin areas with 18 intense blue color close to colorless regions.

) 98 1 16 Careful examination of mutant mice showed –

.h 14

2 96 localized light blue regions where no skin – 12 10 94 detachment could be detected, suggestive of an 8 intrinsic skin barrier defect (see muzzle and 92 6 neck). KO, knockout; WT, wild-type. (b)TEWL Percent weight TEWL (g.m 4 90 and dehydration assay over time of E18.5 and 2 newborn mice. Loss of fluid at 37 C from E18.5 0 88 1 +/ WT neonate KO neonate E18.5 Neonate E18.5 Neonate embryos and neonates of intercrossed Spink5 À mice (removed before feeding) was recorded by

enetics monitoring body weight loss. The data are expressed as percentages of initial body weights.

studies22, dye exclusion in wild-type embryos showed that barrier 7% of their body weight, respectively, in 3 h (Fig. 4b). This weight

.com/natureg formation was established between embryonic day (E) 16.5 and E17.5 loss could be attributed to fluid evaporation due to a compromised / (data not shown). Spink5À À neonates had colorless regions near to skin barrier function or partial stratum corneum detachment in large patches of intense blue staining at sites of stratum corneum neonates, in the absence of mouse feeding or urinating during the .nature detachment (Fig. 4a). Careful examination of mutant mice showed evaluation period. localized light blue regions where no skin detachment could be / detected, suggestive of an intrinsic skin barrier defect (Fig. 4a). To Ultrastructural anomalies in epidermis of Spink5À À mice http://www evaluate this intrinsic skin barrier defect, we tested the ability of skin to Transmission electron microscopic examination of epidermis from

/ prevent fluid loss by measuring trans-epidermal water loss (TEWL) in Spink5À À mice showed marked similarities to epidermis of indivi- / / oup Spink5À À E18.5 embryos, which were delivered by caesarean section to duals with Netherton syndrome. The stratum corneum of Spink5À À

Gr avoid stratum corneum detachment, and in mutant neonates in which mice, compared with that of wild-type mice, showed hyperkeratosis partial loss of the stratum corneum could not be avoided. TEWL was with marked alteration of the keratinization process (Fig. 5a–e). As / three times greater in Spink5À À E18.5 embryos than in wild-type reported in Netherton syndrome, corneocytes were often parakeratotic

lishing / embryos and was more than eight times greater in Spink5À À neonates and contained multiple lipid droplets with residues of cellular com- with partial stratum corneum detachment than in controls (Fig. 4b). ponents in mutant mice (Fig. 5d,e). Intercellular spaces between Pub To confirm the ‘inwards out’ defect in skin of knockout mice, we corneocytes showed abnormal granular material deposition / evaluated the rate of fluid loss through evaporation in Spink5À À mice (Fig. 5d). The stratum corneum was generally detached from the

Nature compared with wild-type mice by monitoring body weight as a underlying granular layer (Fig. 5f), similar to the peeling of corneo- / 4 function of time. Spink5À À embryos and neonates lost 3% and cytes in small stacks described in Netherton syndrome .Cellular 2005 ©

/ Figure 5 Ultrastructural anomalies in Spink5À À mice. (a,b)Upper abc epidermis showing thickening of the stratum corneum (SC) in mutant mice (KO) compared with wild-type mice (WT). Note the well-organized, electron- dense corneocytes in the stratum corneum from the wild-type epidermis. GR, granular layer. (c,d) Granular layer–stratum corneum interface showing a massive alteration in the keratinization process of the horny layer in knockout epidermis. Whereas in the wild-type mice, the first horny layer WT KO WT already presented a homogeneous amorphous keratin matrix (c), the keratin d e f pattern was completely altered in knockout mice (d). Numerous lipid vacuoles (d, empty vacuoles), kerotohyalin granules (d, arrow) and a nuclear remnant (e, arrow) are seen in the knockout corneocytes. Intercellular spaces between corneocytes showed abnormal granular material deposition / (d, arrowhead). (f,g), Spink5À À granular layer ultrastructure showing splitting between cells with remnants of desmosomes (De; g). (h)High KO KO KO magnification of a desmosome in granular layer of wild-type epidermis, showing well-defined ultrastructural organization, composed of the ghi extracellular core domain (desmoglea, ECD), the outer and inner symmetrical dense cytoplasmic plaques (DP) with intermediate filament De insertion (IF). (i) Split desmosome in an area of intercellular separation at the granular layer–stratum corneum interface. Note the presence of the entire desmoglea only connected with the desmosomal plaque of the lower KO WT KO cell. DM, dense midline. (j) Knockout mice had normal secretion of lamellar bodies (j, open arrows). (k,l) Ruthenium tetroxide staining shows comparable jkl lamellar membranes in wild-type and knockout corneocytes (bold arrows). In wild-type, intact and elongated corneodesmosomes are observed, whereas corneodesmosomes were decreased in number and size in knockout mice (k,l, double arrows). Scale bars: a,b,4mm; c–f,j,1mm; g–i,0.5mm; KO k,l,0.1mm. KO WT

NATURE GENETICS VOLUME 37 [ NUMBER 1 [ JANUARY 2005 59 ARTICLES

aeb c d f

gh i j kl enetics

.com/natureg Figure 6 Immunohistochemical analysis of epidermal markers and desmosomal proteins. (a,b) Distribution of Krt10 in epidermis of normal (WT) and / Spink5À À (KO) mice showing expression in the suprabasal layer in both cases but downregulation in mutant skin. (c,d) Ivl, a major precursor of the cornified envelope, is markedly increased in the upper spinous layer of the epidermis of knockout mice compared with that of wild-type mice. (e,f) Lor staining is .nature / intense in the granular layer of the epidermis of knockout mice relative to that of wild-type mice. (g,h) Cdsn is overexpressed in Spink5À À epidermis. / (i,j) Dsg1 cell surface staining in the suprabasal layer of the epidermis is markedly lower in Spink5À À mice than in wild-type mice. (k,l) Similarly, Dsp staining is reduced in knockout epidermis. Scale bars: 50 mm. http://www

oup separation occurred at the granular layer–stratum corneum interface investigated the effect of LEKTI deficiency on filaggrin expression. In / Gr (Fig. 5f) or above the first cell layer of stratum corneum (Fig. 5e). Spink5À À mice, we observed two times more mature filaggrin 30-kDa Separated cells showed remnants of desmosomes on the cell mem- monomers and concomitantly fewer larger precursors, which indicated brane (Fig. 5g). In these areas of intercellular separation, split that proteolytic processing of profilaggrin was enhanced (Fig. 7b). lishing desmosomes were not cleaved symmetrically in the desmoglea, but / rather separated between the desmoglea and the outer desmosomal Desmosomal protein degradation in skin of Spink5À À mice Pub plaque of the cell above (Fig. 5g–i). This resulted in a preserved To investigate further the abnormalities of the desmosomal junctions / desmoglea with a well-defined extracellular dense midline, associated observed in the upper granular layer of Spink5À À epidermis, we

Nature with the desmosomal plaque of the lower nondetached cell (Fig. 5i). focused on the expression of the major desmosomal proteins, includ- In the stratum corneum of knockout mice, corneodesmosomes were ing Dsg1, desmocollins, desmoplakin (Dsp) and plakoglobin. In fewer in number and smaller, similar to, but less marked than, wild-type mice, immunohistochemical analysis of skin sections with 2005

© observations in epidermis from individuals with Netherton syndrome antibody to Dsg1 showed intense staining in the suprabasal layers (Fig. 5l). Secretion of lamellar bodies seemed to be normal in mutant of the epidermis. In contrast, staining with antibody to Dsg1 was / mice, unlike in individuals with Netherton syndrome (Fig. 5j). In markedly reduced in skin of Spink5À À mice, with faint staining addition, ruthenium tetroxide staining showed no gross abnormalities limited to the cell border in the upper epidermis (Fig. 6i,j). Wes- in the lamellar membranes of intercorneocyte spaces (Fig. 5k,l). tern-blot analysis of insoluble skin fractions showed a pronounced 55% reduction in Dsg1 expression (Fig. 7c). Similarly, immunohis- / Altered keratinization in Spink5À À mice tochemical analysis of skin sections with antibody to Dsp showed a We investigated the effects of Spink5 deficiency on the expression of considerable decrease in staining in the epidermis of knockout mice the epidermal differentiation markers keratin 10 (Krt10) and keratin compared with that of wild-type mice (Fig. 6k,l). Immunoblotting 14 (Krt14). Expression of Krt10 in the suprabasal epidermis was with antibody to Dsp showed a 35% reduction in the level of protein reduced in epidermis of knockout mice compared with that of wild- expression in skin of knockout mice(Fig. 7c). In contrast, immuno- type mice (Fig. 6a,b), and we observed a marked reduction of Krt10 blotting and immunohistochemical analysis using antibodies to des- protein level (by 70%) in western blots (Fig. 7a). Similarly, expression mocollin 1 and to all desmocollins, respectively, showed no significant of Krt14, a marker of the basal layer of the epidermis, was reduced in differences between skin of wild-type and knockout mice (data not epidermis of knockout mice (data not shown), and immunoblotting shown). Expression of plakoglobin was also comparable in all epider- confirmed that Krt14 expression was decreased in epidermis of mal layers of wild-type and knockout mice (data not shown). knockout mice (46%) compared with that of wild-type mice (Fig. 7a). We also investigated the expression of corneodesmosin (Cdsn), a We next assessed the consequences of the null mutation on the glycoprotein incorporated in desmosomes at the granular layer– expression of the cornified envelope proteins involucrin (Ivl), loricrin stratum corneum transition. Immunohistochemical analysis of skin (Lor) and filaggrin. Ivl had a markedly greater reactivity in the upper sections with antibody to Cdsn showed an increased reactivity in the spinous layers of the epidermis of knockout mice (Fig. 6c,d)andwas upper spinous layer and granular layer of the epidermis of knockout overexpressed by a factor of B3 as shown by western blotting mice (Fig. 6h), compared with mild staining in the epidermis of wild- (Fig. 7a). Similarly, Lor was upregulated in the epidermis (Fig. 6e,f); typemice(Fig. 6g). Western-blot analysis of protein extracts from skin / western blotting showed that expression was two times higher of newborn Spink5À À mice confirmed these results. In soluble protein in knockout mice (Fig. 7a).Becauseserineproteasesareimplicatedin extracts, full-length Cdsn (75 kDa, mainly present in keratinosomes) / the proteolytic processing of profilaggrin into filaggrin monomers, we was overexpressed (by a factor of 1.75) in Spink5À À mice relative to

60 VOLUME 37 [ NUMBER 1 [ JANUARY 2005 NATURE GENETICS ARTICLES

Figure 7 Relative expression levels of epidermal a b differentiation markers and desmosomal proteins. WT WT KO KO WT WT KO KO (a) Epidermal markers: Lor, Ivl, Krt10 and Krt14. Lor Profilaggrin kDa (b) Immunodetection of profilaggrin, filaggrin 112 2.2 and profilaggrin-processing intermediate dimers IvI 200 (2 Flg) and trimers (3 Flg) in epidermal 140 Â Â 1 1 3.4 3 extracts. (c) Insoluble fractions of skin proteins 3 " Flg 100 stained with antibodies directed against Krt10 80 2 " Flg 60 desmosomal proteins Dsg1 and Dsp. 1 1.1 0.3 0.3 50 (d) Immunodetection of Cdsn showing that the Krt14 40 full-length protein (75 kDa) is overexpressed 1 1 0.55 0.55 Filaggrin 30 in the soluble fraction of skin from knockout 20 !-actin mice. In the insoluble fraction, the clusters of 1 1 2.5 2

enetics 45–60 kDa and of 36–40 kDa are increased in / skin of Spink5À À mice. An additional band of 50 kDa (arrowhead) is seen in the insoluble cd WT WT KO KO Soluble Insoluble / fraction of skin of Spink5À À mice but is absent WT WT KO KO WT WT KO KO from skin of wild-type mice. Numbers indicate Dsg1 75 kDa the amount of protein versus housekeeping 1 1 0.3 0.6

.com/natureg 45–60 kDa protein (soluble or filamentous b-actin; GAPDH) Dsp 36–40 kDa ratios relative to an arbitrary level of 1 1 1 0.6 0.7

.nature determined by the first lane of each set. KO, !-actin 1 1.1 1.6 1.88 / Spink5À À mice; WT, wild-type mice. GAPDH http://www

wild-type mice (Fig. 7d). In the insoluble fraction (Cdsn integrated samples but were significantly more intense in knockout samples. All

oup into desmosomes), expression of the clusters of 45–60 kDa and of the bands that we observed by casein gel zymography at pH 8 were still / Gr 36–40 kDa was greater in Spink5À À mice than in wild-type mice observed at pH 5.5 but were less intense (data not shown). These data (Fig. 7d). An additional band of 50 kDa was observed in the insoluble are indicative of residual protease activity at the physiological pH of / 23 fraction of skin from Spink5À À mice but was absent in that from the stratum corneum, as described for SCTE and SCCE . The case- lishing wild-type mice (Fig. 7d). inolytic activities represented by bands of 31 kDa, 23 kDa and 20 kDa Taken together, these results suggest that the split desmosomes were inhibited by AEBSF (serine protease inhibitor), indicating that Pub / observed in the epidermis of Spink5À À mice result from abnormal they corresponded to serine protease activity (Fig. 8a). The bands of degradation of Dsg1 and Dsp. We confirmed this hypothesis by real- 20 kDa and 23 kDa were inhibited by chymostatin (chymotrypsin

Nature time quantitative RT-PCR, which showed that there were no statisti- protease inhibitor; Fig. 8a), indicative of a chymotrypsin-like activity. cally significant changes in transcript levels of Dsg1a, Dsg1b, Dsg1c and A time-course analysis using the preferential substrate for SCCE24 Dsp in epidermis of knockout mice relative to that of control wild-type showed that activity was 1.9 times higher in epidermis of knockout 2005

© mice (Supplementary Fig. 1 online). mice compared with that of wild-type mice (data not shown). These results, taken together with the molecular weight of these two bands, / Enhanced SCTE and SCCE-like activity in Spink5À À mice indicate that the activities represented by bands of 20 kDa and 23 kDa Because Dsg1 and Dsp were abnormally degraded in epidermis of probably correspond to the unglycosylated and the glycosylated active / 23 Spink5À À mice, we investigated a possible increase in epidermal forms of SCCE, respectively . Inhibition of the 31-kDa caseinolytic protease activity. We analyzed epidermal samples from newborn band by AEBSF, but not by chymostatin or elastatinal (data not mice by casein gel zymography at pH 8 to detect proteolytic activity shown), indicates that this activity could correspond to trypsin-like corresponding to the stratum corneum chymotryptic enzyme (SCCE) activity. A time-course analysis using a trypsin-specific substrate20 23 / / and SCTE as described previously . Samples from Spink5À À mice confirmed that trypsin-like activity in Spink5À À epidermis was sig- showed two caseinolytic bands with molecular masses of B31 kDa nificantly greater (by a factor of 2.1) in epidermis of knockout mice and B23 kDa, which were not observed in wild-type samples compared with that of wild-type mice (data not shown). In addition, (Fig. 8a). Bands of 28 kDa and 20 kDa were detectable in wild-type western blotting using an antibody to SCTE showed that there was two

WT KO WT KO WT KO WT KO NHK abkDa kDa kDa SCTE 31 31 28 28 28 1 0.8 1.8 1.8 23 20 !-actin AEBSF Chymostatin

/ / Figure 8 Epidermal protease analysis. (a) Protolytic activity in epidermis of Spink5À À mice analyzed by casein gel zymography. Spink5À À epidermal samples showed specific caseinolytic bands with a molecular mass of B31 kDa and 23 kDa. In addition, two bands of 28 kDa and 20 kDa were detected / in wild-type and Spink5À À epidermal samples but were more intense in knockout mice. The 31-kDa, 23-kDa and 20-kDa caseinolytic bands were / completely inhibited by AEBSF (serine protease inhibitor). The 20-kDa and 23-kDa caseinolytic bands in Spink5À À epidermal samples were fully inhibited by chymostatin (chymotrypsin-like inhibitor). (b) Expression of the active form of SCTE in epidermis from wild-type and knockout mice. Protein extracts from normal human keratinocytes (NHK) were used as a control. Numbers indicate the amount of SCTE amount versus b-actin ratios relative to an arbitrary level / of 1 determined by the first lane of each set. KO, Spink5À À mice; WT, wild-type mice.

NATURE GENETICS VOLUME 37 [ NUMBER 1 [ JANUARY 2005 61 ARTICLES

times more active SCTE protein (31 kDa) in epidermis of knockout been hypothesized to stabilize the desmosome37.Weobservedover- / mice compared with that of wild-type mice (Fig. 8b). The molecular expression of Cdsn in Spink5À À mice, with increased levels of the full- weight of SCTE detected in the western blot is consistent with the length and proteolytically cleaved Cdsn forms. The additional 50-kDa / molecular weight of the 31-kDa caseinolytic band. To summarize, band observed only in Spink5À À mice could result from an abnormal SCTE and SCCE-like activities were increased in the epidermis of proteolytic processing of Cdsn. Notably, abnormal cleavage of Cdsn knockout mice, probably resulting from a lack of inhibition of these has also been observed in individuals with hypotrichosis simplex of proteases rather than an increase in gene expression. We confirmed the scalp, an autosomal dominant form of alopecia caused by this hypothesis by real-time quantitative RT-PCR (Supplementary nonsense mutations in CDSN38, but no desmosomal split or epider- Fig. 1 online), which showed no significant difference in transcript mal differentiation abnormality is associated with hypotrichosis sim- levels of the genes encoding SCTE and SCCE in epidermis of wild-type plex of the scalp. Finally, our results do not confirm the decrease in / 39 and Spink5À À mice. In addition to SCTE and SCCE-like proteases, we amounts of the 45-kDa to 60-kDa Cdsn forms, which was suggested detected a 28-kDa band in skin samples from both wild-type and to cause desmosomal dissociation and stratum corneum detachment enetics / Spink5À À mice, which was significantly more intense in samples from in Spink5 mutant mice. knockout mice (Fig. 8a). This activity was not inhibited by AEBSF, As a result of unregulated serine protease activity, reduced stratum E64, pepstatin or EDTA, indicating that it does not behave as a typical corneum cohesion leads to a defect in the epidermal barrier, as shown serine, cysteine, aspartate or metalloprotease, respectively. by an increased TEWL and rapid weight loss in E18.5 mutant

.com/natureg embryos, even in the absence of stratum corneum detachment. The / DISCUSSION defective skin barrier function in Spink5À À mice results in typical Here we report the successful targeted disruption of Spink5 in mice, compensatory mechanisms of the adult epidermis involving epidermal .nature which faithfully replicates key features of Netherton syndrome and differentiation and proliferation40. Ivl and Lor, two protein precursors shows that LEKTI has a crucial role in epidermal desquamation, of the epidermal cornified envelope, were considerably overexpressed / keratinization, barrier formation and hair morphogenesis. The loss of in Spink5À À newborns. Parakeratosis was also observed in both http://www adherence of stratum corneum was the most notable defect observed knockout neonates and grafted skin. Hypogranulosis also became

/ in Spink5À À mice and underlies severe epidermal fragility. Cleavage evident in grafted skin from knockout mice. These anomalies are often oup plans occurred at the granular layer–stratum corneum transition and reported in Netherton syndrome as a sign of impaired epidermal 4,10 Gr were characterized by the presence of split desmosomes. These terminal differentiation . Lipid lamellae and lamellar bodies in / anomalies were associated with degradation of Dsg1, probably corre- Spink5À À neonates showed no gross abnormalities, unlike individuals sponding to the a and b forms, as they are the Dsg1 family members with Netherton syndrome, in whom premature secretion of lamellar lishing primarily expressed in the mouse epidermis25,26. These defects were bodies and disorganization of lipid lamellae have been described10. consistent with the asymmetrical separation of desmosomes in the These results suggest that alteration of lipid metabolism and deposi- Pub superficial granular layer, described in skin of individuals with Nether- tion observed in Netherton syndrome may be a delayed event 27 / ton syndrome . Degradation of Dsg1 in Spink5À À mice could be secondary to skin barrier dysfunction.

Nature attributed to unregulated proteolysis in the upper granular layer. This Other defects were detected only in transplanted skin from / possibility was supported by the increased proteolytic activity of SCTE Spink5À À mice, a situation that allowed the barrier defect to persist. and SCCE-like proteases in Spink5 / mice. These serine proteases, Severe acanthosis and papillomatosis were associated with dermal

2005 À À

© which are secreted at the granular layer–stratum corneum transition, inflammation. These features faithfully replicate the Netherton syn- are involved in corneodesmosome degradation during the desquama- drome phenotype. A marked hyperkeratosis was also observed in 9,23,28,29 30 / tion process . SCTE degrades Dsg1 in vitro . This result is Spink5À À skin; this defect has already been reported in association strongly concordant with Dsg1 degradation and increased SCTE with epidermal hyperplasia in other deficient mice suffering from a activity observed in our mutant mice. Because LEKTI inhibits trypsin severe skin barrier defect41–44. In contrast, papillomatosis seems to be 16,31–33 / / in vitro , Dsg1 degradation in the Spink5À À mice could result auniquefeatureofSpink5À À skin. The dermal inflammation seen in / from impaired SCTE inhibition by LEKTI. In addition, the absence of transplanted skin from Spink5À À mice, which is reminiscent of the LEKTI would lead to a lack of inhibition of pro-SCTE proteolytic inflammatory features reported in Netherton syndrome, may also activation. As SCTE can activate pro-SCCE in vitro30, enhanced account for a role of LEKTI in the inhibition of proteases involved in activity of the SCCE-like protease observed in mutant mice skin proinflammatory cytokine activation18. could be caused by an unmodulated cleavage of pro-SCCE by SCTE. Epidermal differentiation abnormalities observed in knockout mice The stratum corneum detachment observed in our mutant neo- may also be due to a more direct role of LEKTI in the keratinization nates and in grafted skin from knockout mice is markedly similar to process. Specifically, profilaggrin processing into filaggrin monomers two conditions that are relevant to human diseases. In the mouse was increased in the knockout neonates. This late terminal differentia- staphylococcal scalded-skin syndrome model, Dsg1 is the target for the tion marker is a result of the complex proteolytic processing of serine protease exfoliative toxin A34, which leads to a severe loss of cell profilaggrin by several enzymes, including the serine protease matrip- adhesion in the superficial living epidermis. Administration of pem- tase. Deficiency of this enzyme has an opposite effect with absence of phigus foliaceus antibodies (antibodies to Dsg1) in mice leads to a the proteolytically processed filaggrin44. Colocalization of LEKTI and similar phenotype35. These observations suggest that proteolytic matriptase in the granular layer of the epidermis suggests that degradation of Dsg1, the only desmoglein family member expressed matriptase could be a target for LEKTI. This implicates LEKTI in in the outer layers of the epidermis, results in abnormal desmosome the regulation of serine proteases involved in epidermal differentiation. / cleavage and loss of stratum corneum adhesion in Spink5À À skin. The The strong expression of LEKTI in the IRS and the hair shaft cuticle / degradation of Dsp in Spink5À À mice may also contribute to of the human hair follicle supports the idea that Spink5 has a direct / 36 17 / desmosomal fragility, as seen in DspÀ À mice . role in hair formation .InSpink5À À neonates and transplanted skin, Cdsn, which is incorporated into the extracellular core domain of intercellular adhesion was impaired in the IRS and between the IRS / desmosomes at the granular layer–stratum corneum transition, has and the hair shaft. In Spink5À À mice, alterations to IRS may

62 VOLUME 37 [ NUMBER 1 [ JANUARY 2005 NATURE GENETICS ARTICLES

compromise its role in the guidance and molding of the growing hair system for RT-PCR (Invitrogen). We used forward and reverse primers to shaft45, resulting in bad orientation and deformation of erupted amplify a region spanning exons 1–4 of Spink5 cDNA (primer sequences are vibrissae in knockout neonates. These anomalies are reminiscent of available on request). As a control, we amplified b-actin cDNA as a house- the poor and sparse hair growth seen in individuals with Netherton keeping gene. For details of quantitative RT-PCR analysis, see Supplementary syndrome46. They may also explain the pathogenesis of trichorrhexis Methods online. invaginata, which is described as the invagination of the distal part of Antibodies. Primary antibodies were directed against LEKTI (2 mgml1; 47 À the hair shaft into its proximal part . D4-D5); Krt10 and Krt14 (Covance); Dsg1, raised against a polypeptide shared In conclusion, our findings elucidate the molecular pathology of the by a and b and partially by g isoforms, and Ivl (Santa Cruz Biotechnology); severe generalized exfoliation observed in Netherton syndrome: lack of pan-desmocollin (DPC Biermann); desmocollin 1 (Santa Cruz Biotechnology); LEKTI leads to unregulated SCTE and SCCE-like activity and loss of plakoglobin (Zymed Laboratories, Inc.); Dsp (Serotec); and SCTE (Abcam). stratum corneum adhesion through degradation of Dsg1. Reduced We used primary antibodies in accordance with the manufacturer’s recom- granular layer–stratum corneum cohesion results in defective barrier mendations. A polyclonal antibody raised against the central domain (AAGP- enetics function, which could, in turn, account for dehydration, infections and PISEGKYFSS) of the Cdsn protein was generated by A. Ishida-Yamamoto (Medical College, Midorigaoka-Higashi, Asahikawa, Japan). We used this increased allergen penetration, which are all features relevant to 1 1 antibody at dilutions of 7 mgmlÀ and 2.8 mgmlÀ in immunohistochemical Netherton syndrome. The demonstration of SCTE and SCCE-like and western-blot analyses, respectively. / hyperactivity in Spink5À À mice identifies these proteases as potential

.com/natureg therapeutic targets. Pharmacological approaches using specific syn- Histological and immunohistochemical analysis. We killed newborn pups, thetic inhibitors of SCTE or SCCE to compensate for defective fixed them for 24 h in 10% neutral buffered formalin, dehydrated them for 24 h inhibition by LEKTI may be promising strategies to restore epidermal in 70% ethanol and embedded in paraffin. We cut 4-mm sagittal sections and .nature integrity and barrier function in individuals with Netherton syndrome. stained them with hematoxylin and eosin. For immunohistochemical analysis, we prepared 4-mm sections from paraffin-embedded mice and investigated their reactivity to various antibodies. We detected a specific signal using the METHODS appropriate Dako EnVision System, HPR (DAB) kit. To detect Cdsn, we carried http://www Targeting vector construction. We screened a mouse 129/SvJ genomic BAC out epitope retrieval by incubating the sections in 0.01 M citrate buffer at 95 1C library (Incyte genomics, Inc.) with the murine IMAGE Clone A551325 insert, for 40 min and staining with a Vectastain ABC kit. which corresponds to partial Spink5 mouse cDNA, as a probe and isolated oup seven unique genomic clones. We digested these clones with HindIII, randomly Gr Barrier function assay. We euthanized newborn mice and immediately subcloned the resulting genomic DNA fragments into pBR322 and character- subjected them to methanol dehydration and subsequent rehydration as ized them by restriction enzyme digestion and Southern-blot analysis with described22. We then washed the pups in phosphate-buffered saline (PBS) for synthetic oligonucleotides based on sequences derived from the cDNA. We

lishing 1 min, stained them overnight at room temperature in 0.1% toluidine blue fractionated the endonuclease digestion products by electrophoresis on 1% (Fisher Scientific), destained them for 15 min in PBS at room temperature and

Pub agarose gels and estimated the sizes of the resulting bands by comparison with photographed them. We recorded TEWL measurements from newborn mice standard DNA markers (New England Biolabs). On the basis of the mouse and E18.5 embryos, delivered by caesarean sections to avoid stratum corneum Spink5 genomic sequence, we selected a 1.3-kb fragment upstream of the ATG detachment, with the EP1 evaporimeter (ServoMed). translation initiation site, amplified it by high-fidelity long-range PCR, digested Nature it with HindIII and obtained an 8-kb fragment containing exons 5–7. We Transmission and SEM. We fixed tissues in 4% glutaraldehyde with 0.1 subcloned these fragments into the pMC1neo Poly A vector, which contains a phosphate (Sorensen’s) buffer (pH 7.4) for 1 h at 4 1C and then rinsed them 2005 neomycin-resistance gene (neo) and a polyadenylation site under the control of twice in Sorensen’s buffer (pH 7.4) for 12 h at 4 1C. For SEM, we dehydrated © the thymidine kinase promoter (Stratagene). In the targeting vector, the 1.3-kb the fixed tissues in graded ethanol solutions, desiccated them, metallized them fragment in the 5¢ arm and the 8-kb fragment in the 3¢ arm (Fig. 1a)flankthe and examined them with a Hitachi S450 scanning electron microscope. For neo cassette. After homologous recombination with the Spink5 gene locus, the transmission electron microscopy, we postfixed tissues for 1 h at room ATG translation initiation site and exons 1–4 of the coding sequences were temperature in 0.25 M saccharose with 0.5 M Sorensen’s buffer and 2% deleted (Fig. 1a), introducing a frameshift into the coding phase. osmium. We then dehydrated the samples in graded ethanol solutions and embedded them with Embed 812 kit (Electron Microscopy Sciences). For / Targeting of embryonic stem cells and generation of Spink5À À mice. This ruthenium tetroxide transmission electron microscopy, we fixed 1-mm pieces work was approved by the Commission de Ge´nie Ge´ne´tique (23 November of skin samples overnight in 2.5% glutaraldehyde and 2% paraformaldehyde in 2003, agreement number 3987) and by the Local Ethical Committee (DEC 0.1 M sodium cacodylate buffer (pH 7.4) at 4 1C. We postfixed the samples 04005). All experiments were done in accordance with the relevant guidelines with 1% OsO4 for 2 h in the dark, incubated them in 0.25% ruthenium and regulations. We linearized the targeting vector with BglII and introduced tetroxide for 45 min, dehydrated them and embedded them. We polymerized into 129/Ola embryonic stem (ES) cells (clone E14) by electroporation as the blocks at 68 1C for 48 h. We mounted 80- to 90-nm ‘near-surface’ sections described previously48. We selected cells with G418 and identified two correctly on copper grids, stained them with uranyl acetate and lead citrate, and targeted clones by Southern-blot analysis. We injected targeted ES cells into examined them with a transmission electron microscope. C57/B6 blastocysts and then implanted them into pseudopregnant foster mothers. We crossed male chimeric mice with wild-type FVB females to Western blotting. We used skin or epidermis samples from newborn mice for establish germline transmission and obtain heterozygous offspring. We con- western blotting. For epidermis isolation, we incubated skin from newborn firmed correct targeting by Southern-blot analysis of a SacI fragment using the wild-type and knockout mice in PBS at 56 1C for 10 min and mechanically 5¢ probe P1 (Fig. 1a,b). We then genotyped wild-type, heterozygous and separated the epidermis from the dermis. We pulverized skin or epidermis in knockout mice by PCR using a forward primer and two specific reverse primers protein extraction buffer (150 mM NaCl, 50 mM Tris HCl (pH 8), 5 mM EDTA 1 for the wild-type and recombinant allele, respectively (Fig. 1c). We intercrossed (pH 8), 1% Nonidet-P40, 1 mM phenylmethylsulfonyl fluoride, 10 mgmlÀ 1 1 mice heterozygous with respect to the targeted mutation to obtain homozygous leupeptin, 10 mg mlÀ pepstatin A and 1 mgmlÀ antipain) with Ultra-Turrax. Spink5 mutants. We extracted genomic DNA from mouse tails and carried out We separated soluble and insoluble protein fractions by centrifugation and endonuclease digestion and Southern-blot analyses using standard procedures. solubilized the pellet for 1 h in the same buffer containing 9 M urea and 50 mM dithiothreitol. For the detection of filaggrin, we extracted the epidermis in the RT-PCR analysis. We isolated total RNA from skin of wild-type, heterozygous same extraction buffer and subjected it to ultracentrifugation (27,000g for / 49 and Spink5À À mouse pups using Trizol Reagent (Invitrogen). We reverse- 30 min at 0 1C) . We then mixed the protein fractions with Laemmli buffer transcribed 3 mg of total RNA using the Superscript first-strand synthesis (62.5 mM Tris HCl (pH 6.8), 5 % b-mercaptoethanol, 2% SDS, 10% glycerol

NATURE GENETICS VOLUME 37 [ NUMBER 1 [ JANUARY 2005 63 ARTICLES

and 0.002% bromophenol blue). For the immunodetection of Cdsn, we 5. Judge, M.R., Morgan, G. & Harper, J.I. A clinical and immunological study of Nether- pulverized skin in lysis buffer (10 mM Tris-Cl (pH 7.4), 5 mM EDTA, 100 ton’s syndrome. Br. J. Dermatol. 131, 615–621 (1994). mM NaCl, 1% Triton X-100 with 1 mM phenylmethylsulfonyl fluoride, 10 g 6. Smith, D.L., Smith, J.G., Wong, S.W. & deShazo, R.D. Netherton’s syndrome. Br. J. m Dermatol. 133, 153–154 (1995). 1 1 1 mlÀ leupeptin, 10 mg mlÀ pepstatin A and 1 mgmlÀ antipain). We separated 7. Van Gysel, D. et al. Clinico-immunological heterogeneity in Comel-Netherton syn- soluble and insoluble fractions by centrifugation and dissolved insoluble pellets drome. Dermatology 202, 99–107 (2001). with Laemmli buffer. We then incubated equal amounts of protein for 5 min at 8. Elias, P.M. & Menon, G.K. Structural and lipid biochemical correlates of the epidermal 95 C, separated them by SDS-PAGE and transferred them to Hybond-C extra permeability barrier. Adv. Lipid Res. 24, 1–26 (1991). 1 9. Suzuki, Y., Nomura, J., Koyama, J. & Horii, I. The role of proteases in stratum corneum: membranes (Amersham Pharmacia biotech). After incubation with primary involvement in stratum corneum desquamation. Arch. Dermatol. Res. 286, 249–253 and secondary antibodies, we carried out enhanced chemiluminescence (ECL) (1994). detection as recommended by the manufacturer. We quantified results using 10. Fartasch, M., Williams, M.L. & Elias, P.M. Altered lamellar body secretion and stratum the NIH Image 1.63 software. For western blotting with antibody to SCTE, we corneum membrane structure in Netherton syndrome. Arch. Dermatol. 135, 823–832 (1999). used protein extracts from normal human keratinocytes, differentiated in vitro 11. De Wolf, K. et al. Netherton’s syndrome: a severe neonatal disease. A case report. as previously described17,asacontrol. Dermatology 192, 400–402 (1996). enetics 12. Scheimberg, I., Harper, J.I., Malone, M. & Lake, B.D. Inherited ichthyoses: Epidermal protease activity. We crushed epidermis from wild-type and a review of the histology of the skin. Pediatr. Pathol. Lab. Med . 16, 359–378 knockout mice in 1 M acetic acid solution with Ultra-Turrax. After overnight (1996). 13. Chavanas, S. et al. Mutations in SPINK5, encoding a serine protease inhibitor, cause extraction at 4 1C, we lyophilized soluble proteins and resuspended them in Netherton syndrome. Nat. Genet. 25, 141–142 (2000). PBS. After acetone precipitation, we assayed proteins (Bradford, Bio-Rad) and 14. Bitoun, E. et al. Netherton syndrome: disease expression and spectrum of SPINK5 .com/natureg loaded 5 mg of the soluble fractions onto casein copolymerized acrylamide gels mutations in 21 families. J. Invest. Dermatol. 118, 352–361 (2002). (15% acrylamide, 0.05% a-casein; Sigma) for electrophoresis. We washed gels 15. Sprecher, E. et al. The spectrum of pathogenic mutations in SPINK5 in 19 families with Netherton syndrome: implications for mutation detection and first case of prenatal with 2.5% Triton X-100 for 1 h to remove SDS and incubated them for 16–36 h

.nature diagnosis. J. Invest. Dermatol. 117, 179–187 (2001). at 37 1C in a reaction buffer containing 50 mM Tris (pH 8). We stained gels 16. Magert, H.J. et al. LEKTI, a novel 15-domain type of human serine proteinase inhibitor. with 1% Coomassie Brillant blue for 30 min. Areas of caseinolytic activity J. Biol. Chem. 274, 21499–21502 (1999). appeared as clear zones against a dark blue background. To determine the class 17. Bitoun, E. et al. LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome. Hum. Mol. Genet. 12, of proteinases visualized on the zymograms, we used class-specific inhibitors. 2417–2430 (2003). http://www We added AEBSF (1 mM) or chymostatin (500 mM) to the sample before 18. Mitsudo, K. et al. Inhibition of serine proteinases plasmin, trypsin, subtilisin A, electrophoresis (15 min on ice) and in the reaction buffer. We quantified signal cathepsin G, and elastase by LEKTI: a kinetic analysis. Biochemistry 42,3874– oup intensity using the NIH Image 1.63 software. 3881 (2003). 19. Jayakumar, A. et al. Expression of LEKTI domains 6-9¢ in the baculovirus expression Gr We assayed trypsin-like hydrolytic activity using a synthetic peptide (Phe- system: recombinant LEKTI domains 6-9¢ inhibit trypsin and subtilisin A. Protein Expr. 20 Val-Arg-pNA; Sigma) . For chymotrypsin-like hydrolytic activity, we used a Purif. 35, 93–101 (2004). preferential synthetic substrate of SCCE (Suc-Arg-Pro-Tyr-pNA). All assays 20. Komatsu, N. et al. Elevated stratum corneum hydrolytic activity in Netherton syndrome suggests an inhibitory regulation of desquamation by SPINK5-derived peptides. lishing were done in 50 mM Tris (pH 8) at 37 1C (final volume of 200 ml). We used the J. Invest. Dermatol. 118, 436–443 (2002). soluble PBS fractions of epidermis in a quantity range of 20–30 mg per assay. 21. Raghunath, M. et al. SPINK5 and Netherton syndrome: novel mutations, demonstra- Pub We initiated proteinase activity by adding the synthetic substrate (final tion of missing LEKTI, and differential expression of transglutaminases. J. Invest. concentration of 0.1 mM) to reaction mixtures. We measured the released Dermatol. 123, 474–483 (2004). pNa spectrophometrically at 405 nm for 1–2 h. Trypsin-like and chymotrypsin- 22. Hardman, M.J., Sisi, P., Banbury, D.N. & Byrne, C. Patterned acquisition of skin barrier function during development. Development 125, 1541–1552 (1998). Nature –1 –1 like activities of the epidermal samples were expressed in DDO405 min mg 23. Ekholm, I.E., Brattsand, M. & Egelrud, T. Stratum corneum tryptic enzyme in normal protein from the velocity plots. epidermis: a missing link in the desquamation process? J. Invest. Dermatol. 114,

2005 56–63 (2000). Skin grafting. We transplanted full-thickness dorsal skin grafts from neonate 24. Franzke, C.W., Baici, A., Bartels, J., Christophers, E. & Wiedow, O. Antileukoprotease © donors onto athymic nude recipient mice as 2-cm2 squares using the skin-flap inhibits stratum corneum chymotryptic enzyme. Evidence for a regulative function in technique50. After 2 weeks, we removed the skin flap and exposed the graft to desquamation. J. Biol. Chem. 271, 21886–21890 (1996). 25. Pulkkinen, L., Choi, Y.W., Kljuic, A., Uitto, J. & Mahoney, M.G. Novel member ambient air for 3 additional weeks. of the mouse desmoglein gene family: Dsg1-beta. Exp. Dermatol. 12, 11–19 (2003). Note: Supplementary information is available on the Nature Genetics website. 26. Kljuic, A. & Christiano, A.M. A novel mouse desmosomal cadherin family member, desmoglein 1 gamma. Exp. Dermatol. 12, 20–29 (2003). ACKNOWLEDGMENTS 27. Ishida-Yamamoto, A. et al. LEKTI is localized in lamellar granules, separated from We thank P. Krimpenfort and R. Bin Ali for carrying out the blastocyst KLK5 and KLK7, and is secreted in the extracellular spaces of the superficial stratum granulosum. J. Invest. Dermatol. (in the press). injections; B. Payre, I. Fourquaux and D. Crumrine for technical assistance 28. Hansson, L. et al. Cloning, expression, and characterization of stratum corneum for ultrastructural analyses; F. Capilla and D. Rosi for carrying out chymotryptic enzyme. A skin-specific human serine proteinase. J. Biol. Chem. 269, immunohistochemical analyses; L. Lamant for expertise in histopathological 19420–19426 (1994). analysis; F. Galliano for participation in the targeting strategy; and V. Turlier for 29. Brattsand, M. & Egelrud, T. Purification, molecular cloning, and expression of a human advice on TEWL measurements. This work was supported by grants from the stratum corneum trypsin-like serine protease with possible function in desquamation. Fondation pour la Recherche Me´dicale and the INSERM. P.D. was a recipient J. Biol. Chem. 274, 30033–30040 (1999). of a grant from the French Ministry of Research and Technology. 30. Caubet, C. et al. Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J. Invest. Dermatol. 122, 1235–1244 (2004). COMPETING INTERESTS STATEMENT 31. Magert, H.J. et al. The 15-domain serine proteinase inhibitor LEKTI: biochemical The authors declare that they have no competing financial interests. properties, genomic organization, and pathophysiological role. Eur. J. Med. Res. 7, 49–56 (2002). Received 4 October; accepted 23 November 2004 32. Magert, H.J. et al. LEKTI: a multidomain serine proteinase inhibitor with pathophy- Published online at http://www.nature.com/naturegenetics/ siological relevance. Int. J. Biochem. Cell Biol. 34, 573–576 (2002). 33. Kreutzmann, P., Schulz, A., Standker, L., Forssmann, W.G. & Magert, H.J. Recombi- nant production, purification and biochemical characterization of domain 6 of LEKTI: a 1. Comel, M. Ichtyosis Linearis circumflexa. Dermatologica 98, 133–136 (1949). temporary Kazal-type-related serine proteinase inhibitor. J. Chromatogr. B Analyt. 2. Netherton, E.W. A unique case of Trichorrexis Invaginata. Arch. Dermatol. 78,483– Technol. Biomed. Life Sci. 803, 75–81 (2004). 487 (1958). 34. Amagai, M., Matsuyoshi, N., Wang, Z.H., Andl, C. & Stanley, J.R. Toxin in bullous 3. Traupe, H. The Ichthyosis: A Guide to Clinical Diagnosis, Genetic Counselling, and impetigo and staphylococcal scalded-skin syndrome targets desmoglein 1. Nat. Med. Therapy (Springer-Verlag, Berlin Heidelberg, 1989). 6, 1275–1277 (2000). 4. Hausser, I. & Anton-Lamprecht, I. Severe congenital generalized exfoliative erythro- 35. Ding, X., Diaz, L.A., Fairley, J.A., Giudice, G.J. & Liu, Z. The anti-desmoglein 1 derma in newborns and infants: a possible sign of Netherton syndrome. Pediatr. autoantibodies in pemphigus vulgaris sera are pathogenic. J. Invest. Dermatol. 112, Dermatol. 13, 183–199 (1996). 739–743 (1999).

64 VOLUME 37 [ NUMBER 1 [ JANUARY 2005 NATURE GENETICS ARTICLES

36. Vasioukhin, V., Bowers, E., Bauer, C., Degenstein, L. & Fuchs, E. Desmoplakin is 43. Segre, J.A., Bauer, C. & Fuchs, E. Klf4 is a transcription factor required for establishing essential in epidermal sheet formation. Nat. Cell Biol. 3, 1076–1085 (2001). the barrier function of the skin. Nat. Genet. 22, 356–360 (1999). 37. Simon, M., Montezin, M., Guerrin, M., Durieux, J.J. & Serre, G. Characterization and 44. List, K. et al. Loss of proteolytically processed filaggrin caused by epidermal deletion of purification of human corneodesmosin, an epidermal basic glycoprotein associated Matriptase/MT-SP1. J. Cell Biol. 163, 901–910 (2003). with corneocyte-specific modified desmosomes. J. Biol. Chem. 272, 31770–31776 45. Bernard, B.A. Hair shape of curly hair. J. Am. Acad. Dermatol. 48, S120–S126 (1997). (2003). 38. Levy-Nissenbaum, E. et al. Hypotrichosis simplex of the scalp is associated with 46. Stevanovic, D.V. Multiple defects of the hair shaft in Netherton’s disease. Association nonsense mutations in CDSN encoding corneodesmosin. Nat. Genet. 34, 151–153 with ichthyosis linearis circumflexa. Br. J. Dermatol. 81, 851–857 (1969). (2003). 47. Ito, M., Ito, K. & Hashimoto, K. Pathogenesis in trichorrhexis invaginata (bamboo hair). 39. Yang, T. et al. Epidermal detachment, desmosomal dissociation, and destabilization of J. Invest. Dermatol. 83, 1–6 (1984). / corneodesmosin in Spink5À À mice. Genes Dev. 18, 2354–2358 (2004). 48. van der Neut, R., Krimpenfort, P., Calafat, J., Niessen, C.M. & Sonnenberg, A. 40. Elias, P.M. The epidermal permeability barrier: from the early days at Harvard to Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null emerging concepts. J. Invest. Dermatol. 122, vi–ix (2004). mice. Nat. Genet. 13, 366–369 (1996). 41. Kuramoto, N. et al. Development of ichthyosiform skin compensates for defective 49. Resing, K.A., Walsh, K.A. & Dale, B.A. Identification of two intermediates during permeability barrier function in mice lacking transglutaminase 1. J. Clin. Invest. 109, processing of profilaggrin to filaggrin in neonatal mouse epidermis. J. Cell Biol. 99, 243–250 (2002). 1372–1378 (1984). enetics 42. Furuse, M. et al. Claudin-based tight junctions are crucial for the mammalian 50. Barrandon, Y., Li, V. & Green, H. New techniques for the grafting of cultured epidermal barrier: a lesson from claudin-1-deficient mice. J. Cell Biol. 156, 1099– human epidermal cells onto athymic animals. J. Invest. Dermatol. 91, 315–318 1111 (2002). (1988). .com/natureg .nature http://www oup Gr lishing Pub Nature 2005 ©

NATURE GENETICS VOLUME 37 [ NUMBER 1 [ JANUARY 2005 65 Chapitre C : Caractérisation d’une nouvelle protéase épidermique

Article 4

Hyperactivity of Elastase 2, a new epidermal protease, causes severe impairment of epidermal barrier function and contributes to Netherton syndrome phenotype.

L’absence de LEKTI entraîne l’hyperactivité de la KLK5, la KLK7 ainsi que d’une troisième protéase épidermique d’un poids moléculaire apparent de 28 kDa. Dans cet article, nous décrivons l’identification par spectrométrie de masse de cette enzyme, l’élastase 2 pancréatique (Ela2). Ela2 apparaît comme une nouvelle enzyme épidermique de la couche granuleuse, différant de l’isoforme pancréatique par la présence d’une modification post- traductionnelle de type N-glycosylation. Nos résultats ne mettent pas en évidence une inhibition directe de l’activité de l’Ela2 par LEKTI. Cependant, nous proposons un mécanisme indirect selon lequel l’acteur central est KLK14, dont l’activité est inhibée par LEKTI et qui active la pro-Ela2 en Ela2 active, d’après notre étude. Nous avons développé un modèle de souris transgénique conditionnelle pour la forme murine de l’Ela2, dont l’expression du transgène est sous le contrôle du promoteur de l’involucrine. Les souris transgéniques INV-

Ela2 présentent des phénotypes de sévérité variable, dont l’analyse montre l’implication de cette enzyme dans les processus d’hyperprolifération, d’inflammation cutanée, ainsi que dans les défauts de différenciation terminale et d’élaboration de la barrière cutanée. Enfin, notre

étude moléculaire montre que SLPI est un inhibiteur physiologique potentiel de l’Ela2. De plus, son expression est induite de manière précoce dans la peau des souris transgéniques.

Nos résultats démontrent que la dérégulation d’activité de l’Ela2 a probablement un rôle majeur dans de nombreux aspects du phénotype SN et en particulier dans la perte de fonction barrière cutanée. En conclusion, ces travaux identifient une nouvelle protéase

épidermique en même temps qu’une cible thérapeutique potentielle pour le traitement des patients SN.

111 112 Hyperactivity of Elastase 2, a new epidermal protease, causes severe impairment of epidermal barrier function and contributes to Netherton syndrome phenotype.

C. Bonnart*,†,# , C. Deraison*,†,‡,#, C. Besson*,†, A. Robin*,†, A. Briot*,†, M. Lacroix*, M. Gonthier§, B. Monsarrat§ and A Hovnanian*,†,‡

* INSERM, U563, Toulouse, F-31300 France; † Université Toulouse III Paul-Sabatier, UMR-S563, Toulouse, F-31400 France; ‡ CHU Toulouse, Hôpital Purpan, Departement de Génétique Médicale, Toulouse, F31000 France; § Laboratoire de Protéomique et Spectrométrie de Masse des Biomolécules, Institut de Pharmacologie et de Biologie Structurale, CNRS UMR 5089, 205 route de Narbonne, 31077 Toulouse, France

# These authors contributed equally to the work.

Manuscrit en préparation ABSTRACT

The severe genodermatosis Netherton syndrome (NS) is caused by mutations in

SPINK5, leading to defective expression of LEKTI, a serine protease inhibitor. Here, we report the unambiguous identification by tandem mass spectrometry of a new epidermal protease, Elastase 2 (Ela2), which is hyperactive in Spink5-/- mice and in

NS patients. Transgenic mice for Ela2 show several phenotypical features of NS, including impaired skin barrier function, epidermal hyperproliferation, a disturbed differentiation program, a defective lamellar body secretion and the presence of inflammatory infiltrate. We identified KLK14 as a potential activator of Ela2 and SLPI, a major actor of innate immunity, as a potent Ela2 inhibitor which is induced upon

Ela2 overexpression as a probable compensatory mechanism. This work discloses important functions of a new epidermal actor, which may be of great importance for epidermal research. It identifies a new potential target for forthcoming therapeutic strategy of NS.

II INTRODUCTION

Until recently, proteases were considered primarily to be protein-degrading enzymes. However, it is now well documented that proteases and their inhibitors play key roles in fundamental physiological processes such as mitosis, apoptosis, differentiation, cell migration, cell signalling, molecule activation, development, reproduction. However, deregulation of proteolysis underlies common human pathologies such as cancer, inflammation, infectious diseases, metabolic disorders, and hormonal dysfunction. A disturbance of the protease – antiprotease balance in the skin may have serious consequences as illustrated by the severe rare genetic disease Netherton syndrome (NS) (OMIM 256500). As soon as birth, NS patients suffer from intense epidermal dysfunctions, which compromise the vital prognosis due to extreme dehydration.

The epidermal tissue consists of four layers of keratinocytes called the basal layer (BL), the spinous layer (SP), the granular layer (GR) and the stratum corneum

(SC). Keratinocytes proliferate in the BL, and then enter into a specific program of differentiation until the SC, which contains dead, anucleated and keratin-filled corneocytes (Fuchs 2007). Epidermis renewal is allowed by the desquamation process, which corresponds to the continual shedding of the most superficial corneocytes through the degradation of cell-cell adhesion structures, called corneodesmosomes (Madison 2003). As the epidermis is the most external organ of the human body, its function is to provide a protective barrier against water loss from the inside, microbe and allergen penetration from the outside. This protective barrier is conferred by two important structures of the SC, the extracellular lipid lamellae, and the cornified envelope of the corneocytes (Candi et al. 2005). Important biochemical and morphological changes occur at the GR – SC interface leading to the formation of an effective skin barrier (cornification process).

III Netherton syndrome (NS) is an autosomal recessive skin disorder characterized by a nonbullous congenital ichthyosiform erythroderma, a specific hair shaft defect (trichorrhexis invaginata), and atopic manifestations (Comel 1949;

Netherton 1958; Traupe 1989). NS infants typically present at birth with generalized exfoliative erythema which persists throughout life in the most severe cases or gradually evolves into a milder condition known as ichthyosis linearis circumflexa. A broad range of atopic manifestations can affect NS patients, including atopic dermatitis, allergic rhinitis, asthma, hay fever, and food allergy. These manifestations are constantly accompanied by a high IgE serum concentration. Bacterial infection, hypernatremic dehydration and nutritional defects (malabsoption, diarrhea) are frequent complications observed in NS patients. Histologically, NS skin shows epidermal hyperplasia (acanthosis) with persistence of nuclei in the SC

(parakeratosis). The SC is thick (hyperkeratosis) but is often detached from the underlying epidermis. Moreover, a reduction or absence of the granular layer

(agranulosis) is commonly observed (Hausser and Anton-Lamprecht 1996).

We previously identified SPINK5 (Serine Protease INhibitor Kazal type 5) as the defective gene of NS (Chavanas et al. 2000). All causative mutations described so far create premature termination codons, leading to the absence of expression of the SPINK5-encoded protein, LEKTI (Lympho-Epithelial Kazal-type related inhibitor)

(Chavanas et al. 2000; Bitoun et al. 2002). LEKTI is a serine protease inhibitor normally expressed in all pluristratified epithelia. In epidermis, LEKTI expression is restricted to the GR (Bitoun et al. 2003). We have previously demonstrated that

LEKTI is produced as a high molecular weight precursor, rapidly cleaved by furin into bioactive fragments that are secreted in the extracellular space between the granular layer and the stratum corneum (SC) (Ishida-Yamamoto et al. 2005; Tartaglia-Polcini et al. 2006; Deraison et al. 2007). We showed that these bioactive LEKTI fragments inhibit three major proteases involved in the desquamation process, kallikreins (KLK)

5, 7 and 14 (Deraison et al. 2007). Our study revealed that the pH-dependency of

IV LEKTI and KLK interaction finely controls the release of active KLKs at the acidic surface of SC, resulting in the detachment of the most superficial corneocytes

(Deraison et al. 2007).

We have generated an animal model of NS in which Spink5 gene has been invalidated by homologous recombination (Descargues et al. 2005). Spink5-/- mice mimic key features of NS, including altered desquamation, impaired keratinisation

(terminal differentiation), hair malformation and a skin barrier defect. Like in NS patients, we showed that Spink5 KO epidermis is characterized by deep SC detachment. Abnormal corneodesmosome cleavage occurred below the SC, due to lack of protease activity control by LEKTI. Specifically, we showed that desmoglein-1 was degraded due to hyperactivity of KLK5 (Stratum Corneum Tryptic Enzyme,

SCTE) and KLK7 (Stratum Corneum Chymotryptic Enzyme, SCCE) (Descargues et al. 2005). Furthermore, this study revealed a third, 28 kDa epidermal protease hyperactivated in the absence of LEKTI.

This work presents the tandem mass spectrometry identification of this proteinase as being pancreatic Elastase 2 (pancEla2), the expression of which had not been reported in the epidermis so far. We demonstrated expression of Elastase 2

(Ela2) in not only mouse but also human epidermis, and we show its hyperactivity in both Spink5-/- and NS epidermis. In order to investigate the role of Ela2 in vivo, we engineered conditional mEla2 transgenic mice overexpressing the transgene in the

GR (INV-Ela2 mice). Transgenic animals showed several skin abnormalities observed in NS patients or Spink5-/- mice, identifying Ela2 as a novel and major contributor to the development of the disease. INV-Ela2 mice showed impaired skin barrier function and revealed Ela2 as a new epidermal proteinase involved in cornification. This provides new insights into the molecular mechanisms of this key process of epidermal biology.

V MATERIAL AND METHODS

Construction and genotyping of Elastase 2 transgenic mice

This work was approved by the Commission de Génie Génétique (date, agreement number XXXX) and by the Local Ethical Committee (XXXX). All experiments were done in accordance with the relevant guidelines and regulations.

The involucrin promoter vector (pH3700-pL2), which also contained the first involucrin intron, an SV40 intron, a !-galactosidase gene, and an SV40 polyadenylation site, was a gift from Dr Carroll (Carroll and Taichman 1992). Mouse cDNA encoding Elastase 2 was amplified by RT-PCR as described in the following

RT-PCR section. A PCR allowed the introduction of 27 nucleotides that encode the

FLAG octopeptide epitope at the 3’end of the cDNA as well as NotI sites at each end.

The final sequence was confirmed by nucleotide sequencing. The !-galactosidase gene was removed from pH3700-pL2 and replaced with the mouse Ela2-FLAG cDNA. The transgene (containing the involucrin promoter and mouse Ela2-FLAG cDNA) was excised with SalI.

Transgenic mice were produced by injecting the transgene into the pronuclei of fertilized oocytes from (C57BL/6 x CBA) F1 mice. Injected oocytes were implanted in pseudopregnant females. Mouse tail DNA, extracted with High pure PCR template preparation kit (Roche) was used for PCR to establish genotypes. Forward primer

5’CAAATCAAAGAACTGCTCCTC3’ and reverse primer

5’GTCATCGTCATCCTTGTAATC3’ were used to differentiate transgenic animals

(942 bp) from wild-type (no signal).

Backcrossing to wild-type C57BL/6 was used to produce a transgenic line from the founder. Some INV-Ela2 mice had a lethal phenotype, the epidermis of which was studied in details.

VI Proteins, protease inhibitors and antibodies

SLPI and SKALP recombinant proteins were purchased from R&D and

Sigma-Aldrich, respectively. Recombinant KLK5 was purchased from R&D.

Recombinant KLK14 was obtained as previously described (Brattsand et al. 2005).

PNGase F was purchased from New England Biolabs. Protease inhibitors AEBSF,

Pepstatin, EDTA, E64 and leupeptin, were purchased from Sigma-Aldrich.

Purified human pancreatic Elastase 2 (active and proforms) was a gift from Dr

C. Largman (Largman et al. 1976). Anti-human pancreatic Elastase 2 rabbit polyclonal serum was kindly provided by Dr C. Largman (Largman et al. 1976;

Largman et al. 1980). A polyclonal rabbit anti-elastase 2 antibody specific to a peptide highly conserved between human and murine pancreatic Elastase 2 was produced by the custom production facility of Interchim (Montluçon, France). Purified primary antibodies were directed against Flag (Sigma-Aldrich); CD45 (BD

Biosciences-Pharmingen); Ki67 (Abcam), Keratin 6 (Abcam), Keratin 14 (Covance),

Keratin 10 (Covance); Involucrin (Santa Cruz), Filaggrin (Covance), and Loricrin

(Covance).

RT-PCR analysis

We isolated total RNA from mouse epidermis, dermis and pancreas as well as human epidermis using Rneasy kit (Qiagen). 1.5 to 5 µg RNA were reverse transcribed using the recommendations of the Superscript!first strand synthesis system. Forward primer 5’ACAGACGTCCAGGGACACAC3’ and reverse primer

5’GGGGACAGTGGCAGTAATGT3’ were specific to 5’UTR and 3’UTR of murine pancreatic elastase 2, respectively. Forward primers

5’TTACAGAACTCCCACGGACA3’ and reverse primers

5’CCCAGGGACTTCTTTTGGT3’ were specific to the 5’UTR and 3’UTR of human

ELA2. PCR was performed with GoTaq polymerase (Promega), using 1/10 cDNA as a matrix. The PCR program included 40 cycles of amplification, with annealing

VII temperature of 57°C. The amplified signal visualized on agarose gel was cloned into pGEMT-easy (Promega) and sequenced using Big Dye Terminator.

Forward primer 5’TTACCTTTCACGGTGCTCCTTG3’ and reverse primer

5’CTCCCAGTCAGTACGGCATTG3’ were specific to murine SLPI.

Purification of 28 kDa on sbTI affinity chromatography column and preparation for tandem mass spectrometry analysis

Twenty Spink5-/- newborn mice were euthanized soon after birth. Skin was removed and heated 30 minutes at 56 °C for epidermis / dermis separation. We crushed the epidermis in 1M acetic acid with Ultra-Turrax. After overnight extraction at 4°C, we lyophilized soluble proteins and resupended them in sterile water. After acetone precipitation, proteins were resuspended in a binding buffer composed of 50 mM Tris-Cl pH7.2, 0,1M NaCl and 10 mM CaCl2. Proteins (6 mg) were applied on

1.5 mL sbTI resin (Pierce) and left overnight at 4°C on a circular rotor for optimal binding. Then the resin was poured into a chromatography column, connected to a computer-monitored FPLC system. The unfixed protein fraction (flow through) was collected for analysis. The column was washed with the binding buffer until DO280 was zero. Elution buffer was obtained using a linear gradient between the binding buffer and a solution composed of 0.15 M acetic acid, 10 mM CaCl2. A 30 mL gradient allowed obtaining thirty 1mL-elution fractions.

Elution fractions 11 to 21, were pooled and concentrated on vivaspin20 MW

3Kda (Vivasciences) until a final volume of 20 µl. Then, the concentrated sample was loaded onto a precast 6% acrylamide gel (Euromedex). After a minimal penetration of proteins into the gel, migration was stopped and the gel was stained according to the recommendations of Silver stain kit (Amersham).

VIII Mass spectrometry analysis

Spot excision, in-gel protein digestion, and peptide extraction

Gel slices were excised, destained with 30 mM potassium and 100 mM sodium thiosulfate (1:1, v/v) for 10 min, rinsed with deionized water for 10 min and washed twice successively with 25 mM ammonium bicarbonate for 15 min and acetonitrile.

The gel pieces were dried in a speed-vacuum centrifuge and swollen in a sufficient covering volume (25!l) of modified trypsin (Promega, Madison, WI) solution (20 ng/!l in 50 mM NH4HCO3) for 15 min in an ice bath. After overnight digestion at 37 °C, three peptide extracts were performed for 15 min under shaking, once with 50 mM

NH4HCO3 and then twice with 5% formic acid in 50% acetonitrile, respectively. The peptide mixture was concentrated to 10 !L by vacuum centrifugation.

Tandem mass spectrometry (MS/MS) and protein identification

The tryptic digest was analyzed by on-line capillary HPLC (Dionex/LC

Peckings, USA) coupled to a nanospray Qq-Tof mass spectrometer (QSTAR Pulsar

XL, Applied Biosystems, Foster City, USA). Peptides were separated on a 75 mm ID x 15 cm C18 PepMap™ column after loading onto a 300 !m ID x 5mm PepMap C18 precolumn (Dionex/LC Packings, USA). The flow rate was set at 200 nL/min.

Peptides were eluted using a 0 to 50% linear gradient of solvent B in 50 min at a flow rate of 200 nl/min delivered by the Ultimate pump (solvent A was 0.2% formic acid in

5% acetonitrile and solvent B was 0.2% formic acid in 90% acetonitrile). The mass spectrometer was operated in positive ion mode at a 2.1 kV needle voltage. MS and

MS/MS data were continuously acquired in an information-dependent acquisition mode consisting of a 7s cycle time. Within each cycle, a MS spectrum was accumulated for 1s over the range m/z 300-2000 followed by three MS/MS acquisitions of 2s each on the three most abundant ions in the MS spectrum. A dynamic exclusion duration was employed to prevent repetitive selection of the same

IX ions within 30s. Collision energies were automatically adjusted according to the charge state and mass value of the precursor ions. Mascot (version 2.2.1) was used to automatically extract peak lists from Analyst QS .wiff files. For creation of the peak lists, the default charge state was set to 2+, 3+, and 4+. MS and MS/MS centroid parameters were set to 50% height percentage and a merge distance of 0.1 amu. All peaks in MS/MS spectra were conserved (threshold intensity set to 0% of highest peak). For MS/MS grouping, the following averaging parameters were selected: spectra with fewer than five peaks or precursor ions with less than 5 cps or more than

10,000 cps were rejected, the precursor mass tolerance for grouping was set to 0.1

Da, the maximum number of cycles per group was set to 10, and the minimum number of cycles per group was set to 1. MS/MS data were searched against mammals sequences in the public database UniProt version 11.0, which consists of

Swiss-Prot Protein Knowledgebase Release 53.0 and TrEMBL Protein Database

Release 36.0 (233 563 entries), using the Mascot search engine (Mascot Daemon, version 2.2; Matrix Science, London, UK). Up to two trypsin missed cleavages were allowed and the mass tolerance for peptide and MS/MS fragment ions was 0.5 Da.

Cysteine carbamidomethylation was set as fixe modification, methionine oxidation were set as variable modification. The identification was confirmed by manual interpretation of corresponding MS/MS data.

Immunohistochemical analysis

Frozen skin sections from wild-type or Spink5-/- mice were fixed for 10 minutes in 100% acetone. Anti-human Elastase 2 rabbit polyclonal serum (gift from

Largman) was diluted 1/200. For signal amplification, secondary goat anti-rabbit antibody (1/200) and tertiary rabbit anti-goat antibody (1/200) were used. We detected a specific signal using Dako EnVision System, HRP (DAB) kit. For all other immunostainings, paraffin-sections of skin were used. The anti-Elastase 2 antibody

X developed against a synthetic peptide was diluted 1/50. For commercially available primary antibodies, we followed the manufacturer’s recommendations.

Casein zymography

Epidermis from wild-type and Spink5-/- animals was crushed in 1M acetic acid solution with Ultra-turrax. After overnight extraction at 4°C, soluble proteins were lyophilized and resuspended in PBS. After acetone precipitation, proteins were assayed (Bradford, Bio-Rad) and 5 µg of soluble fractions were loaded onto casein co-polymerized with acrylamide gels (15% acrylamide, 0.05% !-casein, Sigma) for electrophoresis. Gels were washed with 2.5% Triton X-100 for 1 hour to remove

SDS, and incubated 24 hours at 37°C in a reaction buffer containing 50 mM Tris pH

8. Gels were stained with 1% Coomassie Brillant blue for 30 minutes. Areas of caseinolytic activity appeared as clear zones against a dark blue background. Each protease inhibitor AEBSF (1 mM), pepstatin (100 µM), EDTA (15 mM), E64 (1 mM) was added to the sample before electrophoresis (15 min on ice), and in the reaction buffer. PNGase F (New England Biolabs) treatment was performed at 37°C before zymography analysis, according to the manufacturer’s instructions.

In situ zymography

Frozen sections (5 mm thickness) were rinsed with a washing solution (2%

Tween 20 in deionized water) and incubated at 37°C overnight with 100 µl of

Fluorescein IsoThioCyanate (FITC)-conjugated elastin using the EnzChek" elastase

Assay kit (Invitrogen, Carlsbad, CA) in Tris-Cl 50 mM pH 8 in order to visualize elastolytic activity. All sections were rinsed with PBS solution and visualized with the inverted high-end microscope Axiovert 200 (Zeiss, UK) at an excitation wavelength of

485 nm and an emission wavelength of 530 nm for FITC. Frozen sections from WT and KO skin were photographed at equal exposure time. Images were captured and

XI analyzed with Metamorph Imaging system software, version 3.6 (Universal Imaging

Corporation, Downingtown, PA). SLPI (50 nM), SKALP (50 nM). The intensity of the fluorescence signals was coded as color gradient, ranging from 0 (dark) to 255

(white).

Proteinase activity and inhibitory assay

Elastolytic activity measurements from epidermal sample

All assays were done in 50 mM Tris-Cl pH8 containing leupeptin (500 µM),

E64 (10 µM) and EDTA (15 mM) to avoid possible contaminant trypsic-like, cystein proteinase and metalloproteinase activities. The epidermal proteins prepared as indicated in casein zymography section were used in a quantity range of 3 µg per assay. The elastolytic activity was initiated by adding the FITC-elastin (final concentration 12,5 µg/mL) from the EnzChek! elastase Assay kit (Invitrogen,

Carlsbad, CA) to reaction mixtures (final volume 200 µl). The released fluorescence from substrate degradation was measured by spectrofluorometry for 1 hour ("Exc=

505 nm, "Em= 515 nm). Elastolytic activity was calculated from the velocity plots.

Activation of pro-Ela2 by KLK5 and KLK14

The purified proform of human pancreatic elastase 2 (100 ng) was incubated with 33 ng or 10 ng purified KLK (ratio pro-Ela2/KLK = 3 or 10, respectively) in 50 mM Tris-Cl pH8 during 2 hours at room temperature. DQ# elastin (final concentration

12,5 µg/mL) was added (final volume 100 µL) and the release of fluorescence was followed for 1 hour. Elastolytic activity was reflected by the slope of the velocity plot.

Activation of pro-Ela2 by KLK was deduced from the following ratio (expressed as a x-fold activation) :

XII v(proEla2 + KLK) " v(KLK) v(proEla2) v(proEla2 + KLK) : Elastolytic activity of pro-Ela2 incubated with KLK v(KLK) : Basal elastolytic! activity of KLK v(proEla2) : Basal elastolytic activity of pro-Ela2

Inhibition tests

Varying concentrations of FITC-elastin was incubated with a fixed amount of purified human pancreatic elastase 2 (7 ng) in 50 mM Tris-Cl pH8 (final volume 100

µL). Initial velocities were measured by monitoring the fluorescence signal. Double reciprocal Lineweaver-Burk plots of 1/[V] versus 1/[S] were used to determine the affinity constant Km of elastase 2 for FITC-elastin.

Six separate mixtures of enzymes and inhibitors in various ratios were incubated for 5 min. The proteinase activity was initiated by adding the FITC-elastin and the activity of free enzyme was determined by monitoring the release fluorescence during 1 hour. Initial velocities were calculated and IC50 was calculated by plotting [V0/Vi]-1 versus [I]. To account for the effect of substrate Km on the inhibition constant, IC50 were converted to Ki using the formula (Morris et al. 2002):

IC50 Ki = [S] 1 + Km

Western-blotting

Epidermis was crushed in a protein extraction buffer (PEB) containing Tris-Cl

50mM pH8, 150mM NaCl, EDTA 5 mM pH8, 1% NP40, 1mM PMSF, 10 µg/mL leupeptine, 10 mg/mL pepstatinA, 1 mg/mL antipaïne with an Ultra-Turrax. Lysates were clarified from insoluble material by centrifugation at 13000 g, 4° C for 5 minutes.

Proteins were quantified by Bradford protein assay kit (Biorad Laboratories). Protein

XIII fractions were mixed with Laemmli buffer (Bio-Rad Laboratories, Hercules, CA), incubated for 5 min at 65°C and then separated by SDS-polyacrylamide gel electrophoresis. After migration, proteins were transferred to Hybond-C extra membranes (Amersham Pharmacia biotech, Buckinghamshire, UK). Following incubation with primary and secondary antibodies, enhanced chemiluminescence

(ECL) detection was performed as recommended by the manufacturer.

Oil red O staining

Frozen sections were fixed in formaldehyde 10% for 30 minutes. After washing with PBS solution, slides were covered by a solution containing 0.1 mg/mL oil red O and 15% isopropanol for 5 minutes. Slides were then washed with 30% isopropanol, water, and stained by hematoxylin before mounting in glycerine medium. Visualization of lipid by red staining was done under a light microscope.

Transmission electron microscopy

Tissue were fixed in 4% glutaraldehyde with 0.1 phosphate (Sorensen’s) buffer, pH 7.4 for 12 hours at 4°C. For transmission electron microscopy, fixed tissues were post-fixed for 1 hour at room temperature in 0.25 M saccharose with 0.5

M Sorensen’s buffer and 2% osmium. The samples were then dehydrated in a graded series of ethanol and embedded with Embed 812 kit (Electron Microscopy

Sciences, Hatfield, PA).

XIV RESULTS

Identification of a new epidermal proteinase which is hyperactive in Spink5- deficient epidermis

In our previous study about the functional characterization of Spink5-/- mice, we showed that three proteolytic activities were increased in the epidermis of KO mice compared to WT. Two of these activities could be identified as KLK5 and KLK7

(Descargues et al. 2005). However, the third proteolytic activity, migrating at a 28 kDa apparent molecular weight on casein zymography, remained unidentified so far.

In an attempt to characterize this 28 kDa activity on casein zymography, a panel of inhibitors were used. This activity could not be inhibited by AEBSF, E64, pepstatin or

EDTA, indicating that it did not behave as a typical serine, cysteine, aspartate or metalloprotease, respectively (Figure 1A).

In order to determine the optimal pH for the 28 kDa activity, casein zymography was performed at pH 4, pH 5.5, pH 7 and pH 8 (Figure 1B). Zymograms revealed the highest activity at pH 7, suggesting that the 28 kDa did not correspond to cysteine or aspartate protease, whose optimal pH is acidic. Instead, the 28 kDa protease was more likely to be a serine or metalloprotease, as their optimal pH is neutral.

In order to definitely identify this unknown protease, we used a strategy combining enrichment and direct identification by tandem mass spectrometry. The 28 kDa protease was enriched from an acetic acid-extracted epidermal fraction using affinity chromatography with a large-scale protease inhibitor, sbTI (soybean Trypsin

Inhibitor) as a ligand. The different fractions from epidermal were analysed by casein zymography for detection of the 28 kDa activity (Figure 1C). The total fraction showed the presence of the 28 kDa and KLK7, the two major caseinolytic activities of the murine epidermal extract. In the flow-through and washing fractions, absence of

XV the 28 kDa activity was concordant with its retention to the affinity column. The 28 kDa proteinase – containing fractions were submitted to mass spectrometry analysis. This revealed the presence of three high-confident peptides belonging to pancreatic elastase 2 (Ela2), corresponding to a 8% sequence coverage. (Figure

2A).

Pancreatic Elastase 2 was not known to be expressed in the epidermis. In the pancreas, the murine pancreatic Elastase 2 (GenBank accession number

NM007919) is expressed as a preproenzyme of 271 amino acids, including a signal peptide and an activation peptide of 16 and 14 residues, respectively. We next investigated the expression of epidermal Elastase 2 (Ela2) at the transcriptional level.

RT-PCR was performed from murine epidermal, dermal and pancreatic RNA.

Primers specific to the 5’UTR and 3’UTR of murine pancEla2 allowed the amplification of a 863 pb-band in the control pancreatic sample (Figure 2B). A single band of similar molecular weight was amplified from the epidermis, whereas no signal was detected in the dermis. Sequencing of the epidermal amplicon revealed

100% homology with pancEla2 full-length transcript. This analysis revealed that in the skin, only epidermal cells express Ela2. Moreover, it revealed that in the epidermis, like in the pancreas, the elastase 2 gene is transcribed into a single transcript corresponding to the full-length exonic sequence.

It has been shown that pancreatic Ela2 is devoid of glycosylation (Ohlsson and Olsson 1976). In order to test whether epidermal Ela2 was also unglycosylated, murine epidermal extracts were incubated in the presence of PNGase F (Figure 2C).

Zymography analysis revealed a caseinolytic activity 3 kDa lower in the PNGase- treated extract (25 kDa), but with a similar intensity compared to the untreated sample. This result reveals that Ela2 is N-glycosylated. However, the presence of sugars is not essential for the proteolytic activity of Ela2 on casein zymography. The predicted size of active Ela2 (25 kDa) is concordant with the 25 kDa apparent molecular weight of the unglycosylated Ela2 on zymography. Therefore, epidermal

XVI Ela2 differs from its pancreatic counterpart by the presence of sugars whose localisation and function remain to be elucidated.

Ela2 is hyperactive but not overexpressed in the granular layer and stratum corneum of Spink5-/- epidermis

In order to assess the localization of Ela2 in the epidermis, frozen skin sections from WT and KO newborns were immunostained with anti pancEla2 antibodies (Figure 3A). Ela2 was detected in the granular layer (GR) and the stratum corneum (SC) in both WT and KO animals. The staining was similar in intensity, suggesting similar expression level. In KO epidermis, Ela2 was also extended to the upper spinous layer, indicative of a premature expression of Ela2, as we previously described for KLK5 and KLK7 in Spink5 knockout mice (Descargues et al. 2005).

Ela2 belongs to the elastase family, a group of proteases defined by their ability to release soluble peptides from insoluble elastin filaments by a proteolytic process called elastolysis. Therefore, in order to detect Ela2 activity in situ, frozen skin sections from WT and KO epidermis were incubated with FITC-elastin (Figure

3B). Elastolytic activity was detected in the GR as well as in the SC of WT mouse epidermis, concordant with Ela2 immunolocalization. Elastolytic activity was strongly increased in the epidermis of KO animals and the localization of fluorescent signal extended to the outermost layer of the spinous layer.

A time-course analysis with FITC-elastin revealed a 5.3-fold increase in elastolytic activity from KO epidermal extracts compared to WT samples (Figure 3C).

KLK5 and KLK7, the two hyperactivated kallikreins detected in Spink5-/- epidermis did not induce FITC-elastin degradation (data not shown), making Ela2 the main known protease responsible for the observed elastolytic activity in the absence of other elastase described in murine epidermis. Altogether, our results showed that Ela2 is hyperactivated but not overexpressed in Spink5-/- mouse epidermis and identify Ela2 as a new potential target of LEKTI.

XVII Elastase 2 is activated by KLK14, a target of LEKTI

We addressed the hypothesis of a direct inhibition of Ela2 by LEKTI domains

D1, D5, D6, D8-D11 and D9-D15, the inhibitory capacities of which have been documented (Deraison et al. 2007). Inhibition tests did not show any inhibition of Ela2 activity by LEKTI fragments (data not shown), suggesting the existence of an indirect inhibition mechanism.

Previous studies have shown that pancreatic pro-Elastase 2 must be cleaved after arginin residue 28 by pancreatic trypsin in order to be active (Largman et al.

1980). In the epidermis, KLK5 and KLK14 are major trypsin-like enzymes expressed in the GR and involved in the desquamation process (Ekholm et al. 2000; Komatsu et al. 2003; Brattsand et al. 2005). Moreover, we and other have shown that LEKTI fragments are potent inhibitors of KLK5 and KLK14 (Egelrud et al. 2005; Schechter et al. 2005; Borgono et al. 2007; Deraison et al. 2007). Consequently, we tested the possible activation of pro-Ela2 into active Ela2 by KLK5 and KLK14. As shown in

Figure 4, pro-Ela2 was activated by KLK14, but not by KLK5. This result, together with the localisation of both partners in the GR, highly suggests that LEKTI indirectly inhibits Ela2 activity trough modulating the activity of KLK14, the enzyme involved in the activation step of epidermal pro-Ela2 into its active form.

INV-Ela2 transgenic mice display skin abnormalities with an impaired proliferation / differentiation program

In order to investigate the role of Ela2 in vivo, we generated transgenic mice overexpressing Ela2 under the control of the human involucrin promoter, to target the suprabasal layers of murine epidermis. For this, the murine Ela2 cDNA was fused to the Flag tag by PCR, and cloned downstream of regulatory sequences of human involucrin promoter described previously (Carroll et al. 1993) (Figure 5A). PCR- genotyping allowed a specific amplification of the transgene (942 bp-band) whereas

XVIII no amplification was detectable in the non-transgenic littermates, clearly differentiating transgenic (INV-Ela2) from wild-type animals (figure 5B). Western blot analysis confirmed expression of pro- and active forms of Ela2-FLAG in the epidermis, but not in dermis, of INV-Ela2 animal (Figure 5C).

We obtained two categories of transgenic animals: the less severely affected

(mild phenotype INV-Ela2) could live whereas the most affected (severe phenotype

INV-Ela2) did not survive at birth. The living Inv-Ela2 animals were indistinguishable from the WT at birth. Few days after, they developed a generalized scaling skin phenotype ( Figure 5D). At post-natal day 6, INV-Ela2 skin was covered by fine superficial scales all over the body surface and presented a delay of hair growth. At day 8, alternating regions of hair and thick scales lead to a striped appearance of the

INV-Ela2 skin. Surprisingly, in the following days, we could notice a progressive spontaneous regression of scales, concomitantly with hair growth. Afterwards, the mouse develops normally without any phenotyical abnormality at the macroscopic level.

Figure 5E shows the most severely affected INV-Ela2 mouse, which was found dead at birth. A generalized erythema was observed, more pronounced on the head. The skin was shiny and showed superficial scaling. Histological analysis of

INV-Ela2 epidermis showed a marked acanthosis, a detached compact and thick SC

(hyperkeratosis), which was mainly orthokeratotic (anucleated corneocytes) (Figure

5D, c-d). The GR was reduced to completely absent in some regions. Dilated capillaries in the dermis revealed the presence of an inflammatory infiltrate, which was prominent in the subcorneal region of epidermis. The immunostaining of CD45, a large-scale marker of leucocytes confirmed the histological findings and shows that accumulation of inflammatory cells co-localized with SC detachment (Figure 5E, e).

This inflammatory infiltrate was rich in neutrophiles as shown by the specific granules observed in electron microscopy (Figure 5E, f). To investigate a possible infection as a cause of neutrophile migration in the epidermis, Gram and PAS stainings were

XIX performed and confirmed the absence of bacteria and fungi in the transgenic skin

(data not shown).

The immunodetection of Flag revealed high and patchy expression of ectopic

Ela2 in the suprabasal layers of the epidermis (Figure 5E, g-h). In situ elastolytic activity detected by degradation of FITC-elastin was increased in the transgenic animal compared to the WT, and correlated with localisation of the transgene (Figure

5D).

Histological examination revealed the presence of acanthosis in the severely affected INV-Ela2 epidermis (Figure 5D, c-d). Because acanthosis might result from increased proliferation of the basal keratinocytes, we next investigated by immunohistochemistry whether the proliferation / differentiation program was disturbed in INV-Ela2 transgenic mice (Figure 6). The nuclear proliferation marker

Ki67 was expressed by a small number of basal cells in WT epidermis. In contrast, a high number of basal cells and some suprabasal keratinocytes were stained in INV-

Ela2 epidermis. The hyperproliferation marker keratin 6 (K6), normally absent in normal epidermis, was markedly expressed in the suprabasal layers of INV-Ela2 animals. These results indicated a hyperproliferative epidermis in the INV-Ela2 animals.

We next investigated the effects of Ela2 overexpression on the expression of the differentiation markers keratin 14 (K14) and Keratin 10 (K10). K14, normally restricted to the basal layer, was abnormally extended to the suprabasal compartment of the INV-Ela2 epidermis. The staining of the suprabasal K10 was reduced in intensity in INV-Ela2 epidermis and was absent in some area. Expression of the cornified envelope precursors involucrin, loricrin and filaggrin was then studied in WT and INV-Ela2 epidermis. Involucrin, which is normally expressed from the late spinous layers, was observed as a faint signal in a higher number of cell layers in

INV-Ela2 epidermis compared to WT, consistently with acanthosis. Expression of loricrin was decreased in intensity and was absent focally. Finally, filaggrin, a filament

XX aggregating protein, which is a major constituent of the keratohyalin granules of the granular layer, was markedly reduced in transgenic epidermis. Altogether, this study indicates an abnormal differentiation pattern in transgenic epidermis.

INV-Ela2 transgenic mice display skin barrier defect due to impaired barrier formation

We have previously shown that Spink5-/- mice died shortly after birth because of severe dysfunction of skin barrier (Descargues et al. 2005). Skin barrier anomaly is also a major feature of NS skin. We therefore investigated whether Ela2 overactivity could result in skin permeability defect. To address this question, we tested the ability of skin to prevent fluid loss by measuring trans-epidermal water loss (TEWL) in the progenies of the INV-Ela2 founder. In parallel, we monitored body weight since skin barrier dysfunction generally correlates with a decreased body weight (Figure 7).

TEWL and body weights measurements were performed each day from post-natal days 4 to 11. During this period, TEWL was up to 3.2 times higher in transgenic animals than in control littermates, while their body weight was significantly lower

(down to 31%). From day 8, after hair started to grow, TEWL values of transgenic mice returned to normal. Following barrier reestablishment, the transgenic animals grew normally although their body weight remained lower than WT. These data indicate a perfect time-correlation between the degree of phenotype severity and the skin barrier loss of the living INV-Ela2 animals.

Because of the rapid death of the severely affected INV-Ela2 mice, it was not possible to evaluate their skin barrier defect by TEWL. However, observation of their epidermis under electron microscopy allowed investigating the consequences of Ela2 ectopic expression on epidermis ultrastructure. An important mechanism underlying the formation of an efficient skin barrier relies on the exocytosis of specialized vesicles named lamellar bodies (LBs) at the interface between the GR and the SC.

Secreted lipid precursors are then processed into mature lipids, which spatially

XXI arrange into lipid bilayers called lamellae. Lamellae fill the whole extracellular space of the SC until the uppermost layers (Swartzendruber et al. 1989).

TEM examination of the epidermis from INV-ela2 mice showed marked abnormalities in the keratinisation process (Figure 7B). The SC was compact and hyperkeratosic. In the major part of the skin section, no keratohyalin granule was seen, a feature which correlates with the reduction of the granular layer observed in histological examination. As reported for NS patients, and in a lesser extent in

Spink5-/- mice, the INV-Ela2 SC was full of intracellular electron-lucent vacuoles, which correspond to lipid droplets (Figure 7B,c). Secretion of LBs was visible in the

WT animal but absent in INV-Ela2 epidermis (Figure 7B,d-e). Finally, a marked spongiosis was observed in the lower epidermis, concordant with the presence of the inflammatory infiltrate (Figure 7B,f-g).

The lipid nature of the vacuoles observed in the SC of INV-Ela2 by TEM was confirmed by oil red O staining (Figure 7C, a-b). In WT animals, oil red O clearly outlines the lipid boundaries of the corneocytes, allowing the discernment of the lipid lamellae structure. In contrast, the INV-Ela2 SC showed only few aligned red lines most superficially, suggesting that a limited number of lipid lamellae structure had formed. This was consistent with the observation of red intracellular lipid vesicles, which persist throughout the whole layers of SC. Similarly, in the grafted Spink5-/- animals, but not in newborns, intracellular lipid vesicles and no extracellular lamellae could be observed (Figure 7D, c-f). Interestingly, NS patient skin displayed similar anomalies (Figure 7D, g-h). Our result suggests that the lipid lamellae defect is a feature of the adult Spink5-/- skin as well as NS skin consequently to Ela2 hyperactivity in the epidermis.

XXII Elastase 2 overexpression activates SLPI expression, a major mediator of skin innate immunity

As LEKTI was unable to inhibit Ela2, we investigated Ela2 physiological inhibitor(s). Pancreatic Ela2 is physiologically inhibited by !1-antitrypsin or !2- macroglobulin in human blood circulation (Laurent and Bieth 1989). These systemic inhibitors cannot be considered as physiological epidermal Ela2 inhibitors since they are not expressed in the skin. In contrast, two elastase inhibitors are expressed at low level in the GR of human epidermis in normal conditions, SLPI (Secretory

Leucocyte Protease Inhibitor) and SKALP/elafin (Skin-derived antileukoproteinase).

Inhibitory capacity of these two inhibitors towards Ela2 was evaluated by in vitro inhibition tests. As illustrated in Figure 8A, both SLPI and SKALP displayed high inhibitory capacity for Ela2 as shown by their inhibition constants (Ki). The inhibitory constant of SLPI (Ki = 29.9 nM) is higher than the one of SKALP (Ki = 14.3 nM) indicating that SKALP inhibits Ela2 more efficiently than SLPI does.

The ability of SLPI and SKALP to inhibit native epidermal Ela2 was subsequently assessed by in situ zymography on skin cryosections from WT and transgenic animals. Figure 8B shows an increased elastolytic activity in the INV-Ela2 epidermis compared to WT. Addition of 50 nM SLPI resulted in a slight decrease of elastolytic activity in WT skin and INV-Ela2 epidermis. Elastolytic activity from WT and INV-Ela2 epidermis was strikingly reduced by the presence of 50 nM SKLAP.

The inhibition strength of SLPI and SKALP towards native Ela2 was well correlated with the Ki values determined in vitro for each inhibitor. On the basis of these results, these two inhibitors appear as potential physiological inhibitors of Ela2 activity in the epidermis.

In addition to their inhibitory capacity which were historically first identified,

SLPI and SKALP display antimicrobial properties, which make them two major actors of epidermal innate immunity. SKALP has not been described in mouse in contrast to

SLPI, which has been characterized in both human and mouse epidermis. It is

XXIII believed that SLPI is induced by inflammatory stimuli as TNF! and IL-1, but also by

-11 neutrophile elastase, which represents its major physiological target (Ki = 10 M)

(Sallenave et al. 1994). We investigated whether, like neutrophile elastase, Ela2 could activate the expression of its own inhibitor SLPI. Two progenies of the INV-

Ela2 founder were sacrificed either at birth or at post-natal day 10 for RT-PCR analysis of the skin. RT-PCR results showed that SLPI is expressed at low level in the skin of WT newborn and 10-day old animals. In INV-Ela2 skin, SLPI expression was markedly increased in both animals (Figure 8C). These results show that Ela2 overexpression induces the expression of SLPI at a very early stage, before any sign of skin barrier dysfunction.

Elastase 2 is expressed in human epidermis and is hyperactive in NS patients

The human pancreatic elastase 2 homologs exist in two isoforms ELA2A and

ELA2B. In order to investigate ELA2 expression in human epidermis, RT-PCR was performed from human epidermal RNA (Figure 9A). Primers specific for the 5’UTR and 3’UTR of human ELA2 (common to ELA2A and ELA2B) allowed the amplification of a 913 pb band. The PCR product was subsequently cloned and six clones were sequenced, all of which contained the ELA2A transcript, confirming that this ELA2 isoform was expressed at the transcriptional level in human epidermis.

Immunohistochemistry using the anti-Ela2 antibody stained the GR of normal human epidermis (Figure 9B). In NS skin, ELA2A was detected in a higher number of cell layers, consistent with acanthosis of the epidermis. In NS skin, the staining was intracellular and intense at the periphery of the keratinocytes. No difference in staining intensity could be observed, indicating a similar expression of ELA2A between normal and NS epidermis, as observed in the Spink5-/- murine model.

In order to detect ELA2A activity, frozen skin sections from normal and NS patients were analysed by in situ zymography (Figure 9C). Elastolytic activity was

XXIV detected in the GR of normal epidermis. In NS section, elastolytic activity was strongly enhanced and extended to the suprabasal compartment.

Therefore, like in Spink5-deficient mouse epidermis, the lack of LEKTI in NS patients leads to elastolytic hyperactivity. The identification of hyperactive Ela2 in

Spink5-/- mice highly suggests a similar pathomechanism in human, by which the increased elastolytic activity in the GR of NS epidermis is due to ELA2A hyperactivity in the absence of LEKTI.

XXV DISCUSSION

Netherton syndrome is a severe skin disease caused by a lack of control of specific epidermal serine proteases in the absence of LEKTI. KLK5 and KLK7 are two of these hyperactivated proteases that contribute to an accelerated shedding of the stratum corneum through premature desmosomal degradation (Descargues et al.

2005). Here we report the unambiguous identification by tandem mass spectrometry of a novel epidermal serine protease, pancreatic elastase 2 (Ela2), which is hyperactivated in Spink5-/- mice. In 1987, Kawashima and co-workers studied tissue- specific expression of Elastase 2 in several human samples: blot hybridization analysis showed no expression of Elastase 2 in the kidney, heart, liver, aortic intima, spleen and peripheral blood lymphocytes, whereas a strong signal could be detected in the pancreas (Kawashima et al. 1987). However, skin was not included in this study. Furthermore, a difficulty with regard to proteases is their very low expression level, which does not reflect the level of proteolytic activity. The high number of PCR cycles necessary to amplify the cDNA of Ela2 from the epidermis is in favour of such a low basal expression level of Ela2 in this tissue. This is concordant with the absence of Ela2 in keratinocyte libraries, and in transcriptomic analysis of the granular layer (Toulza et al. 2007).

Here, we could demonstrate Ela2 expression and activity in the GR and the

SC of murine and human epidermis, this localization being consistent with a possible control of Ela2 by LEKTI. However, we could not detect any inhibitory activity of

LEKTI domains against Ela2, suggesting that Ela2 might not be a direct target of

LEKTI. This is concordant with the ineffectiveness of elastase-type inhibition by

LEKTI physiological domains (Deraison et al. 2007). We showed that KLK14 was able to activate pro-Ela2 into active Ela2. Since LEKTI is a potent inhibitor of KLK14, it could indirectly regulate the activity of Ela2 though modulating the activation of pro-

XXVI Ela2 into its active form by KLK14. In contrast to LEKTI, direct inhibition of Ela2 by

SLPI and SKALP could be demonstrated. These two low molecular weight proteins exhibit protease inhibitory properties as well as antimicrobial peptides. Their expression is low in normal keratinocytes but markedly induced upon inflammatory conditions like wound healing and psoriasis (Alkemade et al. 1994; Wingens et al.

1998; Nakane et al. 2002). They constitute a first line of skin defence mechanism against the destructive effect of leucocyte proteases, mainly neutrophile elastase.

Our study extends the number of SLPI and SKALP targets to Ela2, with a higher inhibitory capacity of SKALP compared to SLPI. Recently, !-2 macroglobulin-like has been identified in the human skin and could be another potential Ela2 inhibitor since

!-2 macroglobulin inhibits pancEla2 in the blood circulation (Laurent and Bieth 1989;

Galliano et al. 2006).

In order to gain insight in the biological role of Ela2 in the epidermis, and to evaluate its contribution to the pathophysiology of NS, we have engineered a transgenic INV-Ela2 mouse model using the human involucrin promoter backbone

(Carroll et al. 1993). The living INV-Ela2 mice showed a transient scaling phenotype, correlated with an increased TEWL and a delayed body weight intake. The reasons for phenotypical improvement of the living transgenic animals are currently unknown.

It is likely that skin improvement might be enhanced by hair growth-mediating deposition of sebum lipid at the surface of the skin. Preliminary results suggest that decreased quantity of filaggrin in the epidermis (due to decreased expression or overdegradation) could account for the transient barrier defect of INV-Ela2 animals.

Analysis of the severely affected INV-Ela2 mice which died at birth provides evidence that ectopic expression of Ela2 in murine epidermis has major consequences on the proliferation / differentiation program of epidermis.

Interestingly, the suprabasal layers of Spink5-/- newborn epidermis also express the hyperproliferation marker keratin 6 (manuscript in prep). Epidermal hyperproliferation is a general compensatory mechanism to impaired skin barrier function. However,

XXVII this mechanism is normally not observed as early as in newborns with lethal skin barrier defect, as shown in the klf4 knockout newborns (Segre et al. 1999). This observation, together with our results, highly suggests a direct involvement of Ela2 in epidermal hyperproliferation in INV-Ela2 and possibly in Spink5-/- animals and NS patients, through a signal transduction from the granular to basal layer.

A high number of ichthyosis involves lipid abnormalities. In atopic dermatitis, a major clinical feature of Netherton syndrome, it has been shown that an impaired

LB-extruding mechanism was partly responsible for the deficient water permeability barrier (Fartasch and Diepgen 1992). Here we report the persistence of intracellular

LB and the absence of lamellae formation in the most severely affected INV-Ela2 mice, as well as in Spink5-grafted skin and also in NS patients.

Oil red O staining revealed the formation of lipid lamellae in newborn Spink5-/-

SC. However, at the ultrastructural level, we have previously described small intracorneocyte lipid droplets. These could account for the intrinsic barrier defect reported for Spink5-/- newborns (Descargues et al. 2005). This suggests that the lipid secretion defect is minimal but already detectable in Spink5-/- newborns, and becomes prominent in adult knockout skin, leading to the severe skin barrier defect of adult Spink5-deficient epidermis. In INV-Ela2 epidermis, the level of elastolytic activity was higher compared to the one in Spink5-/- mice. This could explain why the lipid secretion defect is already major in INV-Ela2 newborn epidermis. These results highly support the hypothesis that Ela2 hyperactivity could prevent the formation of the protective skin barrier in NS through impeded LB secretion. The mechanisms of

LB secretion are not well understood, but proteases seem to play a role in controlling this process since the application of serine protease inhibitors after barrier disruption improves barrier recovery through enhanced LB secretion. Interestingly, this includes

PMSF, which displays inhibitory capacity toward Elastase 2 (Hachem et al. 2006).

Whereas there was no evidence for skin detachment due to premature corneodesmosome cleavage in INV-Ela2 epidermis, we could observe SC

XXVIII detachment associated with the subcorneal accumulation of a neutrophile-rich inflammatory infiltrates. The histology of this inflammatory infiltrate was highly reminiscent of the Munro micro-abscesses, characteristic of psoriasic lesions.

Interestingly, such micro-abscesses have also been reported in a number of NS patients (Altman and Stroud 1969; Traupe 1989; Hausser and Anton-Lamprecht

1996; De Felipe et al. 1997). Our results are in agreement with a possible role of

Ela2 in the initiation of epidermal inflammation in NS. Several studies have pointed the role of Interleukine 1! (IL-1!) in the pro-inflammatory responses including neutrophile accumulation and degranulation (Dinarello 1988). To reach full activity, pro-IL-1! must undergo a proteolytic cleavage. In vitro studies have shown that cathepsin G and neutrophile elastase were able to activate IL-1! (Hazuda et al.

1990). It is thus possible that Ela2 is able to activate IL-1! produced by keratinocytes, resulting in the accumulation of neutrophiles and other IL-1!- chemoattracted inflammatory cells in the uppermost layers of epidermis. In addition to the probable decreased cohesiveness of keratinocytes surrounded by inflammatory cells, proteases released at the site of inflammation could participate in the degradation of cell-cell adhesion structures. Interestingly, some similar histological traits could be observed between INV-Ela2 epidermis and psoriasic skin section, including hyperproliferation, subcorneal inflammation and detachment of hypercompact and hyperkeratosic SC. Altogether, the subcorneal inflammatory infiltrate could have an important contribution to the SC detachment observed in INV-

Ela2 epidermis and in enflamed NS skin.

Recently, it has been shown that NS patient skin exhibited a high expression of anti-microbial peptides such as SKALP and !-defensin 2 in response to skin inflammation and infection (Raghunath et al. 2004; Shimomura et al. 2005). In human, SKALP represents a potential physiological inhibitor of ELA2A since its inhibitory capacity is as good as the one for its target human proteinase 3 (Ki = 9,5

XXIX nM). Therefore, in NS skin, SKALP overexpression could play a role in inhibiting

ELA2A hyperactivity in addition to its known target inflammatory proteases. The murine ortholog protein to human SKALP has not been identified yet. In contrast,

SLPI is an anti-microbial peptide described in both humans and mice. We showed that SLPI is rapidly over-expressed in the skin of INV-Ela2, before any barrier defect could be detected. In INV-Ela2 newborn, the induction of SLPI expression could represent an early negative feedback loop aiming at inhibiting Ela2 hyperactivity.

Nevertheless, this is not sufficient to prevent the subsequent impairment of the skin barrier during the critical hairless period. As SLPI is still overexpressed at day 10, it could participate to the phenotypical reversion.

PancEla2 is produced in the pancreas and secreted in the intestinal tract, where it plays an important role in food digestion (Jakobsson et al. 1983). As LEKTI is expressed in a variety of tissues and some domains have been found in the blood circulation, it is possible that LEKTI exerts its anti-proteolytic activity at distance from the skin and could regulate extra-epidermal serine proteinase involved in the activation step of pro-Ela2. Thus, Ela2 hyperactivity in extra-epidermal compartments could explain several of the complications observed in NS. It is possible that the severe malabsorption and maldigestion problems often reported in NS patients could be the result of a lack of Ela2 inhibition in the intestinal tract (Pradeaux et al. 1991;

Judge et al. 1994). In addition, Ela2 hyperactivity is known to participate in the destruction of elastin fibres of intra-pancreatic vessel walls during acute pancreatitis

(Geokas 1968; Borgstrom et al. 1980). The occurrence of unexplained acute pancreatitis in a young girl affected by NS suggests a possible lack of control of Ela2 activity in the pancreas of this patient (Soreide et al. 2005).

To conclude, we have shown that Ela2 hyperactivity promotes a number of abnormalities which are similar to Spink5-/- newborns, Spink5-/- grafts, or NS patients.

This includes a defective barrier function, epidermal hyperproliferation, impaired terminal differentiation, intracorneocyte lamellar body retention, subcorneal

XXX inflammatory infiltrate and activation of the cutaneous innate immunity. These observations strongly confirm the contribution of Ela2 in several aspects of NS pathophysiology. We believe that the identification of epidermal Elastase 2 is of the highest interest to understand the mechanisms involved in the formation of the skin barrier. Furthermore, our work identifies a new potential therapeutic target for NS patients, as well as other skin diseases in which this enzyme could be involved.

XXXI Acknowledgements

We are indebted to Dr Largman for providing us with the anti-pancElastase2 antibody and the purified human pancreatic Elastase 2. We are grateful to Julia Segre for providing us with the pH3700-pL2 vector. We thank Michel Baron for technical assistance during the purification procedure, Sophie Allart from the imagery platform

(INSERM, Institut Claude de Préval, IFR30, Imagerie cellulaire, Toulouse, F-31300

France). We are indebted to Anne Huchenq-Champagne and Sylvie Appolinaire-

Pilipenko for their help and deep involvement in the generation of transgenic animals

(INSERM, Institut Claude de Préval, IFR30, Plateau technique de transgenèse et cryopréservation, Toulouse, F-31300 France). We thank Florence Capilla from the experimental histopathology platform of IFR30 (Génopole Toulouse Midi-Pyrénées) for technical assistance (INSERM, Institut Claude de Préval, IFR30, Histopathologie expérimentale, Toulouse, F-31300 France). We are grateful to Isabelle Fourquaux and Nacer Benmeradi from electron microscopy platform, IFR31, Toulouse. This work was supported by grants from the national agency for research (ANR maladies rares), the French Ministry of Research and Technology, the French Foundation for

Medical Research (FRM), the European centre of skin and epithelia research

(CERPER, Toulouse) and the European Geneskin coordination action project.

XXXII References

Alkemade JA, Molhuizen HO, Ponec M, Kempenaar JA, Zeeuwen PL, de Jongh GJ, van Vlijmen- Willems IM, van Erp PE, van de Kerkhof PC, Schalkwijk J (1994) SKALP/elafin is an inducible proteinase inhibitor in human epidermal keratinocytes. J Cell Sci 107 ( Pt 8):2335-42 Altman J, Stroud J (1969) Neterton's syndrome and ichthyosis linearis circumflexa. Arch Dermatol 100:550-8 Bitoun E, Chavanas S, Irvine AD, Lonie L, Bodemer C, Paradisi M, Hamel-Teillac D, Ansai S, Mitsuhashi Y, Taieb A, de Prost Y, Zambruno G, Harper JI, Hovnanian A (2002) Netherton syndrome: disease expression and spectrum of SPINK5 mutations in 21 families. J Invest Dermatol 118:352-61 Bitoun E, Micheloni A, Lamant L, Bonnart C, Tartaglia-Polcini A, Cobbold C, Al Saati T, Mariotti F, Mazereeuw-Hautier J, Boralevi F, Hohl D, Harper J, Bodemer C, D'Alessio M, Hovnanian A (2003) LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome. Hum Mol Genet 12:2417-30 Borgono CA, Michael IP, Komatsu N, Jayakumar A, Kapadia R, Clayman GL, Sotiropoulou G, Diamandis EP (2007) A potential role for multiple tissue kallikrein serine proteases in epidermal desquamation. J Biol Chem 282:3640-52 Borgstrom A, Kukora J, Ohlsson K (1980) Studies on immunoreactive pancreatic elastase 2 in human serum. Hoppe Seylers Z Physiol Chem 361:633-40 Brattsand M, Stefansson K, Lundh C, Haasum Y, Egelrud T (2005) A proteolytic cascade of kallikreins in the stratum corneum. J Invest Dermatol 124:198-203 Candi E, Schmidt R, Melino G (2005) The cornified envelope: a model of cell death in the skin. Nat Rev Mol Cell Biol 6:328-40 Carroll JM, Albers KM, Garlick JA, Harrington R, Taichman LB (1993) Tissue- and stratum-specific expression of the human involucrin promoter in transgenic mice. Proc Natl Acad Sci U S A 90:10270-4 Carroll JM, Taichman LB (1992) Characterization of the human involucrin promoter using a transient beta-galactosidase assay. J Cell Sci 103 ( Pt 4):925-30 Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M, Irvine AD, Bonafe JL, Wilkinson J, Taieb A, Barrandon Y, Harper JI, de Prost Y, Hovnanian A (2000) Mutations in SPINK5, encoding a serine protease inhibitor, cause netherton syndrome. Nat Genet. 25:141-2 Comel M (1949) Ichtyosis Linearis circumflexa. Dermatologica 98:133-136 De Felipe I, Vazquez-Doval FJ, Vicente J (1997) Comel-Netherton syndrome. A diagnostic challenge. Br J Dermatol 137:468-9 Deraison C, Bonnart C, Lopez F, Besson C, Robinson R, Jayakumar A, Wagberg F, Brattsand M, Hachem JP, Leonardsson G, Hovnanian A (2007) LEKTI Fragments Specifically Inhibit KLK5, KLK7, and KLK14 and Control Desquamation through a pH-dependent Interaction. Mol Biol Cell 18:3607-3619 Descargues P, Deraison C, Bonnart C, Kreft M, Kishibe M, Ishida-Yamamoto A, Elias P, Barrandon Y, Zambruno G, Sonnenberg A, Hovnanian A (2005) Spink5-deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease hyperactivity. Nat Genet 37:56-65 Dinarello CA (1988) Biology of interleukin 1. Faseb J 2:108-15 Egelrud T, Brattsand M, Kreutzmann P, Walden M, Vitzithum K, Marx UC, Forssmann WG, Magert HJ (2005) hK5 and hK7, two serine proteinases abundant in human skin, are inhibited by LEKTI domain 6. Br J Dermatol 153:1200-3 Ekholm IE, Brattsand M, Egelrud T (2000) Stratum corneum tryptic enzyme in normal epidermis: a missing link in the desquamation process? J Invest Dermatol 114:56-63 Fartasch M, Diepgen TL (1992) The barrier function in atopic dry skin. Disturbance of membrane- coating granule exocytosis and formation of epidermal lipids? Acta Derm Venereol Suppl (Stockh) 176:26-31 Fuchs E (2007) Scratching the surface of skin development. Nature 445:834-42 Galliano MF, Toulza E, Gallinaro H, Jonca N, Ishida-Yamamoto A, Serre G, Guerrin M (2006) A novel protease inhibitor of the alpha2-macroglobulin family expressed in the human epidermis. J Biol Chem 281:5780-9 Geokas MC (1968) The role of elastase in acute pancreatitis. II. Intrapancreatic elastolytic activity in trypsin-induced acute pancreatitis in dogs. Arch Pathol 86:127-34 Hachem JP, Houben E, Crumrine D, Man MQ, Schurer N, Roelandt T, Choi EH, Uchida Y, Brown BE, Feingold KR, Elias PM (2006) Serine protease signaling of epidermal permeability barrier homeostasis. J Invest Dermatol 126:2074-86 Hausser I, Anton-Lamprecht I (1996) Severe congenital generalized exfoliative erythroderma in newborns and infants: a possible sign of Netherton syndrome. Pediatr Dermatol 13:183-99 Hazuda DJ, Strickler J, Kueppers F, Simon PL, Young PR (1990) Processing of precursor interleukin 1 beta and inflammatory disease. J Biol Chem 265:6318-22

XXXIII Ishida-Yamamoto A, Deraison C, Bonnart C, Bitoun E, Robinson R, O'Brien TJ, Wakamatsu K, Ohtsubo S, Takahashi H, Hashimoto Y, Dopping-Hepenstal PJ, McGrath JA, Iizuka H, Richard G, Hovnanian A (2005) LEKTI is localized in lamellar granules, separated from KLK5 and KLK7, and is secreted in the extracellular spaces of the superficial stratum granulosum. J Invest Dermatol 124:360-6 Jakobsson I, Borulf S, Lindberg T, Benediktsson B (1983) Partial hydrolysis of cow's milk proteins by human trypsins and elastases in vitro. J Pediatr Gastroenterol Nutr 2:613-6 Judge MR, Morgan G, Harper JI (1994) A clinical and immunological study of Netherton's syndrome. Br J Dermatol 131:615-21. Kawashima I, Tani T, Shimoda K, Takiguchi Y (1987) Characterization of pancreatic elastase II cDNAs: two elastase II mRNAs are expressed in human pancreas. DNA 6:163-72 Komatsu N, Takata M, Otsuki N, Toyama T, Ohka R, Takehara K, Saijoh K (2003) Expression and localization of tissue kallikrein mRNAs in human epidermis and appendages. J Invest Dermatol 121:542-9 Largman C, Brodrick JW, Geokas MC (1976) Purification and characterization of two human pancreatic elastases. Biochemistry 15:2491-500 Largman C, Brodrick JW, Geokas MC, Johnson JH, Fassett M (1980) Demonstration of a pancreatic proelastase 2-alpha 1-protease inhibitor complex in normal human plasma. Am J Physiol 238:G177-82 Laurent P, Bieth JG (1989) Kinetics of the inhibition of free and elastin-bound human pancreatic elastase by alpha 1-proteinase inhibitor and alpha 2-macroglobulin. Biochim Biophys Acta 994:285-8 Madison KC (2003) Barrier function of the skin: "la raison d'etre" of the epidermis. J Invest Dermatol 121:231-41 Morris MT, Coppin A, Tomavo S, Carruthers VB (2002) Functional analysis of Toxoplasma gondii protease inhibitor 1. J Biol Chem 277:45259-66 Nakane H, Ishida-Yamamoto A, Takahashi H, Iizuka H (2002) Elafin, a secretory protein, is cross-linked into the cornified cell envelopes from the inside of psoriatic keratinocytes. J Invest Dermatol 119:50-5 Netherton EW (1958) A unique case of Trichorrexis Invaginata. Arch. Dermatol. 78:483-487 Ohlsson K, Olsson AS (1976) Purification and partial characterization of human pancreatic elastase. Hoppe Seylers Z Physiol Chem 357:1153-61 Pradeaux L, Olives JP, Bonafe JL, Le Tallec C, Pigeon P, Ghisolfi J (1991) [Digestive and nutritional manifestations of Netherton's syndrome]. Arch Fr Pediatr 48:95-8 Raghunath M, Tontsidou L, Oji V, Aufenvenne K, Schurmeyer-Horst F, Jayakumar A, Stander H, Smolle J, Clayman GL, Traupe H (2004) SPINK5 and Netherton syndrome: novel mutations, demonstration of missing LEKTI, and differential expression of transglutaminases. J Invest Dermatol 123:474-83 Sallenave JM, Shulmann J, Crossley J, Jordana M, Gauldie J (1994) Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/elafin) in human airway epithelial cells by cytokines and neutrophilic enzymes. Am J Respir Cell Mol Biol 11:733-41 Schechter NM, Choi EJ, Wang ZM, Hanakawa Y, Stanley JR, Kang Y, Clayman GL, Jayakumar A (2005) Inhibition of human kallikreins 5 and 7 by the serine protease inhibitor lympho-epithelial Kazal-type inhibitor (LEKTI). Biol Chem 386:1173-84 Segre JA, Bauer C, Fuchs E (1999) Klf4 is a transcription factor required for establishing the barrier function of the skin. Nat Genet 22:356-60 Shimomura Y, Sato N, Kariya N, Takatsuka S, Ito M (2005) Netherton syndrome in two Japanese siblings with a novel mutation in the SPINK5 gene: immunohistochemical studies of LEKTI and other epidermal molecules. Br J Dermatol 153:1026-30 Soreide K, Soiland H, Korner H, Haga H, Soreide JA (2005) Acute pancreatitis in a young girl with the Netherton syndrome. J Pediatr Surg 40:e69-72 Swartzendruber DC, Wertz PW, Kitko DJ, Madison KC, Downing DT (1989) Molecular models of the intercellular lipid lamellae in mammalian stratum corneum. J Invest Dermatol 92:251-7 Tartaglia-Polcini A, Bonnart C, Micheloni A, Cianfarani F, Andre A, Zambruno G, Hovnanian A, D'Alessio M (2006) SPINK5, the defective gene in netherton syndrome, encodes multiple LEKTI isoforms derived from alternative pre-mRNA processing. J Invest Dermatol 126:315-24 Toulza E, Mattiuzzo NR, Galliano MF, Jonca N, Dossat C, Jacob D, de Daruvar A, Wincker P, Serre G, Guerrin M (2007) Large-scale identification of human genes implicated in epidermal barrier function. Genome Biol 8:R107 Traupe H (1989) The ichthyosis. A guide to clinical diagnosis, genetic counselling, and therapy. Springer-Verlag Ed., Berlin Heidelberg Wingens M, van Bergen BH, Hiemstra PS, Meis JF, van Vlijmen-Willems IM, Zeeuwen PL, Mulder J, Kramps HA, van Ruissen F, Schalkwijk J (1998) Induction of SLPI (ALP/HUSI-I) in epidermal keratinocytes. J Invest Dermatol 111:996-1002

XXXIV Figure Legends

Figure 1 - Characterization of the 28 kDa protease and affinity purification on

SbTI affinity column

(A) Inhibitor sensitivity of the 28 kDa protease. Proteolytic activity of the 28 kDa in normal and Spink5-/- mouse epidermis was analysed by casein gel zymography. The 28 kDa proteolytic activity was detected in WT and KO epidermis, but was more intense in KO samples. This activity was not inhibited by the different class-specific inhibitors used: AEBSF (serine protease inhibitor), pepstatin (aspartate protease inhibitor), EDTA (metalloprotease) and E64 (cystein protease inhibitor). (B) pH-dependent activity of the 28 kDa protease. Epidermal samples from two WT and two KO were analyzed on casein gel zymography performed at pH 4, 5.5, 7 and 8.

The 28 kDa protease activity was maximal at pH 7, and decreased with acidification.

A residual activity was visible at pH 5.5, but none remained at pH 4.4. (C) Purification of the 28 kDa on SbTI affinity column. The chromatography column was loaded with acetic acid extracted epidermal proteins, washed, and elution was performed with an acidic gradient. Each collected fraction was analysed by casein gel zymography.

“Total” corresponded to the unpurified fraction, “FT” referred to the flow through of the column. Wash fractions 1 to 7 as well as elution fractions 7 to 24 were analyzed.

High-abundance proteins were eliminated during the first five washes. The 28 kDa protease activity (arrow) was detected from elution fractions 11 to 21. These fractions, devoid of any other visible proteolytic activity, were pooled and submitted to tandem mass spectrometry analysis.

XXXV Figure 2 - Identification of pancreatic elastase 2, a N-glycosylated epidermal protease

(A) Sequence of murine pancreatic Elastase 2 precursor. The peptides identified by mass spectrometry are shown in bold red, corresponding to 8% sequence coverage. The score of each peptide is indicated. (B) RT-PCR of Elastase

2 from mouse epidermis. RT-PCR were realized from epidermal, dermal and pancreatic murine total RNA. Primers specific to the 5’UTR and 3’UTR of murine elastase 2 allowed the amplification of a 863 pb in the control pancreatic sample. A single band of similar molecular weight was amplified by RT-PCR from the epidermis, whereas no signal was detected by RT-PCR from the dermis. Signal specificity was confirmed by PCR of samples that were not reverse transcribed (-RT). (C) N- deglycosylation status of epidermal Elastase 2. Spink5-/- epidermal extracts were incubated in the presence (+) or absence (-) of PNGase F. Samples were analyzed by casein zymography. In the PNGase F-treated sample, Elastase 2 activity migrated at 25 kDa.

Figure 3 - Expression and activity of Elastase 2 in WT and Spink5-/- epidermis

(A) Immunohistochemical analysis using anti-Elastase 2 antibody on wild-type

(WT) and Spink5-/- (KO) skin cryosections. Elastase 2 was detected in the granular layer and the stratum corneum in both WT and KO animals. The signal intensity was similar between the two samples. (B) In situ zymography analysis of WT and KO skin cryosections. elastolytic activity of WT and KO epidermis. Elastolytic activity detected by the degradation of the BODIPY FL elastin substrate is mainly found in the granular layer as well as in the stratum corneum of WT and KO mouse epidermis. Signal intensity was strongly increased in the epidermis of KO animal and extended to the outermost layers of the spinous layer. Activity intensity is indicated in a pseudo- colour gradient ranging from 0 (dark) to 255 (white). Scale bar: 50 µm. (C)

Quantification of elastolytic activity in WT and KO epidermal extracts. Elastolytic

XXXVI activity measured by the degradation velocity of BODIPY FL elastin was increased

5.3 times in KO extracts compared to WT.

Figure 4 - Regulation of Ela2 activity

(A) Activation of pro-Elastase 2 by KLK5 and KLK14. The degradation velocity of BODIPY FL elastin by activated Elastase 2 was measured. The presence of KLK5 had a minor effect on pro-Elastase 2 activation. In the presence of KLK14, the elastolytic activity was increased 3 fold compared to the basal activity level of pro-Ela2. The basal elastolytic activity of KLK5 and KLK14 alone were taken into account in the calculations (see Material and Methods section).

Figure 5 - Engineering of transgenic INV-mEla2 mice

(A) Schematic representation of the transgenic cassette. NotI restriction sites were used to clone the murine Elastase 2 cDNA fused with the FLAG tag downstream of the human involucrin (inv) regulatory sequences (2.7 kb promoter, first exon, and first intron). Forward and reverse primers in SV40 intron and FLAG sequence were used for PCR genotyping (arrowheads). (B) PCR analysis of genomic DNA showed the presence of a specific 1 Kb in transgenic animals. (C)

Western blot analysis of WT and INV-Ela2 (Tg) epidermal and dermal extracts, using an anti-FLAG antibody. The ectopic Elastase 2 is detected as pro- and active forms in the epidermis of transgenic animals. (D) Phenotype evolution of the less affected transgenic animals (Tg), compared to a wild-type (WT) littermate. The transgenic mouse appeared normal at birth but developed a few days after birth a generalized scaling which showed spontaneous regression from post-natal day 8, concomitantly with the beginning of hair growth. No scale was visible in the adulthood. (D)

Phenotype and skin analysis of severely affected INV-Ela2 mice. (a,b) The transgenic animal was found dead at birth. Macroscopic examination showed a generalized erythema and massive scales (zoom). (c-d) Hematoxylin and eosin

XXXVII staining of the INV-Ela2 showed an acanthotic epidermis with focal hypogranulosis and prominent orthokeratotic hyperkeratosis. The stratum corneum was often detached from the underlying epidermis. This detachment correlates with the presence of inflammatory cells in the subcorneal area. (e-f) Immunohistochemical analysis of INV-Ela2 paraffin section using an anti-CD45 antibody revealed the presence of leucocytes in the dermis, and confirmed the marked accumulation of these cells in the subcorneal region. (f) Ultrastructural examination of INV-Ela2 skin showed the presence of numerous neutrophiles in the subcorneal inflammatory infiltrate. (g-h) Immunofluorescence of WT and INV-Ela2 skin sections with anti-Flag antibody revealed a high-level and patchy transgene expression in the granular layer and stratum corneum of INV-Ela2. (i-j) In situ zymography analysis of skin cryosections showed a high elastolytic activity in the granular layer and stratum corneum of INV-Ela2. Note that stratum corneum is attached to the underlying epidermis on this area. Scale bars: c,d,e,g,h, 75 µm; f, 500 nm; i,j, 200 µm.

Figure 6 – Immunohistochemical analysis of proliferation and differentiation markers.

(a-b) Ki67, a proliferation marker, is expressed in a higher number of basal cells and in some suprabasal keratinocytes in the INV-Ela2 (Tg) epidermis compared to wild-type (WT). (c-d) The hyperproliferation marker Keratin 6 (K6) is not expressed in the epidermis of WT animal whereas high expression is observed in the suprabasal layers of INV-Ela2 epidermis. (e-f) The basal marker keratin 14 (K14) is extended to the suprabasal compartment in the transgenic epidermis. (g-h) Keratin

10 is detected in the suprabasal layers of WT epidermis, but is markedly reduced in intensity in the transgenic animal. (i-n) The stainings of early (involucrin) or late

(loricrin, filaggrin) cornified envelope precursors are reduced in intensity and extended to the outermost spinous layer. (g-n) The INV-Ela2 epidermis show regions

XXXVIII of complete lack of differentiation marker staining, which correlated with absence of the keratohyaline granules. Scale bar: 75 µm.

Figure 7 – Skin barrier defect in INV-Ela2 epidermis

(A) Transepidermal water loss (TEWL) and body weight measurements.

Between day 4 and day 8, the TEWL values were higher in INV-Ela2 animals compared to the WT (up to 3.2 times on day 5). After day 8, TEWL values of WT and transgenic mice were similar. From day 4 to 11, the body weight of INV-Ela2 mice was lower than the one of WT animals, with a maximal variation of 31% on day 6. (B)

Ultrastructural anomalies in INV-Ela2 epidermis. (a-b) Upper epidermis showing a thick and compact stratum corneum (SC) in transgenic mouse (Tg) compared to wild- type mouse (WT) (GR, granular layer; SP, spinous layer). (c) Higher magnification of upper transgenic epidermis reveals the presence of numerous intracellular empty vacuoles (arrowheads). No keratohyalin granule was observed in this area. (d-e)

Granular layer (GR) - stratum corneum (SC) interface showing normal secretion of lamellar body in WT epidermis (arrowheads). In contrast, no lamellar body was visualized near the membrane in INV-Ela2 epidermis. (f-g) Lower epidermis showing a marked spongiosis in the spinous layer (SP) of transgenic epidermis. Scale bars: a,f,g, 13,3 µm; b, 5,7 µm; c, 4 µm; d,e, 167 nm. (C) Oil red O staining of INV-Ela2,

Spink5-/- and Netherton syndrome skin cryosections. (a-b) In WT epidermis, the dye localizes in the extracellular spaces of the corneocytes, forming well-parallel lines

(arrowheads). In the INV-Ela2 SC, numerous red-coloured lipid droplets are observed (arrowheads). Note the thickness of the transgenic SC compared to the WT

SC. (c-d) In the newborn epidermis, the staining was similar between WT and

Spink5-/- (KO) newborns. (e-f) In the Spink5-/- grafted animals (WTg and KOg), the staining was normal in WT animals whereas the KO graft showed numerous lipid droplets and no extracellular staining. (g-h) The staining of Netherton syndrome (NS) patient epidermis was similar to INV-Ela2 or Spink5-/- epidermis, showing intracellular

XXXIX droplets, in comparison to the extracellular and lamellar staining of normal epidermis.

Scale bar: 15 µm.

Figure 8 – Potential physiological inhibitors of Elastase 2 and negative feedback loop

(A) Inhibition properties of SLPI and SKALP toward Elastase 2. Elastase 2 was incubated with increased concentrations of inhibitors. The curves represent the percentage of resulting elastolytic activity according to the ratio [inhibitor]/[enzyme].

Inhibition constants (Ki) were calculated as described in Materials and Methods.

SKALP displayed a better inhibitory capacity toward Elastase 2 compared to SLPI.

(B) In situ zymography analysis showing SLPI and SKALP inhibitory capacity toward native Elastase 2. The ability of SLPI and SKALP to reduce elastolytic activity was assessed on wild-type (WT) and INV-Ela2 (Tg) cryosections. Elastolytic activity of

WT epidermis is mainly detected in the granular layer and stratum corneum. In INV-

Ela2 epidermis, elastolytic activity was markedly increased. Elastolytic activity was slightly decreased in the presence of SLPI. The signal intensity was markedly decreased in the presence of SKALP. Scale bar: 200 µm (C) RT-PCR of skin RNA showing SLPI expression in newborn and 10 days-old WT and INV-Ela2 animals. At birth and post-natal day 10, SLPI transcript is detected at low level in WT animals and is significantly increased in transgenic skin. HPRT was used as a control.

Figure 9 – Expression and activity of Elastase 2 in normal and Netherton syndrome epidermis

(A) RT-PCR of Elastase 2 from human epidermal RNA. Primers specific to the 5’UTR and 3’UTR of human Elastase 2 allowed the amplification of a 913 pb band, whose sequence matched with the ELA2A isoform of human pancreatic

Elastase 2. (B) Immunolocalization of ELA2A in normal and Netherton syndrome

XL (NS) epidermis. Anti-Ela2 antibodies were used to detect ELA2A in human paraffin skin section. ELA2A was detected in the granular layer and the stratum corneum in both normal and NS skin, with a similar signal intensity. ELA2A signal was extended to the uppermost region of the spinous layer in NS skin. Moreover, the signal was very intense in the cytoplasm of NS keratinocytes. Note the presence of an inflammatory infiltrate (asterisk).Scale bar : 75 µm. (C) In situ zymography of normal and NS skin cryosections. Elastolytic activity was detected in the granular layer as well as in the stratum corneum of normal human epidermis. Signal intensity was strongly increased in the epidermis of NS patients and extended to all epidermal layers. Activity intensity is indicated in a pseudo-colour gradient ranging from 0 (dark) to 255 (white). Scale bar: 50 µm.

XLI Figure 1

A AEBSF Peps EDTA E64

28 kDa

SCCE

WT KO KO KO KO KO

B WT KO WT KO WT KO WT KO

28 kDa

4 5.5 7 8

C Wash Elution

TotalFT 1 2 3 4 5 6 7 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

pH 6,15 pH 3,6 Figure 2

A

LVVHQR (Ions score 33) LASPVTLSK (Ions score 48) KPSVFTR (Ions score 34)

B C PNGase F + Dermis EpidermisPancreas kDa - RT + - + - +

Kb 28 25 1 0.5 Figure 3 A

WT KO

B C +

KO 32000

27000

22000 WT

17000

- Fluorescence 12000 15 25 35 45 55 Time (min) WT KO

Figure 4

3,5

3

2,5

2 pro-Ela2 pro-Ela2 + KLK5 1,5 pro-Ela2 + KLK14

1

x-fold activation 0,5

0 3 10 pro-Ela2 / KLK Figure 5

A B C Tg epidermis dermis 5 kb kDa - + WT Tg WT Tg Sal I Sal I 200 3 Kb 50 mEla2 1 Kb 30 1 kb 0.5 Kb 20

D Day 6 Day 8 Day 10 Day 13

WT

Tg

E a b

WT Tg

c d e f

WT Tg Tg Tg

g h i j

WT Tg WT Tg Figure 6

WT Tg

a b

Ki67

c d

K6

e f

K14

g h

K10

i j

Involucrin

k l

Filaggrin

m n

Loricrin Figure 7 A

TEWL Body weight ) 10 7 -1 9

.h 8 6 -2 7 5 6 5 Wt 4 Wt 4 Tg Tg 3 3 2 Weight (g) 2 1

TEWL (g.m 0 1 3 4 5 6 7 8 9 10 11 12 3 4 5 6 7 8 9 10 11 12 Age (days) Age (days)

C

a b c SC KG SC GR SC SP GL WT Tg d e SC SC

GR GR GR WT Tg

f GR g GR SP SP SP BL WT Tg Tg

D c d g

a b

WT KO Normal

e f h

WT Tg

WTg KOg NS Figure 8

A SLPI SKALP

120 120 100 100 80 80 60 60 40 40 20 20 Ela2 activity (%) Ela2 activity (%) 0 0 0 5 10 15 20 0 5 10 15 20 I/E I/E

Ki = 29.9 nM Ki = 14.3 nM

+ SLPI + SKALP B a b c

WT +

d e f - Tg

C Newborn Post-natal day 10 WT Tg WT Tg

SLPI

HPRT Figure 9

A B pb

1500

1000 913 700 * 500

Normal NS

C

+

- Normal NS

DISCUSSION GENERALE

113 Chapitre 1 - Diversité structurale et fonctionnelle des fragments de LEKTI

I - Diversité de transcrits

LEKTI est l’inhibiteur de type Kazal possédant le plus grand nombre de domaines inhibiteurs parmi ceux qui sont décrits à ce jour. La diversité structurale de

LEKTI dépend non seulement du nombre particulièrement élevé de domaines Kazal, mais également de la synthèse de transcrits alternatifs de SPINK5 qui engendre une variabilité supplémentaire (figure 24). Le premier transcrit de SPINK5 identifié est un transcrit de 3,5 kb codant l’isoforme de 15 domaines, LEKTI full-length (137).

Ensuite, deux autres transcrits de SPINK5 ont été identifiés grâce au criblage d’une banque d’ADNc de kératinocytes différenciés humains (Article 1). Un transcrit de 3 kb code une isoforme courte, LEKTI short (LEKTIsh) composée des 13 domaines N- terminaux (D1 à D13). Un transcrit de 3,7 kb code l’isoforme longue de LEKTI, LEKTI long (LEKTIl) qui diffère de LEKTIf-l par l’insertion de 30 acides aminés dans la région linker entre les domaines D13 et D14. L’analyse du profil d’expression des transcrits alternatifs de SPINK5 indique qu’il n’existe pas de spécificité tissulaire en fonction du transcrit (Article 1, figure 2). Ainsi, soit toutes les isoformes s’expriment dans un tissu donné, soit aucune. Cependant, dans les kératinocytes primaires, la forme la plus abondante est SPINK5f-l (Article 1, figure 4).

L’existence de trois transcrits de SPINK5 suggère des spécificités fonctionnelles de chacune des isoformes de LEKTI, mais qu’il est difficile d’expliquer

à ce jour. Il est intéressant de noter l’expression d’un seul transcrit de Spink5 chez la souris, qui code une isoforme de Lekti fortement homologue à la forme LEKTIl à la différence que le domaine D6 humain n’a pas d’homologue murin. Ces observations suggèrent que la fonction du domaine D6 est primordiale chez l’homme, alors que la souris ne requiert pas cette fonction. Inversement, les 30 acides aminés caractéristiques de l’isoforme longue de LEKTI, constitutivement exprimés chez la

114 Abondance relative dans les KHN

AUG UGA SPINK5 f-l 7

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

LEKTIf-l

AUG UGA SPINK5l 2.3

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

LEKTIl

AUG UAA SPINK5sh 1 1 2 3 4 5 6 7 8 9 10 11 12 13

LEKTIsh

Figure 24 - Les trois précurseurs de LEKTI La transcription de SPINK5 donne naissance à trois transcrits qui diffèrent dans leur région 3’. Le transcrit SPINK5f-l a une taille de 3,5 kb et code l’isoforme entière de LEKTI (LEKTIf-l), qui comprend 15 domaines d’inhibition. Cette isoforme est la plus abondante dans les kératinocytes humains normaux (KHN) primaires en culture. Le transcrit SPINK5l de 3,7 kb est généré suite à l’utilisation de sites d’épissage alternatifs qui entraînent une insertion de 30 acides aminés dans la région linker entre les domaines D13 et D14. Enfin, l’isoforme la plus courte, LEKTIsh dérive du transcrit SPINK5sh, généré grâce à l’utilisation d’un site de polyadénylation cryptique dans l’intron 28 de SPINK5. Cette isoforme courte est délétée des domaines D14 et D15, et diffère des deux autres formes par la séquence de la région 3’ UTR.

115 116 souris, mais épissés ou non chez l’homme, joueraient un rôle plus important dans l’épiderme murin que dans l’épiderme humain. Le fragment de LEKTI contenant l’insertion de 30 acides aminés caractéristiques de la forme longue n’a pas encore fait l’objet d’étude fonctionnelle. Afin de connaître les différences fonctionnelles des trois transcrits, il serait intéressant d’effectuer des tests d’inhibition avec chacun des trois fragments C-terminaux. L’obtention de souris invalidées pour Spink5 et transgéniques pour chacune des trois isoformes de SPINK5 humain devrait nous permettre de discerner les spécificités fonctionnelles de ces trois isoformes.

II - Diversité structurale des fragments protéolytiques

Dans les kératinocytes primaires humains, les trois transcrits de SPINK5 codent des précurseurs intracellulaires de 145 kDa (LEKTIf-l), 148 kDa (LEKTIl) et

125 kDa (LEKTIsh) et des fragments protéolytiques sécrétés C-terminaux de 65 kDa,

68 kDa et 42 kDa détectés en western blot avec un anticorps dirigé contre les domaines D13 à D15 de LEKTI (!D13-D15) (Article 1, figure 5). Grâce à l’expression hétérologue des isoformes LEKTIf-l et LEKTIsh dans les cellules de mammifères

CHO, nous avons montré que les fragments C-terminaux de 65 kDa et 42 kDa dérivaient de la protéolyse des deux précurseurs de 145 kDa (LEKTIf-l) et de 125 kDa

(LEKTIsh), respectivement (Articles 1, figure 5). De la même façon, la transfection des cellules CHO avec l’isoforme LEKTIl nous a permis de démontrer que le fragment C-terminal de 68 kDa sécrété dans le milieu de culture dérivait du clivage intracellulaire du précurseur de 148 kDa (résultat non publié).

La différence de poids moléculaire entre les précurseurs et leurs fragments

C-terminaux dérivés étant similaire, nous proposons un modèle protéolytique selon lequel un site de clivage C-terminal commun est utilisé sur les trois précurseurs de

LEKTI. Selon ce modèle, des fragments identiques à leur extrêmité N-terminale sont

117 générés, ils ne diffèrent que par leur extrêmité C-terminale en fonction du précurseur d’origine (Article 1, figure 5).

En utilisant des anticorps de LEKTI dirigés contre les domaines D1 à D6

(!D1-D6) et D8 à D11 (!D8-D11), nous avons mis en évidence la présence de nombreux fragments protéolytiques de LEKTI sécrétés dans le milieu de culture, et qui sont identiques quel que soit le précurseur de LEKTI dont ils dérivent (Article 2, figure 1). Ces résultats confirment que les protéases de maturation de LEKTI utilisent les mêmes sites de clivage sur les trois précurseurs, générant ainsi les mêmes fragments à l’exception des fragments C-terminaux.

L’utilisation des cellules CHO comme système de production hétérologue nous a permis de reproduire la maturation protéolytique physiologique de LEKTI, prédisant l’expression par ces cellules de la ou des enzyme(s)-clé(s) responsable(s).

La furine, une convertase intracellulaire impliquée dans la maturation d’une grande quantité de proprotéines et dont l’expression dans la couche granuleuse est connue, représentait un bon candidat (102, 153 ). En utilisant des cellules CHO déficientes en furine, nous avons confirmé que la furine était responsable du clivage de la majorité des fragments bioactifs de LEKTI. Son invalidation chez la souris étant létale de manière précoce pendant la vie embryonnaire (154), nous ne pouvons pas prédire l’importance de la protéolyse de LEKTI in vivo. Cependant, nos résultats montrent que les précurseurs de LEKTI sont rapidement clivés en fragments protéolytiques sécrétés. L’absence de détection des précurseurs de LEKTI à partir d’extrait d’épiderme humain est en accord avec l’hypothèse selon laquelle les fragments dérivés de la protéolyse de LEKTI, et non pas les précurseurs, sont les formes bioactives de LEKTI (Article 2, figure 1).

Afin de connaître la localisation de LEKTI pendant sa migration intracellulaire jusqu’à la membrane, une étude en immunomicroscopie électronique a été réalisée en collaboration avec le Dr Akemi Ishida-Yamamoto (Annexe 2). LEKTI est localisé dans des corps lamellaires, dont le contenu est déversé par exocytose dans l’espace

118 intercellulaire. Le clivage de LEKTI par la furine précède sa sécrétion, et implique une colocalisation de LEKTI et de la furine dans les corps lamellaires des kératinocytes granuleux. Aucune donnée actuelle ne permet de savoir si la protéolyse de LEKTI s’effectue dans un ordre chronologique particulier ou si la furine agit sur tous les sites de clivage de manière simultanée.

En plus d’une maturation post-traductionnelle par protéolyse, nous avons montré que certains domaines de LEKTI étaient glycosylés, en accord avec la prédiction bioinformatique. D’après nos résultats, LEKTI serait O-glycosylée sur le domaine 15, contribuant à une masse additionnelle de 4 kDa. De plus, les domaines

D8 et D12 seraient N-glycosylés à raison de 2 kDa et 4 kDa, respectivement (Article

2, figure 3). Les acides aminés portant les chaînes glycosylées pourront être formellement identifiés par spectrométrie de masse, technique qui permet de connaître également la nature des ramifications glucidiques impliquées. Le rôle de la glycosylation des protéines est multiple, incluant le repliement correct de la protéine, ou la protection contre la dégradation protéolytique (155). Il est donc possible que les sucres présents sur LEKTI empêchent l’accessibilité de la furine au niveau de certaines régions linkers. Ceci pourrait expliquer pourquoi, malgré la richesse en résidus basiques consécutifs dans chacune des 14 régions linker, LEKTI n’est pas clivé en 15 domaines isolés comme cela a été proposé dans des études antérieures

(156). En outre, il est concevable que les sucres présents sur LEKTI jouent un rôle dans la modulation de l’activité inhibitrice des fragments bioactifs, comme c’est le cas pour les domaines Kazal de l’ovomucoïde de dinde (157).

En tenant compte de la masse moléculaire aglycosylée des fragments protéolytiques de LEKTI, de l’anticorps utilisé, et des données issues de la littérature, nous en avons déduit que D1, D5, D6, D8-D11 et D9-D15 étaient des fragments bioactifs épidermiques potentiels dérivés du précurseur majoritaire de LEKTI, LEKTIf-l

(Article 2, figures 1 et 3).

111918 119 III - Diversité fonctionnelle des fragments protéolytiques

Le tableau 3 regroupe les données fonctionnelles des différents fragments individuels ou multi-domaines de LEKTI issues de nos résultats et de la littérature à ce jour (Article 2). Ces résultats montrent que tous les fragments de LEKTI étudiés, excepté le domaine 1, possèdent des propriétés inhibitrices de protéases à sérine avec des spécificités et des forces d’inhibition qui dépendent de la nature du fragment de LEKTI étudié.

Les données disponibles sur le mécanisme d’inhibition des fragments de

LEKTI, indiquées dans le tableau 3, révèlent que le précurseur entier et les fragments multi-domaines de LEKTI agissent selon un mode d’inhibition non compétitif ou mixte vis-à-vis des protéases testées, alors que le domaine individuel

D6 agit en compétition avec le substrat. Ainsi, le domaine Kazal D6 se comporte de manière conforme aux inhibiteurs canoniques, alors que les fragments multi- domaines peuvent inhiber leur protéase-cible en se fixant sur une région différente du site actif de l’enzyme. Ce mécanisme d’inhibition inhabituel chez les inhibiteurs canoniques rend compte de la complexité de l’interaction entre des domaines Kazal agissant en tandem et leur protéase-cible.

L’observation d’une activité trypsique élevée dans la CC des patients SN est en accord avec les capacités d’inhibition de protéases à sérine de type trypsique par

LEKTI (156). En effet, à l’exception du domaine D15, tous les fragments de LEKTI testés contre la trypsine ont des propriétés inhibitrices envers cet archétype protéasique, avec des capacités d’inhibition plus élevées pour les fragments individuels de LEKTI comparés au précurseur. Cette observation indique que la capacité d’inhibition d’un fragment multi-domaine ne correspond pas à la somme des capacités d’inhibition de chacun des domaines pris individuellement. Cela suggère que les fragments multi-domaines de LEKTI adoptent des repliements

120 Protéases à sérine c. = mode d Les modes d Les valeurs de constantes d Tableau 3. Propri Références KLK14 KLK13 KLK8 KLK7 KLK6 KLK5 (KLK3) plasmatique KLK (KLK1) KLK Urokinase Subtilisine Facteur Chymase Plasmine Tryptase t-PA Thrombine Cat HLE Chymotrypsine Trypsine Production G tissulaire Xa ’ inhibition comp ’inhibition sont indiqu A Deraison Non Non Non Non Non Non Non Non Non Non Non Non Non E.Coli rD1 é t é s inhibitrices des fragments de LEKTI étitif ; n.c. = mode d ’ K Non K K Non Non Non Non Non Non Non Non K E.Coli rD5 inhibition (K 2007 i i i i = 77,2 = 32,8 = 60,5 = 17,6 és entre parenth

Jayakumar K Non 34,8 K K Non Non Non Non Non Non Non Non K E.Coli D11 rD8- i ) ou constantes d i i i i = 3,7 = = = 10,3 3,1 2004 ’ inhibition non compé 52,3 K Non Non 118,7 K Non Non Non Non Non Non Non Non K insect D15 rD9- èse i i i

= 350 Kreutzmann = = ! : ’ inhibition apparente (IC Non Non K K Non Non Non Non Non Non Non Non Non Non Non Non K Ki IC E.Coli rD6 i i i = 296,4 = 83,3 = 74,6 50 =

200 2004 Non Non Non Non Non Non Non = 100 (c.) titif ; m. = mode d

Magert IC IC Non Non Non Non Non Non Non Non Non Non Non IC IC Native D6 50 50 50 50

= 340 = Non Non Non Non Non Non = = 150 60 100 1999 ! Egelrud 2005 50 ) sont exprim (m.) Ki (m.) Ki = 24 (m.) Ki (m.) Ki = 2,3 Non insect rD1-D6 ’ inhibition mixte = = 13 0,22 Borgono 2007 (m.) Ki = 3,4 (n.c.) Ki Ki<11 (n.c.) Ki (m.) Ki = 4,7 Ki Non (n.c.) Ki = 200 Non Non Non Non (n.c.) Ki = 370 rD6-D9’ insect ées en nM, r ! ! = 47, 6 = 222 = 5 (m.) Ki = 10,3 (n.c.) Ki Ki=220 (n.c.) Ki = 195,3 (m.) Ki = 2,8 Ki Non D12 rD9- insect Schechter 2005 ! = = = recombinant 3 408,6 Non Non Non (m.) Ki = 21,8 Non insect D15 rD12- Mitsudo 2003 Non Non Non Non 100 IC Non Non Faible Non Non E.Coli rD15 50

= (n.c.) Ki = 49 (n.c.) Ki = 27 (n.c.) Ki = 67 (n.c.) Ki Non (n.c.) Ki = 849 insect rLEKTI = 317

121 122 conformationnels particuliers qui influencent leurs capacités et leurs spécificités d’inhibition.

Contrairement à la trypsine, les kallikréines 1, 5, 6, 7, 8, 13 et 141 représentent des cibles potentielles de LEKTI en raison de leur expression dans la couche granuleuse de l’épiderme (90, 158). Exceptées KLK1, KLK3 et KLK8, toutes les autres kallikréines testées (KLKs 5, 6, 7, 13 et 14) sont inhibées par LEKTI avec des constantes d’inhibition aussi basses que 0,22 nM pour le complexe KLK14 / D1-

D6, bien que ce fragment de LEKTI ne semble pas être physiologique. D’après l’ensemble des résultats d’inhibition, KLK5 et KLK14 apparaissent comme les deux cibles préférentielles de LEKTI, suivies par KLK6, KLK7 et KLK13. Il a été montré in vitro que KLK5, KLK7 et KLK14 étaient capables de dégrader les structures d’adhésion intercornéocytaires nécessaires à la desquamation (89). La colocalisation de LEKTI avec les kallikréines épidermiques dans les dernières couches de l’épiderme conforte le rôle de LEKTI dans le contrôle du processus de desquamation

(Annexe 2).

Notre étude révèle une absence d’inhibition des protéases inflammatoires

(tryptase, cathepsine G, élastase du neutrophile, chymase) par les différents fragments de LEKTI testés. Cependant, d’autres études montrent que D15 inhibe l’élastase du neutrophile (faiblement) et la plasmine (IC50 = 100 nM) et que le précurseur entier LEKTIf-l inhibe l’élastase du neutrophile (Ki = 317 nM), la plasmine

(Ki = 27 nM) et la cathepsine G (Ki = 67 nM) (Tableau 3). Toutefois, d’après nos résultats, le domaine D15 et le précurseur entier de LEKTI ne représentent pas des formes bio-actives de LEKTI. De plus, le fait que le domaine D15 seul mais pas le domaine D9-D15 (un fragment physiologique d’après notre étude) soit capable d’inhiber les protéases inflammatoires citées confirme que les spécificités d’un fragment multi-domaine ne résultent pas des spécificités propres à chacun des

1 Les kallikréines 1, 5, 6, 8 et 13 ont une activité de type trypsique alors que les kallikréines 3 et 7 ont une activité de type chymotrypsique (Klokk et al. 2006). La kallikréine 14 a des activités de types trypsique et chymotrypsique (Steffanson et al. 2006).

123 domaines qui le composent. Ceci suggère que des activités anti-protéasiques de

LEKTI décrites dans la littérature puissent être en partie artéfactuelles, du fait de l’utilisation de fragments qui n’existent pas physiologiquement.

Cependant, on ne peut pas exclure la possibilité que des domaines physiologiques de LEKTI que nous n’avons pas testés dans notre étude aient des capacités inhibitrices vis-à-vis de protéases inflammatoires. Une étude fonctionnelle exhaustive des fragments de LEKTI devrait permettre de répondre à la question.

Pour cela, les efforts doivent être portés vers l’identification de l’ensemble des fragments physiologiques dérivés de la maturation protéolytique des précurseurs de

LEKTI.

IV - D1, le mystère reste entier

Le domaine D1 possède 4 cystéines dont le positionnement sur la séquence primaire est similaire à celui d’un motif Kazal-like. Pourtant, le domaine D1 ne forme pas de boucle inhibitrice et ne possède pas d’activité antiprotéasique (139) (Article

3). Néanmoins, il est intéressant de noter que des mutations ponctuelles localisées à distance du site P1 permettent de modifier la conformation de la molécule et de former une boucle inhibitrice similaire à celle d’un domaine Kazal (figure 25). Il existe, dans la nature, des séquences dites « caméléons » qui sont capables d’adopter des structures secondaires différentes selon un contexte environnemental donné (mutations à distance de la séquence caméléon, liaison de différents ligands, modification de pH). Un des exemples les plus connus de conversion d’une hélice ! en feuillet " concerne les maladies à prion (159).

D1 comporte donc une séquence caméléon susceptible de se modifier dans un contexte in vivo particulier. Cependant, même si D1 adopte une conformation de domaine Kazal, ses capacités anti-protéasiques sont minimes (très faible inhibition de la chymotrypsine et de l’élastase du neutrophile) (160). Cela peut s’expliquer par

124 D1 D1-caméléon D6

Figure 25 - Représentation tridimensionnelle des domaines D1, D1-caméléon et D6 de LEKTI La structure tridimensionnelle de D1 ne comporte pas de boucle inhibitrice, contrairement au domaine D6 (flèche). Dans la structure D1-caméléon, la substitution de deux résidus (Phe28Pro et Phe29Ile) dans la séquence colorée en bleu de D1 (pointe de flèche) entraîne une modification de la conformation du domaine et la formation d’une boucle inhibitrice proche de celle du domaine D6 (flèche). Les sites P1-P1’ sont représentés (Gln46, Asp47 pour D1 et D1-caméléon ; Arg383 et Glu384 pour D6). (Images modifiées à partir de Lauber et al., (2003) et Tidow et al., (2004)).

125 le fait que D1 possède une glutamine en position P1, ce qui le distingue des autres domaines D2 (acide aspartique), D3-D14 (arginine) et D15 (lysine). L’acide aspartique ou l’arginine/lysine en position P1 d’un domaine Kazal sont associées à des capacités d’inhibition de la subtilisine A, et la trypsine respectivement (161 ,

162). En revanche, la glutamine en position P1 n’est pas typiquement rencontrée dans les inhibiteurs Kazal, et aucune spécificité d’inhibition envers une sous-classe de protéases à sérine n’a été décrite pour ce résidu.

Il est donc rationnel de penser que malgré la présence d’une séquence primaire de type Kazal-like, le domaine D1 joue certainement un rôle qui le distingue des autres domaines de LEKTI. Il est possible que la nature caméléon de ce domaine rende difficile les études fonctionnelles in vitro. L’analyse de souris transgéniques ou invalidées pour D1 devraient permettre de comprendre son rôle biologique, qui demeure un véritable mystère à ce jour.

V- Conclusion

La caractérisation structurale de LEKTI dans l’épiderme nous a conduit à l’identification de fragments bioactifs que nous avons testés vis-à-vis de protéases cibles candidates. L’expression tissulaire de LEKTI suggère qu’il joue un rôle dans de nombreux tissus en plus de l’épiderme. Afin de connaître les fonctions de LEKTI de manière exhaustive, il est nécessaire d’étudier le profil de fragments bioactifs dérivés de la maturation protéolytique de LEKTI dans chacun des tissus. Cela permettra de réaliser des études fonctionnelles visant à identifier l’ensemble des voies protéolytiques de l’organisme qui sont dépendantes de la régulation par LEKTI.

126 Chapitre 2 - Quels sont les rôles biologiques potentiels de LEKTI ?

La complexité et la sévérité du phénotype SN indiquent que LEKTI intervient dans le contrôle de l’homéostasie de plusieurs processus biologiques. L’expression de

LEKTI dans les tissus épithéliaux et le thymus suggère que LEKTI joue un rôle dans la différenciation épidermique, le contrôle des réponses inflammatoires et/ou immunologiques ainsi que la défense anti-microbienne (Annexe 1, figure 7). Le développement d’un modèle murin du SN a permis, d’une part, de comprendre les mécanismes moléculaires impliqués dans la physiopathologie de la maladie, et d’autre part, d’identifier les protéases-cibles physiologiques de LEKTI (Article 3, figure 8).

I - LEKTI contrôle le processus de desquamation

Les patients SN présentent des anomalies cutanés majeures incluant un décollement de la couche cornée hyperkératosique. Les souris Spink5-/- présentent un phénotype similaire avec des érosions de la couche cornée parfois très étendues, entraînant un profond défaut de barrière cutanée responsable de la mort périnatale rapide des animaux. Nous avons pu montrer que l’absence de LEKTI provoquait une dégradation accélérée des composants des desmosomes due à l’hyperactivité des protéases KLK5 et KLK7, avec pour conséquence le décollement de la couche cornée.

Concordant avec les données biochimiques, KLK5 et KLK7 représentent deux cibles majeures de LEKTI identifiées dans le modèle Spink5-/-. Par immunomicroscopie

électronique, il a été confirmé que LEKTI, KLK5 et KLK7 étaient déversés à l’interface

CG-CC suite à l’exocytose des corps lamellaires. Dans l’espace intercellulaire, LEKTI et ses cibles sont détectées à proximité des cornéodesmosomes, ce qui confirme l’hypothèse que LEKTI contrôle la dégradation de la desmoglea en modulant les activités de KLK5 et KLK7. La sécrétion de LEKTI précédant légèrement celle de KLK5

127 et KLK7 permet un contrôle immédiat de ces deux kallikréines dès leur sécrétion à l’interface CG-CC. (Annexe 2).

Des études biochimiques nous ont permis de mettre en évidence une régulation très fine de l’activité des KLKs par LEKTI en fonction du pH. Nous avons montré que le pH contrôlait non seulement l’efficacité de l’activité de KLK5 et KLK7, mais aussi l’interaction entre LEKTI et ses cibles (Article 2, figure 6 et figure supplémentaire 3). Dans la CC profonde, la neutralité du pH permet une forte interaction LEKTI – KLKs qui empêche la dégradation des cornéodesmosomes. Avec l’acidification du pH le long des strates de la CC, LEKTI libère progressivement ses cibles, qui deviennent alors disponibles pour protéolyser les structures cornéodesmosomales, et permettre ainsi le détachement des couches les plus superficielles de la couche cornée (Article 2, figure 9)

La couche cornée des patients atteints de dermatoses inflammatoires chroniques dont le SN présente un pH homogène neutre (163). La neutralité du pH dans la couche cornée SN engendre une activité optimale des KLKs, en absence de toute inhibition par LEKTI, ce qui pourrait exacerber la dégradation des cornéodesmosomes dès l’interface CG-CC, et entraîner le décollement précoce de la couche cornée chez les patients SN.

II - LEKTI contrôle la morphogenèse du follicule pilo-sébacé

LEKTI est fortement exprimé dans les cellules matricielles (zone kératogène) du FP en phase anagène (Annexe 1, figure 7). Chez les patients SN, la zone kératogène du cortex présente des défauts de formation des groupements disulfures, qui pourraient être la conséquence de l’absence de LEKTI dans cette région.

Cependant, les cibles protéasiques de LEKTI et le mécanisme mis en jeu restent à déterminer.

128 Bien que les souris invalidées pour Spink5 ne reproduisent pas la dysplasie pilaire spécifique du SN (le Trichorrhexis invaginata), elles présentent des altérations marquées des vibrisses. Celles-ci apparaissent moins nombreuses, courtes, et coudées. La gaine épithéliale interne est marquée par la perte de cohésion intercellulaire, ainsi que par l’absence de contact prolongé avec la tige pilaire. Des greffes de peau dorsale de souris Spink5-/- sur souris immunodéficientes confirment la persistance du défaut pilaire dans la peau adulte des animaux, qui se traduit par une alopécie totale (Article 3, figure 3). Par conséquent, l’absence de LEKTI induit des altérations majeures de la croissance et de la morphogenèse du FP.

La colocalisation de LEKTI avec ses cibles KLK5, KLK7 et KLK14 dans la gaine épithéliale interne (GEI) du FP rend possible une implication de ces deux protéases dans la fragilité pilaire du SN (Annexe 1, figure 7) (90, 158). La cohésion des kératinocytes de la GEI est assurée par des jonctions desmosomales dans lesquelles la desmogléine-1 est l’isoforme majoritaire (164). En absence de LEKTI, comme dans la CC, l’hyperactivité des KLKs pourrait induire une dissociation des cellules de la GEI en digérant la desmogléine-1 des desmosomes intercellulaires.

Ceci aurait pour conséquence la déstabilisation de la GEI, qui ne pourrait plus jouer son rôle de gaine de la tige pilaire. Cette dernière, mal orientée et moins bien guidée, serait plus sensible au frottement et se casserait plus facilement, expliquant la présence de zones alopéciques parfois importantes chez les patients SN.

III - LEKTI est un acteur de l’immunité innée

La sensibilité des patients SN aux infections microbiennes et la localisation de LEKTI dans les épithéliums en contact avec l’environnement extérieur suggèrent fortement un rôle de LEKTI dans l’immunité innée. Cette sensibilité accrue pourrait

être secondaire à une barrière cutanée altérée à travers laquelle les microbes s’infiltreraient facilement, et/ou à la perte d’un mécanisme antimicrobien direct.

129 III-1 LEKTI contrôle la maturation de la cathélicidine

Un des mécanismes de défense cutanée innée contre l’infection repose sur l’expression locale constitutive ou inductible de peptides antimicrobiens par les kératinocytes. La !-défensine et la cathélicidine font partie de cette famille d’antibiotiques naturels. La pro-cathélicidine est maturée protéolytiquement en peptide antimicrobien mature LL-37, un chemoattractant fort des neutrophiles, des monocytes, des lymphocytes T et des mastocytes, et un antibactérien puissant

(69). La pro-cathélicidine est activée en LL-37 grâce à l’activité protéolytique contrôlée de la protéinase 3 des neutrophiles. Dans l’épiderme, la pro-cathélicidine est exprimée constitutivement par les glandes sudoripares et de manière inductible par les kératinocytes, où KLK5 est responsable de son activation en LL-37 (Annexe

3). Ensuite, KLK5 et KLK7 clivent LL-37 en peptides de plus petite taille qui possèdent des capacités antibactériennes et immunostimulatrices spécifiques

(Annexe 3). Dans l’épiderme des souris nouveau-nées Spink5-/-, il a été montré une surexpression de la cathélicidine et une augmentation des formes protéolytiques dérivées qui sont actives contre la souche bactérienne Staphylococcus aureus (S. aureus). Ainsi, l’activité anti - S. aureus d’un épiderme KO est supérieure à celle d’un épiderme WT, ce qui est contradictoire avec les nombreux épisodes d’infections cutanées à S. aureus reportés chez les patients SN (Annexe 3). Par conséquent, il apparaît vraisemblable que la perte de barrière cutanée des patients

SN induise une sensibilité à l’infection trop importante pour être compensée par l’augmentation locale d’activité antibactérienne.

D’après une étude très récente, la protéolyse dérégulée de la cathélicidine en peptides hautement pro-inflammatoires par KLK5 serait impliquée dans la physiopathologie de la rocasée, une pathologie cutanée caractérisée par une inflammation chronique de la peau et une dilatation vasculaire (Annexe 4). La surexpression de KLK5 chez les patients atteints de rocasée n’a pas de

130 conséquence sur la desquamation épidermique, alors que le modèle murin transgénique pour KLK5 développe des décollements importants de la couche cornée (Annexe 6). Il est probable que l’augmentation de l’activité KLK5 dans l’épiderme de ces patients reste largement inférieure à l’activité de KLK5 dans la peau des patients SN ou dans celle des souris trangéniques pour KLK5.

Néanmoins, elle semble être suffisante pour cliver la cathélicidine en plusieurs peptides pro-inflammatoires ayant la capacité d’induire chez la souris un érythème et une dilatation des vaisseaux caractéristiques de la rocasée chez l’homme

(Annexe 4).

III-2 Rôle antimicrobien direct de LEKTI : une hypothèse…

L’augmentation de l’activité antimicrobienne anti-S. aureus dans l’épiderme des souris Spink5-/- n’est pas contradictoire avec une possible diminution d’activité antimicrobienne envers d’autres types de bactérie, des champignons et/ou des virus.

Il a été montré dans la littérature que certains inhibiteurs de type Kazal possèdaient des propriétés anti-microbiennes (165). Une étude détaille la mise en

évidence de 5 nouveaux gènes SPINK (SPINK6 à SPINK10) chez l’homme localisés à proximité de SPINK5 en 5q32. Le gène SPINK9 code un seul domaine

Kazal, LEKTI-2, pour lequel des propriétés antimicrobiennes vis-à-vis de C. albicans ont été mises en évidence (166). Cette observation conforte l’hypothèse selon laquelle certains domaines de LEKTI puissent également avoir une activité anti-fongique directe (ou d’autres activités antimicrobiennes à l’exception de S. aureus comme le suggère le modèle Spink5-/- , cf. annexe 3). Cette hypothèse est renforcée par le développement de candidose chez plusieurs patients SN décrits dans la littérature (136 , 167 , 168). Si cette hypothèse est vérifiée, l’absence de

LEKTI entraînerait un déficit cutané primaire en activité antimicrobienne qui viendrait s’ajouter à la perte de l’intégrité de la barrière cutanée.

131 IV - LEKTI joue un rôle anti-inflammatoire / anti-allergique

IV-1 Un rôle anti-inflammatoire / anti-allergique direct ?

Contrairement aux autres ichtyoses, la fréquence et l’intensité des manifestations atopiques sont considérables chez les patients SN. Cette observation prédit un rôle de LEKTI dans la modulation des réponses inflammatoires et/ou allergiques (169).

D’une part, il a été montré que le précurseur de LEKTI et le domaine D15

(formes non physiologiques) possédaient des propriétés inhibitrices de protéases pro-inflammatoires (cathepsine G, élastase du neutrophile). Notre étude biochimique n’a pas mis en évidence de capacités d’inhibition de protéases inflammatoires par les fragments physiologiques de LEKTI (Article 2). Toutefois, cela n’exclut pas l’hypothèse que des fragments physiologiques non testés puissent cibler ces protéases. D’autre part, une analyse in silico de la région promotrice de

SPINK5 révèle la présence de sites de fixation à divers éléments de régulation impliqués dans l’inflammation comme NF-kB, et IL6RE-I (éléments de réponse à l’interleukine-6) (138). Ces observations suggèrent que l’expression de LEKTI puisse être activée par des médiateurs pro-inflammatoires afin de protéger les tissus contre les effets délétères des protéases pro-inflammatoires.

Des études indépendantes montrent l’association entre des polymorphismes de SPINK5 (Glu420Lys) et la dermatite atopique (DA), corrélant avec l’hypothèse d’un rôle de LEKTI dans le contrôle du développement allergique (146-148, 170,

171). La conséquence du polymorphisme Glu420Lys est l’apparition d’un résidu lysine dans la région linker située entre les domaines D6 et D7. La lysine est un résidu basique sensible au clivage protéolytique par les convertases, dont la furine.

Ainsi, l’hypothèse actuelle serait que le polymorphisme associé à la DA crée un nouveau site de protéolyse dans le précurseur de LEKTI, entraînant la disparition

132 133 Normal SN

Microbes Microbes Allergènes Allergènes

LEKTI TEWL !

Barrière fonctionnelle Perte de barrière

Dermatite atopique Infection

Protéases endogènes Asthme allergique

Figure 26 - Conséquences de l’altération de la barrière chez les patients SN Dans une peau normale, LEKTI régule les activités protéolytiques des protéases endogènes (KLK5, KLK7, KLK14…) permettant une desquamation contrôlée et une barrière protectrice vis-à-vis des pathogènes extérieurs. Une régulation directe des protéases allergèniques par LEKTI est possible. Dans la peau SN, LEKTI ne contrôle plus l’activité des protéases endogènes, qui digèrent alors de manière précoce et excessive les jonctions cornéodesmosomales de la couche cornée. Cela conduit à une desquamation prématurée qui s’accompagne d’une perte de la fonction barrière comme en témoigne l’élévation de la perte en eau transépidermique (TEWL). L’altération de la barrière cutanée crée des interstices dans lesquelles s’infiltrent microbes et allergènes, lesquels sont responsables des infections et du développement de la DA chez les patients SN. La DA représente un facteur de risque majeur de l’asthme allergique, une manifestation atopique fréquente chez les patients. (Schéma modifié à partir de Smith et Harper (2006)).

134 d’un ou plusieurs fragments multi-domaines contenant au minimum le fragment D6-

D7.

Des études préliminaires réalisées au laboratoire montrent un profil de fragments protéolytiques de LEKTI différent entre les kératinocytes primaires en culture d’individus porteurs ou non du polymorphisme Glu420Lys, ce qui concorde avec une maturation protéolytique distincte des deux isoformes de LEKTI. Notre expérience et les données de la littérature montrent que la modification de la nature des fragments de LEKTI a probablement une conséquence majeure sur les capacités inhibitrices de LEKTI. Ces résultats suggèrent que, dans la population porteuse du polymorphisme Glu420Lys, la perte de fonctionnalité d’un ou plusieurs fragments de LEKTI pourrait constituer un facteur prédisposant à la DA. Par ailleurs, il est connu que les maladies allergiques sont multifactorielles, et résultent de l’interaction complexe entre des facteurs génétiques et des facteurs environnementaux. Récemment, il a été montré que l’application topique de Der f 1, une protéase à cystéine qui correspond à un allergène important de l’acarien entraînait une perte de barrière cutanée (172). Un effet semblable est possible avec les nombreux allergènes de type protéases à sérine, qui représentent des cibles potentielles de LEKTI. Les allergènes protéasiques exogènes, en détériorant la barrière cutanée, pourraient y faciliter leur propre progression ou celle d’autres allergènes, contribuant ainsi à la pathogenèse de l’allergie cutanée (figure 26).

Ainsi, qu’il s’agisse des patients SN ou des personnes présentant le polymorphisme Glu420Lys, le défaut d’inhibition de certaines protéases endogènes

(dont les protéases médiatrices de l’allergie) mais aussi exogènes (allergènes) pourraient favoriser la pénétration d’allergènes à travers une barrière cutanée altérée et ainsi expliquer le développement de la dermatite atopique. Comme chez les patients atteints d’ichtyose vulgaire, il est possible que la réponse allergique cutanée précède la mise en place de l’asthme allergique, une manifestation atopique fréquente chez les patients SN.

135 IV-2 Un rôle anti-inflammatoire indirect ?

LEKTI pourrait également jouer un rôle indirect sur l’initiation de l’inflammation en régulant des protéases capables d’activer des cytokines ou des récepteurs pro-inflammatoires. Par exemple, l’interleukine 1! (IL-1!), une cytokine pro-inflammatoire du système immunitaire inné, est activée par KLK7 dans l’épiderme (173). L’analyse des souris transgéniques pour KLK7 confirme l’implication de cette protéase dans le développement de l’inflammation cutanée, qui s’accompagne d’un prurit intense (174). Ainsi, en l’absence de LEKTI, l’hyperactivité de KLK7 pourrait induire une activation exacerbée de l’IL-1!, impliquée dans la stimulation des réponses inflammatoires chez les patients.

L’observation d’une augmentation de l’expression de l’IL-1! dans l’épiderme des greffons Spink5-/- renforce cette hypothèse (175).

Les PARs (protease-activated receptors) appartiennent à une classe de récepteurs couplés aux protéines G, activés par la protéolyse de leur extrémité N- terminale par des protéases à sérine. Parmi les quatre membres identifiés dans cette famille (PAR-1 à PAR-4), PAR-2 est exprimé dans la couche granuleuse de l’épiderme (176). Dans les kératinocytes primaires humains, son activation induit la sécrétion de cytokines pro-inflammatoires (GM-CSF, IL-6, IL-8, eotaxine) et de molécules d’adhésion (ICAM, E-selectine) impliquant la voie NF-kB (177). Il a été montré récemment que KLK5 et KLK14 pouvaient activer le récepteur PAR-2 (178).

Ces résultats suggèrent que la suractivité des protéases épidermiques en l’absence de LEKTI induise des effets pro-inflammatoires dus à une activation incontrôlée de

PAR-2. Les cytokines pro-inflammatoires sécrétées pourraient alors favoriser le recrutement d’éosinophiles et de mastocytes qui sont nombreux dans les sites inflammatoires cutanés chez les animaux Spink5-/- greffés (175). L’obtention d’animaux doublement invalidés pour Spink5 et Par-2 permettra de confirmer ou

136 non cette hypothèse et d’évaluer la contribution de PAR-2 dans le développement du phénotype SN.

IV – LEKTI joue un rôle dans le développement du système immunitaire

LEKTI est très fortement exprimé dans les corpuscules de Hassall du thymus, qui sont des petits nodules de cellules épithéliales kératinisées disposées de façon concentrique dans la médulla, jouant un rôle dans la sélection positive des lymphocytes T régulateurs (179). Il est donc possible que LEKTI inhibe des protéases thymiques impliquées dans la maturation lymphocytaire. Son déficit pourrait ainsi entraîner des anomalies immunitaires intrinsèques favorisant la mise en place d’un terrain allergique chez les patients SN.

Bien que la matriptase et TSSP (Thymus specific serine protease) soient deux protéases à sérine thymiques, leur localisation dans les cellules épithéliales du cortex et non pas dans les corpuscules de Hassall est peu en faveur d’un contrôle de leur activité par LEKTI (180 , 181). Par conséquent, les cibles protéasiques thymiques de LEKTI restent à identifier.

V – LEKTI régule la maturation protéolytique de l’hormone de croissance

Récemment, un rôle possible de LEKTI a été proposé dans la régulation de la maturation de l’hormone de croissance par KLK5 et KLK14. Les auteurs suggèrent que le retard de développement observé chez les patients SN soit causé par la dégradation excessive de l’hormone de croissance en l’absence de LEKTI (182).

Cependant, cette hypothèse est basée sur des études in vitro pour lesquelles il manque une confirmation physiologique chez les patients SN.

Par ailleurs, cette étude montre pour la première fois l’expression de LEKTI dans les cellules endothéliales de la veine hypophysaire, ce qui pourrait expliquer la

137 présence des fragments D1, D5 et D6 isolés à partir d’hémofiltrat humain et dont l’origine est actuellement inconnue.

VI – Conclusion

Notre équipe s’intéresse aux rôles de LEKTI dans le compartiment

épidermique et aux conséquences physiopathologiques liées à la perte de son expression chez les patients SN. En plus d’un rôle majeur dans l’homéostasie

épidermique (différenciation terminale, desquamation, croissance et morphogenèse du FP, immunité innée cutanée, rôle anti-inflammatoire et anti-allergique), il semble

évident que LEKTI possède des fonctions supplémentaires en raison de la diversité de tissus dans lesquels il est exprimé. Dans ce contexte, une des thématiques de l’équipe s’oriente vers la compréhension de l’origine de l’atopie chez les patients SN.

En particulier, une question majeure à laquelle nous nous intéressons actuellement est de savoir si l’absence de LEKTI entraîne un défaut de barrière cutané suffisant à induire le développement de la DA, ou s’il existe un défaut immunologique intrinsèque prédisposant aux réponses de type allergique chez les patients SN.

138 Chapitre 3 - Identification d’une nouvelle protéase épidermique hyperactive en l’absence de LEKTI

I - Une identification difficile, pourquoi ?

Nous avons montré que l’absence de Lekti chez la souris entraînait une hyperactivité de deux protéases bien caractérisées dans l’épiderme, KLK5 et KLK7.

En outre, nous avons enrichi puis identifié par spectrométrie de masse une troisième protéase hyperactive, l’élastase 2 pancréatique dont l’expression dans l’épiderme n’était pas connue (Article 4). En effet, l’ADNc de l’élastase 2 pancréatique (Ela2) n’apparaît pas dans les banques réalisées à partir d’extrait épidermique. Ceci soulève le problème de l’identification des protéines dont le niveau d’expression est très faible, telles que les protéases. Un exemple éloquent est celui d’une étude transcriptomique globale des kératinocytes granuleux, qui n’a pas permis de mettre en évidence l’expression transcriptionnelle de KLK5, alors que cette enzyme importante de la desquamation est spécifiquement exprimée dans cette couche

(183). Par ailleurs, l’identification de protéines à partir d’épiderme est rendue difficile par la présence de kératines et de filaggrine qui représentent plus de 90 % du matériel protéique. Par conséquent, il est certain que la mise en évidence de l’expression d’un gène est totalement dépendante de la sensibilité de la technique utilisée.

La spectrométrie de masse est une méthode de choix pour l’identification des protéines peu abondantes, à condition que celles-ci soient suffisamment enrichies et que leurs séquences en acides aminés génèrent des peptides trypsiques d’une taille adéquate pour l’analyse (5-15 acides aminés).

L’identification de l’élastase 2 dans l’épiderme murin a été possible grâce à la conjoncture entre une quantité importante d’extrait épidermique brut, un enrichissement efficace par chromatographie d’affinité, et une analyse réalisée avec un spectromètre de masse de haute sensibilité de type Qq-Tof, le QSTAR. Cet

139 appareil permet d’identifier des protéines par séquençage peptidique, après digestion trypsique de l’extrait suivi d’une séparation des peptides sur nano-HPLC. Il est approprié pour les identifications à partir de mélange protéique complexe, ce qui

était notre cas.

II- Ela2 : une nouvelle cible (indirecte) de LEKTI

Nos travaux rapportent les premières études de l’Ela2 épidermique chez l’homme et la souris. Chez la souris, l’élastase 2 pancréatique (Ela2) est codée par un gène présent à raison d’une seule copie dans le génome (GenBank NM007919)

(184). Chez l’homme, 2 gènes dupliqués ELA2A et ELA2B codent 2 isoformes de l’ELA2 de forte homologie (89% d’identité). En 1987, Kawashima et ses collaborateurs ont démontré l’expression de l’ELA2 humaine (sans distinction des deux isoformes) dans le pancréas, mais une absence d’expression dans le rein, le cœur, le foie, l’aorte, la rate et les lymphocytes périphériques (185). Le tissu cutané n’était pas inclus dans cette étude.

Nous avons démontré l’expression de l’élastase 2 pancréatique dans l’épiderme murin et humain (isoforme ELA2A). Son expression est localisée au niveau de la couche granuleuse et de la couche cornée. Les transcrits et les séquences protéiques primaires de l’Ela2 d’origine épidermique et pancréatique sont identiques à 100%. Cependant, l’Ela2 épidermique est N-glycosylée contrairement à l’enzyme pancréatique (Article 4, figure 2). Cette différence peut traduire une spécificité de modifications post-traductionnelles dépendantes du tissu. La glycosylation de l’Ela2 pourrait influencer sur sa stabilité et/ou son interaction avec ses cibles protéiques épidermiques.

L’expression de l’Ela2 dans la couche granuleuse de l’épiderme suppose une activation transcriptionnelle du gène spécifiquement dans les kératinocytes vivants les plus différenciés. Certaines familles de facteurs de transcription (AP-1, AP-2,

140 POU, Sp1, STAT, Ets, C/EBP, Get-1/Grhl3…) sont activées lors de la différentiation terminale de l’épiderme, et pourraient jouer un rôle dans l’activation de l’expression de l’Ela2. Une analyse de prédiction de sites de facteur de transcription

(www.cbrc.jp/research/db/TFSEARCH.html) révèle la présence des sites AP-1, Sp1,

C/EBP et c-Ets sur une région promotrice de 4 Kb de l’Ela2 murin. La même analyse in silico du promoteur de l’ELA2A humain montre la présence des sites AP-1, Sp1,

C/EBP et STAT dans la même région. Des études de gènes rapporteurs devraient permettre d’identifier les différents éléments indispensables à la régulation transcriptionnelle de l’Ela2 et ELA2A dans les kératinocytes différenciés.

III – Rôle de l’élastase 2 in vivo et contribution dans le développement du phénotype SN

III-1 La surexpression de l’Ela2 induit des anomalies cutanées sévères

L’identification de cette nouvelle protéase épidermique nous a conduit à développer une souris transgénique dont l’expression ectopique de l’Ela2 est sous le contrôle du promoteur de l’involucrine, afin de respecter la localisation physiologique de l’Ela2. L’analyse des souris sur des plans moléculaire, histologique, immunohistochimique, ultrastructural et enzymatique nous a permis de déterminer l’effet de la surexpression de l’Ela2 sur l’homéostasie épidermique. En particulier, nous avons montré que l’expression ectopique de l’Ela2 provoquait (1) un épiderme acanthosique hyperprolifératif, (2) un défaut de différenciation, (3) des anomalies de sécrétion lipidique dans la couche cornée, (4) la formation d’un infiltrat inflammatoire sous-corné rappelant les corpuscules de Munro du psoriasis. L’ensemble de ces anomalies sont présentes à divers degrés dans le syndrome de Netherton, et impliquent donc l’Ela2 dans le développement du phénotype SN. Cependant, l’Ela2 n’est pas impliquée dans le clivage CG-CC caractéristique de la peau SN et des souris Spink5-/-. Cette anomalie majeure est la conséquence de la dégradation de la

141 desmogléine-1 par la KLK5 essentiellement, comme le suggèrent des études in vitro

(89) et comme nous l’avons confirmée in vivo grâce à la caractérisation de souris transgéniques pour KLK5 générées au laboratoire (Annexe 6).

III-2 Quelles sont les cibles de l’Ela2 ?

L’ensemble des anomalies relevées chez les souris transgéniques suggèrent que l’Ela2 est impliquée dans différentes voies biologiques, et qu’elle possède de nombreuses cibles protéiques. Une technique de choix, COFRADIC (COmbined

FRactional DIagonal Chromatography) a été développée récemment pour l’identification des substrats des protéases. Elle est basée sur l’identification par spectrométrie de masse des protéines qui sont clivées dans un extrait tissulaire de souris sauvages mais qui ne le sont pas dans celui d’une souris invalidée pour une protéase. Théoriquement, cette technique permet de détecter la globalité des substrats d’une protéase par une approche in vivo. Le développement d’une souris

Ela2-/- permettrait de réaliser cette étude afin de connaître les substrats de cette nouvelle protéase épidermique.

III-3 Ela2 est-elle impliquée dans d’autres pathologies cutanées ?

L’immunolocalisation de l’Ela2 révèle un marquage intracellulaire, particulièrement marqué dans la peau de patients SN, ce qui la distingue de KLK5 et

KLK7 qui sont déversées dans l’espace extracellulaire où elles dégradent des composants des cornéodesmosomes (Article 4, Figure 9). De plus, contrairement à

KLK5 et KLK7, Ela2 n’est pas directement inhibée par LEKTI mais par d’autres inhibiteurs physiologiques potentiels intracellulaires, SLPI et l’Elafine, qui la placent au cœur d’une voie biologique spécifique (immunité innée). En conséquence, il est

142 possible que la dérégulation de l’activité Ela2 puisse être observée dans des pathologies cutanées autres que le SN.

Le psoriasis est une dermatose héréditaire fréquente, d’étiologie inconnue, à

évolution chronique, et caractérisée par des zones érythémateuses recouvertes de squames sèches abondantes et friables. Le plus souvent localisées aux coudes, aux genoux, et au cuir chevelu, les lésions peuvent parfois envahir tout le corps.

L’histologie de l’épiderme psoriasique présente des caractéristiques communes avec la peau des patients SN, incluant une papillomatose, une hyperprolifération, et la présence d’un infiltrat inflammatoire évoluant en micro-abcès de Munro. Ces micro- abcès sont typiques du psoriasis et moins fréquents dans l’épiderme SN. De nombreux modèles murins du psoriasis ont été générés, mais, à notre connaissance, la souris transgénique Ela2 est le seul modèle reproduisant des infiltrats inflammatoires dont l’histologie est aussi semblable à celle des micro-abcès de

Munro. Par ailleurs, nous avons montré par zymographie in situ une activité

élastolytique augmentée dans l’ensemble de la couche cornée de plusieurs biopsies de peau de psoriasis, même en l’absence d’infiltrat inflammatoire, excluant ainsi l’activité élastolytique de l’élastase du neutrophile (résultat non publié). Il est donc possible que la suractivation de l’Ela2 joue un rôle dans la pathogenèse du psoriasis.

Différentes études ont démontré que l’IL-1! stimulait un grand nombre de réponses inflammatoires dont l’accumulation et la dégranulation des neutrophiles

(186). Une étude in vitro montre le clivage de la proforme de l’IL-1! en forme active par différentes protéases incluant la cathepsine G, l’élastase du neutrophile et la collagénase (187). Dans les kératinocytes granuleux, il est possible que la pro-IL-1! soit clivée par l’Ela2, ce qui pourrait expliquer l’attraction, puis l’ascension des neutrophiles dans les couches supérieures de l’épiderme, résultant en la formation des micro-abcès neutrophiliques sous-cornés observés chez la souris transgénique

Ela2, les patients SN et les patients atteints de psoriasis.

143 De plus, l’épiderme psoriasique est caractérisé par une hyperprolifération de type cicatrisation (épiderme suprabasal positif pour la kératine 6), comme dans les souris surexprimant l’Ela2. De manière similaire à l’élastase du neutrophile, l’Ela2 pourrait avoir un effet direct sur la prolifération épidermique en activant le récepteur à l’EGF des kératinocytes (188 , 189).

La majorité des publications sur l’Ela2 datent des années 80 et documentent uniquement sa fonction dans le pancréas. Il est aujourd’hui important de réaliser une

étude globale du profil d’expression tissulaire de l’Ela2 chez l’homme afin de connaître de nouvelles voies biologiques et physiopathologiques où l’Ela2 serait impliquée. L’obtention d’un Ac anti-Ela2 efficace (Article 4, Figure 9) nous permettra de réaliser l’immunolocalisation de l’Ela2, d’une part sur des coupes de peaux atteintes de diverses pathologies cutanées (collection du Centre de référence des maladies rares de la peau Midi-Pyrénées), et d’autre part sur une collection de tissus humains sains et tumoraux (tumorothèque, Cancéropôle Grand Sud-Ouest).

IV – Conclusion

L’identification de l’Ela2 dans l’épiderme est un exemple d’identification de protéine à très faible niveau d’expression, ce qui suggère que d’autres protéases restent certainement à identifier dans l’épiderme et les autres tissus. L’implication des protéases dans la plupart des voies biologiques et l’observation de leur dérégulation dans de nombreuses pathologies laissent deviner l’importance de leur identification et de leur caractérisation. Le perfectionnement des méthodes de purification des protéines et l’amélioration de la sensibilité des spectromètres de masse seront la clé de l’identification future de ces protéases encore inconnues, dont le niveau d’expression sous-estime souvent l’importance fonctionnelle.

144 Chapitre 4 - Stratégies thérapeutiques du syndrome de Netherton : perspectives

Bien que le pimécrolimus offre des perspectives thérapeutiques intéressantes pour les patients, ce traitement n’est pas spécifique du SN puisqu’il ne cible que l’aspect inflammatoire de la maladie. Il existe donc un besoin réel d’innovation dans ce domaine afin de proposer aux patients des thérapies ciblées sur les défauts spécifiques conséquents à l’absence de LEKTI. Dans cette optique, une thérapie de substitution du SN, reposant sur l’identification et l’utilisation d’inhibiteurs spécifiques des protéases épidermiques dérégulées, pourrait améliorer le phénotype des patients en même temps que leur qualité de vie.

En 2006, afin de pallier le manque d’inhibiteur de protéase dans la peau des patients SN, un essai d’application topique a été réalisé avec un inhibiteur de protéase à sérine à large spectre naturellement produit dans le sang, l’!1- antitrypsine. Cependant, aucun bénéfice thérapeutique n’a été observé (190). Cet

échec soulève le problème de la taille de la molécule appliquée (ce qui conditionne son accessibilité aux cibles endogènes dans l’épiderme) et de son spectre d’activité.

La couche cornée représente une barrière que les molécules thérapeutiques doivent franchir afin d’atteindre leur cible pharmacologique. D’une part, le poids moléculaire de l’!1-antitrypsine (52 kDa) est largement supérieur à la taille maximale préconisée des molécules pour application topique (500 Da) (191). D’autre part, des études fonctionnelles ont montré que l’!1-antitrypsine était inactif vis-à-vis de KLK5 (192).

Pour ces raisons, il ne semblait pas judicieux à posteriori d’utiliser l’!1-antitrypsine comme agent thérapeutique du SN, malgré l’innocuité probable de cette molécule naturelle.

Il est actuellement nécessaire d’identifier des petites molécules inhibitrices dont la taille favorise la pénétration dans la couche cornée, et dont la spécificité permette d’envisager une efficacité thérapeutique in vivo.

145 I – Choix de la cible thérapeutique

Le modèle murin du SN est un véritable outil pour comprendre les défauts moléculaires impliqués dans la physiopathologie de la maladie et rend possible les approches thérapeutiques ciblées. Il nous a permis d’identifier les cibles protéasiques majeures de LEKTI, dont l’implication respective dans le développement de la maladie a été évaluée grâce à l’étude des animaux transgéniques (Ela2 et KLK5 générés au laboratoire, et KLK7, produits dans un autre laboratoire (174)).

I-1 KLK5

Nous avons montré, par l’étude de cinétiques d’inhibition ainsi que des cinétiques d’interaction par BiaCore, que KLK5 était la cible principale de LEKTI et que le complexe protéase-inhibiteur se formait très rapidement avec une très forte affinité (Article 2, figures 4 et 5). Grâce à sa capacité d’auto-activation et d’activation de KLK7 et KLK14, KLK5 se positionne en amont de la cascade protéolytique conduisant à la desquamation prématurée dans la peau SN. Les souris transgéniques pour KLK5 reproduisent les caractéristiques majeures du SN incluant une hyperdesquamation résultant d’un clivage asymétrique des cornéodesmosomes, une inflammation cutanée associée à un prurit intense, une hyperprolifération

épidermique, des défauts de la différenciation terminale et des anomalies pilaires

(Annexe 6). Par conséquent, KLK5 représente une cible pharmacologique de choix pour la thérapie du SN.

146 I-2 KLK7

Nous avons montré que les fragments de LEKTI inhibaient KLK7 avec une efficacité moins importante que KLK5. En effet, les constantes d’inhibition de D8-D11 sont de 34,8 nM vis-à-vis de KLK7 et de 3,7 nM vis-à-vis de KLK5, soit 10 fois moins.

De plus, la dissociation du complexe D8-D11 – KLK7 est plus rapide que celle du complexe D8-D11 – KLK5 (Article 2, figures 4 et 5).

In vitro, KLK7 est capable de dégrader des composants des cornéodesmosomes (desmocolline), ce qui l’implique dans le processus de desquamation normale de l’épiderme. Tout comme KLK5, KLK7 pourrait jouer un rôle important dans les défauts de décollements de la couche cornée. Cette hypothèse est cependant réfutée par le phénotype léger des souris transgéniques pour KLK7, qui montrent l’apparition de fines squames cinq semaines après la naissance, accompagnées d’un prurit et d’une inflammation cutanée évoquant un phénotype DA (174). Par ailleurs, il a été montré que l’expression de KLK7 était augmentée dans la peau de patients DA, ce qui suggère son rôle dans le développement de cette pathologie allergique commune chez les patients SN (193).

En conclusion, l’analyse des souris transgéniques pour KLK7 indique que cette protéase ne joue pas un rôle primaire dans le phénotype érythodermique desquamatif des nouveaux-nés SN mais, à long terme, pourrait favoriser la mise en place d’un terrain cutané allergique chez les patients.

I-3 KLK14

KLK14 apparaît comme une cible potentielle majeure de LEKTI d’après notre analyse biochimique et les données de la littérature (Article 3, figure 4 et Tableau 3).

En zymographie sur gel de caséine, KLK14 et KLK7 ont une mobilité

électrophorétique identique (94). En conséquence, dans le modèle Spink5-/-, il est probable que la suractivité de KLK14 soit masquée par celle de KLK7. L’absence de

147 souris transgénique pour KLK14 à ce jour ne permet pas d’évaluer sa contribution dans le phénotype SN. Cependant, il est probable que l’hyperactivité de KLK14 ait de graves conséquences sur l’homéostasie épidermique en raison de son activité spécifique élevée, de son rôle possible dans la desquamation (dégradation de la desmogléine-1) et dans l’inflammation cutanée (activation de PAR-2) (178).

I-4 Ela2

L’analyse des souris surexprimant l’Ela2 permet de mettre en évidence des anomalies caractéristiques du SN (hyperprolifération, défaut de différenciation terminale). En outre, l’anomalie de sécrétion des lipides et la formation d’un infiltrat inflammatoire sous-corné sont des défauts spécifiques secondaires à la surexpression de l’Ela2 qui sont présents chez les patients SN mais que l’on n’observe pas dans les souris transgéniques KLK5 ou KLK7. Par ces spécificités,

Ela2 représente également une cible potentielle intéressante pour la thérapie ciblée du SN.

I-5 Conclusion

Les protéases dont l’activité est dérégulée dans le SN sont impliquées dans différentes voies physiopathologiques et contribuent à divers degrés au développement de la maladie. Le décollement de la couche cornée, qui est à l’origine d’une perte de fonction barrière importante menace lourdement le pronostic vital des nouveaux-nés. A notre connaissance, seule KLK5 a une implication majeure dans ce défaut cutané, ce qui fait d’elle une cible thérapeutique prioritaire.

Cependant, la suractivité de l’Ela2 et de KLK7 entraîne des anomalies cutanées qui peuvent aggraver la barrière cutanée altérée, et favoriser le développement du phénotype inflammatoire des patients. Il est donc probable que l’utilisation combinée

148 de plusieurs inhibiteurs actifs contre ces trois protéases ait une meilleure efficacité thérapeutique que l’utilisation d’un seul inhibiteur. Cela permettrait de compenser l’absence de LEKTI au niveau des différentes cascades protéolytiques dérégulées.

II – Identification d’inhibiteur de protéase pour une thérapie de substitution du SN

II-1 Criblage à haut débit et « docking »

La recherche d’une molécule efficace pouvant inhiber les fonctions protéolytiques des protéases-cibles peut être réalisée par criblage à haut débit d’une chimiothèque (banque de molécules chimiques ou naturelles). Lors d’un test de criblage, la protéase et un de ses substrats sont mis en contact avec chacune des molécules de la banque. Le criblage primaire consiste à mettre en évidence des molécules qui empêchent le clivage du substrat par l’enzyme. Pour cela, on utilise un substrat lié à un groupement chromophore ou fluorophore qui permet de détecter son clivage. Le criblage primaire permet l’identification de molécules actives dont il est possible de connaître la constante d’inhibition (Ki).

Indépendamment du criblage primaire, il est possible de prédire virtuellement la structure d’un squelette moléculaire optimal d’un inhibiteur pour une protéase donnée. Pour cela, des études de modélisation moléculaire du site actif de l’enzyme- cible sont réalisées. Dans le meilleur des cas, la modélisation peut être réalisée directement à partir de l’analyse cristallographique de la protéase. Cette stratégie sera applicable à KLK5 et KLK7 dont les données cristallographiques viennent d’être publiées (194 , 195). Alternativement, si la cristallographie n’existe pas, la modélisation peut s’appuyer sur la cristallographie d’autres protéases de la même famille, à condition que le pourcentage d’identité entre les deux enzymes soit suffisant. La prédiction d’un inhibiteur optimal découle de la confrontation de différentes structures moléculaires chimiques connues dans la poche catalytique de

149 l’enzyme, afin d’identifier des squelettes permettant le meilleur ajustement. Cette méthode est appelée « docking » (to dock : arrimer).

Il est intéressant de noter l’existence d’un inhibiteur chimique de l’élastase 2 porcine, référencé par le numéro GR143783 dans la base de données Merops. La formule chimique de l’inhibiteur correspond au (2R)-2-[(1R,2S)-2- hydroxycyclopentyl]pent-4-enal (168,2 g/mol) (figure 27). La base de donnée donne accès à la structure tridimensionnelle de l’élastase 2 porcine en interaction avec

GR143783 réalisée par une étude aux rayons X par Jhoti et ses collaborateurs.

Cependant, il est surprenant que GR143783 ne fasse l’objet d’aucune publication ni brevet. L’Ela2 porcine présente un pourcentage d’identité de 73% avec l’Ela2 murine et 83% avec l’ELA2A humaine, ce qui permet d’envisager l’intérêt médical potentiel de GR143783.

En conclusion, les méthodes de criblages à haut débit et de docking permettent d’identifier des inhibiteurs potentiels de protéases cibles. Cependant, l’identification d’un inhibiteur ne présuppose pas qu’il aura une efficacité thérapeutique, ce qui justifie la réalisation d’étapes de validation supplémentaires obligatoires.

II-2 Criblage secondaire et validation in vivo

L’identification d’inhibiteurs de protéase potentiels est une étape initiale qui précède la vérification de deux paramètres importants pour l’inhibiteur : sa spécificité et son efficacité thérapeutique in vivo. Des tests cinétiques visant à tester la capacité inhibitrice des molécules candidates vis-à-vis d’un panel de protéases permettront d’évaluer la spécificité de l’inhibiteur.

Enfin, l’efficacité des inhibiteurs sélectionnés pourra être mise en évidence in vivo par l’application topique ou par l’administration systémique de ces molécules dans un modèle murin. En raison de la mort rapide des souris Spink5-/- quelques

150 A B

Figure 27 - Structure de GR143783 et représentation tridimensionnelle du complexe entre l’élastase 2 pancréatique porcine et GR143783 Un inhibiteur chimique de l’élastase 2 pancréatique porcine (GR143783) est référencé dans la base de donnée MEROPS. (A) Structure de GR143783 dont la formule chimique est (2R)-2- [(1R,2S)-2-hydroxycyclopentyl]pent-4-enal (168,2 g/mol). (B) L’étude aux rayons X du complexe entre l’élastase 2 pancréatique porcine et GR143783 permet de modéliser l’interaction entre les deux partenaires. La flèche indique le positionnement de GR143783 logé dans le site actif de l’enzyme. (Modifiés à partir de http://remediation.wwpdb.org/pyapps/ldHandler.py?query=1NB et http://www.rcsb.org/pdb/images/1bru_bio_r_250.jpg (base de données protéiques PDB)).

151 heures après leur naissance, il n’est pas envisageable d’utiliser facilement ce modèle murin pour mettre en évidence des molécules pharmacologiquement actives. En revanche, les modèles d’animaux transgéniques pour chacune des protéases seront de première utilité pour ces études.

Afin d’optimiser la pénétration de la molécule à travers la couche cornée parfois très épaisse, ou complètement absente chez les patients, un choix judicieux de l’excipient est nécessaire. Cet excipient pourra être modulé en fonction du compartiment sub-cellulaire ciblé. En effet, l’Ela2 diffère de KLK5, KLK7 et KLK14 par sa localisation intracellulaire, qui ajoute une étape supplémentaire de franchissement de la membrane plasmique par l’inhibiteur. En revanche, la position extracellulaire de KLK5, KLK7 et KLK14 devrait faciliter l’accessibilité de leurs inhibiteurs respectifs.

Lors de ces études pré-cliniques, l’observation de la réversion des défauts cutanés et l’absence d’effets secondaires ou de toxicité de la molécule ouvriront des perspectives d’études cliniques chez l’homme.

III – Conclusion

Il est maintenant possible d’envisager des thérapies ciblées basées sur l’utilisation d’inhibiteurs spécifiques des protéases hyperactives afin de compenser l’absence de LEKTI dans l’épiderme des patients. La dermatite atopique qui accompagne systématiquement les patients SN est une pathologie qui affecte 15 à

20% des enfants dans les pays développés. Cette pathologie courante résulterait d’un défaut primaire cutané ayant des origines génétiques et environnementales diverses. Le gène de la filaggrine (FLG) représente un des gènes majeurs de prédisposition à la DA (150). En outre, plusieurs observations prouvent que la DA peut résulter d’une dérégulation de la balance protéases / inhibiteurs dans l’épiderme. Premièrement, l’association entre le polymorphisme Glu420Lys de

152 SPINK5 et la DA suggère l’existence d’un défaut d’activité inhibitrice d’un ou plusieurs domaines de LEKTI chez les patients DA. Deuxièmement, une augmentation de l’expression de certaines kallikréines dans la peau de patients DA a

été montrée, incluant KLK5, KLK7 et KLK14 (92). Troisièmement, une association a

été rapportée entre une insertion de 4 bp dans la région 3’UTR de KLK7 et la DA, compatible avec une expression plus stable de KLK7 chez les patients (196).

Cependant, ces derniers résultats n’ont jamais été reproduits dans la littérature.

Par conséquent, l’identification de molécules inhibitrices spécifiques de KLK5,

KLK7 et KLK14 pourrait non seulement constituer la base d’un traitement spécifique pour les patients SN mais également ouvrir des perspectives thérapeutiques pour une catégorie de patients DA.

153 s s e n l a

d t e

I s T e l K b i E c e L

é

s r e a n i p é t

Inflammation o . é inn r p ! ués

s iq r gulées d u é e in l r IL-1

t

, n s I o PAR-2 cathélicidine e s T Immunit

u K q E L ués ti

y iq l l e d mp

i

e l s KLK7 ô r protéo t que n

gi o s pro o c

ol de ine-1 e l bi é ca

Desmocolline s s us u s Desquamation KLK7 o Ca s

ces - s o e r

s p 8 a e é 2 ts Desmoplakine Desmogl t KLK5

o r e ren p r derm i u fé s g f ép e ’ Fi l L di LEKTI Cornification KLK5 Profilaggrine pro ération KLK14 KLK14 des pro Hyperprolif Ela2 Ela2 Enzymes de maturation lipides pro ère lipidique SKALP SLPI Barri

154 CONCLUSION GENERALE

Le syndrome de Netherton est une maladie génétique rare caractérisée par des défauts cutanés sévères et des réponses allergiques exacerbées. L’identification du gène SPINK5 dont les mutations sont responsables de la maladie a permis de révéler l’importance de la protéine pour laquelle il code, LEKTI, dans l’homéostasie de l’épiderme (figure 28). Nos travaux ont permis d’avancer dans la compréhension de la maturation de LEKTI. Celui-ci est produit sous la forme d’un précurseur rapidement scindé par la furine afin de générer un profil de fragments protéolytiques incluant des domaines isolés et des fragments multi-domaines. L’étude biochimique que nous avons réalisée a permis d’identifier KLK5, KLK7 et KLK14 comme les protéases-cibles majeures de LEKTI. Grâce au modèle murin du Netherton, nous avons identifié une nouvelle protéase épidermique, l’élastase 2 pancréatique (Ela2) dont l’activité augmente en l’absence de LEKTI. Cependant, Ela2 n’est pas une cible directe de LEKTI. La surexpression de cette nouvelle protéase épidermique chez la souris entraîne le développement de plusieurs caractéristiques du phénotype SN, indiquant une contribution de l’Ela2 dans la physiopathologie de la maladie.

L’étude des animaux transgéniques pour chacune des protéases dérégulées dans le syndrome de Netherton rend possible l’évaluation de leur importance dans le développement du SN. En outre, elle permet d’envisager la mise en place d’une stratégie thérapeutique ciblée visant à utiliser des petits inhibiteurs efficaces et spécifiques des protéases hyperactives dans l’épiderme SN.

Les modèles animaux que nous avons développés au laboratoire seront des outils précieux pour tester le pouvoir thérapeutique de ces petites molécules inhibitrices. La mise en place d’une thérapie ciblée devrait permettre d’améliorer les moyens thérapeutiques actuels en même temps que la qualité de vie des patients

SN.

155 156 Bibliographie

157 158 1. Schmitt, D., Biologie de la peau humaine. Institut National de la Santé et de la Recherche Médicale (INSERM) ed 1995. 326. 2. Prost-Squarcioni, C., [Histology of skin and hair follicle]. Med Sci (Paris) (2006) 22, 131-7. 3. Lin, J.Y. and D.E. Fisher, Melanocyte biology and skin pigmentation. Nature (2007) 445, 843-50. 4. Katz, S.I., K. Tamaki, and D.H. Sachs, Epidermal Langerhans cells are derived from cells originating in bone marrow. Nature (1979) 282, 324-6. 5. Thivolet Jean, N.J.-F., Immunologie cutanée, tome 1. John Libbey Eurotext ed 2002, Paris. 6. Szeder, V., et al., Neural crest origin of mammalian Merkel cells. Dev Biol (2003) 253, 258-63. 7. Lucarz, A. and G. Brand, Current considerations about Merkel cells. Eur J Cell Biol (2007) 86, 243-51. 8. Sidhu, G.S., P. Chandra, and N.D. Cassai, Merkel cells, normal and neoplastic: an update. Ultrastruct Pathol (2005) 29, 287-94. 9. Lumpkin, E.A. and M.J. Caterina, Mechanisms of sensory transduction in the skin. Nature (2007) 445, 858-65. 10. Hosoi, J., et al., Regulation of Langerhans cell function by nerves containing calcitonin gene-related peptide. Nature (1993) 363, 159-63. 11. Fuchs, E., Scratching the surface of skin development. Nature (2007) 445, 834-42. 12. Lechler, T. and E. Fuchs, Asymmetric cell divisions promote stratification and differentiation of mammalian skin. Nature (2005) 437, 275-80. 13. Fuchs, E. and H. Green, Changes in keratin gene expression during terminal differentiation of the keratinocyte. Cell (1980) 19, 1033-42. 14. Ishida-Yamamoto, A., et al., Loricrin immunoreactivity in human skin: localization to specific granules (L-granules) in acrosyringia. Arch Dermatol Res (1993) 285, 491-8. 15. Eckert, R.L., et al., Transglutaminase function in epidermis. J Invest Dermatol (2005) 124, 481-92. 16. Madison, K.C., Barrier function of the skin: "la raison d'etre" of the epidermis. J Invest Dermatol (2003) 121, 231-41. 17. Bikle, D.D., et al., Calcium- and vitamin D-regulated keratinocyte differentiation. Mol Cell Endocrinol (2001) 177, 161-71. 18. Yuspa, S.H., et al., Expression of murine epidermal differentiation markers is tightly regulated by restricted extracellular calcium concentrations in vitro. J Cell Biol (1989) 109, 1207-17. 19. Menon, G.K., S. Grayson, and P.M. Elias, Ionic calcium reservoirs in mammalian epidermis: ultrastructural localization by ion-capture cytochemistry. J Invest Dermatol (1985) 84, 508-12. 20. Menon, G.K. and P.M. Elias, Ultrastructural localization of calcium in psoriatic and normal human epidermis. Arch Dermatol (1991) 127, 57-63. 21. Choi, Y. and E. Fuchs, TGF-beta and retinoic acid: regulators of growth and modifiers of differentiation in human epidermal cells. Cell Regul (1990) 1, 791-809. 22. Mills, A.A., et al., p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature (1999) 398, 708-13. 23. Yang, A., et al., p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature (1999) 398, 714-8. 24. Truong, A.B., et al., p63 regulates proliferation and differentiation of developmentally mature keratinocytes. Genes Dev (2006) 20, 3185-97. 25. Ihrie, R.A., et al., Perp is a p63-regulated gene essential for epithelial integrity. Cell (2005) 120, 843-56. 26. Cotsarelis, G., T.T. Sun, and R.M. Lavker, Label-retaining cells reside in the bulge area of pilosebaceous unit: implications for follicular stem cells, hair cycle, and skin carcinogenesis. Cell (1990) 61, 1329-37. 27. Andl, T., et al., WNT signals are required for the initiation of hair follicle development. Dev Cell (2002) 2, 643-53. 28. Tong, X. and P.A. Coulombe, Keratin 17 modulates hair follicle cycling in a TNFalpha-dependent fashion. Genes Dev (2006) 20, 1353-64. 29. Potter, G.B., et al., The hairless gene mutated in congenital hair loss disorders encodes a novel nuclear receptor corepressor. Genes Dev (2001) 15, 2687-701.

159 30. Bernard, B.A., hairless : il s'en est fallu d'un cheveu = hairless mutations and genetic disorders of hair. Médecine sciences (2002) 18, 276-280. 31. Ahmad, W., et al., Alopecia universalis associated with a mutation in the human hairless gene. Science (1998) 279, 720-4. 32. Sprecher, E., et al., Atrichia with papular lesions resulting from a nonsense mutation within the human hairless gene. J Invest Dermatol (1999) 113, 687-90. 33. Rhee, H., L. Polak, and E. Fuchs, Lhx2 maintains stem cell character in hair follicles. Science (2006) 312, 1946-9. 34. Taylor, G., et al., Involvement of follicular stem cells in forming not only the follicle but also the epidermis. Cell (2000) 102, 451-61. 35. Claudinot, S., et al., Long-term renewal of hair follicles from clonogenic multipotent stem cells. Proc Natl Acad Sci U S A (2005) 102, 14677-82. 36. Castilho, R.M., et al., Requirement of Rac1 distinguishes follicular from interfollicular epithelial stem cells. Oncogene (2007) 26, 5078-85. 37. Benitah, S.A., et al., Stem cell depletion through epidermal deletion of Rac1. Science (2005) 309, 933-5. 38. Getsios, S., A.C. Huen, and K.J. Green, Working out the strength and flexibility of desmosomes. Nat Rev Mol Cell Biol (2004) 5, 271-81. 39. Simon, M., et al., Refined characterization of corneodesmosin proteolysis during terminal differentiation of human epidermis and its relationship to desquamation. J Biol Chem (2001) 276, 20292-9. 40. Furuse, M., et al., Claudin-based tight junctions are crucial for the mammalian epidermal barrier: a lesson from claudin-1-deficient mice. J Cell Biol (2002) 156, 1099-111. 41. Mese, G., G. Richard, and T.W. White, Gap junctions: basic structure and function. J Invest Dermatol (2007) 127, 2516-24. 42. Djalilian, A.R., et al., Connexin 26 regulates epidermal barrier and wound remodeling and promotes psoriasiform response. J Clin Invest (2006) 116, 1243-53. 43. Richard, G., et al., Missense mutations in GJB2 encoding connexin-26 cause the ectodermal dysplasia keratitis-ichthyosis-deafness syndrome. Am J Hum Genet (2002) 70, 1341-8. 44. Ishiko, A., et al., Immunomolecular mapping of adherens junction and desmosomal components in normal human epidermis. Exp Dermatol (2003) 12, 747-54. 45. Sprecher, E., et al., Hypotrichosis with juvenile macular dystrophy is caused by a mutation in CDH3, encoding P-cadherin. Nat Genet (2001) 29, 134-6. 46. Chan, E.F., et al., A common human skin tumour is caused by activating mutations in beta-catenin. Nat Genet (1999) 21, 410-3. 47. Kuramoto, N., et al., Development of ichthyosiform skin compensates for defective permeability barrier function in mice lacking transglutaminase 1. J Clin Invest (2002) 109, 243-50. 48. Huber, M., et al., Mutations of keratinocyte transglutaminase in lamellar ichthyosis. Science (1995) 267, 525-8. 49. Christiano, A.M., Frontiers in keratodermas: pushing the envelope. Trends Genet (1997) 13, 227-33. 50. Candi, E., R. Schmidt, and G. Melino, The cornified envelope: a model of cell death in the skin. Nat Rev Mol Cell Biol (2005) 6, 328-40. 51. Resing, K.A., K.A. Walsh, and B.A. Dale, Identification of two intermediates during processing of profilaggrin to filaggrin in neonatal mouse epidermis. J Cell Biol (1984) 99, 1372-8. 52. Ishida-Yamamoto, A., et al., Translocation of profilaggrin N-terminal domain into keratinocyte nuclei with fragmented DNA in normal human skin and loricrin keratoderma. Lab Invest (1998) 78, 1245-53. 53. Rawlings, A.V., et al., Stratum corneum moisturization at the molecular level. J Invest Dermatol (1994) 103, 731-41. 54. Presland, R.B., et al., Loss of normal profilaggrin and filaggrin in flaky tail (ft/ft) mice: an animal model for the filaggrin-deficient skin disease ichthyosis vulgaris. J Invest Dermatol (2000) 115, 1072-81. 55. List, K., et al., Loss of proteolytically processed filaggrin caused by epidermal deletion of Matriptase/MT-SP1. J Cell Biol (2003) 163, 901-10.

160 56. Denecker, G., et al., Caspase-14 protects against epidermal UVB photodamage and water loss. Nat Cell Biol (2007) 9, 666-74. 57. Smith, F.J., et al., Loss-of-function mutations in the gene encoding filaggrin cause ichthyosis vulgaris. Nat Genet (2006) 38, 337-42. 58. Bouwstra, J.A., et al., Structure of the skin barrier and its modulation by vesicular formulations. Prog Lipid Res (2003) 42, 1-36. 59. Denda, M., S. Fuziwara, and K. Inoue, Influx of calcium and chloride ions into epidermal keratinocytes regulates exocytosis of epidermal lamellar bodies and skin permeability barrier homeostasis. J Invest Dermatol (2003) 121, 362-7. 60. Hachem, J.P., et al., Serine protease signaling of epidermal permeability barrier homeostasis. J Invest Dermatol (2006) 126, 2074-86. 61. Choi, M.J. and H.I. Maibach, Role of ceramides in barrier function of healthy and diseased skin. Am J Clin Dermatol (2005) 6, 215-23. 62. Nemes, Z. and P.M. Steinert, Bricks and mortar of the epidermal barrier. Exp Mol Med (1999) 31, 5-19. 63. Traupe, H., The ichthyosis. A guide to clinical diagnosis, genetic counselling, and therapy, ed. p168-178 1989, Berlin Heidelberg: Springer-Verlag Ed. 64. Swanbeck, G. and N. Thyresson, A study of the state of aggregation of the lipids in normal and psoriatic horny layer. Acta Derm Venereol (1962) 42, 445-7. 65. de Jager, M.W., et al., Novel lipid mixtures based on synthetic ceramides reproduce the unique stratum corneum lipid organization. J Lipid Res (2004) 45, 923-32. 66. Swartzendruber, D.C., et al., Molecular models of the intercellular lipid lamellae in mammalian stratum corneum. J Invest Dermatol (1989) 92, 251-7. 67. Schmid, M.H. and H.C. Korting, The concept of the acid mantle of the skin: its relevance for the choice of skin cleansers. Dermatology (1995) 191, 276-80. 68. Rippke, F., V. Schreiner, and H.J. Schwanitz, The acidic milieu of the horny layer: new findings on the physiology and pathophysiology of skin pH. Am J Clin Dermatol (2002) 3, 261-72. 69. Braff, M.H., et al., Cutaneous defense mechanisms by antimicrobial peptides. J Invest Dermatol (2005) 125, 9-13. 70. Nizet, V., et al., Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature (2001) 414, 454-7. 71. Richard, G., Molecular genetics of the ichthyoses. Am J Med Genet C Semin Med Genet (2004) 131C, 32-44. 72. Oji, V. and H. Traupe, Ichthyoses: differential diagnosis and molecular genetics. Eur J Dermatol (2006) 16, 349-59. 73. Jarnik, M., et al., Quasi-normal cornified cell envelopes in loricrin knockout mice imply the existence of a loricrin backup system. J Invest Dermatol (2002) 118, 102-9. 74. Djian, P., K. Easley, and H. Green, Targeted ablation of the murine involucrin gene. J Cell Biol (2000) 151, 381-8. 75. Puente, X.S., et al., Human and mouse proteases: a comparative genomic approach. Nat Rev Genet (2003) 4, 544-58. 76. Schechter, I. and A. Berger, On the size of the active site in proteases. I. Papain. Biochem Biophys Res Commun (1967) 27, 157-62. 77. Barrett, A.J., N.D. Rawlings, and J.F. Woessner, Handbook of Proteolytic Enzymes. Academic Press ed 2004, London. 78. Hengartner, M.O., The biochemistry of apoptosis. Nature (2000) 407, 770-6. 79. Bannwarth, L. and M. Reboud-Ravaux, An alternative strategy for inhibiting multidrug-resistant mutants of the dimeric HIV-1 protease by targeting the subunit interface. Biochem Soc Trans (2007) 35, 551-4. 80. Kleiner, D.E. and W.G. Stetler-Stevenson, Matrix metalloproteinases and metastasis. Cancer Chemother Pharmacol (1999) 43 Suppl, S42-51. 81. Balbin, M., et al., Loss of collagenase-2 confers increased skin tumor susceptibility to male mice. Nat Genet (2003) 35, 252-7. 82. Page-McCaw, A., A.J. Ewald, and Z. Werb, Matrix metalloproteinases and the regulation of tissue remodelling. Nat Rev Mol Cell Biol (2007) 8, 221-33. 83. Rawlings, N.D., D.P. Tolle, and A.J. Barrett, Evolutionary families of peptidase inhibitors. Biochem J (2004) 378, 705-16. 84. Kazal, L., D. Spicer, and R. Brahinsky, Isolation of a crystalline trypsin inhibitor- anticoagulant protein from the pancreas. J Am. Chem. Soc. (1948) 70, 3034-3040.

161 85. Witt, H., et al., Mutations in the gene encoding the serine protease inhibitor, Kazal type 1 are associated with chronic pancreatitis. Nat Genet (2000) 25, 213-6. 86. Bode, W. and R. Huber, Proteinase-protein inhibitor interaction. Biomed Biochim Acta (1991) 50, 437-46. 87. Lu, S.M., et al., Predicting the reactivity of proteins from their sequence alone: Kazal family of protein inhibitors of serine proteinases. Proc Natl Acad Sci U S A (2001) 98, 1410-5. 88. Ye, S. and E.J. Goldsmith, Serpins and other covalent protease inhibitors. Curr Opin Struct Biol (2001) 11, 740-5. 89. Caubet, C., et al., Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J Invest Dermatol (2004) 122, 1235-44. 90. Komatsu, N., et al., Expression and localization of tissue kallikrein mRNAs in human epidermis and appendages. J Invest Dermatol (2003) 121, 542-9. 91. Komatsu, N., et al., Multiple tissue kallikrein mRNA and protein expression in normal skin and skin diseases. Br J Dermatol (2005) 153, 274-81. 92. Komatsu, N., et al., Quantification of human tissue kallikreins in the stratum corneum: dependence on age and gender. J Invest Dermatol (2005) 125, 1182-9. 93. Kishibe, M., et al., Kallikrein 8 is involved in skin desquamation in cooperation with other kallikreins. J Biol Chem (2007) 282, 5834-41. 94. Stefansson, K., et al., Kallikrein-related peptidase 14 may be a major contributor to trypsin-like proteolytic activity in human stratum corneum. Biol Chem (2006) 387, 761-8. 95. Brattsand, M., et al., A proteolytic cascade of kallikreins in the stratum corneum. J Invest Dermatol (2005) 124, 198-203. 96. Borgono, C.A., et al., A potential role for multiple tissue kallikrein serine proteases in epidermal desquamation. J Biol Chem (2007) 282, 3640-52. 97. Bernard, D., et al., Analysis of proteins with caseinolytic activity in a human stratum corneum extract revealed a yet unidentified cysteine protease and identified the so- called "stratum corneum thiol protease" as cathepsin l2. J Invest Dermatol (2003) 120, 592-600. 98. Igarashi, S., et al., Cathepsin D, but not cathepsin E, degrades desmosomes during epidermal desquamation. Br J Dermatol (2004) 151, 355-61. 99. Pearton, D.J., B.A. Dale, and R.B. Presland, Functional analysis of the profilaggrin N- terminal peptide: identification of domains that regulate nuclear and cytoplasmic distribution. J Invest Dermatol (2002) 119, 661-9. 100. Resing, K.A., et al., Characterization of profilaggrin endoproteinase 1. A regulated cytoplasmic endoproteinase of epidermis. J Biol Chem (1995) 270, 28193-8. 101. Yamazaki, M., et al., Cytoplasmic processing of human profilaggrin by active mu- calpain. Biochem Biophys Res Commun (1997) 235, 652-6. 102. Pearton, D.J., et al., Proprotein convertase expression and localization in epidermis: evidence for multiple roles and substrates. Exp Dermatol (2001) 10, 193-203. 103. Leyvraz, C., et al., The epidermal barrier function is dependent on the serine protease CAP1/Prss8. J Cell Biol (2005) 170, 487-96. 104. Egberts, F., et al., Cathepsin D is involved in the regulation of transglutaminase 1 and epidermal differentiation. J Cell Sci (2004) 117, 2295-307. 105. Zeeuwen, P.L., et al., Evidence that unrestricted legumain activity is involved in disturbed epidermal cornification in cystatin M/E deficient mice. Hum Mol Genet (2004) 13, 1069-79. 106. Roth, W., et al., Cathepsin L deficiency as molecular defect of furless: hyperproliferation of keratinocytes and pertubation of hair follicle cycling. Faseb J (2000) 14, 2075-86. 107. Tobin, D.J., et al., The lysosomal protease cathepsin L is an important regulator of keratinocyte and melanocyte differentiation during hair follicle morphogenesis and cycling. Am J Pathol (2002) 160, 1807-21. 108. Toomes, C., et al., Loss-of-function mutations in the cathepsin C gene result in periodontal disease and palmoplantar keratosis. Nat Genet (1999) 23, 421-4. 109. Murakami, M., et al., Postsecretory processing generates multiple cathelicidins for enhanced topical antimicrobial defense. J Immunol (2004) 172, 3070-7.

162 110. Schalkwijk, J., O. Wiedow, and S. Hirose, The trappin gene family: proteins defined by an N-terminal transglutaminase substrate domain and a C-terminal four-disulphide core. Biochem J (1999) 340 ( Pt 3), 569-77. 111. Ashcroft, G.S., et al., Secretory leukocyte protease inhibitor mediates non-redundant functions necessary for normal wound healing. Nat Med (2000) 6, 1147-53. 112. Judge, M.R., G. Morgan, and J.I. Harper, A clinical and immunological study of Netherton's syndrome. Br J Dermatol (1994) 131, 615-21. 113. Altman, J. and J. Stroud, Neterton's syndrome and ichthyosis linearis circumflexa. Arch Dermatol (1969) 100, 550-8. 114. Stevanovic, D.V., Multiple defects of the hair shaft in Netherton's disease. Association with ichthyosis linearis circumflexa. Br J Dermatol (1969) 81, 851-7. 115. Ito, M., K. Ito, and K. Hashimoto, Pathogenesis in trichorrhexis invaginata (bamboo hair). J Invest Dermatol (1984) 83, 1-6. 116. Wilkinson, R.D., G.H. Curtis, and W.A. Hawk, Netherton's Disease; Trichorrhexis Invaginata (Bamboo Hair), Congenital Ichthyosiform Erythroderma and the Atopic Diathesis. A Histopathologic Study. Arch Dermatol (1964) 89, 46-54. 117. Sedlacek, V. and J. Krenar, [Symptomatology of Comel's linear circumflex ichthyosis (a case associated with genito-anal papillomatosis)]. Hautarzt (1971) 22, 390-7. 118. Krasagakis, K., et al., Early development of multiple epithelial neoplasms in Netherton syndrome. Dermatology (2003) 207, 182-4. 119. Hintner, H., E. Jaschke, and P. Fritsch, Netherton syndrome: weakened immunity, generalized verrucosis and carcinogenesis. Hautarzt (1980) 31, 428-32. 120. Saghari, S., H. Woolery-Lloyd, and K. Nouri, Squamous cell carcinoma in a patient with Netherton's syndrome. Int J Dermatol (2002) 41, 415-6. 121. De Felipe, I., F.J. Vazquez-Doval, and J. Vicente, Comel-Netherton syndrome. A diagnostic challenge. Br J Dermatol (1997) 137, 468-9. 122. Hausser, I. and I. Anton-Lamprecht, Severe congenital generalized exfoliative erythroderma in newborns and infants: a possible sign of Netherton syndrome. Pediatr Dermatol (1996) 13, 183-99. 123. Muller, F.B., et al., Genetic analysis of a severe case of Netherton syndrome and application for prenatal testing. Br J Dermatol (2002) 146, 495-9. 124. Fartasch, M., M.L. Williams, and P.M. Elias, Altered lamellar body secretion and stratum corneum membrane structure in Netherton syndrome: differentiation from other infantile erythrodermas and pathogenic implications. Arch Dermatol (1999) 135, 823-32. 125. Hachem, J.P., et al., Serine protease activity and residual LEKTI expression determine phenotype in Netherton syndrome. J Invest Dermatol (2006) 126, 1609-21. 126. Descargues, P., et al., Corneodesmosomal cadherins are preferential targets of stratum corneum trypsin- and chymotrypsin-like hyperactivity in Netherton syndrome. J Invest Dermatol (2006) 126, 1622-32. 127. Smith, D.L., et al., Netherton's syndrome: a syndrome of elevated IgE and characteristic skin and hair findings. J Allergy Clin Immunol (1995) 95, 116-23. 128. Wehr, R.F., J. Hickman, and L. Krochmal, Effective treatment of Netherton's syndrome with 12% lactate lotion. J Am Acad Dermatol (1988) 19, 140-2. 129. Buxman, M., et al., Therapeutic activity of lactate 12% lotion in the treatment of ichthyosis. Active versus vehicle and active versus a petrolatum cream. J Am Acad Dermatol (1986) 15, 1253-8. 130. Halverstam, C.P., A. Vachharajani, and S.B. Mallory, Cushing syndrome from percutaneous absorption of 1% hydrocortisone ointment in Netherton syndrome. Pediatr Dermatol (2007) 24, 42-5. 131. Capezzera, R., et al., UVA1 phototherapy of Netherton syndrome. Acta Derm Venereol (2004) 84, 69-70. 132. Godic, A. and V. Dragos, Successful treatment of Netherton's syndrome with topical calcipotriol. Eur J Dermatol (2004) 14, 115-7. 133. Allen, A., et al., Significant absorption of topical tacrolimus in 3 patients with Netherton syndrome. Arch Dermatol (2001) 137, 747-50. 134. Chavanas, S., et al., Localization of the Netherton syndrome gene to chromosome 5q32, by linkage analysis and homozygosity mapping. Am J Hum Genet (2000) 66, 914-21.

163 135. Chavanas, S., et al., Mutations in SPINK5, encoding a serine protease inhibitor, cause netherton syndrome. Nat Genet. (2000) 25, 141-2. 136. Bitoun, E., et al., Netherton syndrome: disease expression and spectrum of SPINK5 mutations in 21 families. J Invest Dermatol (2002) 118, 352-61. 137. Magert, H.J., et al., LEKTI, a novel 15-domain type of human serine proteinase inhibitor. J Biol Chem (1999) 274, 21499-502. 138. Magert, H.J., et al., The 15-domain serine proteinase inhibitor LEKTI: biochemical properties, genomic organization, and pathophysiological role. Eur J Med Res (2002) 7, 49-56. 139. Lauber, T., et al., Homologous proteins with different folds: the three-dimensional structures of domains 1 and 6 of the multiple Kazal-type inhibitor LEKTI. J Mol Biol (2003) 328, 205-19. 140. Seidah, N.G. and M. Chretien, Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides. Brain Res (1999) 848, 45-62. 141. Magert, H.J., K. Drogemuller, and M. Raghunath, Serine proteinase inhibitors in the skin: role in homeostasis and disease. Curr Protein Pept Sci (2005) 6, 241-54. 142. Galliano, M.F., et al., Characterization and expression analysis of the Spink5 gene, the mouse ortholog of the defective gene in Netherton syndrome. Genomics (2005) 85, 483-92. 143. Kreutzmann, P., et al., Recombinant production, purification and biochemical characterization of domain 6 of LEKTI: a temporary Kazal-type-related serine proteinase inhibitor. J Chromatogr B Analyt Technol Biomed Life Sci (2004) 803, 75- 81. 144. Mitsudo, K., et al., Inhibition of serine proteinases plasmin, trypsin, subtilisin A, cathepsin G, and elastase by LEKTI: a kinetic analysis. Biochemistry (2003) 42, 3874-81. 145. Vickery, B.P., Skin barrier function in atopic dermatitis. Curr Opin Pediatr (2007) 19, 89-93. 146. Walley, A.J., et al., Gene polymorphism in Netherton and common atopic disease. Nat Genet (2001) 29, 175-8. 147. Kato, A., et al., Association of SPINK5 gene polymorphisms with atopic dermatitis in the Japanese population. Br J Dermatol (2003) 148, 665-9. 148. Nishio, Y., et al., Association between polymorphisms in the SPINK5 gene and atopic dermatitis in the Japanese. Genes Immun (2003) 4, 515-7. 149. Mischke, D., et al., Genes encoding structural proteins of epidermal cornification and S100 calcium-binding proteins form a gene complex ("epidermal differentiation complex") on human chromosome 1q21. J Invest Dermatol (1996) 106, 989-92. 150. Palmer, C.N., et al., Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nat Genet (2006) 38, 441-6. 151. Sandilands, A., et al., Comprehensive analysis of the gene encoding filaggrin uncovers prevalent and rare mutations in ichthyosis vulgaris and atopic eczema. Nat Genet (2007) 39, 650-4. 152. Weidinger, S., et al., Loss-of-function variations within the filaggrin gene predispose for atopic dermatitis with allergic sensitizations. J Allergy Clin Immunol (2006) 118, 214-9. 153. Nakayama, K., Furin: a mammalian subtilisin/Kex2p-like endoprotease involved in processing of a wide variety of precursor proteins. Biochem J (1997) 327 ( Pt 3), 625- 35. 154. Roebroek, A.J., et al., Failure of ventral closure and axial rotation in embryos lacking the proprotein convertase Furin. Development (1998) 125, 4863-76. 155. Lee, R.T., G. Lauc, and Y.C. Lee, Glycoproteomics: protein modifications for versatile functions. Meeting on glycoproteomics. EMBO Rep (2005) 6, 1018-22. 156. Komatsu, N., et al., Elevated stratum corneum hydrolytic activity in Netherton syndrome suggests an inhibitory regulation of desquamation by SPINK5-derived peptides. J Invest Dermatol (2002) 118, 436-43. 157. Dabich, D., E.C. Yurewicz, and V.A. Battel, Deglycosylation with trifluoromethanesulfonic acid differentially affects inhibitor activities of turkey ovomucoid. Biochim Biophys Acta (1993) 1164, 47-53.

164 158. Ekholm, I.E., M. Brattsand, and T. Egelrud, Stratum corneum tryptic enzyme in normal epidermis: a missing link in the desquamation process? J Invest Dermatol (2000) 114, 56-63. 159. Harrison, P.M., et al., The prion folding problem. Curr Opin Struct Biol (1997) 7, 53-9. 160. Tidow, H., et al., The solution structure of a chimeric LEKTI domain reveals a chameleon sequence. Biochemistry (2004) 43, 11238-47. 161. Tian, M. and S. Kamoun, A two disulfide bridge Kazal domain from Phytophthora exhibits stable inhibitory activity against serine proteases of the subtilisin family. BMC Biochem (2005) 6, 15. 162. Laskowski, M., Jr., M.A. Qasim, and S.M. Lu, Interaction of standard mechanism, canonical protein inhibitors with serine proteinases. Kleanthous, C ed 2003, Oxford: Oxford University Press. 163. Chikakane, K. and H. Takahashi, Measurement of skin pH and its significance in cutaneous diseases. Clin Dermatol (1995) 13, 299-306. 164. Wu, H., J.R. Stanley, and G. Cotsarelis, Desmoglein isotype expression in the hair follicle and its cysts correlates with type of keratinization and degree of differentiation. J Invest Dermatol (2003) 120, 1052-7. 165. Gebhard, L.G., et al., A Kazal prolyl endopeptidase inhibitor isolated from the skin of Phyllomedusa sauvagii. Eur J Biochem (2004) 271, 2117-26. 166. Wu, Z., Analysis of Two Human Gene Clusters Involved in Innate Immunity. 2005, Universität zu Kiel: Kiel. 167. Van Gysel, D., et al., Clinico-immunological heterogeneity in Comel-Netherton syndrome. Dermatology (2001) 202, 99-107. 168. Okkerse, A., A.P. Oranje, and P.C. de Laat, Comel-Netherton syndrome. Br J Dermatol (1994) 131, 725-6. 169. Cookson, W., The alliance of genes and environment in asthma and allergy. Nature (1999) 402, B5-B10. 170. Kabesch, M., et al., Association between polymorphisms in serine protease inhibitor, kazal type 5 and asthma phenotypes in a large German population sample. Clin Exp Allergy (2004) 34, 340-5. 171. Moffatt, M.F., SPINK5: a gene for atopic dermatitis and asthma. Clin Exp Allergy (2004) 34, 325-7. 172. Nakamura, T., et al., Reduction of skin barrier function by proteolytic activity of a recombinant house dust mite major allergen Der f 1. J Invest Dermatol (2006) 126, 2719-23. 173. Nylander-Lundqvist, E. and T. Egelrud, Formation of active IL-1 beta from pro-IL-1 beta catalyzed by stratum corneum chymotryptic enzyme in vitro. Acta Derm Venereol (1997) 77, 203-6. 174. Hansson, L., et al., Epidermal overexpression of stratum corneum chymotryptic enzyme in mice: a model for chronic itchy dermatitis. J Invest Dermatol (2002) 118, 444-9. 175. Briot, A., et al. IL1b and Tryptase Contribute to Inflammatory Changes in Spink5- Deficient Skin Grafts. in 36th Annual European Society for Dermatological Research. 2006. Paris. 176. Steinhoff, M., et al., Proteinase-activated receptor-2 in human skin: tissue distribution and activation of keratinocytes by mast cell tryptase. Exp Dermatol (1999) 8, 282-94. 177. Buddenkotte, J., et al., Agonists of proteinase-activated receptor-2 stimulate upregulation of intercellular cell adhesion molecule-1 in primary human keratinocytes via activation of NF-kappa B. J Invest Dermatol (2005) 124, 38-45. 178. Oikonomopoulou, K., et al., Proteinase-activated receptors, targets for kallikrein signaling. J Biol Chem (2006) 281, 32095-112. 179. Watanabe, N., et al., Hassall's corpuscles instruct dendritic cells to induce CD4+CD25+ regulatory T cells in human thymus. Nature (2005) 436, 1181-5. 180. Kim, M.G., et al., Cloning and chromosomal mapping of a gene isolated from thymic stromal cells encoding a new mouse type II membrane serine protease, epithin, containing four LDL receptor modules and two CUB domains. Immunogenetics (1999) 49, 420-8. 181. Bowlus, C.L., et al., Cloning of a novel MHC-encoded serine peptidase highly expressed by cortical epithelial cells of the thymus. Cell Immunol (1999) 196, 80-6.

165 182. Komatsu, N., et al., Proteolytic processing of human growth hormone by multiple tissue kallikreins and regulation by the serine protease inhibitor Kazal-Type5 (SPINK5) protein. Clin Chim Acta (2007) 377, 228-36. 183. Toulza, E., et al., Large-scale identification of human genes implicated in epidermal barrier function. Genome Biol (2007) 8, R107. 184. Stevenson, B.J., O. Hagenbuchle, and P.K. Wellauer, Sequence organisation and transcriptional regulation of the mouse elastase II and trypsin genes. Nucleic Acids Res (1986) 14, 8307-30. 185. Kawashima, I., et al., Characterization of pancreatic elastase II cDNAs: two elastase II mRNAs are expressed in human pancreas. DNA (1987) 6, 163-72. 186. Dinarello, C.A., Biology of interleukin 1. Faseb J (1988) 2, 108-15. 187. Hazuda, D.J., et al., Processing of precursor interleukin 1 beta and inflammatory disease. J Biol Chem (1990) 265, 6318-22. 188. Meyer-Hoffert, U., J. Wingertszahn, and O. Wiedow, Human leukocyte elastase induces keratinocyte proliferation by epidermal growth factor receptor activation. J Invest Dermatol (2004) 123, 338-45. 189. Rogalski, C., et al., Human leukocyte elastase induces keratinocyte proliferation in vitro and in vivo. J Invest Dermatol (2002) 118, 49-54. 190. Mazereeuw-Hautier, J., et al., Topical recombinant alpha1-antitrypsin: a potential treatment for Netherton syndrome? Arch Dermatol (2006) 142, 396-8. 191. Bos, J.D. and M.M. Meinardi, The 500 Dalton rule for the skin penetration of chemical compounds and drugs. Exp Dermatol (2000) 9, 165-9. 192. Michael, I.P., et al., Biochemical and enzymatic characterization of human kallikrein 5 (hK5), a novel serine protease potentially involved in cancer progression. J Biol Chem (2005) 280, 14628-35. 193. Komatsu, N., et al., Human tissue kallikrein expression in the stratum corneum and serum of atopic dermatitis patients. Exp Dermatol (2007) 16, 513-9. 194. Debela, M., et al., Structural Basis of the Zinc Inhibition of Human Tissue Kallikrein 5. J Mol Biol (2007). 195. Fernandez, I.S., et al., Crystallization and preliminary crystallographic studies of human kallikrein 7, a serine protease of the multigene kallikrein family. Acta Crystallogr Sect F Struct Biol Cryst Commun (2007) 63, 669-72. 196. Vasilopoulos, Y., et al., Genetic association between an AACC insertion in the 3'UTR of the stratum corneum chymotryptic enzyme gene and atopic dermatitis. J Invest Dermatol (2004) 123, 62-6. 197. Klokk, T.I., X. Zhijun, and S. Fahri, Human Tissue Kallikreins – A Family with many surprises. Turk J Biochem (2006) 31, 69-78. 198. Turksen, K. and T.C. Troy, Permeability barrier dysfunction in transgenic mice overexpressing claudin 6. Development (2002) 129, 1775-84. 199. Vasioukhin, V., et al., Desmoplakin is essential in epidermal sheet formation. Nat Cell Biol (2001) 3, 1076-85. 200. Chidgey, M., et al., Mice lacking desmocollin 1 show epidermal fragility accompanied by barrier defects and abnormal differentiation. J Cell Biol (2001) 155, 821-32. 201. Hara-Chikuma, M., et al., Epidermal-specific defect of GPI anchor in Pig-a null mice results in Harlequin ichthyosis-like features. J Invest Dermatol (2004) 123, 464-9. 202. Jennemann, R., et al., Integrity and barrier function of the epidermis critically depend on glucosylceramide synthesis. J Biol Chem (2007) 282, 3083-94. 203. Herrmann, T., et al., Mice with targeted disruption of the fatty acid transport protein 4 (Fatp 4, Slc27a4) gene show features of lethal restrictive dermopathy. J Cell Biol (2003) 161, 1105-15. 204. Vasireddy, V., et al., Loss of functional ELOVL4 depletes very long-chain fatty acids (> or =C28) and the unique omega-O-acylceramides in skin leading to neonatal death. Hum Mol Genet (2007) 16, 471-82. 205. Segre, J.A., C. Bauer, and E. Fuchs, Klf4 is a transcription factor required for establishing the barrier function of the skin. Nat Genet (1999) 22, 356-60. 206. de Guzman Strong, C., et al., Lipid defect underlies selective skin barrier impairment of an epidermal-specific deletion of Gata-3. J Cell Biol (2006) 175, 661-70. 207. Ting, S.B., et al., A homolog of Drosophila grainy head is essential for epidermal integrity in mice. Science (2005) 308, 411-3.

166 208. Geng, S., et al., Targeted ablation of Arnt in mouse epidermis results in profound defects in desquamation and epidermal barrier function. J Cell Sci (2006) 119, 4901- 12. 209. Gareus, R., et al., Normal epidermal differentiation but impaired skin-barrier formation upon keratinocyte-restricted IKK1 ablation. Nat Cell Biol (2007) 9, 461-9. 210. Attar, P.S., et al., Inhibition of retinoid signaling in transgenic mice alters lipid processing and disrupts epidermal barrier function. Mol Endocrinol (1997) 11, 792- 800. 211. Epp, N., et al., 12R-lipoxygenase deficiency disrupts epidermal barrier function. J Cell Biol (2007) 177, 173-82. 212. Hewett, D.R., et al., Lethal, neonatal ichthyosis with increased proteolytic processing of filaggrin in a mouse model of Netherton syndrome. Hum Mol Genet (2005) 14, 335-46. 213. Yang, T., et al., Epidermal detachment, desmosomal dissociation, and destabilization of corneodesmosin in Spink5-/- mice. Genes Dev (2004) 18, 2354-8. 214. Green, K.J. and C.A. Gaudry, Are desmosomes more than tethers for intermediate filaments? Nat Rev Mol Cell Biol (2000) 1, 208-16. 215. Turk, B., Targeting proteases: successes, failures and future prospects. Nat Rev Drug Discov (2006) 5, 785-99. 216. Whitcomb, D.C., et al., Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet (1996) 14, 141-5. 217. Schechter, N.M., et al., Inhibition of human kallikreins 5 and 7 by the serine protease inhibitor lympho-epithelial Kazal-type inhibitor (LEKTI). Biol Chem (2005) 386, 1173- 84. 218. Egelrud, T., et al., hK5 and hK7, two serine proteinases abundant in human skin, are inhibited by LEKTI domain 6. Br J Dermatol (2005) 153, 1200-3. 219. Jayakumar, A., et al., Expression of LEKTI domains 6-9' in the baculovirus expression system: recombinant LEKTI domains 6-9' inhibit trypsin and subtilisin A. Protein Expr Purif (2004) 35, 93-101. 220. Smith, P.K. and J.I. Harper, Serine proteases, their inhibitors and allergy. Allergy (2006) 61, 1441-7.

167 168 Annexes

169 170 Annexe 1

Bitoun E, Micheloni A, Lamant L, Bonnart C, Tartaglia-Polcini A, Cobbold C, Al Saati T, Mariotti F, Mazereeuw-Hautier J, Boralevi F, Hohl D, Harper J, Bodemer C, D’Alessio M, Hovnanian A. LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome. Hum Mol Genet, 2003, 12:2417-2430.

171 172 Human Molecular Genetics, 2003, Vol. 12, No. 19 2417–2430 DOI: 10.1093/hmg/ddg247 LEKTI proteolytic processing in human primary keratinocytes, tissue distribution and defective expression in Netherton syndrome

Emmanuelle Bitoun1,{, Alessia Micheloni2,{, Laurence Lamant3, Chrystelle Bonnart3, Alessandro Tartaglia-Polcini2, Christian Cobbold1, Talal Al Saati3, Feliciana Mariotti2, Juliette Mazereeuw-Hautier3, Franck Boralevi4, Daniel Hohl5, John Harper6, Christine Bodemer7, Marina D’Alessio2 and Alain Hovnanian1,3,*

1Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford OX3 7BN, UK, 2Immacolata Dermatological Hospital, IDI-IRCCS, Rome 00167, Italy, 3INSERM U563, Purpan Hospital, Toulouse 31059, France, 4Pellegrin Hospital for Children, Bordeaux 33076, France, 5Department of Dermatology, CHUV Beaumont Hospital, Lausanne CH1011, Switzerland, 6Great Ormond Street Hospital for Children, London WC1N 3JH, UK and 7Department of Dermatology, Necker Hospital, Paris 71015, France

Received April 25, 2003; Revised and Accepted July 16, 2003

SPINK5, encoding the putative multi-domain serine protease inhibitor LEKTI, was recently identified as the defective gene in the severe autosomal recessive ichthyosiform skin condition, Netherton syndrome (NS). Using monoclonal and polyclonal antibodies, we show that LEKTI is a marker of epithelial differentiation, strongly expressed in the granular and uppermost spinous layers of the epidermis, and in differentiated layers of stratified epithelia. LEKTI expression was also demonstrated in normal differentiated human primary keratinocytes (HK) through detection of a 145 kDa full-length protein and a shorter isoform of 125 kDa. Both proteins are N-glycosylated and rapidly processed in a post-endoplasmic reticulum compartment into at least three C-terminal fragments of 42, 65 and 68 kDa, also identified in conditioned media. Processing of the 145 and 125 kDa precursors was prevented in HK by treatment with a furin inhibitor. In addition, in vitro cleavage of the recombinant 145 kDa precursor by furin generated C-terminal fragments of 65 and 68 kDa, further supporting the involvement of furin in LEKTI processing. In contrast, LEKTI precursors and proteolytic fragments were not detected in differentiated HK from NS patients. Defective expression of LEKTI in skin sections was a constant feature in NS patients, whilst an extended reactivity pattern was observed in samples from other keratinizing disorders, demonstrating that loss of LEKTI expression in the epidermis is a diagnostic feature of NS. The identification of novel processed forms of LEKTI provides the basis for future functional and structural studies of fragments with physiological relevance.

INTRODUCTION into a milder condition known as ichthyosis linearis circumflexa (1–3). Trichorrhexis invaginata is detectable by light micro- Netherton syndrome (NS; MIM 256500) is a severe autosomal scopy on a variable proportion of scalp and eyebrow hairs, and recessive skin disorder characterized by ichthyosiform erythro- corresponds to the atrophy and invagination of their distal parts derma, a specific bamboo hair defect (trichorrhexis invaginata) (2,4). Patients display a broad range of allergic manifestations and atopy. NS infants typically present at birth or soon after including atopic dermatitis, and markedly elevated serum with generalized exfoliative erythroderma, which persists IgE levels (5,6). Most patients also experience recurrent, if throughout life in the most severe cases or gradually evolves not persistent, bacterial infections (7). Histological and

*To whom correspondence should be addressed at: INSERM U563, Purpan Hospital, Place du Dr Baylac, 31059 Toulouse cedex 3, France. Tel: þ33 561158432; Fax: þ33 561499036; Email: [email protected] {The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.

Human Molecular Genetics, Vol. 12, No. 19 # Oxford University Press 2003; all rights reserved 2418 Human Molecular Genetics, 2003, Vol. 12, No. 19 ultrastructural studies reveal an incomplete keratinization of the epidermis and severely impaired cornification. The granular layer is greatly reduced and may be lacking completely. The highly variable clinical presentation, together with the commonly delayed appearance of the pathognomonic bamboo hair after infancy, makes NS difficult to diagnose in early life. In the absence of specific treatment, NS prognosis is poor. The neonatal period is often associated with a profound failure to thrive, which leads to a fatal course in up to 20% of the cases (8). We recently identified SPINK5 (serine protease inhibitor Kazal-type 5) as the defective gene in NS (9,10). A total of 34 SPINK5 mutations have been reported in patients, all of which create premature termination codons of translation (10–13). Northern blot analyses revealed a dramatic reduction of the 3.7 kb SPINK5 transcript levels in cultured human primary keratinocytes (HK) from the majority of patients examined (10,12), suggesting defective protein expression. SPINK5 Figure 1. Immunolocalization of LEKTI in HK. HK were cultured in prolifer- encodes LEKTI (lympho-epithelial Kazal-type related inhibi- ating (low-calcium medium; A) or differentiating (high-calcium medium; B–F) conditions for 24 h, and processed for immunofluorescence microscopy analy- tor), a predicted serine protease inhibitor. The protein consists sis as described in Materials and Methods. (A–C) Cells were immunostained of 1064 amino acids organized into 15 potential inhibitory with LEKTI polyclonal a-C antibodies (green) pre-incubated in the presence Kazal-type domains (D1–D15), preceded by a signal peptide. (þ) or absence () of the recombinant antigen GST-D13-D15 prior to immu- Only D2 and D15 perfectly match the typical Kazal motif nodetection. Cells were counterstained with propidium iodide to reveal nuclei (red). (D–F) Cells were double stained with a-C (D) and anti-calreticulin (E) [C-(X)n-C-(X)7-C-(X)10-C-(X)2/3-C-(X)m-C], whilst other antibodies. The degree of overlap between the two proteins is represented by domains exhibit a Kazal-type-derived four-cysteine residue the yellow signal in the merged image (F). The results shown are representative pattern. The isolation of individual domains D1, D5 and D6 of three to five independent experiments. from human hemofiltrate (14,15) revealed that LEKTI full- length protein most likely represents an inactive precursor, the proteolytic processing of which would be required for the that both precursors are N-glycosylated and rapidly cleaved in a release of bioactive forms. A 30 kDa polypeptide with an N- post-endoplasmic reticulum compartment to generate at least terminal sequence matching D8 of LEKTI was also purified three C-terminal fragments, and provide evidence that furin is from HK conditioned medium (16). involved in LEKTI processing. We also describe the protein Subtilisin-like proprotein convertases (SPC) are a family of expression in normal stratified epithelia, and demonstrate that endoproteases responsible for the processing of numerous loss of LEKTI expression in the epidermis is a diagnostic inactive prohormones and other proproteins into their biologi- feature of NS. cally active forms (17). SPCs display a specific tissue distribution and cellular localization (17), and cleave their substrates at the general motif (K/R)-Xn-(K/R);(n ¼ 0, 2, 4 or RESULTS 6; X-any amino acid) (18). A number of these consensus sequences have been identified within the amino-acid sequence Characterization of LEKTI expression in normal HK of LEKTI, suggesting that SPCs may be involved in the proteolytic processing of LEKTI (13). Given the predicted expression of LEKTI in the uppermost Analysis of the human tissue distribution of SPINK5 differentiated layers of the epidermis, we assessed the transcripts predicts high expression levels of LEKTI in thymus, immunospecificity of the newly generated antibodies on vaginal epithelium, oral mucosa, tonsils and Bartholin’s and proliferating and differentiated cultured HK. Terminal differ- parathyroid glands (14). More recently, in situ hybridization has entiation was induced by switching the ionic calcium content of revealed the localization of SPINK5 transcripts to the upper- the culture medium from low (<0.1 mM) to high (1.2 mM) most spinous layers and the granular layer of normal human concentrations, as previously described (19,20). epidermis (13). The authors also reported a marked increase in trypsin-like hydrolytic activity in the cornified layer of NS Immunolocalization of LEKTI. HK were cultured for 24 h in patients. This finding, together with the demonstration of a low or high calcium conditions and analysed by immunofluor- trypsin-inhibiting activity for D5 and D6 domains (14,15), escence microscopy using antibodies generated against the C- supports a key role for LEKTI in the regulation of proteolytic terminus of LEKTI (a-C). A strong labelling was observed in events involved in skin barrier formation and maintenance. differentiated cells (Fig. 1B; green) whilst only very low pro- To further characterize LEKTI human tissue distribution and tein levels were present in cells grown in proliferating condi- investigate protein expression in HK from normal controls and tions (Fig. 1A). No labelling was observed using pre-immune NS patients, we developed monoclonal and polyclonal anti-N, serum (data not shown). The specificity of labelling was subse- and polyclonal anti-C terminal, antibodies. We report the first quently confirmed by antigen competition experiment. detection of the full-length protein, together with the Incubation of antibodies with recombinant antigen, prior identification of a shorter isoform in normal HK. We show to immunodetection, led to a dramatic reduction in signal Human Molecular Genetics, 2003, Vol. 12, No. 19 2419

Figure 2. Molecular detection of LEKTI in HK. HK were cultured in proliferating (low-calcium medium) or differentiating (high-calcium medium) conditions for 24 h. Twenty microgram protein samples were separated by SDS–PAGE (7.5%) and analysed by western blot. (A) Total cell extracts (lanes 1 and 2) and conditioned medium (lane 3) from proliferating (lane 1) and differentiated (lanes 2 and 3) cells were analysed using LEKTI polyclonal a-C antibodies. Anti-tubulin detection shows equal loading of cell extracts. (B) Total cell extracts from differentiated cells were analysed using a-C antibodies (lanes 2 and 3) pre-incubated in the pre- sence (þ) or absence () of the recombinant antigen, or using the pre-immune serum (lane 1). (C) Total cell extracts from differentiated cells cultured for an additional 6 h in the presence (þ) or absence () of BFA at 10 mg/ml were analysed using LEKTI polyclonal a-C (lanes 1 and 2) and a-N (lanes 3 and 4) antibodies. (D) Total cell extracts from differentiated cells treated with BFAwere analysed using LEKTI polyclonal a-C (lanes 2 and 3) and a-N (lanes 5 and 6) antibodies pre- incubated in the presence (þ) or absence () of the respective recombinant antigens (GST-D13–D15 and GST-D1–D6), or using the corresponding pre-immune sera (lanes 1 and 4, respectively). The asterisk indicates an unrelated protein cross-reacting with a-N antibodies, which is also present in samples from NS patients (data not shown). Arrows indicate the positions of the 42, 65, 68, 125 and 145 kDa protein bands. Molecular weight markers are indicated on the left in kDa. The results shown are representative of three to five independent experiments. intensity (Fig. 1C). Since the labelling showed an extensive reti- cell extract (lane 2) and conditioned medium (lane 3) from cular pattern characteristic of the endoplasmic reticulum (ER), differentiated cells, but not in undifferentiated cells (lane 1). we performed double staining using a-C antibodies (Fig. 1D) These signals were not detected using pre-immune serum and an antibody specific for the ER marker protein, calreticulin (Fig. 2B; lane 1) or a-N antibodies (data not shown). As above, (Fig. 1E). Superimposition showed significant overlap (Fig. 1F), we confirmed the signal specificity by antigen competition indicating that the majority of LEKTI is localized in the ER. experiment (Fig. 2B; lanes 2 and 3). We also examined a Similar results were obtained using antibodies generated against lower protein molecular weight range, but no additional N- the N-terminus of LEKTI (a-N; data not shown). or C-terminal-specific fragments were identified by the corres- ponding antibodies (data not shown). The molecular weight of LEKTI predicted by the amino acid Molecular detection of LEKTI. HK were cultured as above, sequence is 118 kDa. Although both a-N and a-C antibodies and analysed by western blot using a-C antibodies (Fig. 2A). detected LEKTI in the ER of differentiated HK, only 42, 65 Three bands of 42, 65 and 68 kDa were detected in total and 68 kDa proteins were identified in the corresponding cell 2420 Human Molecular Genetics, 2003, Vol. 12, No. 19 extracts by a-C antibodies. These data suggest that LEKTI is rapidly processed in a post-ER compartment and that the 42, 65 and 68 kDa proteins represent C-terminal proteolytic forms. In an attempt to detect the full-length protein, we treated differentiated HK with brefeldin A (BFA), a drug that blocks ER to Golgi protein transport (21). Western blot analysis of these cell extracts (Fig. 2C) revealed two high molecular weight bands of 125 and 145 kDa using a-C (lane 2) and a-N (lane 4) polyclonal antibodies, that were not detected in the absence of BFA (lanes 1 and 3, respectively). Note that only very low levels of the three C-terminal fragments were detected under such conditions (lane 2). In contrast, pre- immune sera failed to recognize the 125 or 145 kDa proteins (Fig. 2D; lane 1, a-C and lane 4, a-N). The specificity of these bands was further confirmed by antigen competition experi- ments (Fig. 2D; lanes 2 and 3, a-C and lanes 5 and 6, a-N), indicating that both the 125 and 145 kDa proteins were derived from LEKTI. Figure 3. LEKTI glycosylation pattern. HK were differentiated for 24 h in high- calcium medium and cultured for an additional 6 h in the presence of BFA at LEKTI is expressed as two N-glycosylated 10 mg/ml (lanes 1 and 2). COS-1 cells were transiently transfected for 48 h with the pEF-DEST51-LEKTI construct containing LEKTI full-length cDNA (lanes precursor isoforms in HK 4 and 5), or with the empty pEF-DEST51 vector as control (lane 3). Twenty micrograms of total cell extracts from HK and COS-1 cells were incubated We previously detected the expression of a single 3.7 kb for 1 h at 37C in the presence (þ) or absence () of PNGase F. Samples were SPINK5 transcript in cultured HK (10,12), whose size is resolved by SDS–PAGE (5%) and analysed by western blot using LEKTI consistent with the full-length protein (14). Since BFA polyclonal a-C antibodies. Arrows indicate the positions of the 115 and treatment revealed two specific signals, we tested whether the 135 kDa de-glycosylated protein forms. Molecular weight markers are indicated on the left in kDa. The results shown are representative of three to five indepen- 145 kDa band could correspond to the glycosylated form of dent experiments. the 125 kDa protein, which approximately matches LEKTI predicted size. Total cell extracts from differentiated HK treated with BFA were incubated in the presence or absence of the (lane 3), and were not observed in total cell extracts (lane peptide N-glycosidase F (PGNaseF) and analysed by western 1), or after a short 3 min incubation (lane 2), a time when the blot using a-C antibodies. PGNase F treatment resulted in a 145 kDa full-length protein was evident. Importantly, an molecular weight shift of 10 kDa for both proteins (Fig. 3; increase in intensity of the 65 and 68 kDa proteolytic compare lanes 1 and 2). These results indicate that the 125 and fragments was observed with increasing incubation times, 145 kDa bands correspond to N-glycosylated forms of two and was mirrored by a loss in signal of the full-length protein separate precursors of LEKTI, with apparent molecular (compare lanes 2–6). Processing reached a maximum at weights of 115 and 135 kDa, respectively. 60 min, when very little precursor protein was detected (lane To confirm the identity of the 145 kDa band as the N- 6). In contrast, mock-treated cells showed no processing of glycosylated form of LEKTI full-length precursor, COS-1 cells LEKTI after 60 min (lane 7). The 65 and 68 kDa proteolytic were transfected with full-length LEKTI cDNA. Western blot products generated from incubation of over-expressed LEKTI analysis using a-N (data not shown) or a-C (Fig. 3) antibodies with furin in these experiments migrated at the same size as showed expression of a 145 kDa band in total protein extract two of the C-terminal proteolytic forms identified in HK from LEKTI cDNA transfected cells (lane 4), but not from (Fig. 2). mock transfected cells (lane 3). A 135 kDa protein was detected To confirm the involvement of furin in the physiological after PGNaseF treatment (lane 5), consistent with the result processing of LEKTI, differentiated HK were cultured for 6 h obtained in HK (lane 2). with increasing concentrations of the furin inhibitor, Dec- RVKR-CMK, or in the presence of brefeldin A (BFA) as a Furin is involved in the processing of LEKTI in HK control (Fig. 4B). Consistent with our previous results (Fig. 2), incubation with BFA led to the detection of the The absence of cleavage of the recombinant full-length protein 125 and 145 kDa proteins, with the concomitant loss of 42, in COS-1 cells prompted us to test furin, a subtilisin-like 65 and 68 kDa proteolytic fragments (lane 4), whilst the proprotein convertase expressed in the epidermis (22), as a precursors were not observed in untreated cells (lane 1). potential candidate for the endoproteolytic processing of Significantly, incubation with the furin inhibitor (lanes 2 LEKTI. and 3) had a similar effect to that of BFA: there was a strong Protein extracts from COS-1 cells overexpressing LEKTI inhibition of processing of the native 125 and 145 kDa were incubated with human recombinant furin for increasing precursors into the 42, 65 and 68 kDa proteolytic forms. times, and analysed by western blot using a-C antibodies These results further implicate furin in the processing of (Fig. 4A). Interestingly, the appearance of 65 and 68 kDa LEKTI precursors into the three C-terminal proteolytic forms fragments were first detected 7 min after furin addition identified in HK extracts. Human Molecular Genetics, 2003, Vol. 12, No. 19 2421

Figure 4. Involvement of furin in LEKTI intracellular processing. (A) COS-1 cells were transiently transfected for 48 h with the pEF-DEST51-LEKTI construct containing LEKTI full-length cDNA. Twenty micrograms of total cell extracts were treated for the indicated times in the presence (þ) or absence () of human recombinant furin (2 units), at 30C. Samples were resolved by SDS–PAGE (7.5%) and analysed by western blot using LEKTI polyclonal a-C antibodies. The asterisk indicates a 70 kDa protein band, detected in all samples incubated at 30C (lanes 2–7) including furin untreated extract (lane 7), which most likely repre- sents a degradation product of the 145 kDa protein. (B) HK were differentiated for 24 h in high-calcium medium, and cultured for an additional 6 h in the absence (lane 1) or presence of the indicated concentrations of furin inhibitor I (lanes 2 and 3) or BFA (10 mg/ml; lane 4). Twenty micrograms of total cell extracts were separated and analysed as above. The asterisk indicates an unrelated protein cross-reacting with a-C antibodies. Anti-tubulin detection shows equal loading. Arrows indicate the positions of the 42, 65, 68, 125 and 145 kDa protein bands. Molecular weight markers are indicated on the left in kDa. The results shown are repre- sentative of three to five independent experiments.

LEKTI expression is impaired in HK from NS patients immunohistochemistry. a-C polyclonal, and a-N monoclonal and polyclonal antibodies showed similar labelling patterns We investigated LEKTI expression in HK from three NS throughout the tissues investigated (Table 1). A strong immuno- patients, termed NS1, NS2 and NS3, whose SPINK5 mutations reactivity was detected in interfollicular epidermis of the skin introduce premature termination codons of translation [(12); and was localized to the cytoplasm of keratinocytes of the patients 10, 11 and 12, respectively]. granular and uppermost spinous layers; the horny layer was We first compared the relative expression levels of SPINK5 negative. In the granular layer, the labelling often appeared more transcript in normal (N) and NS patient (NS1-3) differentiated intense at the cell periphery and in the upper cytoplasm, forming HK by northern blot analysis. A dramatic reduction of the a cuff above the nucleus and resulting in a polarized appearance 3.7 kb signal was observed for all three patients compared to (Fig. 6A). Antigen competition completely abolished the control (Fig. 5A), suggesting nonsense-mediated mRNA decay labelling, confirming its specificity (Fig. 6B). Staining was also and predicting severe impairment of LEKTI expression. observed in cells lining acrosyringeal ducts of hair follicles LEKTI protein levels were subsequently examined by western (Fig. 7A–C), and in the duct of sebaceous glands (Fig. 7D). In blot analysis of cell extracts from normal (N) and NS (NS1-3) hair follicles, the labelling of the hair bulb was restricted to differentiated HK treated in the presence (Fig. 5B) or absence matrical cells that differentiate into the inner root sheath and hair (Fig. 5C) of BFA. Importantly, the full-length protein was only shaft (Fig. 7A-4 and C). Above the hair bulb, the inner root sheath detected in normal controls incubated with BFA, and not in NS layers and hair cuticle were stained, whilst the outer root sheath patient cell extracts (Fig. 5B). Similarly, the 42, 65 and was negative (Fig. 7B-3 and C). In the hair isthmus, reactivity 68 kDa proteolytic fragments were not observed in NS samples, was limited to inner cells of the outer root sheath surrounding the but were present in the control (Fig. 5C). These data confirm that hair shaft (Fig. 7A-2). The follicular infundibulum displayed a the 145 and 125 kDa full length proteins, and the 68, 65 and staining pattern similar to that observed in interfollicular 42 kDa fragments, are encoded by SPINK5, and provide the first epidermis (Fig. 7A-1). In the thymus, LEKTI was abundantly conclusive evidence for defective expression of LEKTI in NS. expressed in Hassall’s corpuscles, which represent the terminal differentiation stages of the thymic medullary epithelium LEKTI expression in normal tissues (Fig. 7E). Strong expression was also detected in the gingival mucosa, mainly localized to the upper half of the stratum Paraffin wax-embedded sections of a variety of normal human spinosum (Fig. 7F). An extended labelling was observed tissues were tested for reactivity with LEKTI antibodies by throughout suprabasal layers of the vaginal mucosa (Fig. 7G) 2422 Human Molecular Genetics, 2003, Vol. 12, No. 19

Table 1. Reactivity of LEKTI antibodies on normal human tissues

Positive Negative Stratified epithelia Simple epithelia Others

Skin (10/10) Lung (0/10) Heart (0/4) Thymus (11/11) Liver (0/6) Central nervous system (0/2) Gingiva (4/4) Kidney (0/12) Cerebellum (0/1) Tonsil (2/2) Stomach (0/7) Peripheral nerves (0/3) Oesophagus (4/4) Duodenum (0/5) Ovary (0/2) Vagina (4/4) Colon (0/11) Testis (0/4) Uterine ectocervix (4/4) Appendix (0/2) Uterus (0/5) Rectum (0/1) Prostate (0/4) Seminal vesicle (0/2) Breast (0/5) Adrenal gland (0/4) Pancreas (0/3) Thyroid (0/8) Salivary gland (0/4) Bone marrow (0/4) Lymph node (0/5) Spleen (0/9)

Sections of various tissues were analysed by immunohistochemistry, as described in Materials and Methods. For each tissue, the number of positive samples out of the total tested is indicated in parentheses.

and uterine ectocervix (Fig. 7H). The tonsillar epithelium and Hailey-Hailey (data not shown) diseases. In ichthyosis (Fig. 7I) and the oesophagus (data not shown) also showed vulgaris, LEKTI was expressed in the reduced granular layer positive staining. In contrast, no labelling was found in the and in the uppermost cell layer of the stratum spinosum epithelia of the gastrointestinal tract, liver, lung and kidney (data (Fig. 8G). not shown). No specific staining was detected in the remainder of Among inflammatory skin disorders, psoriasis was chosen the organs tested (Table 1). In all tissues examined, no labelling both in view of the well-characterized alterations in the was observed using the corresponding pre-immune sera (data not expression pattern of several epidermal differentiation markers shown). Further confirmation of antibody specificity was and as a possible cause of neonatal erythroderma, which can provided by antigen competition (data not shown). be misdiagnosed as NS. LEKTI expression was detected in all 12 samples of chronic plaque psoriasis examined (Fig. 8I). LEKTI expression in congenital erythrodermas, However, an irregular expression pattern was observed, with keratinizing and inflammatory skin diseases areas of markedly reduced staining alternating with areas of normal labelling intensity and extended reactivity pattern. Skin sections from patients affected with congenital erythro- Decreased labelling was mainly detected in thinned suprapa- dermas, inherited disorders of keratinization and inflammatory pillary epidermis showing a highly diminished granular layer, skin diseases were tested for reactivity with LEKTI antibodies marked parakeratosis with neutrophil microabscesses and (Table 2). Immunostaining of skin sections from 21 patients leukocyte infiltration. In interpapillary epidermis of elongated with proven NS showed no detectable protein expression in 20 ridges, LEKTI immunodetection often appeared of normal patients, including NS1, NS2 and NS3 (Fig. 8A), and very intensity but extended to several spinous layers. Lastly, we weak and discontinuous staining in the residual granular layer analysed samples from five adult patients affected with atopic of the remaining (data not shown). In contrast, LEKTI was dermatitis, all of which also proved positive for LEKTI detected in the epidermis of sections from all other congenital expression with decreased staining in spongiotic areas (data erythrodermas, keratinizing and inflammatory skin diseases not shown). tested. All 18 samples of neonatal and infantile erythrodermas due to immune deficiency, atopic dermatitis or psoriasis, clearly showed expression of LEKTI. However the staining pattern was irregular, with areas of reduced staining alternating with DISCUSSION areas of normal or increased reactivity in the upper spinous In this study, we report the first cellular and tissue detection of layers (Fig. 8B, C and E). In all genetic keratinizing disorders lympho-epithelial Kazal-type related inhibitor (LEKTI) using in children or adults tested, LEKTI expression pattern was anti-C and anti-N terminal specific antibodies. We demonstrate abnormally extended to a variable number of cell layers of the that LEKTI is a marker of epithelial differentiation whose stratum spinosum. This was particularly marked in specimens expression, like most differentiation-specific proteins (23,24), from bullous (Fig. 8D) and non-bullous (data not shown) is regulated in cultured keratinocytes by external calcium congenital ichthyosiform erythrodermas, lamellar (Fig. 8F) and concentrations. We have shown that LEKTI is expressed in X-linked (data not shown) ichthyoses, and Darier’s (Fig. 8H) differentiated HK as two N-glycosylated precursor proteins of Human Molecular Genetics, 2003, Vol. 12, No. 19 2423

Figure 5. Comparative analysis of SPINK5 and LEKTI expression levels in HK from normal (N) and NS patients (1–3). HK were differentiated for 24 h in high-calcium medium. (A) Twenty micrograms of total RNA were analysed Figure 6. LEKTI expression in normal human skin. Immunohistochemical by northern blot, as described in Materials and Methods. Hybridization with staining of paraffin embedded sections with LEKTI polyclonal a-N antibodies 32 a P-labelled SPINK5-cDNA specific probe shows a 3.7 kb signal. GAPDH was performed as described in Materials and Methods. LEKTI is strongly detection allows the comparison between samples loading. (B and C) expressed in the cytoplasm of keratinocytes of the epidermal granular and Differentiated HK were cultured for an additional 6 h in the presence (B) or uppermost spinous layers; the polarized appearance of the labelling in the gran- absence (C) of BFA (10 mg/ml). Twenty micrograms of total cell extracts were ular layer, resulting from a more intense reactivity in the upper cytoplasm, is separated by SDS–PAGE (7.5%) and analysed by western blot using LEKTI evident (A). Preincubation of a-N antibodies with the recombinant antigen polyclonal a-C antibodies. Arrows indicate the positions of the 42, 65, 68, GST-D1-D6 prior to immunodetection results in a complete absence of reactiv- 125 and 145 kDa protein bands. RNA size (A) and molecular weight (B and ity, confirming the specificity of labelling (B). Bars: 25 mm (A); 50 mm (B). C) markers are indicated on the left in kb and kDa, respectively. The results shown are representative of three to five independent experiments. COS-1 cells, further indicating that the proteolytic forms 145 and 125 kDa. However, under the experimental conditions identified in HK do not result from auto-catalytic cleavage used, these proteins were only detected when ER to Golgi events. This result also suggested that the 125 kDa protein was transport was inhibited with brefeldin A, indicating rapid not generated through auto-cleavage of the 145 kDa isoform in intracellular processing in a post-ER compartment of the the ER of HK. secretory pathway. In addition, we identified three C-terminal We have also shown that in vitro cleavage of the over- proteolytic fragments of 42, 65 and 68 kDa in both cell extracts expressed 145 kDa precursor by furin generates proteins of 65 and conditioned medium. Time course analysis over 72 h of cell and 68 kDa, whose sizes match those of two C-terminal differentiation showed no further processing of these proteo- proteolytic forms identified in HK. This finding suggests that lytic forms (data not shown). These data suggest that the 42, 65 the 65 and 68 kDa proteins, but not those of 125 kDa and and 68 kDa polypeptides represent stable, and thereby 42 kDa, originate from the cleavage of the 145 kDa precursor in potentially biologically active, forms of LEKTI. They also HK. Interestingly, preliminary data indicate that the 125 kDa indicate that the inhibitory action of LEKTI-derived peptides/ isoform results from alternative processing of the SPINK5 pre- polypeptides (14,15) could target secreted and/or cell-surface- mRNA in keratinocytes (A. Tartaglia-Polcini et al., manuscript exposed serine proteases. In contrast to HK, no processing of in preparation), suggesting that the 42 kDa fragment could the overexpressed 145 kDa full-length protein was observed in originate from the cleavage of this isoform. We have also 2424 Human Molecular Genetics, 2003, Vol. 12, No. 19

Figure 7. Human tissue distribution of LEKTI. Immunohistochemical staining of paraffin sections from normal human tissues (Table 1) with LEKTI polyclonal a- N antibodies was performed as described in Materials and Methods. In the hair follicle (A–C), a strong labelling is evident in the matrical cells of the anagen bulb (A-4 and C), in all internal root sheath layers (cuticle, Huxley’s and Henle’s layers), in the hair shaft cuticle in the lower portion of the follicle (A-3, B and C), in the innermost layers of the outer root sheath at the level of the isthmus (A-2) and in the infundibulum (A-1). Intense LEKTI expression is also observed in the duct of sebaceous glands (D), in thymic Hassall’s corpuscles (E), suprabasal epithelial layers of the gingival (F), vaginal (G) and uterine ectocervix (H) mucosa, as well as in the tonsillar epithelium (I). ORS, outer root sheath; IRS, inner root sheath; HS, hair shaft; C, cuticle; He, Henle’s layer; Hu, Huxley’s layer; MC, matrical cells. Bars: 25 mm (E); 50 mm (D, F–I); 100 mm (B, C); 165 mm (A). shown that treatment of HK with the furin inhibitor, Dec- polypeptide (16), reveals that only a selected proportion of RVKR-CMK, prevents the processing of both endogenous these sites are used during the in vivo processing of LEKTI. precursors, further implicating furin in the intracellular Interestingly, processing of the N-terminal half of LEKTI processing of LEKTI. This is likely to occur in the trans- seems to generate single domains (D1, D5, D6) (14,15), whilst Golgi network where the active form of furin resides (25). Co- the C-terminal half produces larger multi-domain fragments. localization of furin and LEKTI in the granular layer of the These fragments may result from selective post-translational epidermis (22) further supports this hypothesis. However, proteolysis (27) with a different processing in various tissues expression of other subtilisin-like proprotein convertases depending on the enzymes involved. The reasons we could not (SPC), including PACE4, PC5/PC6, PC7/8 and PC8, have detect D1, D5 and D6 in HK using a-N antibodies raised been demonstrated in human epidermis (22,26), raising the against D1–D6 remain unclear; however, this could be due to possibility that these endo-proteases could also be involved in the lack of epitope recognition within these domains and/or the the proteolytic processing of LEKTI. rapid degradation of single protein domains under the The number of consensus sequences for SPC cleavage experimental conditions used. identified within LEKTI could generate at least 14 polypeptides LEKTI tissue distribution pattern clearly demonstrates a (13). However, identification of the 42, 65 and 68 kDa C- specific expression in the most differentiated viable layers terminally processed forms in this study, together with a 30 kDa of stratified epithelial tissues (Table 1). These included Human Molecular Genetics, 2003, Vol. 12, No. 19 2425

Table 2. Congenital erythrodermas and other keratinizing disorders examined in transcriptional/post-transcriptional regulation of LEKTI expres- this study for LEKTI expression by immunohistochemical analysis of skin sion. In psoriasis and neonatal/infantile erythrodermas (due to sections immune deficiency or atopy), an irregular LEKTI staining pattern is detected. In particular, decreased expression corresponds to the Disease Cases examined presence of an intense lympho-mononuclear inflammatory Netherton syndrome 21 infiltrate invading the epidermis, suggesting that some inflamma- Other neonatal/infantile erythrodermas 18 tory cytokines could downregulate LEKTI expression. SCID 5 Although the biological function(s) of LEKTI is still Omenn syndrome 3 Atopic dermatitis 5 unknown, its specific expression in highly differentiated Psoriasis 5 regions of lympho-epithelial tissues, together with the clinical Keratinizing disorders in children or adults 51 features of NS patients, predicts key roles in a number of Ichthyosis vulgaris 3 physiological processes. It is likely that LEKTI plays a role in Lamellar ichthyosisa 9 a terminal epidermal differentiation and/or corneocyte desqua- Non-bullous congenital ichthyosiform erythroderma 5 mation (13), as suggested by its restricted expression in the Bullous congenital ichthyosiform erythroderma 2 X-linked ichthyosis 2 granular layer of the epidermis, and impaired keratinization and Other rare ichthyosesb 3 cornification in NS. Among possible targets are the stratum Darier’s disease 5 corneum trypsin- and chymotrypsin-like enzymes (SCTE and Hailey-Hailey disease 5 SCCE, respectively) (33), whose defective inhibition by LEKTI Atopic dermatitis 5 Psoriasis 12 would result in over desquamation of corneocytes (13). Other putative targets are trypsin-like serine proteases, including the membrane-type serine protease 1 (MT-SP1) (34), which could aTwo cases due to TGM1 mutations. bIchthyosis of Siemens (1), ichthyosis hystrix (1) and Sjo¨gren–Larsson mediate inhibition of keratinocyte differentiation through syndrome (1). activation of PAR-2 (protease-activated receptor-2) at the keratinocyte surface (35). The extent of atopic manifestations in NS, which are not seen in other congenital ichthyoses, also predicts a role for LEKTI as a downregulator of inflammatory keratinizing (skin and its appendages, gingiva and thymus), as and/or immune allergic responses (36). Two recent independent well as non-keratinizing (tonsil, oesophagus, vagina and uterine studies reporting association between SPINK5 missense ectocervix) epithelia. In the epidermis, LEKTI expression was variants and atopic dermatitis (37,38) further support this mainly restricted to the granular layer, where critical biochem- assumption. Among the serine proteases secreted during the ical and morphological changes of terminal differentiation lead inflammation process, the trypsin-like mast cell tryptase is a to cornification (28). In hair follicle, the strong expression of major mediator of numerous allergic and inflammatory LEKTI in matrical cells of the bulb, the hair shaft cuticle and conditions (39). Induction of inflammatory cytokines cell inner root sheath, suggest a possible role in hair growth and secretion (40), mast cell activation (41), and eosinophil and differentiation. In non-keratinizing epithelia, LEKTI expression neutrophil recruitment (42) by the mast cell tryptase, via PAR-2 was more diffuse throughout the upper half of the spinous activation (43), indicates that this serine protease may mediate layers, supporting a role for the protein in earlier stages of an amplification mechanism of the inflammatory response. epithelial differentiation. Lack of downregulation by LEKTI could thus trigger a cycle of We have shown that the absence of LEKTI expression in HK chronic allergen-induced inflammation in NS, and potentially, and epidermis is a common feature of NS. Although very low in common atopic diseases. Finally, many allergens themselves levels of LEKTI could be detected in skin sections of one patient, are serine proteases (44), including the major house dust-mite these results demonstrate that loss of LEKTI expression is the and pollen (45). It is thus possible that lack of inhibition of major molecular mechanism underlying NS. In contrast, normal some of these activities by LEKTI may also contribute to the or slightly reduced levels of LEKTI were detected in all other allergen hyper-responsiveness associated with NS pathology. inherited and acquired skin diseases examined, including a Despite absence of significant immune function abnormalities number of clinically resembling skin disorders (Table 2). This in NS patients (6), the strong and localized expression of finding reveals that defective expression of LEKTI in the LEKTI in thymic Hassall’s corpuscles suggests that the protein epidermis is a diagnostic feature of NS, thus providing the basis could be involved in the regulation of T cell maturation. for the powerful use of LEKTI antibodies for rapid, early and Although the functional significance of Hassall’s corpuscles reliable diagnosis of NS. In a variety of other inherited remains to be determined, recent findings suggest that these are keratinizing disorders tested, LEKTI expression appears to be involved both in maturation of developing thymocytes (46), upregulated and is extended to several spinous layers. The various and activation and tolerization of mature T cells (47). For its epidermal responses mounted to compensate for altered epidermal specific expression in Hassall’s corpuscles (48), the trypsin-like permeability barrier in these diseases, from cytokine production kallikrein 6 (KLK6) serine protease represents a potential target by keratinocytes to the modulation of epidermal calcium gradient of LEKTI inhibitory activity. LEKTI expression in differen- (23,29,30), could be involved in driving increased expression tiated and keratinizing areas of the hair follicle (Fig. 7A–C) and of LEKTI. Interestingly, LEKTI expression pattern in these sebaceous glands (Fig. 7D) suggests a possible role in growth diseases does not match that of any known epithelial differentia- and differentiation of pilosebaceous units. This assumption is tion protein, such as loricrin, involucrin or filaggrin (31,32). further supported by the specific hair shaft abnormality, This indicates that specific mechanisms are involved in the trichorrhexis invaginata (TI), and slow growing hair feature 2426 Human Molecular Genetics, 2003, Vol. 12, No. 19

Figure 8. Expression of LEKTI in Netherton syndrome compared to inherited and acquired skin diseases (Table 2). Immunohistochemical staining of skin sections from patients affected with Netherton syndrome (A) and other skin diseases (B–I) were performed with LEKTI polyclonal a-N antibodies, as described in Materials and Methods: severe combined immunodeficiency syndrome (SCID) (B); Omenn syndrome (C); bullous congenital ichthyosiform erythroderma (D); erythroderma due to atopic dermatitis (E); lamellar ichthyosis (F); ichthyosis vulgaris (G); Darier’s disease (H); and psoriasis (I). Note the intense staining of an increased number of spinous cell layers in bullous congenital ichthyosiform erythroderma (D), lamellar ichthyosis (F), and Darier’s disease (H). In SCID (B), Omenn syndrome (C), atopic dermatitis (E) and psoriasis (I), areas of reduced staining are evident and often match the thinned parakeratotic suprapapillary epidermis where exocytosis of the inflammatory infiltrate is more prominent, while areas of staining extension to suprabasal cell layers are observed. In ichthyosis vulgarilis (G), LEKTI detection was similar to that obtained in normal skin. Bars: 50 mm (A, B, E–H); 100 mm (C, D, I). observed in NS patients. Interestingly, LEKTI co-localizes with infections of bacterial and viral origins could be attributed to SCCE and SCTE in hair (inner root sheath and innermost the severe skin permeability barrier dysfunction, facilitating layers of the outer root sheath in the uppermost follicle) and invasion by microorganisms. However, their persistent/recur- sebaceous (duct) follicles (33,49). This observation raises the rent character, unique to NS among ichthyoses (6), suggests possibility that, like in epidermis, LEKTI may regulate the additional loss of an important host-defense mechanism in the activity of these serine proteases in pilosebaceous follicles. skin. Anti-microbial and anti-viral activities have been Lack of LEKTI expression in NS hair may lead to impaired described for a number of serine protease inhibitors (51), keratinization of structures of the hair shaft, which could including the antileukoprotease (ALP) (52), and b defensins account for softening and collapse of its distal part into its secreted by keratinocytes (53). It is thus possible that LEKTI- proximal portion when driven upward by the growing force, derived bioactive peptides/polypeptides share similar activities resulting in the formation of TI bamboo nodes (50). Reports of as part of the innate immune response in the skin. Given its morphological abnormalities in the keratogenous zone of the tissue distribution, a role for LEKTI in the general anti- hair cortex, and unkeratinized hair cuticle cells in TI (50), also microbial protection of mucous epithelia is also anticipated. correlate with the predicted lack of LEKTI expression in this Surprisingly, particular organs relevant to NS pathology such as location. The predisposition of NS patients to cutaneous lung, kidney and digestive tract were negative for LEKTI Human Molecular Genetics, 2003, Vol. 12, No. 19 2427 expression in normal individuals (Table 1). This suggests that ABI377 automated sequencer (Applied Biosystem, Cheshire, life-threatening complications associated with NS, such as UK). bronchopneumonia, malnutrition and metabolic disorders (6), are not primarily due to defective LEKTI function(s) in these organs, and may reflect a secondary effect resulting from Cell culture and transfections failure to produce LEKTI in other tissues. LEKTI full-length recombinant protein has recently been shown Normal and NS human primary keratinocytes (HK) were to inhibit the enzymatic activities of plasmin, trypsin, subtilisin A, isolated from skin biopsies as previously described (55). HK cathepsin G and elastase (54). This result supports the involve- were expanded on a feeder layer of lethally irradiated 3T3-J2 ment of LEKTI in multiple biological pathways relevant to tissue mouse fibroblasts in keratinocyte-growth medium, following homeostasis, inflammation and anti-microbial defense. the method described by Rheinwald and Green (56,57). For all Interestingly, the native D6 peptide shows a selective and more experiments, HK were grown in the absence of 3T3 feeder potent trypsin inhibition than the full-length recombinant protein, layers in low calcium (<0.1 mM) keratinocyte serum-free suggesting that the inhibitory potency of processed LEKTI medium (K-SFM) supplemented with epidermal growth factor domains against specific proteinases could be significantly higher (0.4 ng/ml) and bovine pituitary extract (25 mg/ml). Cells were than that of the precursor(s). These findings, together with our seeded in low calcium K-SFM at a density corresponding to present data, further suggest that LEKTI proteolytic polypeptides 80% confluence in 60 15 mm tissue culture dishes or eight- represent bioactive forms, with different target specificities. The well chamber slides (Nalge Nunc International, Naperville, IL, identification of the novel processed forms of LEKTI described in USA) for northern/western blot and immunofluorescence this study provides the basis for future functional and structural microscopy analysis, respectively. Cell differentiation was analysis of fragments with physiological relevance. induced for 24 h in high calcium (1.2 mM) K-SFM. Further treatments with brefeldin A (BFA) and furin inhibitor I (Dec-RVKR-CMK; Calbiochem, Nottingham, UK) were per- MATERIALS AND METHODS formed for 6 h at 10 mg/ml and 25–50 mM respectively, in high calcium K-SFM. COS-1 cells were grown in Dulbecco’s modified Eagle Materials medium supplemented with 10% fetal calf serum, 100 U/l All reagents, chemicals and antibodies were purchased from penicillin/streptomycin and 10 ng/ml L-glutamine. Cells were Sigma (Poole, UK) unless otherwise stated. Cell culture media plated in 60 15 mm tissue culture dishes at 70% confluence were obtained from Invitrogen (Paisley, UK). and transiently transfected with pEF-DEST51 or pEF-DEST51- LEKTI vectors (2.5 mg DNA), using FuGENETM 6 Transfection Reagent according to the manufacturer’s recommendations Tissue samples (Roche Molecular Biochemicals). Transfected cells were A wide variety of normal human tissues, listed in Table 1, were maintained in culture for 48 h before proceeding to western blot retrieved from the archives of the Department of Pathology of analysis. Purpan Hospital in Toulouse (France). Skin specimens from 21 patients affected with Netherton syndrome (NS) and other RNA extraction, reverse transcriptase–PCR and genetic and acquired disorders of keratinization, listed in northern blotting Table 2, were obtained from the archives of the Service of Histopathology of the IDI-IRCCS in Rome (Italy), the Total RNA was isolated from normal and NS differentiated HK Department of Pathology in Toulouse, and the Department of using Trizol (Invitrogen) according to the manufacturer’s Dermatology of Necker Hospital in Paris (France). Tissue instructions. cDNA was generated from normal HK total RNA samples had been obtained for diagnostic or research purposes. by reverse-transcription using the AMV reverse transcriptase The Central Oxfordshire Research Ethic Committee approved (Roche Diagnostic Spa, Monza, Italy) and random hexamers. It the study and all patients gave informed consent. was subsequently used as a template for the PCR amplification of a 273 bp cDNA product comprised within the 30 untranslated region of LEKTI cDNA sequence. PCR conditions were as described below with an annealing temperature of 59C, and Cloning of LEKTI full-length cDNA into 0 pEF-DEST51 expression vector primers used were as follows: 5 -CAGGAAGATTGTTGAAAG CCA-30 (sense, nucleotides 3239–3259) and 50-ATTGAACA LEKTI full-length cDNA (GenBank AJ228139) was generated GGCAGTTGGACAG-30 (antisense, nucleotides 3491–3511). by long-range PCR (Expand Long Template PCR System; The PCR product was radiolabelled and used as a probe for the Roche Molecular Biochemicals, E. Sussex, UK) using total northern blot analysis of 20 mg of total RNA extracts, following cDNA from differentiated HK (obtained as described below) as standard methods (58). To assess uniformity of RNA loading a template. The PCR product was subcloned into pCRII-TOPO and transfer, the membrane was further hybridized with a vector (TOPO TA Cloning Kit; Invitrogen) and transferred into radiolabelled probe corresponding to the ubiquitously expressed the mammalian expression vector pEF-DEST51 using the gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Gateway technology, according to the manufacturer’s instruc- GenBank NM002046). Quantification of the hybridization tions (Invitrogen). pEF-DEST51-LEKTI construct was fully signals was performed by densitometric scanning using a sequenced using the Big Dye Terminator Sequencing Kit and an GS-750 densitometer (Bio-Rad, Hercules, CA, USA). 2428 Human Molecular Genetics, 2003, Vol. 12, No. 19

Polyclonal LEKTI antibodies production complete (first injection), incomplete (second and third injections) and without (fourth injection) Freund’s adjuvant Rabbit polyclonal antibodies were raised against the recombi- (Calbiochem, La Jolla, CA, USA). Three days after the fourth nant N-terminal (D1–D6) and C-terminal (D13–D15) parts of immunization, fusion of the spleen cells with the non-Ig- LEKTI, and were termed a-N and a-C antibodies, respectively. producing myeloma cell line X63 Ag8 653 was performed using standard techniques (60). When hybridoma growth could Construction of pGEX4T1-D1–D6 and pGEX3X-D13–D15 be detected, supernatants were tested for antibody-binding bacterial expression vectors. Fragments of LEKTI cDNA activity using an enzyme linked immunosorbent assay encoding the protein domains D1–D6 (nucleotides 52–1278) (ELISA). Of the 295 clones generated, one was found to and D13–D15 (nucleotides 2483–3241) were generated by secrete anti-D1–D6 antibody, as determined by ELISA and PCR using the following primers: D1 sense, 50-CCGCTCGA immunohistochemistry (see below). The selected hybridoma GCAAGATGCTGCCAGTAAGAATGAA-30; D6 antisense, was cloned by limiting dilution. Isotope characterization 50-CCGCTCGAGTTGTCTTTTGTTTCTTGATTCGCC-30; showed that the anti-D1–D6 monoclonal antibody belongs to D13 sense, 50-GCGGGATCCTGGAAAGGGAAGCAGCTG-30, an IgG1 subclass. and D15 antisense, 50-CGGAATTCTGTCATTCGTCAGAC 0 GGG-3 . PCR cycling conditions were: 94 C for 10 min, 35 Immunofluorescence microscopy cycles comprising 94C for 30 s, 66C (D1–D6) or 55C (D13–D15) for 45 s, and 72C for 1 min, followed by a final Cells were fixed in ice-cold methanol for 30 min and processed extension at 72C for 10 min. PCR products were fully for immunofluorescence analysis, as previously described (61). sequenced as decribed above, and subcloned into the The primary antibodies used were LEKTI polyclonal a-N Glutathione-S-Transferase (GST) gene fusion vectors (11 mg/ml) and a-C (4 mg/ml) antibodies, the corresponding pGEX-4T-1 and pGEX-3X (Amersham Pharmacia Biotech, rabbit pre-immune sera used at the same dilutions, and the Amersham, UK) using XhoI and EcoRI/BamHI restriction sites monoclonal anti-calreticulin antibody (Calbiochem). for D1–D6 and D13–D15, respectively. pGEX-D1–D6 Secondary antibodies were goat anti-rabbit conjugated to and pGEX-D13–D15 constructs were transformed into BL21 FITC and sheep anti-mouse conjugated to TRITC. For and TOPO10 E. coli strains (Stratagene, Amsterdam, competition experiments, a-N and a-C antibodies were pre- Netherlands), respectively. incubated for 1 h at room temperature with 2.5-fold excess (weight) of the respective recombinant antigens GST-D1–D6 Expression and purification of recombinant GST-fusion and GST-D13–D15, prior to immunodetection. Cells were proteins. Procedures were essentially performed as previously mounted in Vectorshield in the presence or absence of described (59). Briefly, cell cultures were grown at 37Cin propidium iodide (Vector Laboratories, Peterborough, UK), Luria Broth base (Invitrogen) medium containing 100 mg/ml and examined under a Nikon Optiphot with a 60 oil objective. Images were captured using an MRC 1024 ampicillin to an OD600nm of 0.8. Protein expression was then induced by addition of IPTG to 0.1 mM, and cultures were confocal laser microscope and collected using Lasersharp grown overnight at room temperature. Cells were harvested, software (Bio-Rad). and lysed by sonication. Sonicates were clarified from insoluble material by centrifugation at 16 000g,4C for 30 min. GST- Western blotting D1–D6 (74.6 kDa) and GST-D13–D15 (55.6 kDa) were affinity purified using glutathione sepharose 4B beads, according to the Cells were lysed in a suitable volume of ice-cold lysis buffer manufacturer’s recommendations (Amersham Pharmacia (50 mM Tris–HCl pH 8.0, 150 mM NaCl, 5 mM EDTA, 1% NP- Biotech). 40, 1 mM PMSF and 1 mg/ml each of antipaine, chymostatin, leupeptin and pepstatin). Lysates were incubated for 30 min on ice and clarified from the insoluble materiel by centrifugation at Immunizations. Immunizations of rabbits with the recombi- 16 000g,4C for 3 min. Conditioned media were concentrated nant antigens GST-D1–D6 and GST-D13–D15 were performed by overnight precipitation at 20C in the presence, per ml of by Eurogentec Bel S.A (Herstal, Belgium) and Primm (Milan, medium, of 3.6 ml of ethanol and 100 ml of the solution mix Italy), respectively. 20 mM N-ethylmalaeimide, 10 mM EDTA, 1 mM PMSF, 100 mM 2-mercaptoethanol–acetic acid in 0.1 M Tris–HCl Serum purification. a-C and a-N crude antisera were purified buffer pH 7.4. Proteins were recovered by centrifugation at by affinity chromatography for the respective antigens, using 13 000g,4C for 30 min and resuspended in a suitable volume NHS-activated Sepharose1 4 Fast Flow (Amersham of ice-cold lysis buffer. Protein samples were quantified using Pharmacia Biotech) and the AminoLink Plus Immobilization the BCA protein assay kit (Pierce, Rockford, IL, USA), and Trial purification procedure (Pierce, Rockford, IL, USA), 20 mg were fractionated by SDS–polyacrylamide gel electro- respectively, following manufacturers’ instructions. phoresis (PAGE). Proteins were transferred onto Immobilon-P membranes (Millipore, Herts, UK) using the Hoefer Semiphor Monoclonal LEKTI antibody production semi-dry transfer unit (Amersham Pharmacia Biotech). Blots were immunostained following standard protocols (60). First BALB/c mice were immunized four times with 50 mgof antibodies were LEKTI polyclonal a-N (1.9 mg/ml), a-C recombinant GST-D1–D6 at 2 week intervals, once subcuta- (1.2 mg/ml), and monoclonal a-N (1 mg/ml) antibodies, and neously and three times intraperitoneally, in association with the corresponding rabbit pre-immune sera used at the same Human Molecular Genetics, 2003, Vol. 12, No. 19 2429 dilutions. Secondary antibodies were donkey anti-rabbit or REFERENCES sheep anti-mouse antibodies conjugated to horseradish perox- 1. Come`l, M. (1949) Ichthyosis linearis circumflexa. Dermatologica, 98, idase (Amersham Pharmacia Biotech). Proteins were visualized 133–136. using the ECL detection system according to the manufac- 2. Netherton, E.W. (1958) A unique case of trichorrhexis nodosa—‘bamboo turer’s instructions (Amersham Pharmacia Biotech). hairs’. Arch. Dermatol., 78, 483–487. Competition experiments were performed as described above 3. Traupe, H. (1989) The Come`l–Netherton syndrome. In Traupe, H (ed.), The Ichthyoses: a Guide to Clinical Diagnosis, Genetic Counselling, using 2.5-fold excess (weight) of the recombinant antigens. To and Therapy. Springer, Berlin, pp. 168–178. verify equal sample loading, membranes were stripped 4. Stevanovic, D.V. (1969) Multiple defects of the hair shaft in Netherton’s following Amersham’s ECL detection system instructions, disease. Association with ichthyosis linearis circumflexa. Br. J. Dermatol., and reprobed using the anti-tubulin monoclonal antibody. 81, 851–857. PNGase F (New England Biolabs, Hitchin, UK) and human 5. Greene, S.L. and Mu¨ller, S.A. (1985) Netherton’s syndrome: report of a case and review of the literature. J. Am. Acad. Dermatol., 13, 329–337. recombinant furin sample treatments were performed for 1 h at 6. Judge, M.R., Morgan, G. and Harper, J.I. (1994) A clinical and 37 and 30 C, respectively, according to the manufacturer’s immunological study of Netherton’s syndrome. Br. J. Dermatol., 131, instructions. 615–621. 7. Smith, D.L., Smith, J.G., Wong, S.W. and deShazo, R.D. (1995) Netherton’s syndrome: a syndrome of elevated IgE and characteristic skin and hair Immunohistochemistry findings. J. Allergy Clin. Immunol., 95, 116–123. 8. Jones, S.K., Thomason, L.M., Surbrugg, S.K. and Weston, W.L. (1986) LEKTI a-N polyclonal and monoclonal antibodies worked on Neonatal hypernatraemia in two siblings with Netherton’s syndrome. Br. J. Dermatol., 114, 741–743. paraffin sections only, whilst a-C polyclonal antibodies also 9. Chavanas, S., Garner, C., Bodemer, C., Ali, M., Teillac, D.H., worked on frozen sections. These antibodies were used on a Wilkinson, J., Bonafe, J.L., Paradisi, M., Kelsell, D.P., Ansai, S. et al. large panel of normal human tissue samples (Table 1), as well (2000) Localization of the Netherton syndrome gene to chromosome as on skin biopsies from patients affected with NS or other skin 5q32, by linkage analysis and homozygosity mapping. Am. J. Hum. Genet., disorders (Table 2). Tissue samples were fixed in 10% neutral 66, 914–921. 10. Chavanas, S., Bodemer, C., Rochat, A., Hamel-Teillac, D., Ali, M., buffered formalin. Four-micrometer sections were prepared Irvine, A.D., Bonafe, J.L., Wilkinson, J., Taieb, A., Barrandon, Y. et al. from paraffin-wax-embedded tissues and their reactivity with (2000) Mutations in SPINK5, encoding a serine protease inhibitor, cause LEKTI antibodies was investigated by immunohistochemistry. Netherton syndrome. Nat. Genet., 25, 141–142. Prior to immunodetection, specimens were deparaffinized, 11. Sprecher, E., Chavanas, S., DiGiovanna, J.J., Amin, S., Nielsen, K., Prendiville, J.S., Silverman, R., Esterly, N.B., Spraker, M.K., Guelig, E. rehydrated and processed as described elsewhere (62). et al. (2001) The spectrum of pathogenic mutations in SPINK5 in 19 Antigen retrieval of dewaxed sections was performed by heat- families with Netherton syndrome: implications for mutation detection and treatment for 40 min using a water bath at 95Cin10mM first case of prenatal diagnosis. J. Invest. Dermatol., 117, 179–187. citrate buffer pH 6.0 supplemented with 1% Tween 20, or using 12. Bitoun, E., Chavanas, S., Irvine, A.D., Lonie, L., Bodemer, C., Paradisi, M., the Target Retrieval Solution (Dako, Trappes, France). Sections Hamel-Teillac, D., Ansai, S., Mitsuhashi, Y., Taieb, A. et al. (2002) Netherton syndrome: disease expression and spectrum of SPINK5 were immunostained for 30 min at room temperature with mutations in 21 families. J. Invest. Dermatol., 118, 352–361. polyclonal a-N (11 mg/ml) or a-C (4 mg/ml) antibodies diluted 13. Komatsu, N., Takata, M., Otsuki, N., Ohka, R., Amano, O., Takehara, K. in PBS containing 0.3% BSA, or with the undiluted a-N and Saijoh, K. (2002) Elevated stratum corneum hydrolytic activity in monoclonal antibody (5 mg/ml). Tissue sections were incubated Netherton syndrome suggests an inhibitory regulation of desquamation by with the streptavidin-biotin-peroxidase complex (ABC method) SPINK5-derived peptides. J. Invest. Dermatol., 118, 436–443. 14. Magert, H.J., Standker, L., Kreutzmann, P., Zucht, H.D., Reinecke, M., using the StrepABComplex/HRP Duet (mouse/rabbit) kit Sommerhoff, C.P., Fritz, H. and Forssmann, W.G. (1999) LEKTI, a novel (Dako). Extensive washing with PBS containing 0.3% BSA 15-domain type of human serine proteinase inhibitor. J. Biol. Chem., 274, was performed between each step. Labelling was revealed 21499–21502. using diaminobenzidine tetrahydrochloride and hydrogen 15. Magert, H.J., Kreutzmann, P., Standker, L., Walden, M., Drogemuller, K. and Forssmann, W.G. (2002) LEKTI: a multidomain serine protease peroxide, and nuclei were counterstained with hematoxylin. inhibitor with pathophysiological relevance. Int. J. Biochem. Cell Biol., 34, Negative controls were included for each sample by omitting 573–576. the primary antibody. The labelling specificity was verified 16. Ahmed, A., Kandola, P., Ziada, G. and Parenteau, N. (2001) Purification using the corresponding pre-immune sera at the same and partial amino acid sequence of proteins from human epidermal concentrations and by competition experiments, as described keratinocyte conditioned medium. J. Prot. Chem., 20, 273–278. 17. Bergeron, F., Leduc, R. and Day, R. (2000) Subtilase-like pro-protein above, using 10-fold excess (weight) of the recombinant convertases: from molecular specificity to therapeutic applications. J. Mol. antigens. Endocrinol., 24, 1–22. 18. Seidah, N.G. and Chretien, M. (1999) Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypep- tides. Brain Res., 848, 45–62. ACKNOWLEDGEMENTS 19. Hennings, H., Michael, D., Cheng, C., Steinert, P., Holbrook, K. and Yuspa, S.H. (1980) Calcium regulation of growth and differentiation of We are grateful to the patients and their families who mouse epidermal cells in culture. Cell, 19, 245–254. participated in the study, to J. Boyes for the production of 20. Wille, J.J., Pittelkow, M.R., Shipley, G.D. and Scott, R.E. (1984) Integrated D1–D6 monoclonal antibody, to M. Inzillo for artwork, and to control of growth and differentiation of normal human prokeratinocytes G. Zambruno and C. Deraison for critical review of the cultured in serum-free medium: clonal analyses, growth kinetics, and cell manuscript. This work was supported by grants from The cycle studies. J. Cell Physiol., 121, 31–44. 21. Lippincott-Schwartz, J., Yuan, L.C., Bonifacino, J.S. and Klausner, R.D. Wellcome Trust (Wellcome Trust Senior Clinical Fellowship to (1989) Rapid redistribution of Golgi proteins into the ER in cells treated A.H), the Italian Ministry of Health, the Fondation pour la with brefeldin A: evidence for membrane cycling from Golgi to ER. Cell, Recherche Me´dicale (20000474-3) and the INSERM-AFM. 56, 801–813. 2430 Human Molecular Genetics, 2003, Vol. 12, No. 19

22. Pearton, D.J., Nirunsuksiri, W., Rehemtulla, A., Lewis, S.P., Presland, R.B. 42. He, S., Peng, Q. and Walls, A.F. (1997) Potent induction of a neutrophil and and Dale, B.A. (2001) Proprotein convertase expression and localization in eosinophil-rich infiltrate in vivo by human mast cell tryptase: selective epidermis: evidence for multiple roles and substrates. Exp. Dermatol., 10, enhancement of eosinophil recruitment by histamine. J. Immunol., 159, 193–203. 6216–6225. 23. Elias, P.M. and Feingold, K.R. (2001) Coordinate regulation of epidermal 43. Schechter, N.M., Brass, L.F., Lavker, R.M. and Jensen, P.J. (1998) Reaction differentiation and barrier homeostasis. Skin Pharmac. Appl. Skin Physiol., of mast cell proteases tryptase and chymase with protease activated 14, 28–34. receptors (PARs) on keratinocytes and fibroblasts. J. Cell Physiol., 176, 24. Elias, P.M., Ahn, S.K., Denda, M., Brown, B.E., Crumrine, D., 365–373. Kimutai, L.K., Komuves, L., Lee, S.H. and Feingold, K.R. (2002) 44. Thomas, W.R. (1993) Mite allergens group I–VII. A catalogue of enzymes. Modulations in epidermal calcium regulate the expression of Clin. Exp. Allergy, 23, 350–353. differentiation-specific markers. J. Invest. Dermatol., 119, 1128–1136. 45. Bagarozzi, D.A., Jr and Travis, J. (1998) Ragweed pollen proteolytic 25. Molloy, S.S., Thomas, L., VanSlyke, J.K., Stenberg, P.E. and Thomas, G. enzymes: possible roles in allergies and asthma. Phytochemistry, 47, (1994) Intracellular trafficking and activation of the furin proprotein 593–598. convertase: localization to the TGN and recycling from the cell surface. 46. Bodey, B., Bodey, B., Jr, Siegel, S.E. and Kaiser, H.E. (2000) Novel insights EMBO J., 13, 18–33. into the function of the thymic Hassall’s bodies. In Vivo, 14, 407–418. 26. Bruzzaniti, A., Goodge, K., Jay, P., Taviaux, S.A., Lam, M.H., Berta, P., 47. Douek, D.C. and Altmann, D.M. (2000) T-cell apoptosis and differential Martin, T.J., Moseley, J.M. and Gillespie, M.T. (1996) PC8 [corrected], human leucocyte antigen class II expression in human thymus. a new member of the convertase family. Biochem. J., 314, 727–731. Immunology, 99, 249–256. 27. Hopper, N.M., Karran, E.H. and Turner, A.J. (1997) Membrane protein 48. Petraki, C.D., Karavana, V.N., Skoufogiannis, P.T., Little, S.P., secretases. Biochem. J., 321, 265–279. Howarth, D.J., Yousef, G.M. and Diamandis, E.P. (2001) The spectrum 28. Eckert, R.L. (1989) Structure, function, and differentiation of the of human kallikrein 6 (zyme/protease M/neurosin) expression in human keratinocyte. Physiol. Rev., 69, 1316–1346. tissues as assessed by immunohistochemistry. J. Histochem. Cytochem., 29. Lavrijsen, A.P., Oestmann, E., Hermans, J., Bodde, H.E., Vermeer, B.J. and 49, 1431–1441. Ponec, M. (1993) Barrier function parameters in various keratinization 49. Ekholm, E., Sondell, B., Stranden, P., Brattsand, M. and Egelrud, T. (1998) disorders: transepidermal water loss and vascular response to hexyl Expression of stratum corneum chymotryptic enzyme in human sebaceous nicotinate. Br. J. Dermatol., 129, 547–553. follicles. Acta. Derm. Venereol., 78, 343–347. 30. Schmuth, M., Yosipovitch, G., Williams, M.L., Weber, F., Hintner, H., 50. Ito, M., Ito, K. and Hashimoto, K. (1984) Pathogenesis in trichorrhexis Ortiz-Urda, S., Rappersberger, K., Crumrine, D., Feingold, K.R. and invaginata (bamboo hair). J. Invest. Dermatol., 83, 1–6. Elias, P.M. (2001) Pathogenesis of the permeability barrier abnormality 51. Sallenave, J.M. (2002) Antimicrobial activity of antiproteinases. Biochem. in epidermolytic hyperkeratosis. J. Invest. Dermatol., 117, 837–847. Soc. Trans., 30, 111–115. 31. Hohl, D. (1993) Expression patterns of loricrin in dermatological disorders. 52. Wiedow, O., Harder, J., Bartels, J., Streit, V. and Christophers, E. (1998) Am. J. Dermatopathol., 15, 20–27. Antileukoprotease in human skin: an antibiotic peptide constitutively 32. De Heller-Milev, M., Huber, M., Panizzon, R. and Hohl, D. (2000) produced by keratinocytes. Biochem. Biophys. Res. Commun., 248, Expression of small proline rich proteins in neoplastic and inflammatory 904–909. skin diseases. Br. J. Dermatol., 143, 733–744. 53. Liu, L., Wang, L., Jia, H.P., Zhao, C., Heng, H.H., Schutte, B.C., 33. Ekholm, I.E., Brattsand, M. and Egelrud, T. (2000) Stratum corneum tryptic McCray, P.B., Jr and Ganz, T. (1998) Structure and mapping of the human enzyme in normal epidermis: a missing link in the desquamation process? beta-defensin HBD-2 gene and its expression at sites of inflammation. J. Invest. Dermatol., 114, 56–63. Gene, 222, 237–244. 34. Takeuchi, T., Harris, J.L., Huang, W., Yan, K.W., Coughlin, S.R. and 54. Mitsudo, K., Jayakumar, A., Henderson, Y., Frederick, M.J., Kang, Y., Craik, C.S. (2000) Cellular localization of membrane-type serine protease 1 Wang, M., El-Naggar, A.K. and Clayman, G.L. (2003) Inhibition of serine and identification of protease-activated receptor-2 and single-chain proteases plasmin, trypsin, subtilisin A, cathepsin G, and elastase by urokinase-type plasminogen activator as substrates. J. Biol. Chem., 275, LEKTI: a kinetic analysis. Biochemistry, 42, 3874–3881. 26333–26342. 55. Watt, F.M., Boukamp, P., Hornung, J. and Fusenig, N.E. (1987) Effect of 35. Derian, C.K., Eckardt, A.J. and Andrade-Gordon, P. (1997) Differential growth environment on spatial expression of involucrin by human regulation of human keratinocyte growth and differentiation by a novel epidermal keratinocytes. Arch. Dermatol. Res., 279, 335–340. family of protease-activated receptors. Cell Growth Differ., 8, 743–749. 56. Rheinwald, J.G. and Green, H. (1975) Serial cultivation of strains of human 36. Cookson, W.O. and Moffatt, M.F. (2000) Genetics of asthma and allergic epidermal keratinocytes: the formation of keratinizing colonies from single disease. Hum. Mol. Genet., 9, 2359–2364. cells. Cell, 6, 331–343. 37. Walley, A.J., Chavanas, S., Moffatt, M.F., Esnouf, R.M., Ubhi, B., 57. Simon, M. and Green, H. (1985) Enzymatic cross-linking of involucrin and Lawrence, R., Wong, K., Abecasis, G.R., Jones, E.Y., Harper, J.I. et al. other proteins by keratinocytes particulates in vitro. Cell, 40, 677–683. (2001) Gene polymorphism in Netherton and common atopic disease. Nat. 58. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: Genet., 29, 175–178. a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring 38. Kato, A., Fukai, K., Oiso, N., Hosomi, N., Murakami, T. and Ishii, M. Harbor, NY. (2003) Association of SPINK5 gene polymorphisms with atopic dermatitis 59. Frangioni, J.V. and Neel, B.G. (1993) Solubilization and purification of in the Japanese population. Br. J. Dermatol., 148, 665–669. enzymatically active glutathione S-transferase (pGEX) fusion proteins. 39. Rice, K.D., Tanaka, R.D., Katz, B.A., Numerof, R.P. and Moore, W.R. Anal. Biochem., 210, 179–187. (1998) Inhibitors of tryptase for the treatment of mast cell-mediated 60. Harlow, E. and Lane, D. (1988) Antibodies: A Laboratory Manual. Cold diseases. Curr. Pharm. Res., 4, 381–396. Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 40. Hou, L., Kapas, S., Cruchley, A.T., Macey, M.G., Harriott, P., Chinni, C., 61. Goodyer, I.D., Jones, E.E., Monaco, A.P. and Francis, M.J. (1999) Stone, S.R. and Howells, G.L. (1998) Immunolocalization of protease- Characterization of the Menkes protein copper-binding domains and activated receptor-2 in skin: receptor activation stimulates interleukin-8 their role in copper-induced protein relocalization. Hum. Mol. Genet., 8, secretion by keratinocytes in vitro. Immunology, 94, 356–362. 1473–1478. 41. He, S., Gaca, M.D. and Walls, A.F. (1998) A role for tryptase in the 62. Failla, C.M., Odorisio, T., Cianfarani, F., Schietroma, C., Puddu, P. and activation of human mast cells: modulation of histamine release by tryptase Zambruno, G. (2000) Placenta growth factor is induced in human and inhibitors of tryptase. J. Pharmacol. Exp. Ther., 286, 289–297. keratinocytes during wound healing. J. Invest. Dermatol., 115, 388–395. Annexe 2

Ishida-Yamamoto A, Deraison C, Bonnart C, Bitoun E, Robinson R, O'Brien TJ, Wakamatsu K, Ohtsubo S, Takahashi H, Hashimoto Y, Dopping-Hepenstal PJ, McGrath JA, Iizuka H, Richard G, Hovnanian A. LEKTI is localized in lamellar granules, separated from KLK5 and KLK7, and is secreted in the extracellular spaces of the superficial stratum granulosum. J Invest Dermatol, 2005, 124:360-366.

173 174 LEKTI Is Localized in Lamellar Granules, Separated from KLK5 and KLK7, and Is Secreted in the Extracellular Spaces of the Superficial Stratum Granulosum

Akemi Ishida-Yamamoto,Ã Ce´ line Deraison,w Chrystelle Bonnart,w Emmanuelle Bitoun,w Ross Robinson,z Timothy J. O’Brien,y Kotaro Wakamatsu,Ã Sawa Ohtsubo,Ã Hidetoshi Takahashi,Ã Yoshio Hashimoto,Ã Patricia J. C. Dopping-Hepenstal,z John A. McGrath,z Hajime Iizuka,Ã Gabriele Richard,# and Alain Hovnanianw ÃDepartment of Dermatology, Asahikawa Medical College, Asahikawa, Japan; wDepartment of Genetics, INSERM U563 and Universite´ Paul Sabatier, Purpan Hospital, Toulouse, France; zDepartment of Structural Biology, Wellcome Trust Centre for Human Genetics, Oxford, UK; yDepartment of Obstetrics and Gynecology, University of Arkansas for Medical Science, Arkansas, USA; zGenetic Skin Disease Group, St John’s Institute of Dermatology, GKT Medical school, St Thomas’ Hospital, London, UK; #Department of Dermatology and Cutaneous Biology and the Jefferson Institute of Molecular Medicine, Jefferson Medical College, Philadelphia, Pennsylvania, USA

Lympho-epithelial Kazal-type-related inhibitor (LEKTI) is a putative serine protease inhibitor encoded by serine protease inhibitor Kazal-type 5 (SPINK5). It is strongly expressed in differentiated keratinocytes in normal skin but expression is markedly reduced or absent in Netherton syndrome (NS), a severe ichthyosis caused by SPINK5 mutations. At present, however, both the precise intracellular localization and biological roles of LEKTI are not known. To understand the functional role of LEKTI, we examined the localization of LEKTI together with kallikrein (KLK)7 and KLK5, possible targets of LEKTI, in the human epidermis, by confocal laser scanning microscopy and immunoelectron microscopy. In normal skin, LEKTI, KLK7, and KLK5 were all found in the lamellar granule (LG) system, but were separately localized. LEKTI was expressed earlier than KLK7 and KLK5. In NS skin, LEKTI was absent and an abnormal split in the superficial stratum granulosum was seen in three of four cases. Collectively, these results suggest that in normal skin the LG system transports and secretes LEKTI earlier than KLK7 and KLK5 preventing premature loss of stratum corneum integrity/cohesion. Our data provide new insights into the biological functions of LG and the pathogenesis of NS. Key words: electron microscopy/immunoelectron microscopy/keratinocytes/serine protease inhibitor J Invest Dermatol 124:360 –366, 2005

Lympho-epithelial Kazal-type-related inhibitor (LEKTI) is a NS is characterized by severe ichthyosis (ichthyosis line- predicted serine protease inhibitor encoded by serine pro- aris circumflexa and/or congenital ichthyosiform erythro- tease inhibitor Kazal-type 5 (SPINK5), the causative gene of derma), a specific hair-shaft abnormality known as ‘‘bamboo the severe autosomal recessive ichthyotic skin disorder, hair’’, and atopic manifestations with high IgE levels. Markedly Netherton syndrome (NS) (Chavanas et al, 2000; Bitoun increased trypsin-like hydrolytic activity has been recently et al, 2001; Sprecher et al, 2001, 2004). LEKTI is strongly demonstrated in the stratum corneum of NS (Komatsu et al, expressed in the granular and uppermost spinous layer of 2002). This raises the possibility that defective inhibitory reg- the epidermis (Bitoun et al, 2003). It is processed into short ulation of epidermal serine proteases because of decreased fragments and is secreted from the keratinocytes (Bitoun LEKTI activity may result in early degradation of desmo- et al, 2003). Among its possible targets are kallikrein (KLK)7 somes, and that this might account for the observed skin (stratum corneum chymotryptic enzyme) and KLK5 (stratum pathology in NS. Therefore, to elucidate the role of LEKTI in corneum tryptic enzyme) (Bitoun et al, 2003). KLK7 and skin biology, we studied the localization of LEKTI, KLK7, and KLK5 are thought to be involved in desquamation through KLK5 in normal human skin by confocal laser scanning the proteolysis of intercellular adhesion molecules, such as microscopy and immunoelectron microscopy and analyzed desmoglein (DSG) (Ekholm et al, 2000). KLK7 is localized in the structural integrity of the NS epidermis. lamellar granules (LG) (Sondell et al, 1995; Ishida-Yama- moto et al, 2004), but ultrastructural localization of KLK5 has not been reported. Results and Discussion

LEKTI expression was investigated and compared with those of KLK7 and KLK5. The NS patients in this study Abbreviations: KLK, kallikrein; LEKTI, lympho-epithelial Kazal- type-related inhibitor; LG, lamellar granules; NS, Netherton syn- comprised one individual (case 1) who was a compound drome; SPINK5, serine protease inhibitor Kazal-type 5 heterozygote for the SPINK5 mutations 377delAT and

Copyright r 2004 by The Society for Investigative Dermatology, Inc. 360 124 : 2 FEBRUARY 2005 LEKTI IN LAMELLAR GRANULES 361

Figure 1 Mutations of the serine protease inhibitor Kazal-type 5 gene iden- tified in case 1. Sequence chromatograms illustrate a heterozygous transition (2368C/T) in exon 25 leading to amino acid replacement R790X (A, left) compared with the wild-type sequence (A, right). The mutation results in loss of a TaqI site and prevents digestion of the mutant sequence. TaqI restriction fragment analysis of a PCR amplicon of exon 25 from the affected patient (P) results in two bands, which represent the undigested fragment (367 bp) of the mutant allele in ad- dition to the cleaved fragments (181 and 186 bp, both appear as one band) of the wild-type allele. In contrast, amplicons of six normal con- trols (C1–C6) show complete digestion. M: DNA 100 bp ladder (Prome- ga, Madison, Wisconsin). (B) Illustrates a heterozygous 2 base pair deletion in exon 5 (377delAT) resulting in frameshift and a premature termination codon (B, top left). The mutant sequence of exon 5 is two nucleotides shorter than the wild-type sequence (B, bottom right)as evident from the second peak of the HPLC profile (B, top right) com- pared with normal (B, bottom right).

R790X (Fig 1) similar to an unrelated previously published case (Bitoun et al, 2001), and three cases (cases 2–4) who were all homozygous for the previously described frameshift Figure 2 mutation 2468insA (Chavanas et al, 2000). For the skin Lympho-epithelial Kazal-type-related inhibitor (LEKTI) is express- immunostaining, three different antibodies against LEKTI ed earlier than kallikrein (KLK)7 (A) and KLK5 (B) in the epidermis. LEKTI staining (mouse monoclonal antibody, seen in red) is expressed gave essentially the same results. Concordant with earlier from the upper spinous layer, whereas KLK7 and KLK5 are detected in findings (Bitoun et al, 2003), LEKTI immunoreactivity was the most superficial granular cells (green). A double-positive zone is detected in normal differentiated epidermal kerainocytes seen in between (orange arrows). Note the apical localization of LEKTI (white arrows). Stratum corneum is positive to both KLK, but negative but not in NS epidermis (Figs 2 and 3A, B). The observation to LEKTI. Confocal laser scanning microscopy. Differential interference that no LEKTI protein is detectable on skin biopsy of case 1 microscopy images are superimposed upon immunofluorescent (Fig 3B) indicates that both mutations lead to null alleles. images. KLK7 and KLK5 have been detected in a thin zone at the border between the stratum granulosum and stratum corn- this hypothesis, immunoelectron microscopy was per- eum and also in the stratum corneum (Ekholm et al, 2000), formed. and this was confirmed by this study (Fig 2). Double LG constitute a specialized secretory system within the immunostaining revealed that LEKTI was expressed earlier epidermis. Initially, LG were thought to be isolated granules during epidermal differentiation than KLK7 and KLK5 (Fig 2). that migrate to the apical cell surface and secrete their Although immunoelectron microscopy results showed fre- contents into extracellular spaces. Recent studies, however, quent co-expression of LEKTI and KLK in the superficial have suggested that LG are part of beaded, tubular struc- granular cells, a double-positive layer was only occasionally tures continuous with the trans-Golgi network (Elias et al, detected by confocal laser scanning microscopy. This may 1998; Norlen, 2001; Ishida-Yamamoto et al, 2004). Ultra- be because of the differences in tissue preparation, pene- structurally, LG look different depending on the electron tration of antibodies, epitope masking, and/or sensitivities microscopy methods used to view them. As shown in of techniques. As noted previously (Bitoun et al, 2003), LE- Fig 4A, LG are seen as isolated oval-shaped granules in KTI staining was concentrated on the apical side of the post-embedding methods, whereas they appear as parts of cells, thus suggesting its association with LG. To evaluate beaded tubular structures in cryo-ultramicrotomy (Fig 4B). 362 ISHIDA-YAMAMOTO ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

Figure 3 Lympho-epithelial Kazal-type-related inhibitor (LEKTI) is deficient and cornified cells are less adhesive in Netherton syndrome (NS). Immunohistochemical staining using a polyclonal antibody against the D1–D6 domains of LEKTI revealed the presence of LEKTI protein in the apical parts of the spinous and granular cells of normal skin (A), but not in the NS skin (case 1) (B). Using hematoxylin–eosin staining of paraffin- embedded sections, the stratum corneum was found to be thickened in NS (case 1) (C) than in normal skin (D). In NS, the outlines of the cells were undulated and extensive clefts were noted starting in the deeper layer, as indicated by the arrow, in contrast to the smooth outlines of normal stratum corneum.

Figure 4 In this study, we localized LEKTI within LG using both Lympho-epithelial Kazal-type-related inhibitor (LEKTI) is transport- methods (Fig 4). Thus, together with previous demonstra- ed through the lamellar granule (LG) system. Post-embedding tion of elafin, another protease inhibitor, in the LG (Pfundt immunoelectron microscopy using Lowicryl HM20 resin (A, D) and a cryo-ultramicrotomy method (B, C, E). (A, B) LEKTI signals (black ar- et al, 1996, Nakane et al, 2002), our result highlights rows) are detected in the LG using polyclonal antibodies against D8– the biological significance of LG in regulation of protease D11 in (A) and D1–D6 in (B). Note that LG are seen as isolated granules activities. LEKTI labels were aggregated and not evenly in the post-embedding method (A), but appear as beaded tubular structures in the cryo-ultramicrotomy (B). Lamellar internal structures distributed throughout the LG system, indicating the heter- are seen in both methods (white arrows). (C) LEKTI is secreted from the ogeneous nature of the LG (Ishida-Yamamoto et al, 2004). apical side of upper granular cells (arrows). d, desmosomes. Polyclonal Previous studies have suggested that biologically active antibody to D8–D11 and desmoglein 1 monoclonal antibody were used fragments derived from LEKTI are released extracellularly and were labeled with 5 and 10 nm immunogold, respectively. (D) LEKTI antibody to D8–D11 labels are closely associated with those of the (Bitoun et al, 2003). As demonstrated for other LG cargoes, TGN46-positive trans-Golgi network. (E) LEKTI (monoclonal antibody, 5 LEKTI labels were seen in the extracellular spaces in the nm gold labels) and glucosylceramides (GlcCer, 10 nm gold labels) are superficial granular layers and the first cornified layer with localized within the same continuous beaded tubular structure of the release from the apical side of upper granular cells (Fig 4C). LG system. Aggregates of LEKTI immunolabels were also closely as- sociated with the TGN46-positive trans-Golgi network (Fig 4D). Whether this represents sorting of LEKTI in TGN has to system (Fig 6). Consistent with the immunofluorescent re- be verified in future studies. Double labeling with antibodies sults, LEKTI was detected intracellularly and extracellularly to glucosylceramide, a well-known LG molecule, showed in deeper epidermal layers than KLK7, which was found in that each occupies a distinct domain of beaded tubular more superficial differentiated keratinocytes (Fig 5). This structure (Fig 4E). This separate localization of different finding suggests that LEKTI is expressed and released ear- cargoes was maintained up to the undersurface of the lier than its target proteases, which is consistent with a role plasma membrane in the stratum granulosum–stratum in preventing premature proteolysis of extracellular matrix corneum interface. proteins or cell surface adhesion molecules, and in control- The ultrastructural localization of LEKTI was compared ling the timing of desquamation. In the stratum granulosum– with that of KLK7. As reported previously (Sondell et al, stratum corneum interface, LEKTI and KLK7 were found 1995; Ishida-Yamamoto et al, 2004), KLK7 was localized in either separately or mixed together (Fig 7). About 70% of the LG system (Figs 5 and 6) but was not co-localized with LEKTI gold labels (49 out of 66) were within 30 nm distance LEKTI within keratinocytes. Indeed, in the double-positive from the nearest KLK7 labels. Above the first layer of cells, LEKTI and KLK7 localized separately within the LG the stratum corneum, LEKTI immunoreactivity was not 124 : 2 FEBRUARY 2005 LEKTI IN LAMELLAR GRANULES 363

Figure 7 Lympho-epithelial Kazal-type-related inhibitor (LEKTI) and kallik- Figure 5 rein (KLK)7 are co-localized in the extracellular spaces (ECS). In the Lympho-epithelial Kazal-type-related inhibitor (LEKTI) is secreted ECS of the stratum granulosum (SG1)–stratum corneum (SC) interface, earlier than kallikrein (KLK)7. (A) Shows a Lower magnification view LEKTI (5 nm gold labels, small arrows) and KLK7 (10 nm gold labels, of the stratum corneum (SC), the most superficial stratum granulosum large arrows) can be seen separated in some places, but are apparently (SG1), the second (SG2), and the third granular layer (SG3). The rec- co-localized in others. tangular area marked as ‘‘B’’ is shown at higher magnification in (B), which shows LEKTI secreted into the extracellular spaces (ECS) be- tween SG2 and SG3. (C) Shows a higher magnification view of the boxed area marked ‘‘C’’ in (B) showing KLK7-containing lamellar gran- ules in SG2. d, desmosomes. Cryo-ultramicrotomy method. A mono- clonal antibody to LEKTI D1–D6 and a polyclonal KLK7 antibody were used and were labeled with 10 and 5 nm immunogold, respectively.

Figure 6 Lympho-epithelial Kazal-type-related inhibitor (LEKTI) and kallik- Figure 8 rein (KLK)7 are transported separately in the lamellar granule Kallikrein (KLK)5 is localized in the lamellar granule (LG) system, system. (A) Lower magnification view of the most superficial stratum but separated from Lympho-epithelial Kazal-type-related inhibitor granulosum (SG1), the second (SG2), the third (SG3), and the most (LEKTI). (A) Note beaded tubular structure with partial lamellar internal superficial stratum spinosum (SS). The marked rectangular area in structures (white arrows) of the LG system containing KLK5 as aggre- SG3 is shown at higher magnification in (B). Cryo-ultramicrotomy gates (black arrows). (B) Shows LEKTI (10 nm gold) and KLK5 (5 nm method. A monoclonal LEKTI antibody to D1–D6 and a polyclonal KLK7 gold) double labeling. Cryo-ultramicrotomy method. antibody were used and were labeled with 10 and 5 nm immunogold, respectively.

the LG system (Fig 8B). The separate transport of LEKTI and detected, but KLK7 labels remained up to the superficial KLK may prevent their interaction within the cells. But this layers. Future biochemical analysis of stratum corneum will speculation based on microscopy has to be evaluated by be needed to define when LEKTI-derived fragments and other methods such as biochemical analysis of purified their enzymatic activities are lost in the stratum corneum. proteins. We also studied ultrastructural localization of KLK5 and On light microscopy, the stratum corneum of NS skin found it in the LG system (Fig 8) and extracellular spaces was thick and laminated, and the intercellular clefts were between granular cells and cornified cells. Double labeling observed from just above the stratum granulosum (Fig 3C). showed that LEKTI and KLK5 occupied distinct domain of Although this lamination has often been thought to be an 364 ISHIDA-YAMAMOTO ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

Figure 9 Early desmosome split in Netherton syndrome (NS). By conven- tional transmission electron microscopy, a desmosomal split is seen in the superficial granular cells (A, B). The rectangular area marked in (A)is shown at higher magnification in (B). Note that the midline structures of the desmoglea remain on the basal side of split desmosomes (d) (ar- rows in B). Using desmoglein 1 immunoelectron microscopy, immuno- labeling is detected in the desmoglea in the basal part of the split desmosome in NS (arrow, C), and intact desmosomes in normal control skin (D) (post-embedding method). Asterisks indicate lamellar granule contents secreted into the extracellular spaces.

Figure 10 Desmosome disintegration coincides with kallikrein (KLK)7 secre- tion. (A) In the lower stratum corneum where KLK7 labels (5 nm gold) artifact that arises during tissue dehydration with ethanol, are detected in the intercellular spaces, desmoglein 1 (DSG1) (10 nm we hypothesized that NS skin might actually be more vul- gold) labels are associated with intact desmosomes in the normal skin. nerable and easily separated as part of a real pathological (B) In Netherton syndrome (NS) skin, the early sign of desmosomal split process. In Epon-embedded electron microscopy samples, is detected (right-hand side). Note the many KLK7 labels around DSG1 labels. KLK7 and DSG1 double immunolabeling. (C) A KLK7-positive intercellular micro-splits were observed in the superficial lamellar granule found in NS skin. Post-embedding immunoelectron granular layer in three of four NS cases (cases 1–3) (Fig 9). microscopy. The splits were associated with asymmetrical separation of desmosomes and intercellular release of LG contents, in- cluding KLK7 (Figs 9 and 10). KLK7 was localized in the LG the stratum granulosum of NS are likely to be one of the system in NS as in normal skin and was seen around DSG1 primary consequences of premature protease activation. labels at desmosomal split in NS (Figs 10B, C). (KLK5 lo- Appropriate coordination of proteases and their inhibitors calization in NS could not be investigated, because NS skin is vital for proper desquamation, which requires the pro- samples were processed for a post-embedding method teolytic dissolution of intercellular cohesive structures in the only and the antibody did not work.) We believe that these stratum corneum. Clinically, sheet-like peeling of the stra- abnormalities are distinctive microscopic features of NS, tum corneum resembling peeling skin syndrome has been which indicate that the loss of adhesion within the stratum observed in NS patients (Sprecher et al, 2001). Although the corneum is a key pathological event in this genodermatosis. actual physiologic substrates of LEKTI are currently un- Recent observations in SPINK5-null mice seem to support known, these clinical symptoms together with this demon- this notion (Descargues et al, 2004, submitted). Micro-splits stration of split desmosomes, strongly suggests that LEKTI in the stratum corneum were frequently observed in the is a specific inhibitor of proteases involved in desmosome stratum corneum in the normal as well as in NS skin, but disintegration. Allen et al (2001) proposed the pathogenic granular cell splits were not found in 20 normal control skin sequence model in NS, where increased tryptic enzyme samples. Previously reported electron microscopic examina- leads to barrier defects via multiple pathways including ac- tions of NS have found various morphological changes, in- tivation of phospholipase A2, activation of IL-1a, and des- cluding premature secretion of LG contents, and abnormal mosomal degradation. Komatsu et al (2002) found a marked extracellular material in the stratum corneum (Fartasch et al, increase in trypsin-like hydrolytic activity in stratum corn- 1999). Premature detachment or entirely missing stratum eum from NS, and proposed a model for the proteolytic corneum has also been documented (De Wolf et al,1996, processing of LEKTI in the epidermis and inhibitory Hausser and Anton-Lamprecht, 1996). Micro-clefts found in regulation of corneocyte desquamation by a set of LEKTI- 124 : 2 FEBRUARY 2005 LEKTI IN LAMELLAR GRANULES 365 derived peptides. These results support this model and amplify the entire coding sequence and flanking non-coding se- provide further fundamental information about the biological quences of the SPINK5 gene by PCR. All 33 coding exons were roles of LEKTI. separately amplified, gel purified, and subjected to bi-directional direct DNA sequence analysis as previously described (Sprecher et al, 2001). Sequence variants were confirmed in the patient and excluded from control alleles by dHPLC analysis on a Wave DNA Materials and Methods fragment analysis system (Transgenomics, Omaha, Nebraska) (mutation in exons 5; 90 control individuals) and by restriction Patients and clinical material Case 1 was a 17-y-old Japanese fragment analysis with TaqI (mutation in exon 25; 30 control indi- girl with generalized congenital ichthyosiform erythroderma, viduals). For the former, 10 mL of each sample was separately in- who was born of to non-consanguineous parents. She was initially jected and analyzed over 7.5 min at a non-denaturing temperature diagnosed as having non-bullous congenital ichthyosiform er- of 501C to determine the amplicons sizes. For restriction enzyme ythroderma (Hashimoto et al, 1987). Skin lesions improved with analysis, 400 bp amplicons encompassing exon 25 were purified age, but the face and trunk were constantly erythematous and on MicroSpin S-400 columns (Amersham Pharmacia Biotech, Pi- scaly plaques remained in the extremities. Marked growth retar- scataway, New Jersey), digested for 2 h at 371C according to dation was noted at the age of 3 y. Hair abnormalities were noted the supplier’s recommended conditions (New England Biolabs, after puberty. Hair did not grow long and trichorrhexis nodosa was Beverly, Massachusetts), and separated on 2% agarose gels. detected in some hair shafts. Serum IgE levels were elevated (3857 Since the mutation 2368C T destroys a TaqI recognition site, the IU per mL). Cases 2–4 were typical NS cases from Kashmir cor- ! 367 bp band remained intact in the presence of the mutation, responding to affected members of families 11–13 in the previous whereas the wild-type sequence was cleaved in a 181 and a 186 report (Chavanas et al, 2000). Tissue samples of normal skin were bp fragment, which were visible as a single broad band (Fig 1). used as controls. All participants gave informed consent and the protocol was approved by the medical ethical committee of the Asahikawa Medical Collage. The study was conducted according to the principles of the Helsinki declaration. We would like to thank Mrs Keiko Nishikura and Miss Yasuyo Ni- Antibodies The primary antibodies were three LEKTI antibodies shinome for their valuable technical assistance. This work was sup- (rabbit polyclonal antibodies against N-terminal D1–D6 domains; ported by grants from the Ministry of Education, Culture, Sports, Bitoun et al, 2003, mouse monoclonal antibodies against D1–D6 Science and Technology and the Ministry of Health, Labor, and Welfare domains; Bitoun et al, 2003 and rabbit polyclonal antibodies of Japan to A. I-Y. Electron microscopy samples were observed at the Electron Microscopy Unit of the Central Laboratory for Research and against D8–D11 domains; A. Hovnanian, unpublished), mouse anti- Education at Asahikawa Medical College. Molecular studies were sup- DSG1-P23 (Progen, Heidelberg, Germany), rabbit polyclonal anti- ported by NIH grants AR47157 and AR02141 to G. R. LEKTI antibodies KLK7 (Tanimoto et al, 1999), rabbit polyclonal anti-KLK5 (Santa purification and characterization were supported by PHRC grant Cruz Biotechnology, Santa Cruz, California), sheep anti-TGN46 102908 and INSERM/AFM/Ministry of Research grant A00080BS to (Serotec, Oxford, UK), and rabbit anti-glucosylceramides (Glyco- A. H. biotech, Kukels, Germany). For immunofluorescence analysis, the following secondary re- DOI: 10.1111/j.0022-202X.2004.23583.x agents were used: Alexa-Fluor 488 goat anti-rabbit IgG highly Manuscript received June 12, 2004; revised September 28, 2004; cross-absorbed (Molecular Probes, Eugene, Oregon) and Cy3- accepted for publication September 30, 2004 labeled goat anti-mouse IgG (Amersham Bioscience, Bucking- hamshire, UK). Secondary antibodies used for electron microscopy Address correspondence to: Dr Akemi Ishida-Yamamoto, Department were 10 or 5 nm gold-conjugated goat anti-rabbit IgG (Amersham of Dermatology, Asahikawa Medical College, Midorigaoka-Higashi 2-1- Bioscience, BBInternational, Cardiff, UK), 10 or 5nm gold-conju- 1-1, Asahikawa 078-8510, Japan. Email: [email protected] gated goat anti-mouse IgG (Amersham Bioscience), and 10 nm gold-conjugated donkey anti-sheep IgG (BBInternational).

Immunostaining and morphological analysis Immunofluores- References cence analysis was performed as described previously (Ishida- Allen A, Siegfried E, Silverman R, et al: Significant absorption of topical ta- Yamamoto et al, 2004). Fluorescence images were obtained using crolimus in 3 patients with Netherton syndrome. Arch Dermatol 137: a Fluoview FV500 confocal laser scanning microscope (Olympus 747–750, 2001 America, Melville, New York). For immunohistochemistry, a stand- Bitoun E, Chavanas S, Irvine AD, et al: Netherton syndrome: Disease expression ard streptavidin–biotin method using diaminobenzidine as a subst- and spectrum of SPINK5 mutations in 21 families. J Invest Dermatol rate for peroxidase was used on formalin-fixed and paraffin- 118:352–361, 2001 embedded sections of skin samples from case 1. Bitoun E, Micheloni A, Lamant L, et al: LEKTI proteolytic processing in human Immunoelectron microscopy using Lowicryl K11M resin- and primary keratinocytes, tissue distribution and defective expression in HM20 resin-(Chemische Werke Lowi, Waldkraiburg, Germany) Netherton syndrome. Hum Mol Genet 12:2417–2430, 2003 Chavanas S, Bodemer C, Rochat A, et al: Mutations in SPINK5, encoding a serine embedded samples and ultrathin cryosections was performed protease inhibitor, cause Netherton syndrome. Nat Genet 25:141–142, as described previously (Ishida-Yamamoto et al, 2004). For all 2000 immunohistochemistry, negative controls included incubation in De Wolf K, Ferster A, Sass U, Andre J, Stene J-J, Song M: Netherton’s syndrome: the presence of secondary antibody alone and incubation with A severe neonatal disease. Dermatology 192:400–402, 1996 unrelated primary antibodies. Ekholm IE, Brattsand M, Egelrud T: Stratum corneum tryptic enzyme in normal For conventional transmission electron microscopy, small piec- epidermis: A missing link in the desquamation process? J Invest De- es of skin samples were fixed in half-strength Karnovsky fixative, rmatol 114:56–63, 2000 followed by further fixation in 1% osmium tetroxide in distilled wa- Elias PM, Cullander C, Mauro T, Rassner U, Komuves L, Brown BE, Menon GK: ter. After en bloc staining with uranyl acetate, specimens were The secretory granular cell: The outermost granular cell as a specialized secretory cell. J Invest Dermatol: Dermatol Symp Proc 3:87–100, 1998 dehydrated in ethanol and embedded in Epon812 (Taab, Berkshire, Fartasch M, Williams ML, Elias PM: Altered lamellar body secretion and stratum UK). Ultrathin sections were stained with uranyl acetate and lead corneum membrane structure in Netherton syndrome. Arch Dermatol citrate. 135:823–832, 1999 Hashimoto Y, Ishida A, Matsumoto M, Iizuka H, Mizumoto T, Murono K, Fujita K: A Mutation analysis With informed consent, genomic DNA was ex- case of nonbullous congenital ichthyosiform erythroderma. Jpn J Clin tracted from a peripheral blood sample of patient 1 and used to Dermatol 41:207–213, 1987 366 ISHIDA-YAMAMOTO ET AL THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

Hausser I, Anton-Lamprecht I: Severe congenital generalized exfoliative er- Sondell B, Thornell L-E, Egelrud T: Evidence that stratum corneum chymotryptic ythroderma in newborns and infants: A possible sign of Netherton syn- enzyme is transported to the stratum corneum extracellular space via drome. Pediatr Dermatol 13:183–199, 1996 lamellar bodies. J Invest Dermatol 104:819–823, 1995 Ishida-Yamamoto A, Simon M, Kishibe M, et al: Epidermal lamellar granules Sprecher E, Chavanas S, DiGiovanna JJ, et al: The spectrum of pathogenic transport different cargoes as distinct aggregates. J Invest Dermatol mutations in SPINK5 in 19 families with Netherton syndrome: Implications 122:1137–1144, 2004 for mutation detection and first case of prenatal diagnosis. J Invest De- Komatsu N, Takata M, Otsuka N, Ohka R, Amano O, Takehara K, Saijoh K: rmatol 117:179–187, 2001 Elevated stratum corneum hydrolytic activity in Netherton syndrome Sprecher E, Tesfaye-Kedjela A, Ratajczak P, Bergman R, Richard G: Deleterious suggests an inhibitory regulation of desquamation by SPINK5-derived mutations in SPINK5 in a patient with congenital ichthyosiform er- peptides. J Invest Dermatol 118:436–443, 2002 ythroderma: Molecular testing as a helpful diagnostic tool for Netherton Nakane H, Ishida-Yamamoto A, Takahashi H, Iizuka H: Elafin, a secretory protein, syndrome. Clin Exp Dermatol 29:513–517, 2004 is cross-linked into the cornified cell envelopes from the inside of psoria- Tanimoto H, Underwood LJ, Shigemasa K, Yan Y, Clarke J, Parmley TH, O’Brien tic keratinocytes. J Invest Dermatol 119:50–55, 2002 TJ: The stratum corneum chymotryptic enzyme that mediates shedding Norlen L: Skin barrier formation: The membrane folding model. J Invest Dermatol and desquamation of skin cells is highly overexpressed in ovarian tumor 117:823–829, 2001 cells. Cancer 86:2074–2082, 1999 Pfundt R, van Ruissen F, van Vlijmen-Willems IMJJ, et al: Constitutive and in- ducible expression of SKALP/elafin provides anti-elastase defense in human epithelia. J Clin Invest 98:1389–1399, 1996

Annexe 3

Yamasaki K, Schauber J, Coda A, Lin H, Dorschner RA, Schechter NM, Bonnart C, Descargues P, Hovnanian A, Gallo RL. Kallikrein-mediated proteolysis regulates the antimicrobial effects of cathelicidins in skin. FASEB J, 2006, 20:2068-2080.

175 176 The FASEB Journal • Research Communication

Kallikrein-mediated proteolysis regulates the antimicrobial effects of cathelicidins in skin

Kenshi Yamasaki,* Ju¨rgen Schauber,* Alvin Coda,* Henry Lin,* Robert A. Dorschner,* Norman M. Schechter,† Chrystelle Bonnart,‡ Pascal Descargues,‡ Alain Hovnanian,‡,§ and Richard L. Gallo*,1 *Division of Dermatology, University of California, San Diego, and VA San Diego Health Care System, San Diego, California, USA; †Department of Dermatology, University of Pennsylvania, Philadelphia, Pennsylvania, USA; ‡Inserm, U563, Toulouse, F-31300, France; Universite´Paul-Sabatier, Toulouse, France, and §CHU Purpan, Department of Genetics, France

ABSTRACT The presence of cathelicidin antimicro- the presence of cathelicidin correlates with the ability bial peptides provides an important mechanism for of the host to effectively mount a defense against prevention of infection against a wide variety of micro- infection. Cathelicidin deficiency has also been re- bial pathogens. The activity of cathelicidin is controlled ported in Kostmann syndrome and is associated with by enzymatic processing of the proform (hCAP18 in severe congenial neutropenia and frequent oral infec- humans) to a mature peptide (LL-37 in human neutro- tion (9). Although antimicrobial peptides such as the phils). In this study, elements important to the process- cathelicidins represent an evolutionarily ancient form ing of cathelicidin in the skin were examined. Unique of immune response, current evidence strongly sup- cathelicidin peptides distinct from LL-37 were identi- ports the conclusion that these molecules are an inte- fied in normal skin. Through the use of selective gral element of human immunity (10). Antimicrobial inhibitors, SELDI-TOF-MS, Western blot, and siRNA, peptides such as cathelicidins act both to kill microbes the serine proteases stratum corneum tryptic enzyme and to initiate or modify other cellular immune events. (SCTE, kallikrein 5) and stratum corneum chymotryptic As such, these molecules have been alternatively re- protease (SCCE, kallikrein 7) were shown to control ferred to as “alarmins” (11). Due to this activity on the activation of the human cathelicidin precursor protein host, strict control of cathelicidin expression and func- hCAP18 and also influence further processing to tion is necessary to restrict activity of the peptide to smaller peptides with alternate biological activity. The conditions where maximal defense against microbial importance of this serine protease activity to antimicro- invasion is required. bial activity in vivo was illustrated in SPINK5-deficent The nascent cathelicidin protein is inactive and mice that lack the serine protease inhibitor LEKTI. consists of an N-terminal cathelin domain that is con- Epidermal extracts of these animals show a significant served among mammalian species and a C-terminal increase in antimicrobial activity compared with con- domain encoding the mature cathelicidin peptide. A trols, and immunoabsorption of cathelicidin dimin- comparison of cathelicidin peptides purified from var- ished antimicrobial activity. These observations demon- ious species or predicted by their respective cDNA strate that the balance of proteolytic activity at an sequences has revealed that these potent antimicrobial epithelial interface will control innate immune de- molecules are variable sequences of 20 to 40 amino fense.—Yamasaki, K., Schauber, J., Coda, A., Lin, H., acids in the C-terminal domain. In humans and mice Dorschner, R. A., Schechter, N. M., Bonnart, C., Des- the cathelicidin peptides are alpha-helical, cationic, cargues, P., Hovnanian, A., Gallo, R. L. Kallikrein- and amphipathic. These properties enable association mediated proteolysis regulates the antimicrobial effects and integration with negatively charged cell mem- of cathelicidins in skin. FASEB J. 20, 2068–2080 (2006) branes. Expression of cathelicidins, such as the human LL-37 Key Words: antimicrobial peptide ⅐ stratum corneum tryptic released from neutrophils, is regulated by transcrip- enzyme ⅐ stratum corneum chymotryptic protease ⅐ lympho-epi- tional and post-transcriptional processing. Cathelicidin thelial Kazal-type related inhibitor ⅐ SELDI-TOF-MS transcript and total protein abundance in vivo is in- duced by infection (12), inflammation (13), wounding (14), and differentiation (15, 16). In humans, 1,25- Cathelicidins are an antimicrobial gene family iden- dihydroxyvitamin D is a direct inducer of cathelicidin tified in mammals (1), birds (2), and fish (3). They are 3 expression (17) whereas in mice the cathelicidin best known for their action as innate antimicrobials that protect the host against infection by Gram-positive bacteria (4), Gram-negative bacteria (5, 6), and some 1Correspondence: MC 9111B, 3350 La Jolla Village Dr., San viruses (7). Analysis of several animal models (4), and Diego, CA 92161, USA. E-mail: [email protected] human clinical conditions (8), have demonstrated that doi: 10.1096/fj.06-6075com

2068 0892-6638/06/0020-2068 © FASEB mCRAMP (1) (mouse cathelin-related antimicrobial extracted with 100 ␮lof1ϫ radio-immunoprecipitation assay peptide) expression is dependent on HIF-1a (hypoxia- (RIPA) buffer (50 mM HEPES, 150 mM NaCl, 0.05% SDS, inducible factor 1, alpha) (18). Although these stimuli 0.25% deoxycholate, 0.5% Nonidet P-40, pH 7.4) with pro- teinase inhibitor mixture (complete EDTA-free; Roche, Indi- modify cathelicidin mRNA abundance, factors that anapolis, IN, USA). Samples were kept in –20°C until further regulate the translation and final activation of catheli- analysis. All sample acquisitions, including the skin biopsies, cidin are unclear. Recent observations of cathelicidins were approved by the Committee on Investigations Involving in vivo suggest that the final proteolytic processing of Human Subjects of the University of California, San Diego. cathelicidin dictates antimicrobial or alarmin activity Protein chips (RS100 protein chip array, Ciphergen Bio- ␮ (19). systems, Fremont, CA, USA) were coated with 4 l of rabbit The nascent human cathelicidin gene product is anti-LL-37 antibody (Ab) (0.73 mg/ml) for2hatroom temperature, followed by blocking with 0.5 M etahnolamine designated hCAP18 (human 18-kDa cationic antimicro- in PBS (pH 8.0). After washing three times with PBS/0.5% bial protein) (20). hCAP18 has been shown to be Triton X, protein chips were assembled in the Bioprocessor™ processed to the antimicrobial peptide LL-37 by pro- reservoir, and samples (50 ␮l) were applied and incubated for teinase-3 in neutrophils (21). The prostate-derived pro- 2 h at room temperature. Protein chips were washed three tease gastricsin can also process hCAP18 to ALL-38 times with 1 ϫ RIPA buffer, twice with PBS/0.5% Triton (22). At the skin surface, unidentified proteases present X-100, and three times with PBS, followed by soaking in 10 in human sweat can cleave LL-37 to smaller peptides mM HEPES buffer, then air dried. A half microliter of energy absorbance molecule (50%-saturated alpha-cyano-4-hydroxy such as RK-31, KS-30, and KR-20 (23). The native cinnamic acid in 50% acetonitrile, 0.5% trifluoric acid) was cathelicidin peptides at the skin surface are unknown, applied twice, and all spots were completely dried up. Sam- but these smaller peptides generated in vitro have more ples were analyzed on a SELDI mass analyzer PBS II with a potent antimicrobial activity than LL-37. Analysis of linear time-of-flight mass spectrometer (Ciphergen Biosys- alternatively processed human cathelicidin peptides tems) using time-lag focusing. Specificity and accuracy in this has further shown that processing alters the immuno- system were confirmed by several synthetic cathelicidin pep- tides as standards (19, 23). Synthetic LL-37 and KR-20 pep- stimulatory capacity of cathelicidins, eliminating their tides were used as an internal reference. Skin extracts from ability to stimulate interleukin (IL)-8 release (19). three individuals were analyzed and showed similar patterns These observations demonstrate the importance of of cathelicidin peptides. proteolytic processing to the activity of cathelicidins and, by extension, their importance to immune defense Collection and assay of skin proteases in general. Since the presence of cathelicidin in skin is critical for normal microbial defense and innate immunity, we Protease activity at the skin surface was evaluated in sweat sought in the present study to identify the cathelicidins collected as described for collection of human sweat (24). Activity was monitored by EnzCheck® Protease Assay Kit in human skin and define the proteases responsible for green fluorescence (Molecular Probes, Inc., Eugene, OR, cathelicidin activation. We show that novel cathelicidin USA) according to the manufacturer’s instructions. Briefly, peptide forms are present at the skin surface and that 100 ␮l of the aqueous solution collected from the skin surface kallikreins, a family of serine proteases known for their was mixed with 100 ␮l of BODIPY FL casein substrate and influence on the development of the epidermis, are incubated at 37°C for designated periods. Protease activity responsible for their generation. Moreover, we show was monitored as increased fluorescence with SpectraMax GEMINI EM (Molecular Devices Corp., Sunnyvale, CA, USA). that cathelicidin processing is altered in vivo in the In some experiments protease inhibitors were added, includ- absence of the serine protease inhibitor LEKTI. These ing mixed protease inhibitor mixture (complete EDTA-free, 1 data suggest that the function of kallikreins in the skin tablet/50 ml; Roche, Indianapolis, IN, USA), 200 ␮g/ml is in part to regulate the immune barrier, both by bestatin, 20 ␮g/ml E-64, and 20 ␮g/ml aprotinin (Sigma- modifying the physical structure of the epidermis and Aldrich, St. Louis, MO, USA), 200 ␮M 4-(2-aminoethyl)- ␮ by determining innate antimicrobial peptide function. benzenesulfonylfluoride (AEBSF), 200 M human neutro- phil elastase inhibitor (methoxysuccinyl-Ala-Ala-Pro-Ala- chloromethyl ketone, Calbiochem, San Diego, CA, USA), 200 ␮M human leukocyte elastase inhibitor (methoxysuccinyl-Ala- MATERIALS AND METHODS Ala-Pro-Val-chloromethylketone, Calbiochem), 100 ␮M chy- mostatin (Roche), or 10 ␮M leupeptin (Roche). Surface-enhanced laser desorption/ionization time-of-flight mass spectrometry Purification of protease activity To define the cathelicidin peptides in small samples of normal human skin, we used a surface-enhanced laser desorp- Sweat (240 ml) collected from the skin surface was concen- tion/ionization time-of-flight mass spectrometry (SELDI- trated using Macrosep™ Centrifugal Devices (3 kDa cutoff; TOF-MS) system. Normal human skin was obtained after Pall Life Science, Ann Arbor, MI, USA). Separation of enzyme informed consent. Five to 10 mm of normal skin at the activity was performed using an ⌬KTA purification system surgical margin was removed during routine surgical exci- (Amersham Pharmacia Biotech, Piscataway, NJ, USA) on a sions of nonmelanoma skin lesions. This was embedded in reverse phase HPLC (␮RPC C2/C18 ST 4.6/100 column; Tissue-Tek™ O.C.T. compound (Electron Microscopy Sci- Amersham Pharmacia Biotech). Columns were equilibrated ences, Fort Washington, PA, USA) and freshly frozen. Twenty in 0.1% trifluoroacetic acid at a flow rate of 1 ml/min and sections (10 ␮m thickness) were cut from frozen skin in eluted using gradients of 0–60% acetonitrile for 91 min. O.C.T. compound and collected in tubes. Proteins were Column effluent was monitored at 214, 230, and 280 nm. All

PROTEOLYTIC ACTIVATION OF CATHELICIDINS 2069 fractions collected (1 ml) were lyophilized and suspended in CA, USA) using the pulsed liquid program supplied by the 50 ␮l of distilled water for protease assay and immunoassay. manufacturer. Skin surface fractions purified by HPLC were evaluated by quantitative dot blot. Five microliters of each fraction was compared with a standard curve of recombinant SCTE (25) Antimicrobial assays applied onto NitroBond nitrocellulose membrane (GE Os- monics Labstore, Minnetonka, MN, USA). For immunoblot, For screening of antimicrobial activity, radial diffusion assay membranes were blocked with 5% nonfat milk and 3% BSA was used as described previously (24). Lyophilized HPLC in 0.1% TTBS (0.1% Tween 20/TBS (150 mM NaCl and 10 fractions were dissolved in 10 ␮l of MOPS buffer (pH 7.0) and mM Tris base, pH 7.4) for 60 min at room temperature, then tested against Staphylococcus aureus mprF (gift from A. Peschel, incubated with mouse anti-human SCTE monoclonal anti- Microbial Genetics, University of Tubingen, Tubingen, Ger- body (mAb) (1/1000 in the blocking solution; R&D Systems many). This strain of S. aureus was selected for screening due Inc., Minneapolis, MN, USA) overnight at 4°C. After washing to its increased sensitivity to cationic peptides. Thin plates (1 three times with 0.1% TTBS, the membrane was incubated mm) of 1% SeaKem® GTG® Agarose (Cambrex Corp., East with HRP-conjugated goat antimouse Ab (1/5000 in the Rutherford, NJ, USA) and 1% LB Broth (EM Science, Gibbs- blocking solution; DAKO, Carpinteria, CA, USA) for 60 min town, NJ, USA) in 10 mM phosphate buffer (pH 7.2) con- at room temperature. After washing the membrane again taining 5 ϫ 106 cells/ml of S. aureus mprF were used. with 0.1% TTBS, the membrane was immersed in enhanced One-millimeter wells were punched in the plates, and 2 ␮lof chemiluminescence (ECL) solution (Western Lightning™ samples were loaded in each well. As a positive control, Chemiluminescence Reagents Plus; Perkin-Elmer Life Sci- synthetic LL-37 was applied to separate wells. After incubation ences, Boston, MA, USA) for 60 s, then exposed to X-ray film at 37°C overnight, the inhibition zone diameters were mea- (X-Omat™; Eastman Kodak, Rochester, NY, USA). sured.

Analysis of cathelicidin processing Fluorescence immunohistochemistry LL-37 was synthesized and prepared as described previously (23). For analysis of LL-37 processing, 32 nmol of LL-37 Frozen sections of normal skin (6 ␮m) were fixed with ␮ synthetic peptide was incubated with proteases in 100 l for 0, paraformaldehyde, sections were blocked with 5% goat se- 1, 6, and 24 h at 37°C. The buffer used was 0.2 M NaCl, 0.1 M rum, then incubated simultaneously with polyclonal rabbit MOPS, pH 7.0 for SCTE and 2.0 M NaCl, 0.045 M Tris-HCl, anti-LL-37 and monoclonal mouse anti-SCTE primary anti- pH 8.0 for SCCE. After incubation, peptides were separated bodies. Goat anti-rabbit IgG conjugated to AlexaFluor488 ␮ by reverse phase HPLC (Sephasil peptide C18 12 m, ST (Molecular Probes) and goat antimouse IgG conjugated to 4.6/250 column; Amersham Pharmacia Biotech). Column tetramethylrhodamine isothiocyanate (TRITC) were used as was equilibrated in 10% acetonitrile with 0.1% trifluoroacetic secondary antibodies, respectively. Nuclei were stained with acid at a flow rate of 2 ml/min and cleaved peptides were 4Ј,6Ј-diam idino-2-phenylidole (DAPI) and sections were eluted using gradients of 10–20 and 20–70% acetonitrile for mounted in ProLong Anti-Fade reagent (Molecular Probes). 2 and 31 min, respectively. Column effluent was monitored at Images were obtained using an Olympus BX41 fluorescent 214, 230, and 280 nm. All collected fractions (1 ml) were microscope (Scientific Instrument Company, Temecula, CA, ␮ lyophilized and suspended in 10 l of distilled water for USA). antimicrobial radial diffusion assay or directly analyzed by mass spectrometry. For Western blot, recombinant hCAP18 (26) was incubated siRNA transfection with proteases and separated by 16% Tris-tricine gel (Gene- Mate® Express gels; ISC BioExpress, Kaysville, UT, USA), then transferred onto a polyvinylidene difluoride membrane siRNA for SCTE and SCCE and transfection reagents were (Immobilon-P; Millipore, Billerica, MA, USA). For the posi- obtained from Darmacon, Inc. (Chicago, IL, USA). The tive control, 5 pmol of LL-37 synthetic peptide was applied. human keratinocyte cell line HaCaT, a generous gift from Dr. Membranes were blocked with 5% nonfat milk and 3% BSA Norbert Fusenig (Krebsforschungszentrum, Heidelberg, Ger- in 0.1% TTBS, incubated with anticathelin domain chicken many), was cultured in Dulbecco’s modified Eagle medium Ab (1/5000 in the blocking solution) or anti-LL37 rabbit Ab (DMEM) plus 10% fetal calf serum and 100 U/ml penicillin, ␮ (1/5000 in the blocking solution), and developed as de- 100 g/ml streptomycin, and 2 mM L-glutamine. After cells ␮ scribed above. reached 70% confluence they were treated with 1 g of siRNA with transfection reagent or with transfection reagent only. Cultured media and cells were collected 48 h after transfec- Mass spectrometry and protein sequence analysis tion. Buffer with supplements at final concentrations of 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 5 Mass spectrometry was performed by the Mass Spectrometry mM EDTA, and 1 ␮g/ml pepstatin were added and samples Facility in the Department of Chemistry and Biochemistry were sonicated on ice for 5 min. After centrifuge at 14,000 at University of California, San Diego. The matrix-assisted rpm for 10 min, protease activities of supernatants was laser desorption/ionization time-of-flight mass spectrometry monitored by EnzCheck® Protease Assay Kit as described (MALDI-TOF-MS) spectra were obtained with a Finnigan above. The suppression of SCTE and SCCE mRNA were LCQ DECA mass spectrometer (Thermo Electron Corpora- confirmed by the quantitative RT-polymerase chain reaction tion, Waltham, MA, USA). The instrument has unit mass (RT-PCR) with specific primers and probes (Applied Biosys- resolution over a mass range of 50–2000 m/z with a typical tems). Glyceraldehyde-3-phosphate dehydrogenase primers mass accuracy of 100 ppm (0.01%). Protein sequence analysis and probe (Applied Biosystems) were used as an endogenous for target HPLC fractions was performed by the Division of control. Results of the quantitative polymerase chain reaction Biology Protein Sequencer Facility, University of California, (PCR) were plotted as the relative expression to the control San Diego. Amino acid sequencing was performed on Ap- using the Comparative Ct Method (User Bulletin #2, Applied plied Biosystems Procise model 494 sequencer (Foster City, Biosystems).

2070 Vol. 20 October 2006 The FASEB Journal YAMASAKI ET AL. Cathelicidin peptide extraction from mouse skin tant for defense against bacterial and viral infections. We hypothesized that LL-37, the form of cathelicidin Neonatal mouse skin was excised by 8 mm punch biopsy, first identified from human neutrophils, may not be the homogenized in 1 ml of 1 M acetic acid, and incubated at 4°C major form of cathelicidin normally present in the skin. overnight. After centrifugation for 15 min at 14,000 rpm, To identify the native cathelicidin peptides, normal soluble fractions were transferred to new tubes and lyophi- skin was extracted and peptide mass determined by lized. Pellets were dissolved in 50 ␮l of MOPS buffer (5 mM, pH 7.0). Antimicrobial activity against Staphylococcus aureus SELDI-TOF-MS. Multiple cathelicidin peptides were mprf was examined by radial diffusion assay as described detected in human skin samples in this system, with previously. Antimicrobial activities were determined in solu- LL-37 representing only 13.7% of the total peptides tion assay against wild-type (WT) S. aureus [Rosenbach Amer- detected (peak “n” in Fig. 1). The presence of this ican Type Culture Collection (ATCC) 25923; ATCC, Manas- spectrum of cathelicidin peptides suggested that local sas, VA, USA], methycilin-resistance S. aureus strain (81025 proteolysis has a major influence on the identity of and 82056, and clinical isolate generously provided by Dr. Joshua Fierer, Veterans Affairs Healthcare Systems (San Di- cathelicidin. Furthermore, these findings show that ego, CA, USA), group A streptococcus (M49 strian NZ131 prior conclusions were inaccurate when LL-37 was and M1 strain), and Pseudomonas aeruginosa (clinical isolate assumed to be the form of cathelicidin in skin. generously provided by Dr. Joshua Fierer). Bacteria (1ϫ106- 109 CFU) in log-phase growth were suspended in 20 ␮lof RPMI1640 with 10% FCS, and 5 ␮l of the skin extracts was Identification of cathelicidin processing enzymes at added and incubated at 37°C for 3 h. Bacteria were then the skin surface serially diluted in PBS and plated on TSB agar (tryptic soy broth; 30 g/l, Sigma-Aldrich, Bacto™agar; 10 g/l, BD Bio- science, Sparks, MD, USA) for direct colony count and To identify enzymes at the skin surface that cleave determination of CFU. Amount of mCRAMP was determined human cathelicidin, protease activity collected from the by immuno-dot blot using synthetic CRAMP peptides as skin surface of healthy volunteers was first detected by references, and mean and se of three mice were plotted on a fluorescence-conjugated casein-based assay. Protease the graph. Processing of mCRAMP was analyzed by SELDI- activity was detected by the increase in fluorescence TOF-MS as described previously with rabbit anti-CRAMP Ab over time compared with that seen when substrate was (14) (1.55 mg/ml) instead of antihCAP18/LL-37 Ab. To delete cathelicidin activity from skin extracts, skin extracts incubated in a buffer solution of similar ionic compo- were incubated with immobilized anti-CRAMP Ab, and super- sition (Fig. 2A). Enzyme activity was detectable for up to natants were analyzed as cathelicidin-immunoabsorbed skin 4 days after incubation. To determine the nature of extracts. Depletion of cathelicidin was confirmed by a second these proteases, a panel of inhibitors that distinguish SELDI-TOF analysis. Serine protease activity with the pres- between the various major protease families was in- ␮ ence of 5 mM EDTA and 1 g/ml pepstatin was determined cluded. The only effective inhibitors were aprotinin using EnzCheck® as described previously. and AEBSF, which are inhibitors of serine protease (Fig. 2B). Bestatin (amino peptidase inhibitor), E-64 (cystein protease inhibitor), N.E.I. (neutrophil elastase RESULTS inhibitor), L.E.I. (leukocyte elastase inhibitor), EDTA (metalloprotease inhibitor), and pepstatin (asparate Unique cathelicidin peptides are constitutively protease inhibitor) were ineffective. Chymostatin and present on human skin leupeptin, which specifically inhibit chymotrypsin-like and trypsin-like serine proteases, respectively, were Enzymatic processing of cathelicidin peptides dictates used to characterize this more precisely. Under these their function as an antimicrobial or immune modify- conditions, chymostatin suppressed protease activity ing molecule. These observations compelled us to first whereas leupeptin had a minimum effect, suggesting directly identity the human cathelicidins in normal a chymotrypsin-like serine protease was most active skin, a site where the presence of cathelicidin is impor- (Fig. 2C).

g 6 (LL-37) Figure 1. Processing of cathelicidin peptides n e in human skin. Cathelicidin peptides in hu- 4 l man skin extracts were captured with anti- k LL-37 Ab, and mass sizes were examined with a bc m f SELDI-TOF-MS. One representative data set hi j 2 d from three individuals is shown. The ratio of each peptide was determined by the area of the peaks and is listed. LL-37, the major cathelicidin peptide in neutrophils, was de- 0 tected in peak marked as n. 3000 0053 4000 0054

peak a b c d e f g h I j k l m n total % 3.7 3.3 4.4 2.4 11.5 3.2 22.6 3.1 5.1 3.0 7.9 9.9 6.2 13.7 100

PROTEOLYTIC ACTIVATION OF CATHELICIDINS 2071 59 showed the greatest protease activity against a casein substrate and could cleave LL-37 to several smaller peptides (Fig. 3B). The products cleaved from LL-37 were evaluated by matrix-assisted laser desorption/ionization time-of-flight mass spectrome- try (MALDI-TOF-MS) and their protein sequences were deduced from the molecular weights deter- mined in the analysis (Fig. 3C). Radial diffusion assay revealed that some of these fragments, such as KS-30, KS-27, KR-20, and LL-23, showed antimicrobial activ- ity against S. aureus mprF, whereas other shorter peptides lost antimicrobial activity (data not shown). The deduced cleavage sites producing the peptide patterns in Fig. 3C suggested that two different serine proteases were involved: one with trypsin-like sub- strate specificity that hydrolyze after Arg residues and the other with chymotrypsin-like substrate specificity that cleaves at after Phe residues. Therefore, tryp- tic and chymotryptic serine proteases were consid- ered candidates for skin surface cathelicidin pro- teases. Members of the kallikrein family of serine pro- teases have been detected in the stratum corneum. Two proteases well established as human skin are stratum corneum tryptic enzyme (SCTE, kallikrein 5/KLK5, hK5) and stratum corneum chymotryptic protease (SCCE, kallikrein 7/KLK7, hK7) (27, 28). To determine whether these enzymes were present in the skin surface preparations and whether they colo- calized with cathelicidin in skin, antiserum to each protease was used. SCTE immunoreactivity coeluted with fractions that showed protease activity (Fig. 3A). Immunohistochemistry of normal human skin dem- onstrated that SCTE and cathelicidin are colocalized in the granular to spinous layer, and LL-37 alone is detected at the uppermost layer of stratum corneum (Fig. 4A). Next, to determine what proportion of serine pro- tease activity from keratinocytes could be attributed to Figure 2. Protease activity at the human skin surface. A) Soluble material recovered from the skin surface was kallikrein activity, we examined the influence of siRNA incubated with fluorescence-conjugated casein substrate, targeting of SCTE and SCCE mRNA on the level of and activity was estimated based on the generation of caseinolytic activity secreted from keratinocytes. SCTE fluorescent product as described in Materials and Methods. and SCCE siRNA suppressed SCTE mRNA expression B) Surface protease activity was examined as in panel A at to 56% of control and SCCE mRNA to 72%, respec- 37°C for 24 h in the presence of inhibitor cocktail (non- specific protease inhibitor mixture), aprotinin and AEBSF tively (Fig. 5A), and both SCTE and SCCE siRNA (serine protease inhibitors), bestatin (amino peptidase significantly reduced human keratinocytes protease ac- inhibitor), E-64 (cystein protease inhibitor), N.E.I (neutro- tivity (Fig. 5B). phil elastase inhibitor), L.E.I (leukocyte elastase inhibitor), Human cathelicidin is initially synthesized as a pre- EDTA (metalloprotease inhibitor), and pepstatin (asparate cursor protein hCAP18 (26). To determine whether protease inhibitor). Data are presented as the mean and se SCTE and SCCE could cleave hCAP18, recombinant of three independent samples. C) Soluble protease activity was examined in the presence of serine protease inhibitors: hCAP18 was incubated with recombinant SCTE or chymostatin (specifically inhibits chymotrypsin-like pro- SCCE (25), and cleavage was examined by Western teases), leupeptin (specifically inhibits tryspsin-like pro- blot. Polyclonal antibody (pAb) against the cathelin teases). Data are presented as the mean and se of three domain (recognizing the N-terminal cathelin domain, independent samples. but not detecting cleaved C-terminal peptides, ref. 26) detected bands of ϳ12 kDa and 10 kDa after SCTE Surface enzyme activity was next concentrated by treatment and a ϳ14 kDa band after SCCE treatment centrifugal dialysis and fractionated by reverse-phase (Fig. 6A). Ab against LL-37 (recognizing the C-terminal chromatography (Fig. 3A). Fractions numbered 55 to 37 amino acid mature peptide domain) revealed that

2072 Vol. 20 October 2006 The FASEB Journal YAMASAKI ET AL. Figure 3. Skin production of SCTE cleaves LL-37 to shorter peptides. A) Concentrated surface protease preparations were separated on C2/C18 reverse phase chromatography and the activity of each fraction was measured by incubating with fluorescence-conjugated casein substrate. Immunoreactivity of each fraction to SCTE Ab was examined by dot blot. Fraction #55 to #59 had strong protease activity and immunoreactivity to SCTE Ab. B) Synthetic LL-37 peptide was incubated with fraction #55, and digested peptides were separated on C18 reverse phase chromatography. Antimicrobial activity of each fraction was examined by radial diffu- sion assay, and peptides that have antimicrobial activi- ties were indicated by an asterisk. C) Molecular mass of each peak indicated in panel B by small characters was determined by MALDI-TOF-MS and listed with its pep- tide sequence. Asterisks indicate the peptide with anti- bacterial activity.

SCTE generated a small fragment of ϳ6 kDa, and SCCE of Fig. 7A, the major products of SCTE digestion of generated an ϳ8 kDa band. To determine the se- LL-37 after1hofincubation were KS-29, KS-30 (peak quence of these small fragments directly, SCTE-treated g), and KS-22 (peak f). KS-22 was derived from KS-30 by hCAP18 peptides were isolated by chromatography and second cleavage eight residues from the C terminus. the molecular mass were determined by MALDI-MS. These three peptides have antimicrobial activity, indi- The small peptide cleaved by SCTE had a molecular cating that at early times of digestion SCTE will gener- mass of 4491, identifying it as LL-37 (Fig. 6B). On the ate biologically functional peptides. However, after 3 h other hand, treatment of hCAP18 with SCCE generated the peaks with antimicrobial activity (peaks f, g) began multiple peptides whose abundance was insufficient to to decline, indicating further processing to small non- identify by this approach (data not shown). functional peptides. Cleavage of LL-37 by SCCE was less efficient than SCTE and SCCE cleave LL-37 to shorter peptides by SCTE, as the LL-37 peak disappeared much more slowly in the incubation containing SCCE than in Unlike the in vitro conditions described in Fig. 6, the that containing SCTE. Consistent with its predicted cleaved cathelin domain is rarely detected in vivo. This specificity, SCCE cleaved LL-37 after Phe residues protein has activity as a protease inhibitor and antimi- (Fig. 7D). Although SCCE generated peptides RK-31 crobial (26), and structural studies suggest the cathelin and KR-20 (peaks o and n in Fig. 7C, respectively), domain has a pocket in which the C-terminal LL-37 which had antimicrobial activity and were seen on peptide may bind (29). As this may protect the peptide the surface of skin, the existence of these peptides from further proteolysis, we next examined conditions appeared to be short-lived. Their quantities showed a that reflect those observed in skin. LL-37 was incubated detectable change with time, and were no longer with recombinant SCTE and SCEE, and the peptide present after 24 h of incubation. Thus, their produc- products were determined. As shown in the time course tion appears highly transient, with digestion to

PROTEOLYTIC ACTIVATION OF CATHELICIDINS 2073 of neonatal SPINK5-deficient mice and of WT litter- mates and confirmed that protease activity in skin extracts from SPINK5-deficient mice was higher than WT littermates (Fig. 8A). Direct analysis of the effect of recombinant SCTE and SCCE on bacterial growth showed that these enzymes are not inherently anti- microbial. Furthermore, the abundance of total im- munoreactive cathelicidin expressed in SPINK5-defi- cient mice was not significantly different from WT littermates (Fig. 8B). Despite the similarity in the expression of cathelicidin, skin extracts from SPINK5-deficient mice inhibited growth of S. aureus mprF whereas skin extracts from WT littermates did not (Fig. 8C). Other Gram-positive and negative bacterial species were similarly inhibited by SPINK5- deficient, but not WT mice including WT S. aureus, methycillin-resistant S. aureus, group A Streptococcus, and Pseudomonas aeruginosa (data not shown). Immu- noabsorption of skin extracts with anti-CRAMP Ab effectively removed mCRAMP and precursor protein based on HPLC and SELDI-TOF analysis (data not

Figure 4. Cathelicidin and SCTE are colocalized in human skin. A, B) Localization of cathelicidin and SCTE in normal human skin were examined by immunofluorescence. A) Red-TRIC represents SCTE and green-FITC represents cathe- licidin. B) control IgG. Nuclei were stained with blue-4Ј,6Ј- diam idino-2-phenylidole in both. Original magnification, ϫ400. smaller fragment proceeding faster than their gener- ation.

Serine protease activity controls antimicrobial function in skin Figure 5. SCTE and SCCE are major serine proteases in human keratinocytes. A) Expression of SCTE and SCCE We next tested cathelicidin proteolysis in an in vivo mRNA in HaCat cells treated with siRNA to either SCTE or SCCE for 72 h were analyzed by quantitative RT-PCR. X-axis model. Lympho-epithelial Kazal-type related inhibi- labels indicate siRNA preparation used or transfection con- tor (LEKTI) is a serine protease inhibitor encoded by trol (control). The mean and se of three independent SPINK5 (serine protease inhibitor Kazal-type 5) gene experiments are plotted. Data demonstrate selectivity of (30). LEKTI is expressed in the epidermis, and siRNA treatment for each enzyme. B) HaCat cells were treated mutations of SPINK5 gene are found in the human with SCTE or SCCE siRNA for 72 h. Culture media was condition, Netherton syndrome, leading to a disrup- collected and protease activities in media were measured by incubating with fluorescence-conjugated casein substrate at tion in skin barrier function (31). The activities of 37°C for 24 h. The mean and of three independent experi- SCTE and SCCE are increased in SPINK5-deficient ments were plotted. Data show significant (*PϽ0.05, mice, and these mice mimic the epidermal dysfunc- **PϽ0.01) contribution of both enzymes to total protease tions in Netherton syndrome (32). We extracted skin activity.

2074 Vol. 20 October 2006 The FASEB Journal YAMASAKI ET AL. natural antibiotics and also modify leukocyte recruit- ment (10). In the present study we show that cathelici- din, in either the proform hCAP18 or the peptide form LL-37 released upon neutrophil recruitment, is suscep- tible to proteolytic processing by serine proteases be- longing to the tissue kallikrein family. This processing generates novel peptides with antimicrobial activity and suggests that cathelicidins in skin are more diverse than previously reported. Their function ultimately depends on the activity of proteases at the epithelial surface. Inhibitors of serine proteases such as LEKTI (25) and anti-leukoprotease/SLPI (34) regulate this process (Fig. 9). Although not directly evaluated here, these findings also suggest that other serine protease inhibi- tors such as SKALP/elafin, a potent proteinase 3 inhib- itor expressed in human epidermis (35), may affect hCAP18 proteolysis through the regulation of protein- ase 3 activity. Evidence to support the role of serine proteases to modify the proinflammatory activity of cathelicidin comes from observations of their distribution in the epidermis and their biochemical activity. SCTE and cathelicidin are colocalized in the granular layer, but cathelicidin is dominant in the cornified layer of nor- mal human skin. Since cathelicidin and kallikreins are both stored in lamellar granules and secreted from keratinocytes (36, 37), their localization in skin suggests Figure 6. SCTE and SCCE cleave hCAP18 to shorter peptides. that after secretion, hCAP18 can be efficiently cleaved A) Recombinant hCAP18 was incubated with recombinant by kallikreins and subsequently released at the surface SCTE (1 ␮M) or SCCE (1 ␮M) at 37°C for 2 h. Cleavage of to form an antimicrobial barrier. If processed to forms hCAP18 was monitored by Western blot with Ab against that are not inherently chemotactic or capable of cathelin domain (upper panel) or Ab against LL-37 peptide ϩ stimulating host cells to release chemotactic factors domain (lower panel). Lane 1, hCAP18 SCTE buffer; 2, such as IL-8, this mechanism explains why the consti- hCAP18 ϩSCTE; 3, hCAP18 ϩSCCE buffer; 4, hCAP18 ϩSCCE; 5, hCAP18 alone. B) Recombinant hCAP18 was tutive presence of cathelicidins on the skin is not incubated with recombinant SCTE at 37°C for 2 h. Digested inflammatory under normal conditions or in transgenic peptides were separated on C18 reverse phase chromatogra- models (38) despite the potent capacity of LL-37 or phy. Molecular mass of each peak was determined by MALDI- mCRAMP to induce cytokine release. Kallikrein in the TOF-MS and indicated on chromatograph. normal human epidermis has the potential to both activate and degrade cathelicidin to inactive peptides. shown) and eliminated antimicrobial activity de- Analysis of the enzymatic processing of cathelicidin tected in the in SPINK5-deficient mice (Fig. 8A). suggests that two steps are required: activation from the SELDI-TOF-MS analysis confirmed that mCRAMP in precursor hCAP18 and subsequent processing to mod- SPINK5-deficient mouse skin was processed to ify activity. We found that two cleavage patterns were shorter peptides (data not shown). The mass of the generated in the skin from cathelicidin precursor pro- major peak in SPINK5-deficient mouse was 3878 Da teins: cleavage C-terminal to arginine (R), and cleavage and matched with the mCRAMP1 (GLL-34) peptide C-terminal to phenylalanine (F). SCTE was effective in (33). In WT littermates, major peaks of ϳ17 and generating LL-37 from the precursor hCAP18 and can 20 kDa matched the size of mCRAMP proprotein subsequently produce KS-30, KS-22, and LL-29 from without and with signal peptide, respectively. These LL-37. RK-31 and KR-20 peptides are cleaved by SCCE data suggested that processing of cathelicidin in from LL-37. The ability to generate these antimicrobial SPINK5-deficient mice skin augmented antimicrobial peptides quickly and in high amounts relative to other activity. peptides suggests that the cleavage sites producing these peptides are preferred by SCTE. SCTE has tryp- sin-like activity, and the preference of SCTE for argi- DISCUSSION nine over lysine has been noted in model substrates (39). Thus, SCTE prefers to cleave C-terminal to argi- Cathelicidin antimicrobial peptides such as human nine residues in LL-37, although LL-37 has several LL-37 and mouse mCRAMP are essential molecules in arginine and lysine residues in its sequence and may innate immune defense. Prior work has suggested that best be considered a generator of antimicrobial activity they play dual roles in protecting the host: they act as rather than a degrader of LL-37. Conversely, data

PROTEOLYTIC ACTIVATION OF CATHELICIDINS 2075 Figure 7. SCTE and SCCE cleave synthetic LL-37 peptide to shorter peptides. A, C) Synthetic LL-37 was incubated with 10 nM of SCTE (A) or SCCE (C ) at 37°C for the periods indicated. Digested peptides were separated on C18 reverse phase chromatography. Antimicrobial activity of each fraction was examined by radial diffusion assay, and peptides that have antimicrobial activities were indicated by an asterisk. B, D) Molecular mass size of each peak indicated by alphabet in chromatography was determined by MALDI-TOF-MS and listed with its peptide sequence (B: peptides generated by SCTE, D: peptides generated by SCCE). Asterisks indicate the peptide with antibacterial activity. obtained with SCCE suggested this enzyme might be cleaving LL-37 to generate smaller peptides, and considered a degrader of LL-37 rather than a generator smaller peptides may be easier to be accessed and of antimicrobial peptides. SCCE has been shown to degraded by SCCE. Thus, SCCE may serve as an inac- prefer tyrosine over phenylalanine and to be less able to tivator, an important role when the chemotactic activity cleave C-terminal to phenylalanine in model substrates of LL-37 is no longer beneficial to the defense process. (34). Therefore, SCCE is less effective than SCTE in It is debatable whether only SCTE and SCCE digest

2076 Vol. 20 October 2006 The FASEB Journal YAMASAKI ET AL. cleavage patterns and trypsin-like cleavage patterns were observed with LL-37 as substrate. However, unlike SCTE, we did not detect SCCE in protease-active frac- tions with commercially available anti-SCCE antibodies (data not shown). This may reflect a relative lack in the sensitivity of this Ab, as our other data based on RNAi and uses of recombinant enzymes suggest that SCTE and SCCE can both cleave cathelicidin. Alternatively, assays of total proteolytic activity from the skin surface based on casein substrate may not detect either SCCE or SCTE, and may actually detect another chymotryp- sin. Furthermore, in the current study SELDI-TOF-MS revealed that diverse cathelicidin peptides exist in skin, but these were not identical to the peptides isolated earlier by standard HPLC approaches from human sweat (24). Because the current samples were extracted from whole skin, these may have been generated by proteases from various cells in skin such as keratino- cytes, endothelial cells, fibroblast, dendritic cells, and some inflammatory cells, and not only surface proteases such as SCTE and SCCE. Alternatively, the purification methods may have influenced these results. However, taken together with results derived from tissues and recombinant enzymes, the current observations strongly support a major role for both SCTE and SCCE in process- ing cathelicidin in skin. The actual identity (size and sequence) of cathelici- din peptides at various locations has only recently come into question. Subsequent to the initial cloning of human cathelicidin from a human bone marrow li- brary, a 39 aa peptide designated FALL-39 was pre- Figure 8. Altered processing of cathelicidin in SPINK5-defi- dicted (41). Subsequent purification and direct se- cient mice. A) Serine protease activity in the skin of SPINK5- quencing from human neutrophils identified the actual deficient mice and WT littermates using casein-based pro- peptide as a 37aa peptide, LL-37, and proteinase 3, an tease assay with the presence of protease inhibitors (EDTA elastase-like serine protease stored in neutrophil gran- and pepstatin). The mean and se of three individuals are ules, was suggested to be the enzyme responsible for plotted. B) The amount of mCRAMP in the skin extracts from the processing of precursor protein hCAP18 to gener- 8 mm punch biopsy was determined by immuno-dot blot with synthetic CRAMP peptide as a reference. The mean and se of three individuals are plotted. C) Antimicrobial activity against S. aureus mprF were examined from skin extracts by radial diffusion assay. Skin extracts (2 ␮l) from three SPINK5- deficiency mice (KO) and three WT littermates (wild-type) are shown. Upper two rows show the inhibitory area of total extract (before absorption) and lower two rows show extracts treated with anti-CRAMP Ab (after absorption). Synthetic cathelicidin peptide (LL-37, 32 ␮M, 1 ␮l) and buffer were spotted as control. hCAP18 and generate cathelicidin antimicrobial pep- tides at the complex human skin surface. Human skin epidermis and appendages express several kallikrein proteases, and these proteases may act together (40). Treatment of human keratinocytes with siRNA for SCTE and SCCE showed a decrease of serine protease activity, suggesting that SCTE and SCCE are major serine proteases in culture. Purification of crude skin Figure 9. Schematic model of cathelicidin processing by skin extracts was detected SCTE in fractions that cleaved surface proteases. Multiple enzymatic activation events are required for control of cathelicidin activity. Initial processing LL-37. The chymotryptic serine protease SCCE is also a of inactive hCAP18 precursor protein is followed by further candidate because protease activity in the skin surface processing to peptides with alternative antimicrobial and was suppressed the most by the chymotrypsin-specific immunostimulatory activities. LEKTI regulates activation and inhibitor chymostatin, and both chymotrypsin-like final degradation.

PROTEOLYTIC ACTIVATION OF CATHELICIDINS 2077 ate LL-37 (21). More recently, urogenital epithelium develop frequent and sometimes severe skin infections was found to process hCAP18 to ALL-38 by the prostate- (47). derived protease gastricsin (22). In contrast to these Several antimicobial molecules in addition to cathe- longer peptides, several alternate cathelicidin antimi- licidin are produced in skin and may be subject to crobial peptides were detected at the skin surface (23), similar enzymatic regulation. These include defensins an interface that has been shown to rely on the and SKALP/elafin (48). Human ␤-defensin 2 (HBD-2) expression of cathelicidin for defense against microbial and SKALP/elafin have been reported to be strongly invasion (4). These observations suggested that previ- expressed in the epidermis of Netherton syndrome ous conclusions claiming LL-37 was the sole human (49). Like cathelicidins, HBD-2 and SKALP/elafin are cathelicidin were an oversimplification. inducible by bacterial infection and inflammatory reac- The significance of variable processing of cathelici- tions, but low in normal skin (48, 50). Reports of high din to peptides other than LL-37 lies in the observa- HBD-2 and SKALP/elafin in Netherton syndrome may tions that LL-37 induces chemokine release and can reflect the consequence of repeated skin infection and function in host cell stimulation through direct recep- inflammation due to barrier disruption (51). In the tor-ligand interactions such as the stimulation of formyl current mouse model, the use of neonatal mice mini- peptide receptor-like 1 (42) or through transactivation mized this effect and permitted evaluation of antimi- of the epidermal growth factor (EGF) receptor (43). A crobial function as regulated by enzymatic processing comparison of the ability of LL-37 and shorter peptides distinct from the quantity of the gene expressed. to induce CXCL8 secretion has shown that shorter Taken together, these data show that the balance of peptides are less able to induce inflammatory reactions serine protease activity in the skin leads directly to the but are more potent antimicrobials (19). LL-37 acts as control of innate antimicrobial activity. All components a chemoattractant of neutrophils, monocytes, T cells, of this system, their triggers, and individual modifying and mast cells (42, 44, 45). Human cathelicidin peptide agents remain to be elucidated. Our findings show that LL-37 and mouse cathelicidin CRAMP also show angio- kallikreins are at least one important part of this system, genic properties (46). However, smaller cathelicidin and demonstrate that several cathelicidin antimicrobial peptides such as KR-20, RK-31, and KS-30 have greater peptides are generated at the barrier between the host antimicrobial activity and are less able to induce and the external environment. The balance of proteo- CXCL8 (19, 23). Additional cathelicidin peptides were lytic activity will modulate cathelicidin function to found at the skin surface in the present work (LL-23, direct diverse antimicrobial and stimulatory activities; LL-29, and KS-27), confirming the antimicrobial activ- this is a previously unrecognized mechanism for regu- ity of such shorter cathelicidins. lation of immune defense. Furthermore, these findings Based on these observations, it is reasonable to show that control of microbial growth and an inflam- hypothesize that after infection or wounding, cathelici- matory response may rest in the balance of epithelial din expression in skin will shift from the short form proteolytic activity. cathelicidins generated and inactivated by the kal- likreins toward a predominance of the LL-37 form This work was supported by National Institutes of Health grants N01-AI-40029AI48176, R01-AI052453, R01-AR45676, released from neutrophils. This would act to amplify HL57345, and a VA Merit Award to R.L.G., the Association for the recruitment of neutrophils through its action as a Preventive Medicine of Japan to K.Y., and the German chemoattractant and host cell stimulant. Upon resolu- Academy of Natural Scientists Leopoldina (BMBF-LPD9901– tion of the microbial challenge or injury, epidermal 119) to J.S. protease activity will process LL-37 to forms lacking proinflammatory activity and thus re-establish an effec- tive microbial shield without further increasing tissue damage as a result of inflammation. REFERENCES The importance of maintaining normal activity of serine proteases for control of antimicrobial activity was 1. Zanetti, M. (2004) Cathelicidins, multifunctional peptides of shown directly in the LEKTI-deficient mice. A lack of the innate immunity. J. Leukoc. Biol. 75, 39–48 2. Van Dijk, A., Veldhuizen, E. J., van Asten, A. J., and Haagsman, this serine protease inhibitor increased the balance of H. P. (2005) CMAP27, a novel chicken cathelicidin-like antimi- serine protease activity, increased antimicrobial activity, crobial protein. Vet. Immunol. Immunopathol. 106, 321–327 and increased the proportion of mature cathelicidin in 3. Chang, C. I., Pleguezuelos, O., Zhang, Y. A., Zou, J., and the skin. The increase of cathelicidin was not due to an Secombes, C. J. (2005) Identification of a novel cathelicidin gene in the rainbow trout, Oncorhynchus mykiss. Infect Immun. increase in leukocyte recruitment or keratinocyte syn- 73, 5053–5064 thesis since these newborn mice were euthanized 4. Nizet, V., Ohtake, T., Lauth, X., Trowbridge, J., Rudisill, J., within8hofbirth, and there was neither infection nor Dorschner, R. A., Pestonjamasp, V., Piraino, J., Huttner, K., and Gallo, R. L. (2001) Innate antimicrobial peptide protects the inflammatory cell infiltration at that stage. However, skin from invasive bacterial infection. Nature 414, 454–457 the increase in the antimicrobial properties of the skin 5. Rosenberger, C. M., Gallo, R. L., and Finlay, B. B. (2004) of SPINK5-deficient mice is not sufficient to compen- Interplay between antibacterial effectors: a macrophage antimi- sate for the increased susceptibility to infection due to crobial peptide impairs intracellular Salmonella replication. Proc. Natl. Acad. Sci. U. S. A. 101, 2422–2427 the severe disruption in barrier properties of the epi- 6. Iimura, M., Gallo, R. L., Hase, K., Miyamoto, Y., Eckmann, L., dermis. Similarly, patients with Netherton syndrome and Kagnoff, M. F. (2005) Cathelicidin mediates innate intesti-

2078 Vol. 20 October 2006 The FASEB Journal YAMASAKI ET AL. nal defense against colonization with epithelial adherent bacte- 24. Murakami, M., Ohtake, T., Dorschner, R. A., Schittek, B., Garbe, rial pathogens. J. Immunol. 174, 4901–4907 C., and Gallo, R. L. (2002) Cathelicidin anti-microbial peptide 7. Howell, M. D., Jones, J. F., Kisich, K. O., Streib, J. E., Gallo, R. L., expression in sweat, an innate defense system for the skin. and Leung, D. Y. (2004) Selective killing of vaccinia virus by J. Invest. Dermatol. 119, 1090–1095 LL-37: implications for eczema vaccinatum. J. Immunol. 172, 25. Schechter, N. M., Choi, E. J., Wang, Z. M., Hanakawa, Y., 1763–1767 Stanley, J. R., Kang, Y., Clayman, G. L., and Jayakumar, A. (2005) 8. Ong, P. Y., Ohtake, T., Brandt, C., Strickland, I., Boguniewicz, Inhibition of human kallikreins 5 and 7 by the serine protease M., Ganz, T., Gallo, R. L., and Leung, D. Y. (2002) Endogenous inhibitor lympho-epithelial Kazal-type inhibitor (LEKTI). J. Biol. antimicrobial peptides and skin infections in atopic dermatitis. Chem. 386, 1173–1184 N. Engl. J. Med. 347, 1151–1160 26. Zaiou, M., Nizet, V., and Gallo, R. L. (2003) Antimicrobial and 9. Putsep, K., Carlsson, G., Boman, H. G., and Andersson, M. protease inhibitory functions of the human cathelicidin (2002) Deficiency of antibacterial peptides in patients with (hCAP18/LL-37) prosequence. J. Invest. Dermatol. 120, 810–816 morbus Kostmann: an observation study. Lancet 360, 1144–1149 27. Hansson, L., Stromqvist, M., Backman, A., Wallbrandt, P., 10. Zanetti, M. (2005) The role of cathelicidins in the innate host Carlstein, A., and Egelrud, T. (1994) Cloning, expression, and defenses of mammals. Curr. Issues Mol. Biol. 7, 179–196 characterization of stratum corneum chymotryptic enzyme. A 11. Oppenheim, J. J., and Yang, D. (2005) Alarmins: chemotactic skin-specific human serine proteinase. J. Biol. Chem. 269, 19420– activators of immune responses. Curr Opin. Immunol. 17, 359– 19426 365 28. Ekholm, I. E., Brattsand, M., and Egelrud, T. (2000) Stratum 12. Wu, H., Zhang, G., Minton, J. E., Ross, C. R., and Blecha, F. corneum tryptic enzyme in normal epidermis: a missing link in (2000) Regulation of cathelicidin gene expression: induction by the desquamation process? J. Invest. Dermatol. 114, 56–63 lipopolysaccharide, interleukin-6, retinoic acid, and Salmonella 29. Sanchez, J. F., Hoh, F., Strub, M. P., Aumelas, A., and Dumas, C. enterica serovar typhimurium infection. Infect. Immun. 68, 5552– (2002) Structure of the cathelicidin motif of protegrin-3 pre- 5558 cursor: structural insights into the activation mechanism of an 13. Frohm, M., Agerberth, B., Ahangari, G., Stahle-Backdahl, M., antimicrobial protein. Structure 10, 1363–1370 Liden, S., Wigzell, H., and Gudmundsson, G. H. (1997) The 30. Magert, H. J., Standker, L., Kreutzmann, P., Zucht, H. D., expression of the gene coding for the antibacterial peptide Reinecke, M., Sommerhoff, C. P., Fritz, H., and Forssmann, LL-37 is induced in human keratinocytes during inflammatory W. G. (1999) LEKTI, a novel 15-domain type of human serine disorders. J. Biol. Chem. 272, 15258–15263 proteinase inhibitor. J. Biol. Chem. 274, 21499–21502 14. Dorschner, R. A., Pestonjamasp, V. K., Tamakuwala, S., Ohtake, 31. Chavanas, S., Bodemer, C., Rochat, A., Hamel-Teillac, D., Ali, T., Rudisill, J., Nizet, V., Agerberth, B., Gudmundsson, G. H., M., Irvine, A. D., Bonafe, J. L., Wilkinson, J., Taieb, A., Barran- and Gallo, R. L. (2001) Cutaneous injury induces the release of don, Y., et al. (2000) Mutations in SPINK5, encoding a serine cathelicidin anti-microbial peptides active against group A protease inhibitor, cause Netherton syndrome. Nat. Genet. 25, Streptococcus. J. Invest. Dermatol. 117, 91–97 141–142 15. Hase, K., Eckmann, L., Leopard, J. D., Varki, N., and Kagnoff, 32. Descargues, P., Deraison, C., Bonnart, C., Kreft, M., Kishibe, M., M. F. (2002) Cell differentiation is a key determinant of Ishida-Yamamoto, A., Elias, P., Barrandon, Y., Zambruno, G., cathelicidin LL-37/human cationic antimicrobial protein 18 Sonnenberg, A., and Hovnanian, A. (2005) Spink5-deficient expression by human colon epithelium. Infect. Immun. 70, mice mimic Netherton syndrome through degradation of des- 953–963 moglein 1 by epidermal protease hyperactivity. Nat. Genet. 37, 16. Sayama, K., Komatsuzawa, H., Yamasaki, K., Shirakata, Y., 56–65 Hanakawa, Y., Ouhara, K., Tokumaru, S., Dai, X., Tohyama, M., 33. Gallo, R. L., Kim, K. J., Bernfield, M., Kozak, C. A., Zanetti, M., Ten Dijke, P., et al. (2005) New mechanisms of skin innate Merluzzi, L., and Gennaro, R. (1997) Identification of CRAMP, immunity: ASK1-mediated keratinocyte differentiation regulates a cathelin-related antimicrobial peptide expressed in the em- the expression of beta-defensins, LL37, and TLR2. Eur. J. Immu- bryonic and adult mouse. J. Biol. Chem. 272, 13088–13093 nol. 35, 1886–1895 34. Franzke, C. W., Baici, A., Bartels, J., Christophers, E., and 17. Wang, T. T., Nestel, F. P., Bourdeau, V., Nagai, Y., Wang, Q., Wiedow, O. (1996) Antileukoprotease inhibits stratum corneum Liao, J., Tavera-Mendoza, L., Lin, R., Hanrahan, J. W., Mader, S., chymotryptic enzyme. Evidence for a regulative function in and White, J. H. (2004) Cutting edge: 1,25-dihydroxyvitamin D3 desquamation. J. Biol. Chem. 271, 21886–21890 is a direct inducer of antimicrobial peptide gene expression. 35. Wiedow, O., Luademann, J., and Utecht, B. (1991) Elafin is a J. Immunol. 173, 2909–2912 potent inhibitor of proteinase 3. Biochem. Biophys. Res. Commun. 18. Peyssonnaux, C., Datta, V., Cramer, T., Doedens, A., Theodor- 174, 6–10 akis, E. A., Gallo, R. L., Hurtado-Ziola, N., Nizet, V., and 36. Braff, M. H., Di Nardo, A., and Gallo, R. L. (2005) Keratinocytes Johnson, R. S. (2005) HIF-1alpha expression regulates the store the antimicrobial peptide cathelicidin in lamellar bodies. bactericidal capacity of phagocytes. J. Clin. Invest. 115, 1806– J. Invest. Dermatol. 124, 394–400 1815 37. Ishida-Yamamoto, A., Deraison, C., Bonnart, C., Bitoun, E., 19. Braff, M. H., Hawkins, M. A., Di Nardo, A., Lopez-Garcia, B., Robinson, R., O’Brien, T. J., Wakamatsu, K., Ohtsubo, S., Howell, M. D., Wong, C., Lin, K., Streib, J. E., Dorschner, R., Takahashi, H., Hashimoto, Y., et al. (2005) LEKTI is localized in Leung, D. Y., and Gallo, R. L. (2005) Structure-function rela- lamellar granules, separated from KLK5 and KLK7, and is tionships among human cathelicidin peptides: dissociation of secreted in the extracellular s of the superficial stratum granu- antimicrobial properties from host immunostimulatory activi- losum. J. Invest. Dermatol. 124, 360–366 ties. J. Immunol. 174, 4271–4278 38. Lee, P. H., Ohtake, T., Zaiou, M., Murakami, M., Rudisill, J. A., 20. Zaiou, M., and Gallo, R. L. (2002) Cathelicidins, essential Lin, K. H., and Gallo, R. L. (2005) Expression of an additional gene-encoded mammalian antibiotics. J. Mol. Med. 80, 549–561 cathelicidin antimicrobial peptide protects against bacterial skin 21. Sorensen, O. E., Follin, P., Johnsen, A. H., Calafat, J., Tjabringa, infection. Proc. Natl. Acad. Sci. U. S. A. 102, 3750–3755 G. S., Hiemstra, P. S., and Borregaard, N. (2001) Human 39. Michael, I. P., Sotiropoulou, G., Pampalakis, G., Magklara, A., cathelicidin, hCAP-18, is processed to the antimicrobial peptide Ghosh, M., Wasney, G., and Diamandis, E. P. (2005) Biochem- LL-37 by extracellular cleavage with proteinase 3. Blood 97, ical and enzymatic characterization of human kallikrein 5 3951–3959 (hK5), a novel serine protease potentially involved in cancer 22. Sorensen, O. E., Gram, L., Johnsen, A. H., Andersson, E., progression. J. Biol. Chem. 280, 14628–14635 Bangsboll, S., Tjabringa, G. S., Hiemstra, P. S., Malm, J., 40. Komatsu, N., Takata, M., Otsuki, N., Toyama, T., Ohka, R., Egesten, A., and Borregaard, N. (2003) Processing of seminal Takehara, K., and Saijoh, K. (2003) Expression and localization plasma hCAP-18 to ALL-38 by gastricsin: a novel mechanism of of tissue kallikrein mRNAs in human epidermis and append- generating antimicrobial peptides in vagina. J. Biol. Chem. 278, ages. J. Invest. Dermatol. 121, 542–549 28540–28546 41. Gudmundsson, G. H., Agerberth, B., Odeberg, J., Bergman, 23. Murakami, M., Lopez-Garcia, B., Braff, M., Dorschner, R. A., T., Olsson, B., and Salcedo, R. (1996) The human gene and Gallo, R. L. (2004) Postsecretory processing generates FALL39 and processing of the cathelin precursor to the multiple cathelicidins for enhanced topical antimicrobial de- antibacterial peptide LL-37 in granulocytes. Eur. J. Biochem. fense. J. Immunol. 172, 3070–3077 238, 325–332

PROTEOLYTIC ACTIVATION OF CATHELICIDINS 2079 42. De, Y., Chen, Q., Schmidt, A. P., Anderson, G. M., Wang, J. M., A., de Prost, Y., et al. (2002) Netherton syndrome: disease Wooters, J., Oppenheim, J. J., and Chertov, O. (2000) LL-37, the expression and spectrum of SPINK5 mutations in 21 families. neutrophil granule- and epithelial cell-derived cathelicidin, J. Invest. Dermatol. 118, 352–361 utilizes formyl peptide receptor-like 1 (FPRL1) as a receptor to 48. Braff, M. H., Bardan, A., Nizet, V., and Gallo, R. L. (2005) chemoattract human peripheral blood neutrophils, monocytes, Cutaneous defense mechanisms by antimicrobial peptides. J. In- and T cells. J. Exp. Med. 192, 1069–1074 vest. Dermatol. 125, 9–13 43. Tjabringa, G. S., Aarbiou, J., Ninaber, D. K., Drijfhout, J. W., 49. Raghunath, M., Tontsidou, L., Oji, V., Aufenvenne, K., Schur- Sorensen, O. E., Borregaard, N., Rabe, K. F., and Hiemstra, P. S. meyer-Horst, F., Jayakumar, A., Stander, H., Smolle, J., Clayman, (2003) The antimicrobial peptide LL-37 activates innate immu- G. L., and Traupe, H. (2004) SPINK5 and Netherton syndrome: nity at the airway epithelial surface by transactivation of the novel mutations, demonstration of missing LEKTI, and differ- epidermal growth factor receptor. J. Immunol. 171, 6690–6696 ential expression of transglutaminases. J. Invest. Dermatol. 123, 44. Di Nardo, A., Vitiello, A., and Gallo, R. L. (2003) Cutting edge: 474–483 mast cell antimicrobial activity is mediated by expression of 50. Alkemade, J. A., Molhuizen, H. O., Ponec, M., Kempenaar, J. A., cathelicidin antimicrobial peptide. J. Immunol. 170, 2274–2278 Zeeuwen, P. L., de Jongh, G. J., van Vlijmen-Willems, I. M., van 45. Niyonsaba, F., Iwabuchi, K., Someya, A., Hirata, M., Matsuda, H., Erp, P. E., van de Kerkhof, P. C., and Schalkwijk, J. (1994) Ogawa, H., and Nagaoka, I. (2002) A cathelicidin family of SKALP/elafin is an inducible proteinase inhibitor in human human antibacterial peptide LL-37 induces mast cell chemo- epidermal keratinocytes. J. Cell Sci. 107, 2335–2342 taxis. Immunology 106, 20–26 51. Chao, S. C., Richard, G., and Lee, J. Y. (2005) Netherton 46. Koczulla, R., von Degenfeld, G., Kupatt, C., Krotz, F., Zahler, S., syndrome: report of two Taiwanese siblings with staphylococcal Gloe, T., Issbrucker, K., Unterberger, P., Zaiou, M., Lebherz, C., scalded skin syndrome and mutation of SPINK5. Br. J. Dermatol. et al. (2003) An angiogenic role for the human peptide antibi- 152, 159–165 otic LL-37/hCAP-18. J. Clin. Invest. 111, 1665–1672 47. Bitoun, E., Chavanas, S., Irvine, A. D., Lonie, L., Bodemer, C., Received for publication March 7, 2006. Paradisi, M., Hamel-Teillac, D., Ansai, S., Mitsuhashi, Y., Taieb, Accepted for publication May 15, 2006.

2080 Vol. 20 October 2006 The FASEB Journal YAMASAKI ET AL.

Annexe 4

Yamasaki K, Di Nardo A, Bardan A, Murakami M, Ohtake T, Coda A, Dorschner RA, Bonnart C, Descargues P, Hovnanian A, Morhenn VB, Gallo RL. Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea. Nat Med. 2007 ;13(8):975-80.

177 178 LETTERS

Increased serine protease activity and cathelicidin promotes skin inflammation in rosacea

Kenshi Yamasaki1, Anna Di Nardo1, Antonella Bardan1, Masamoto Murakami2, Takaaki Ohtake3, Alvin Coda1, Robert A Dorschner1, Chrystelle Bonnart4,5, Pascal Descargues4,5, Alain Hovnanian4–6, Vera B Morhenn1 & Richard L Gallo1 .com/naturemedicine

Acne rosacea is an inflammatory skin disease that affects 3% chemotaxis14, angiogenesis15 and the expression of extracellular matrix of the US population over 30 years of age and is characterized by components16. Because many of these effects are similar to the clinical erythema, papulopustules and telangiectasia1–3. The etiology of changes seen in rosacea, we considered that abnormal expression of this disorder is unknown, although symptoms are exacerbated by cathelicidin peptides may be a factor in its pathogenesis. http://www.nature factors that trigger innate immune responses, such as the release To test whether the expression of cathelicidin is altered in rosacea, of cathelicidin antimicrobial peptides4.Hereweshowthat skin biopsies were obtained from the naso-malar fold and compared individuals with rosacea express abnormally high levels with skin from a similar location in normal individuals. All specimens of cathelicidin in their facial skin and that the proteolytically from individuals with rosacea showed abundant cathelicidin by processed forms of cathelicidin peptides found in rosacea immunostaining, whereas normal facial skin showed minimal expres- are different from those present in normal individuals. These sion (Fig. 1a). Cathelicidin was located diffusely throughout the cathelicidin peptides are a result of a post-translational epidermis, but was not seen in healthy volunteers. To quantify this processing abnormality associated with an increase in stratum difference, epidermal cathelicidin was measured in tape-stripped corneum tryptic enzyme (SCTE) in the epidermis. In mice, samples of facial skin. Significantly higher cathelicidin expression injection of the cathelicidin peptides found in rosacea, addition was found in rosacea than in normal skin (Fig. 1b, P =0.015). of SCTE, and increasing protease activity by targeted deletion of Cathelicidin mRNA was also evident in rosacea skin by in situ the serine protease inhibitor gene Spink5 each increases hybridization (Fig. 1c), in contrast to normal epidermis where

Nature Publishing Gr oup 200 7 Nature Publishing inflammation in mouse skin. The role of cathelicidin in enabling cathelicidin mRNA is hardly detectable (ref. 17 and data not

© SCTE-mediated inflammation is verified in mice with a targeted shown). Thus, we concluded that the skin of individuals with rosacea, deletion of Camp, the gene encoding cathelicidin. These findings similar to that of individuals with other inflammatory diseases18, confirm the role of cathelicidin in skin inflammatory responses expressed more cathelicidin than normal facial skin. and suggest an explanation for the pathogenesis of rosacea by Proteolytic processing of the cathelicidin precursor protein into demonstrating that an exacerbated innate immune response can active peptide is an essential step for function and controls the ability reproduce elements of this disease. of cathelicidin to act as an antimicrobial or pro-inflammatory molecule19,20. Human cathelicidin is secreted as proprotein, named Cathelicidins have been identified in mammals5,birds6 and fish7,and 18-kDa cationic antimicrobial protein (CAP18). CAP18 is biologically are known for their functions to protect the host against infection by inactive19. Proteolytic cleavage near the C terminus results in release Gram-positive8 and Gram-negative bacteria9,10, and some viruses11. of the active antimicrobial peptide. Because the function of the Several animal models8, and human clinical conditions12,haveshown cathelicidin peptide is dictated by the extent of post-translational that the presence of cathelicidin correlates with the ability of the host processing of CAP18, we analyzed the mass of cathelicidin peptides to mount an effective defense against infection. In addition, anti- from rosacea and normal skin using surface-enhanced laser microbial peptides such as cathelicidins and defensins may have a dual desorption-ionization time-of-flight mass spectrometry (SELDI- role in immunity because they can act both to kill microbes and TOF-MS) to examine whether the increased expression of cathelicidin potentially to trigger various host tissue responses. This function has in rosacea signifies a change in CAP18 processing. The mass distribu- led to use of the term ‘alarmins’13 in recognition of their capacity to tions of cathelicidin peptides were very similar among independent signal an inflammatory reaction. Among observations of cathelicidin individuals with rosacea (Fig. 2). Samples obtained from normal facial function are findings that these peptides can promote leukocyte skin were also similar to each other, but were markedly different from,

1Division of Dermatology, University of California, San Diego, and VA San Diego Health Care System, 3350 La Jolla Village Drive, San Diego, California 92161, USA. 2Department of Dermatology, Asahikawa Medical College, Asahikawa 078-8510, Japan. 3Department of Medicine, Asahikawa Medical College, 2-1-1-1 Midorigacka Hidashi, Asahikawa 078-8510, Japan. 4INSERM, U563, Toulouse F-31000, France. 5Universite´ Paul-Sabatier, Toulouse F-31000, France. 6CHU Toulouse, Department of Genetics, Place du Dr. Baylac, Toulouse F-31000, France. Correspondence should be addressed to R.L.G. ([email protected]).

Received 27 March; accepted 13 June; published online 5 August 2007; doi:10.1038/nm1616

NATURE MEDICINE VOLUME 13 [ NUMBER 8 [ AUGUST 2007 975 LETTERS

a Rosacea Normal Figure 1 Cathelicidin is abundant in rosacea. (a) Cathelicidin expression in lesional skin of individuals with rosacea was examined by immunohistochemistry with antibody to LL-37. Top, anti–LL-37; bottom, pre-immune IgG. Scale bars, 500 mm. (b) Amount of cathelicidin in skin was measured by quantitative immuno-dot blot analysis of tape-stripped samples. The amount of cathelicidin in skin samples was determined by comparison to synthetic LL-37 as a reference and by normalization to total protein concentration. The mean of each group is indicated by a broken line (n ¼ 3). (c) Localization of cathelicidin mRNA in lesional skin of rosacea individuals was visualized by in situ hybridization with a probe to LL-37. Brown color indicates positive signal; blue color indicates methylene blue staining of nuclei. Left, antisense probe; right, sense probe. Scale bars, 500 mm. Preimmune IgG Cathelicidin

bcAntisense Sense release (Fig. 4a). To test the function of these peptides in vivo,mice 16 were given subcutaneous injections of LL-37 and FA-29. The concen- 14 P = 0.015 tration of cathelicidin injected (320 mM) was selected to reflect local

.com/naturemedicine 12 physiological concentrations seen in rosacea (maximum 1,500 mM). 10 Injection of both LL-37 and FA-29 induced erythema and vascular 8 dilatation in skin after 48 h, and was characterized histologically by a 6 neutrophilic infiltrate, thrombosis and hemorrhage (Fig. 4b and 4 Supplementary Fig. 4 online). Conversely, injection of peptide KR-20 from normal skin did not induce inflammation. The inflam-

Cathelicidin (fmol/ µ g protein) 2 http://www.nature 0 matory reaction to LL-37 was dose dependent and seen at concentra- Rosacea Normal tions as low as 3.2 mM(Supplementary Fig. 4); it was also observed equally in BALB/c and C57BL/6 mouse strains (data not shown). and contained fewer cathelicidin fragments than, those from rosacea. Totest the hypothesis that the innate expression of cathelicidin in skin The 37-amino-acid peptide LL-37 was one of the main forms can promote inflammation, we tested mice with targeted deletion of the identified in rosacea, but it was much less abundant in normal skin. cathelicidin antimicrobial peptide gene Camp8. Individuals with rosacea In addition, rosacea skin contained peptides of unique mass that were show facial inflammation in response to external stimuli; therefore, the absent in normal skin (Fig. 2, arrowheads; deduced sequences are response of Camp/ mice to irritant stimuli was examined by using an given in Supplementary Fig. 1 and Supplementary Methods online). established mouse skin model of irritation. These experiments supported These data demonstrate that both the abundance and the processing of cathelicidin peptides are altered in rosacea. Rosacea Stratum corneum tryptic enzyme (SCTE; also known as kallikrein 5, 6 KLK5 or hK5), a serine protease of the kallikrein family, is a key 4 Nature Publishing Gr oup 200 7 Nature Publishing protease that cleaves CAP18 to active peptides in human epidermis21. 2 © 0 On the basis of the abnormal cathelicidin peptide abundance and 6 distribution pattern observed in rosacea, we next examined whether 4 the expression of SCTE was altered in rosacea as compared with 2 normal skin. SCTE was highly expressed in rosacea and colocalized 0 with cathelicidin in the granular and cornified layers of the epidermis 6 4 (Fig. 3a and Supplementary Fig. 2 online). Some rosacea specimens 2 also expressed SCTE in the basal layer of the epidermis, accompanied 0 by an increase in cathelicidin expression. By contrast, cathelicidin and 3,000 3,500 4,000 4,500 (m/z)

SCTE were much less abundant and localized superficially in normal LL-37 skin (Fig. 3a and Supplementary Fig. 3 online). This increase in Normal 6 immunoreactivity in rosacea correlated with higher protease activity 4 in the epidermis, as determined by in situ zymography of rosacea 2 skin and normal skin (Fig. 3b). Total protease activity was measurable 0 in individuals with rosacea (Fig. 3c), but was typically undetectable in 6 normal individuals. This activity was a serine protease such as SCTE, 4 because the serine protease inhibitors aprotinin and AEBSF completely 2 0 suppressed the observed proteolytic activity in rosacea skin (Fig. 3c). 6 Having observed that individuals with rosacea uniformly show an 4 increase in cathelicidin and an abnormality in enzymatic processing, 2 we examined whether these findings could explain the clinical pre- 0 sentation of this disease. To test the consequences of abnormal 3,000 3,500 4,000 4,500 (m/z) cathelicidin peptides, human keratinocytes were cultured in the Figure 2 Altered expression of cathelicidin peptides in rosacea skin. Shown presence of peptides such as LL-37 and FA-29 that are abundant in is the mass of cathelicidin peptides in lesional skin of rosacea (top) and in rosacea. These rosacea peptides, but not the shorter peptides DI-27 normal skin (bottom) as examined by SELDI-TOF-MS. Arrowheads indicate and KR-20, which are present on normal skin20,22, induced IL-8 unique peptide peaks in rosacea skin.

976 VOLUME 13 [ NUMBER 8 [ AUGUST 2007 NATURE MEDICINE LETTERS

abCathelicidin SCTE Merged c FITC-casein DAPI None Mix Bestatin E64 Rosacea

Rosacea Aprotinin AEBSF NEI LEI EDTA Pepstatin Normal Normal 0 100 200 Fluorescence

Figure 3 Increased SCTE expression and protease activity in rosacea epidermis. (a) Expression of cathelicidin and SCTE in skin visualized by immunofluorescence. Top, rosacea skin; bottom, normal skin. Green indicates cathelicidin; red indicates SCTE. Scale bars, 500 m. (b) Protease activity .com/naturemedicine m in human skin examined by in situ zymography with FITC-conjugated casein substrate (left). Nuclei were also stained with DAPI (right). Scale bars, 500 mm. (c) Skin surface protease was measured with FITC-conjugated casein substrate. The indicated protease inhibitors were used to identify proteases. Serine protease inhibitors (aprotinin and AEBSF) and a protease inhibitor mixture (Mix) completely suppressed skin surface protease activity.

the observations made after the injection of excess peptide, because inflammatory changes in mice characteristic of the disease in humans.

http://www.nature considerably less inflammation after application of a contact irritant was These observations are consistent with an evolving understanding of seen in Camp/ mice than in wild-type mice (Fig. 4c,d). A similar the functions of antimicrobial peptides. On the basis of largely in vitro decrease in inflammatory infiltrate in Camp/ mice was also seen after observations, cathelicidins and other antimicrobial peptides have been physical abrasion of the skin (data not shown). proposed to do more than just kill microbes: they can stimulate Totest how the increase in serine protease activity observed in rosacea cytokine release20,angiogenesis15,chemotaxis14 and wound repair18,26. contributes to the clinical findings of the disease, we examined mice In the case of rosacea, an increase in production of cathelicidin, deficient in the gene encoding serine peptidase inhibitor Kazal-type 5 combined with greater proteolytic processing, leads to a situation (Spink5), which do not express the serine protease inhibitor Lympho- where accumulation of these peptides can initiate the classical man- epithelial Kazal-type–related inhibitor (LEKTI) and show increased ifestations of this disorder. A change in local antimicrobial peptide SCTE activity23.SkinfromSpink5/ mice had altered expression of expression may also change the population of commensal microbes on cathelicidin peptides similar to that seen in rosacea (Fig. 4e). The main involved skin. Such a change in the microflora in rosacea1–3 may peak was GLL-34 (m/z 3,877; Fig. 4e, arrowhead), a mouse cathelicidin contribute further to the manifestations of this disease. peptide similar in activity to human LL-37 (ref. 24). Like LL-37, GLL-34 Several clinical observations also support the involvement of abnor- Nature Publishing Gr oup 200 7 Nature Publishing was not detected in wild-type mouse littermates with normal serine mal proteolysis in the pathogenesis of rosacea. Protease activity is higher © protease activity. These data support the hypothesis that an increase in in facial skin in which rosacea symptoms occur than in other areas of the serine protease activity leads to activation of cathelicidin. body that are spared of the disease (data not shown). Tetracyclines can To determine whether an increase in SCTE results in greater indirectly inhibit serine proteases27, thereby explaining their therapeutic inflammation, SCTE was injected subcutaneously in a manner similar benefit over other antibiotics despite the frequent development of to that used for the cathelicidin peptides themselves. The amount of tetracycline resistance in microflora cultured from the skin of affected SCTE in human skin is as high as 2–13 ng per mg of dry weight of individuals. Indeed, preliminary data show that minocycline decreases skin25. From the data of the protease assay, we estimated the amount skin protease activity during treatment. Thus, the association between of serine protease activity in lesional skin of individuals with rosacea the administration of a clinically effective drug and a decrease in the to be as high as 500 ng of tryptic kallikrein per mg of dry weight of capacity of the skin to proteolytically generate cathelicidin peptides skin. Therefore, 1 mg of SCTE was injected twice a day for 2 d to further supports the notion that protease activity has a role in rosacea. mimic local concentrations seen in rosacea. Injection of active SCTE The balance between cathelicidin and SCTE is disturbed in rosacea; induced erythema and inflammatory cell infiltration accompanied by however, other serine proteases and protease inhibitors may participate processing of cathelicidin peptide (Fig. 4f), which were not observed in determining the final steady-state accumulation of cathelicidin in control treated skin. This response to SCTE was dependent on the products. Evidence supporting the idea that other serine proteases presence of cathelicidin, because Camp/ mouse showed consider- have a role in modifying cutaneous inflammation is provided by ably less cell infiltration after SCTE injection as compared with wild- transgenic mice overexpressing kallikrein 7 in the skin. These mice type mice (Fig. 4g,h). These data show that injection of SCTE show abnormal formation of the epidermal barrier and inflammation increases cathelicidin processing and induces skin inflammation. in the dermis28. It is unclear to what extent an abnormal physical Therefore, the increase in SCTE observed in rosacea would account barrier, as compared with abnormal processing of inflammatory for the pathological changes observed this disease. mediators such as cathelicidin, contributes to this observation. Simi- Our findings demonstrate an association between the clinical signs larly, mice lacking LEKTI have barrier abnormalities and inflammation of rosacea and abnormal cathelicidin expression and processing. of the skin, and an excess of active cathelicidins21. Although the Overexpression of cathelicidin and the subsequent generation of inflammatory effects in both models are likely to be partly a con- abnormally processed peptides by highly increased serine protease sequence of the effects of protease on the stratum corneum, our activity results in the accumulation of peptides that can induce findings suggest that the generation of pro-inflammatory forms of

NATURE MEDICINE VOLUME 13 [ NUMBER 8 [ AUGUST 2007 977 LETTERS

cathelicidin is also a contributing factor. Thus, surface protease activity antimicrobial peptide. This abnormality in enzymatic activity and seems not only to influence physical barrier formation but also to peptide expression can lead to the development of many aspects of the be an essential element in regulating inflammatory signals. This human disease in mice. Our findings suggest a new direction for concept emphasizes the importance of total enzymatic activity, a understanding the pathophysiology of rosacea. Influencing the balance process that will be modified by various environmental factors such of antimicrobial peptides, and their post-secretory processing, pro- as temperature and pH. Because these factors are also well described as vides an opportunity for designing more effective therapy and reveals associated with precipitating disease in rosacea29, these clinical associa- the potential for the involvement of proteolysis and cathelicidin tions further support the hypothesis that rosacea is a manifestation of expression in other inflammatory disorders. an abnormality in antimicrobial peptide expression and processing. In conclusion, individuals with rosacea have an increase in both METHODS serine protease activity and cathelicidin peptides in their facial Immunohistochemistry. All sample acquisition, including skin biopsies and skin, resulting in the generation of pro-inflammatory forms of the tape-stripped samples, was approved by the Committee on Investigations

a bcLL-37 KR-20

.com/naturemedicine 4

3

2 IL-8 (ng/ml) 1 http://www.nature 0 Camp –/– Camp +/+ LL-37 FA-29 DI-27 KR-20 none

de1,400 30 Spink5 –/– 1,200 20 1,000 800 10 600 0

Cells/HPF 400 30 +/+ 200 Spink5 20 0 –/– +/+ Camp Camp 10 Nature Publishing Gr oup 200 7 Nature Publishing

© 0 (m/z) 2,000 4,000 6,000 8,000 10,000 f g 2 SCTE 1

2 Camp –/– Camp +/+ Boiled SCTE 1 800 (m/z) h 3,000 4,000 5,000 6,000 600

400 Figure 4 Cathelicidin peptides augment cytokine induction in human keratinocytes and skin inflammation.

(a) Human epidermal keratinocytes were stimulated by cathelicidin peptides, and IL-8 in culture media was measured. Cells/HPFs 200 Data are the mean ± s.d. (n ¼ 3 experiments). (b) Skin surface and histology images of lesions caused by injection of cathelicidin peptides. Left, LL-37–injected skin; right, KR-20–injected skin. Scale bars, 5 mm (skin surface), 500 mm 0 –/– +/+ (histology). (c,d) Skin irritation caused by epicutaneous DNFB application to Camp / and wild-type littermate Camp Camp (Camp +/+) mice. Shown are histology (c) and mean ± s.d. of leukocyte counts per HPF from 3 randomly selected regions (d). Wild-type mice showed significantly more cell infiltration than Camp / mice (P o 0.05). Scale bars, 500 mm. (e) Cathelicidin processing in Spink5 –/– mice analyzed by SELDI-TOF-MS. Skin from Spink5 –/– mice had processed cathelicidin peptides of o7 kDa (top), whereas the main cathelicidin in wild-type (Spink5 +/+) mice was a non-processed form of 48 kDa (bottom). Arrowhead indicates GLL-34, a representative mouse cathelicidin peptide. (f) SCTE or boiled SCTE was injected subcutaneously, and histology (left) and cathelicidin processing (right) were examined. SCTE-treated skin showed inflammation and processed cathelicidin peptide (m/z 4,244, sequence FKKISRLAGLLRKGGEKIGEKLKKIGQKIKNFFQKLV). Scale bars, 500 mm. (g,h) SCTE was injected subcutaneously into Camp / and wild-type mice. Skins were processed by hematoxylin-eosin staining (g), and the mean ± s.d. (n ¼ 4) of infiltrated cells per HPF was plotted (h). Camp / mice showed significantly less cell infiltration (P o 0.05).

978 VOLUME 13 [ NUMBER 8 [ AUGUST 2007 NATURE MEDICINE LETTERS

Involving Human Subjects of the University of California, San Diego. We ethanolamine in PBS (pH 8.0). After three washes with 0.5% Triton-X in PBS, obtained informed consent for all procedures. After the injection of local protein chips were assembled in the Bioprocessor reservoir, 50 mlofeluted anesthesia, 3-mm punch biopsies were taken from the untreated lesional skin of sample was applied, and the chips were incubated for 2 h at room temperature. individuals with rosacea and from skin of normal healthy volunteers. The tissue The protein chips were washed twice with RIPA buffer, once with PBS was freshly frozen in Tissue-Tek OCT compound (Electron Microscopy containing 0.5% Triton-X and three times with PBS, and then soaked in Sciences). We cut 5-mm sections and fixed them in methanol for 30 min at 10 mM HEPES buffer and air-dried. We applied 0.5 mlofenergyabsorbance 4 1C. Sections were blocked with 5% donkey serum in PBS for 30 min, incubated molecule (50% saturated a-cyano-4-hydroxy cinnamic acid in 50% acetonitrile for 1 h with polyclonal chicken IgY antibody to the LL-37 peptide of CAP18, plus 0.5% trifluoric acid) twice, and all spots were allowed to dry completely. and then incubated for 30 min with horseradish peroxidase (HRP)-conjugated Samples were analyzed on a SELDI mass analyzer PBS II with a linear TOF goat antibody to chicken IgY. Immunostaining was visualized by using a mass spectrometer (Ciphergen Biosystems) using time-lag focusing. The Vectastain ABC kit (Vecta Laboratories). We obtained images with an Olympus specificity of antibodies to LL-37 and mouse CRAMP in this system has been BX41 microscope (Scientific Instrument Company). In total, 11 rosacea confirmed by several synthetic cathelicidin peptides20,22. Synthetic LL-37 and samples and 10 normal samples were examined to confirm similar results. KR-20 peptides were used as references to calibrate the exact mass sizes.

Cathelicidin protein analysis. To obtain skin surface cathelicidin peptides, Fluorescence immunohistochemistry. We fixed 6-mm frozen sections with facial skin was tape-stripped 20 times from the same lesion with a 23-mm paraformaldehyde, blocked them with 5% goat serum, and incubated them with diameter tape (D-Squame; a gift of CuDerm Corp.). The tapes were immersed polyclonal rabbit antibody to LL-37 or monoclonal mouse antibody to SCTE. in 1 ml of 1 M HCl containing 1% trifluoroacetic acid and vortexed. We FITC-conjugated goat antibody to rabbit IgG and AlexaFluor568-conjugated lyophilized the protein extracts completely and dissolved the pellet in 100 mlof goat antibody to mouse IgG (Molecular Probes), respectively, were used as distilled water. Concentrations of total protein were measured by a BCA protein secondary antibodies. We mounted sections in ProLong Anti-Fade reagent assay (Pierce Biotechnology). For quantification of cathelicidin, 5 mlofeach (Molecular Probes). Images were obtained by a Zeiss LSM510 laser scanning sample, or serially diluted synthetic LL-37 peptide as a standard, was dotted confocal microscope coupled with an Axiovert 100 inverted stage microscope. onto a nitrocellulose membrane. The membrane was blocked with 5% non-fat m dry milk in PBS for 1 h, incubated overnight with rabbit antibody to LL-37 at In situ zymography. The frozen sections 6 ( m) were rinsed with 1% Tween-20 m 4 1C, and then incubated for 1 h with HRP-conjugated goat antibody to in distilled water and incubated with 100 l of BODIPY-FL-casein substrate http://www.nature.com/naturemedicine (10 mg/ml in 10 mM Tris-HCl, pH 7.8; Molecular Probes) at 37 1Cfor3h. rabbit IgG (DAKO). The immunoreactions were visualized by Western Lighting chemiluminescence reagent plus (Perkin-Elmer Life Science), and the density of After removal of excess of substrate solution, nuclei were stained with ¢ each dot was measured with NIH Image and compared with standard controls. 4 ,6-diamidino-2-phenylindole (DAPI) and rinsed with 1% Tween-20 in distilled water. We mounted sections in ProLong Anti-Fade reagent (Molecular Probes). Images were obtained with an Olympus BX41 microscope (Scientific In situ hybridization. To localize cathelicidin mRNA expression in the skin, we carried out in situ hybridization as described30. Digoxigenin (DIG)-labeled Instrument Company). riboprobes were prepared by using a DIG RNA labeling kit (SP6/T7; Roche Peptide synthesis. Cathelicidin peptides were commercially prepared by Applied Science) in accordance with the instructions provided. Freshly frozen Synpep. We used the following peptide amino acid sequences: LLGDFFRKSKE sections were cut at 8 mm, fixed with 4% paraformaldehyde for 10 min at room KIGKEFKRIVQRIKDFLRNLVPRTES (LL-37), FALLGDFFRKSKEKIGKEFK temperature (18–23 1C), and immersed in 0.1% active diethyl pyrocarbonate in RIVQRIKDF (FA-29), DISCDKDNKRFALLGDFFRKSKEKIGK (DI-27), and PBS at 4 1C for 10 min. The sections were then washed with PBS at room KRIVQRIKDFLRNLVPRTES (KR-20). All synthetic peptides were purified to temperature for 10 min, treated with 1 M triethanolamine solution (pH 8.0) 495% by HPLC and their identity was confirmed by mass spectrometry. containing 0.25% acetic anhydride for 15 min at 37 1C, washed with PBS at

Nature Publishing Group Group 200 7 Nature Publishing least three times, treated with 100% ethanol for 5 min, and then dried. Measurement of IL-8 release. Normal human keratinocytes (Cascade Biolo- © Prehybridization was performed with 50% formamide in 2 SSC (3 M sodium gics) were grown in EpiLife medium (Cascade Biologics) supplemented with 1 chloride and 0.03 M sodium citrate) for 30 min at 45 C. After removal of 0.06 mM Ca2, 1% EpiLife defined growth supplement, and 1% penicillin- excess solution, sections were hybridized for 16 h at 45 1C with sense or streptomycin (Invitrogen Life Technologies). Cells were grown at 37 1Cina antisense DIG-labeled cRNA probes for the LL-37 peptide sequence (137 bp, humidified atmosphere of 5% CO2 and 95% air. We cultured human kerati- 1 mg/ml) in hybridization solution (1 mg/ml of yeast tRNA, 20 mM Tris-HCl nocytes to confluence and treated them with the cathelicidin peptides (3.2 mM) buffer (pH 8.0), 2.5 mM EDTA, 1 Denhart’s solution, 0.3 M NaCl, 50% for 6 h. Supernatants were collected and placed in a sterile 96-well plate for deionized formamide and 50% dextran sulfate). Stringent washing was done ELISA. Production of IL-8 was determined by ELISA (R&D systems) in for 60 min at 45 1C with 50% formamide in 2 SSC, and for 10 min at 37 1C accordance with the manufacturer’s instructions. In brief, 96-well plates were with 2 SSC. RNase treatment was performed with 40 mg/ml of RNase-A coated with capture antibody and incubated overnight at 4 1C. Wells were (Roche Applied Science) for 30 min at 37 1C.Thesectionswerethenwashed washed three times, blocked for 1 h at room temperature, and washed another with 2 SSC for 30 min at 37 1C, and reacted with alkaline phosphate– three times. Standards and samples at a dilution of 1/20 were then added to the conjugated Fab fragment antibody to DIG (1:500 in PBS; Roche Applied wells. After 2 h at room temperature, the wells were washed five times, and the Science) for 5 h at room temperature. Alkaline phosphate was visualized by detection antibody was added. After 1 h at room temperature, the wells were incubation with 5-bromo-4-chloro-3-indolyl phosphate (X-phosphate) and washed seven times, substrate solution was added to each well, and the plate was nitroblue tetrazolium with addition of levamisole solution (DAKO) overnight incubated for 30 min at room temperature in the dark. We added stop solution at room temperature. We used methyl green as a nuclear counterstain. to each well and measured the absorbance at 450 nm with correction at 570 nm.

SELDI-TOF-MS. Skin biopsies were frozen in OCT compound and stored at Skin inflammation models and identification of cathelicidin peptides. All 80 1C. Twenty 10-mm slices were collected in 1.5-ml polypropylene tubes and mouse procedures were approved by the Veterans Affairs (VA) San Diego dissolved in 100 ml of RIPA buffer (50 mM HEPES, 150 mM NaCl, 0.05% SDS, Healthcare System subcommittee on animal studies. Neonatal mouse skin from 0.25% deoxycholate and 0.5% NP-40; pH 7.4) containing protease inhibitors Spink5-deficient mice and wild-type littermates was excised by using an 8-mm (Roche Applied Science). Samples were sonicated for 3 min and centrifuged for punch biopsy. Samples were homogenized and centrifuged for 10 min at 12,000g 10 min at 12,000g. We transferred the supernatant to new tubes and kept it at and the supernatant was collected. We analyzed processing of mouse CRAMP by 20 1C until SELDI-TOF analysis. SELDI-TOF-MS with rabbit antibody to mouse CRAMP, as described above. Protein chips (RS-100 protein chip array; Ciphergen Biosystems) were BALB/c and C57BL/6 mice, shaved 24 h before treatments, were injected coated with 4 ml of rabbit antibody to LL-37 for human samples and rabbit subcutaneously on the back with 40 mlofpeptide(320mM) twice a day. antibody to mouse cathelin-related antimicrobial peptide (CRAMP)26 for Subcutaneous injections were targeted superficially to raise an intact epidermal mouse samples for 2 h at room temperature, and then blocked with 0.5 M bleb, thereby identifying that administration was at the level of the lower

NATURE MEDICINE VOLUME 13 [ NUMBER 8 [ AUGUST 2007 979 LETTERS

epidermis or dermis. Forty-eight hours after the initial injection (four injec- Published online at http://www.nature.com/naturemedicine tions in total), we assessed skin inflammation by the severity of erythema and Reprints and permissions information is available online at http://npg.nature.com/ edema. Skin was then biopsied for hematoxylin-eosin staining to examine the reprintsandpermissions histopathological changes. One representative image of skin surface and

histology from three independents experiments is shown (Fig. 4b). 1. Kelly, A.P. Acne and related disorders. in Principles and Practice of Derma- To determine the role of loss of cathelicidin in inflammation, CRAMP- tology (eds. Sams, W. & Lynch, P.) 801–818 (Churchill Livingstone, New York, deficient (Camp/)mice8 and wild-type littermates were used. To induce 1996). cathelicidin, mice were shaved and skin was injured by light abrasion 20 times 2. Straus, J. Rosacea and acne rosacea. in Dermatology (eds. Orkin, M., Maibach, H. & Dahl, M.) 337–338 (Prentice Hall International Inc., New Jersey, 1991). with sandpaper (aluminum oxide sandpaper, medium 100 grit, 3M). After 3. Crawford, G.H., Pelle, M.T. & James, W.D. Rosacea: I. Etiology, pathogenesis, and 24 h, we induced chemical inflammation epicutaneously by application of 10 ml subtype classification. J. Am. Acad. Dermatol. 51, 327–341 quiz 342–344 (2004). of 2% 2,4-dinitrofluorobenzene (DNFB, Sigma-Aldrich) diluted in acetone 4. Zanetti, M. The role of cathelicidins in the innate host defenses of mammals. Curr. onto abraded back skin. Skin was excised 5 d after the application of DNFB, Issues Mol. Biol. 7, 179–196 (2005). 5. Zanetti, M. Cathelicidins, multifunctional peptides of the innate immunity. J. Leukoc. fixed in 10% formaldehyde solution, and processed for hematoxylin-eosin Biol. 75, 39–48 (2004). staining. Numbers of infiltrated cells in dermis were counted under a micro- 6. van Dijk, A., Veldhuizen, E.J., van Asten, A.J. & Haagsman, H.P. CMAP27, a novel scope. The mean ± s.d. of the counted cells in high power fields (HPFs) from chicken cathelicidin-like antimicrobial protein. Vet. Immunol. Immunopathol. 106, three randomly selected regions is plotted (Fig. 4h). All mouse experiments 321–327 (2005). 7. Chang, C.I., Pleguezuelos, O., Zhang, Y.A., Zou, J. & Secombes, C.J. Identification of a were repeated at least three times to confirm the reproducibility. novel cathelicidin gene in the rainbow trout, Oncorhynchus mykiss. Infect. Immun. 73, For administration of kallikrein, 100 mlof10ng/ml of SCTE (hKLK5; R&D 5053–5064 (2005). Systems) was injected subcutaneously twice a day. We injected boiled SCTE 8. Nizet, V. et al. Innate antimicrobial peptide protects the skin from invasive bacterial (10 min at 100 1C) and vehicle as controls. Forty-eight h after the last injection infection. Nature 414, 454–457 (2001). 9. Rosenberger, C.M., Gallo, R.L. & Finlay, B.B. Interplay between antibacterial effectors: (four injections in total), the skin was biopsied with a 6-mm punch and cut in a macrophage antimicrobial peptide impairs intracellular Salmonella replication. Proc. half. One-half was fixed in 10% formaldehyde solution and subjected for Natl. Acad. Sci. USA 101, 2422–2427 (2004). hematoxylin-eosin staining. The other half was extracted with 200 mlofRIPA 10. Iimura, M. et al. Cathelicidin mediates innate intestinal defense against colonization buffer containing protease inhibitors and subjected to SELDI-TOF-MS analysis. with epithelial adherent bacterial pathogens. J. Immunol. 174, 4901–4907 (2005). 11. Howell, M.D. et al. Selective killing of vaccinia virus by LL-37: implications for eczema Numbers of infiltrated cells were counted from three HPFs, and the mean ± s.d. http://www.nature.com/naturemedicine vaccinatum. J. Immunol. 172, 1763–1767 (2004). of four mice is plotted (Fig. 4f). 12. Ong, P.Y. et al. Endogenous antimicrobial peptides and skin infections in atopic dermatitis. N. Engl. J. Med. 347, 1151–1160 (2002). Skin protease activity. Facial skin was tape-stripped 20 times from the same 13. Oppenheim, J.J. & Yang, D. Alarmins: chemotactic activators of immune responses. lesion with two tapes (D-Squame). The tapes were immersed in 1 ml of Curr. Opin. Immunol. 17, 359–365 (2005). 14. De, Y. et al. LL-37, the neutrophil granule- and epithelial cell-derived cathelicidin, 1 M acetic acid and incubated at 4 1C overnight. The protein extracts were utilizes formyl peptide receptor-like 1 (FPRL1) as a receptor to chemoattract human lyophilized completely, and the pellet was dissolved in 40 ml of PBS (pH 7.4). peripheral blood neutrophils, monocytes, and T cells. J. Exp. Med. 192, 1069–1074 Protease activity of facial skin surface was monitored by using an EnzCheck (2000)[AG1]. protease assay kit (Molecular Probes) in accordance with the manufacturer’s 15. Koczulla, R. et al. An angiogenic role for the human peptide antibiotic LL-37/hCAP-18. J. Clin. Invest. 111, 1665–1672 (2003). instructions. In brief, 10 ml of the aqueous solution collected from the skin surface 16. Gallo, R.L. et al. Syndecans, cell surface heparan sulfate proteoglycans, are induced by was mixed with 190 ml of BODIPY-FL-casein substrate in 10 mM Tris-HCl (pH a proline-rich antimicrobial peptide from wounds. Proc. Natl. Acad. Sci. USA 91, 7.8), and incubated at 37 1C for 24 h. We monitored protease activity as an 11035–11039 (1994). increase in fluorescence with SpectraMax GEMINI EM (Molecular Devices 17. Frohm, M. et al. The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders. J. Biol. Chem. 272, Corporation). In some experiments, protease inhibitors were added, including 15258–15263 (1997).

Nature Publishing Group Group 200 7 Nature Publishing a protease inhibitor mixture (Complete EDTA-free, 1 tablet per 50 ml; Roche), 18. Heilborn, J.D. et al. The cathelicidin anti-microbial peptide LL-37 is involved in

© 200 mg/ml of bestatin, 20 mg/ml of E64, 20 mg/ml of aprotinin (Sigma-Aldrich), re-epithelialization of human skin wounds and is lacking in chronic ulcer epithelium. 200 mM 4-(2-aminoethyl)-benzenesulfonylfluoride (AEBSF), 200 mMhuman J. Invest. Dermatol. 120, 379–389 (2003). 19. Zaiou, M., Nizet, V. & Gallo, R.L. Antimicrobial and protease inhibitory functions of the neutrophil elastase inhibitor (methoxysuccinyl-Ala-Ala-Pro-Ala-chloromethyl human cathelicidin (hCAP18/LL-37) prosequence. J. Invest. Dermatol. 120, 810–816 ketone), and 200 mM human leukocyte elastase inhibitor (methoxysuccinyl- (2003). Ala-Ala-Pro-Val-chloromethylketone; Calbiochem). 20. Braff, M.H. et al. Structure-function relationships among human cathelicidin peptides: dissociation of antimicrobial properties from host immunostimulatory activities. J. Immunol. 174, 4271–4278 (2005). Statistical analysis. Student’s t-test was used for statistical analyses of cathe- 21. Yamasaki, K. et al. Kallikrein-mediated proteolysis regulates the antimicrobial effects licidin protein expression in human skin and cell infiltration in mouse skin of cathelicdiins in skin. FASEB J. 20, 2068–2080 (2006). inflammation models. A value of P o 0.05 was considered significant. 22. Murakami, M., Lopez-Garcia, B., Braff, M., Dorschner, R.A. & Gallo, R.L. Postsecretory processing generates multiple cathelicidins for enhanced topical antimicrobial Note: Supplementary information is available on the Nature Medicine website. defense. J. Immunol. 172, 3070–3077 (2004). 23. Descargues, P. et al. Spink5-deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease hyperactivity. Nat. Genet. 37, ACKNOWLEDGMENTS 56–65 (2005). We thank B. Cottrell for instructions in SELDI-TOF-MS analysis. This work was 24. Gallo, R.L. et al. Identification of CRAMP, a cathelin-related antimicrobial peptide supported by the National Institutes of Health (R01-AI052453, R01-AR45676), expressed in the embryonic and adult mouse. J. Biol. Chem. 272, 13088–13093 The National Rosacea Society and a VA Merit Award (R.L.G.); and the (1997). Association for Preventive Medicine of Japan (K.Y.). 25. Komatsu, N. et al. Quantification of human tissue kallikreins in the stratum corneum: dependence on age and gender. J. Invest. Dermatol. 125, 1182–1189 (2005). 26. Dorschner, R.A. et al. Cutaneous injury induces the release of cathelicidin anti- AUTHOR CONTRIBUTIONS microbial peptides active against group A Streptococcus. J. Invest. Dermatol. 117, K.Y. conducted SELDI-TOF-MS experiments, protease assays including in situ 91–97 (2001). zymography and in vivo studies, and wrote the manuscript. A.D.N. conducted 27. Acharya, M.R., Venitz, J., Figg, W.D. & Sparreboom, A. Chemically modified tetra- the in vivo skin irritation model. A.B., M.M. and T.O. performed cyclines as inhibitors of matrix metalloproteinases. Drug Resist. Updat. 7, 195–208 immunohistochemistry, dot blot and in situ hybridization. A.C. performed (2004). immunofluorescence. R.A.D. prepared and purified peptides. C.B., P.D. and A.H. 28. Hansson, L. et al. Epidermal overexpression of stratum corneum chymotryptic enzyme contributed to the experiments with Spink5-deficient mice. A.B., V.B.M. and in mice: a model for chronic itchy dermatitis. J. Invest. Dermatol. 118, 444–449 (2002). R.L.G. organized human sample collection. R.L.G. conceived, designed and 29. Brinnel, H., Friedel, J., Caputa, M., Cabanac, M. & Grosshans, E. Rosacea: disturbed supervised all aspects of this work. defense against brain overheating. Arch. Dermatol. Res. 281, 66–72 (1989). 30. Murakami, M. et al. Cathelicidin anti-microbial peptide expression in sweat, an COMPETING INTERESTS STATEMENT innate defense system for the skin. J. Invest. Dermatol. 119, 1090–1095 The authors declare no competing financial interests. (2002).

980 VOLUME 13 [ NUMBER 8 [ AUGUST 2007 NATURE MEDICINE Annexe 5

Descargues P, Deraison C, Bonnart C, Hovnanian A. Netherton syndrome: a model for studying the regulation of the desquamation process Med Sci, 2005, 21:457-458.

179 180 MEDECINE/SCIENCES 2005 ; 21 :???-??

NOUVELLE

Syndrome de Netherton: MAGAZINE un modèle d’étude de la régulation de la desquamation Inserm U.563, Université Paul Pascal Descargues, Céline Deraison, Chrystelle Bonnart, Sabatier, place du Dr Baylac, Alain Hovnanian 31059 Toulouse, France alain.hovnanian@ toulouse.inserm.fr

> L’épiderme, la couche la plus externe période néonatale (infections bacté- NOUVELLES de la peau, assure une fonction de bar- riennes, déshydratation hypernatré- rière protectrice essentielle pour l’orga- mique, perte de poids rapide) et sont après la naissance en raison d’un défaut nisme. Il est indispensable à toute vie associées à une altération sévère de la sévère de la barrière cutanée. Le déta- terrestre car il empèche la perte des barrière cutanée [3]. chement de l’épiderme se produit à la fluides corporels et s’oppose aux agres- Nous avons précédemment identifié le transition entre couche granuleuse et sions physiques et chimiques ainsi qu’à gène dont les anomalies sont respon- couche cornée, par clivage asymétrique la pénétration des agents pathogènes. sables de ce syndrome [4]. Il s’agit de des desmosomes. Ces anomalies sont Ce rempart est assuré par la couche cor- SPINK5 (serine proteases inhibitor kazal similaires à celles observées dans la née, couche superficielle de l’épiderme type 5) qui code pour l’inhibiteur de pro- couche granuleuse superficielle des en contact avec l’environnement exté- téases à sérine LEKTI (lympho epithelial patients atteints de syndrome de rieur, constituée de kératinocytes (cor- kazal type inhibitor), appartenant à la Netherton [9]. Nous avons montré chez néocytes) énucléés, aplatis, totalement famille des inhibiteurs de type Kazal [5] différenciés et inclus dans une matrice et fortement exprimé dans la couche lipidique. L’épaisseur de cette couche granuleuse de l’épiderme [6]. LEKTI est est finement contrôlée par le processus constituée de 15 domaines inhibiteurs de de desquamation au cours duquel les protéases à sérine et peut inhiber effica- cornéocytes les plus superficiels se cement la trypsine in vitro [5]. Toutes les détachent de la surface de la peau. mutations de SPINK5 identifiées à ce jour Notre équipe vient de montrer que ce chez les patients entraînent l’apparition processus est profondément perturbé de codons stop prématurés et condui- dans une maladie génétique sévère de la sent à l’absence d’expression de LEKTI peau, le syndrome de Netherton. [4, 6]. Une activité de type trypsine Le syndrome de Netherton (OMIM anormalement élevée a été mise en évi- #256500) est une génodermatose rare, à dence dans la couche cornée de patients transmission autosomique récessive, [7], mais les fonctions de LEKTI restaient caractérisée par une érythrodermie ich- encore mal comprises. Afin de mieux tyosiforme congénitale, une dysplasie comprendre le rôle physiologique de pilaire spécifique (trichorrhexis invagi- LEKTI dans l’homéostasie de l’épiderme, Figure 1. Décollement de la couche cornée des nata ou cheveux bambous) et des mani- nous avons développé des souris Spink5- souris Spink5-/-. A. Les souris Spink5–/– (KO) festations atopiques [1, 2]. Les enfants /- en invalidant le gène par recombinai- présentent dès la naissance des décollements atteints de cette maladie présentent une son homologue [8]. superficiels étendus de la peau. B. La colora- érythrodermie exfoliative pouvant per- Les souris Spink5-/- présentent dès la tion par hématoxyline/éosine de coupes de sister toute la vie pour les cas les plus naissance des érosions cutanées super- peau montre une séparation entre la couche sévères, ou laisser place à une ichtyose ficielles résultant d’une perte d’adhé- granuleuse (CG) et la couche cornée (CC) de linéaire circonflexe évoluant par pous- rence de la couche cornée à l’épithélium l’épiderme chez les souris Spink5-/-. CB: sées [1]. Des complications menaçant le sous-jacent (Figure 1). Ces souris meu- couche basale, CE: couche épineuse, de: pronostic vital sont fréquentes en rent de déshydratation quelques heures derme, WT: souris normale.

M/S n° 5, vol. 21, mai 2005 1 les souris Spink5-/- que ces anomalies veaux-nés est greffée sur des souris développement de stratégies thérapeu- sont provoquées par la dégradation de la immunodéficientes. La peau greffée tiques visant à réguler l’activité des pro- desmogléine 1, protéine desmosomale montre un épaississement marqué de la téases SCTE et SCCE afin de restaurer la majoritairement exprimée dans les der- couche cornée et des couches supraba- fonction de barrière cutanée chez ces nières couches vivantes de l’épiderme et sales de l’épiderme associé à une perte patients. Ces travaux nous conduisent responsable des propriétés d’adhérence d’adhésion de la couche cornée et à la aussi à étudier la fonction de ces pro- des desmosomes. Cette dégradation est présence d’infiltrats inflammatoires téases épidermiques et de leurs inhibi- la conséquence de l’augmentation de dermiques. Ces lésions reproduisent teurs dans la pathogenèse de maladies l’activité protéolytique des protéases fidèlement le phénotype du syndrome de cutanées beaucoup plus fréquentes épidermiques SCTE (stratum corneum Netherton. comme la dermatite atopique. ◊ tryptic enzyme) et SCCE (stratum cor- Comme chez les patients atteints du syn- Netherton syndrome: neum chymotryptic enzyme). Ces pro- drome de Netherton, les altérations de a model for studying the regulation téases à sérine sont sécrétées à la tran- l’épiderme sont associées à des anoma- of the desquamation process sition entre la couche granuleuse et la lies des follicules pileux. Chez les souris couche cornée, et sont impliquées dans Spink5-/-, les cellules de la gaine épithé- RÉFÉRENCES la protéolyse des cornéodesmosomes au liale interne perdent leurs contacts 1. Comel M. Ichtyosis linearis circumflexa. cours du processus de desquamation intercellulaires, compromettant ainsi Dermatologica 1949; 98: 133-6. [10]. La SCTE peut dégrader la desmo- leur rôle dans l’accompagnement de la 2. Netherton EW. A unique case of Trichorrexis gléine 1 in vitro, et LEKTI inhibe la tryp- croissance de la tige pilaire. Ces anoma- Invaginata. Arch Dermatol 1958; 78: 483-7. 3. Fartasch M, Williams ML, Elias PM. Altered lamellar sine in vitro [5]. La dégradation de la lies pourraient ainsi expliquer la patho- body secretion and stratum corneum membrane desmogléine 1 chez les souris Spink5-/- genèse des cheveux bambous, dans les- structure in Netherton syndrome. Arch Dermatol 1999; 135: 823-32. résulte donc très vraisemblablement quels la partie distale du cheveux s’inva- 4. Chavanas S, Bodemer C, Rochat A, et al. Mutations in d’une absence d’inhibition de la SCTE par gine dans sa partie proximale. SPINK5, encoding a serine protease inhibitor, cause LEKTI. La SCTE étant aussi impliquée dans En conclusion, ces travaux nous ont per- Netherton syndrome. Nat Genet 2000; 25: 141-2. 5. Magert HJ, Standker L, Kreutzmann P, et al. LEKTI, a l’activation protéolytique de la pro- mis d’élucider les événements molécu- novel 15-domain type of human serine proteinase SCCE, l’augmentation de l’activité de la laires pathologiques à l’origine de l’éry- inhibitor. J Biol Chem 1999; 274: 21499-502. SCCE chez les souris Spink5-/- pourrait throdermie exfoliative sévère présente 6. Bitoun E, Micheloni A, Lamant L, et al. LEKTI proteolytic processing in human primary être dûe à l’activation non contrôlée de chez les enfants atteints du syndrome de keratinocytes, tissue distribution and defective la pro-SCCE par la SCTE en l’absence de Netherton. L’absence de LEKTI chez les expression in Netherton syndrome. Hum Mol Genet LEKTI. souris Spink5-/- provoque l’augmenta- 2003; 12: 2417-30. 7. Komatsu N, Takata M, Otsuki N, et al. Elevated La perte d’adhérence de la couche cor- tion de l’activité protéolytique des pro- stratum corneum hydrolytic activity in Netherton née chez les souris Spink5-/- rappelle téases épidermiques SCTE et SCCE. syndrome suggests an inhibitory regulation of desquamation by SPINK5-derived peptides. J Invest deux conditions humaines: le syndrome L’hyperactivité de ces enzymes conduit à Dermatol 2002; 118: 436-43. d’épidermolyse staphylococcique et le la dégradation de la desmogléine 1, ce 8. Descargues P, Deraison C, Bonnart C, et al. Spink5- pemphigus foliacé, dans lesquels la des- qui fragilise les desmosomes et entraîne deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease mogléine 1 est la cible à la fois de la pro- un défaut de l’adhérence de la couche hyperactivity. Nat Genet 2005; 37: 56-65. téase à sérine staphylococcique ETA et cornée à l’épithélium sous-jacent. La 9. Ishida-Yamamoto A, Deraison C, Bonnart C, et al. d’auto-anticorps anti-desmogléine 1. perte de la barrière cutanée entraîne une LEKTI is localized in lamellar granules, separated from KLK5 and KLK7, and is secreted in the -/- Les souris Spink5 présentent aussi des déshydratation sévère et facilite la extracellular spaces of the superficial stratum anomalies majeures de la différenciation pénétration des pathogènes et des aller- granulosum. J Invest Dermatol 2005; 124: 360-6. 10. Madison KC. Barrier function of the skin: «la raison terminale de l’épiderme mises en évi- gènes chez les patients. Nos résultats d’être» of the epidermis. J Invest Dermatol 2003; dence lorsque la peau des souris nou- permettent d’envisager dès à présent le 121: 231-41.

2 M/S n° 10, vol. 20, octobre 2004 Annexe 6

Deraison C and Bonnart C, Robin A, Besson C, Briot A, Lacroix M and Hovnanian A KLK5 transgenic mice reproduce Netherton syndrome phenotype 37th Annual European Society for Dermatological Research, Septembre 2007, Zurich

181 182 KLK5 Transgenic mice reproduce Netherton syndrome phenotype

C. Deraison1 & C. Bonnart1, A. Robin1, C. Besson1, A. Briot1, M. Lacroix1 and A. Hovnanian1*

1 INSERM U563, Toulouse, France *contact email: [email protected]

Skin homeostasis requires a tight control of the proteinase/inhibitor balance. LEKTI is a 15-domain serine protease inhibitor whose defective expression causes the severe autosomal recessive ichthyosiform skin condition, Netherton syndrome (NS)1. LEKTI (Lympho-Epithelial Kazal-Type Inhibitor) is encoded by SPINK5 (Serine Protease Inhibitor Kazal -Type 5)2. LEKTI is a key regulator of epidermal proteases and we have shown that Spi nk5–/– mice displ ay enhanced epider mal pr otease activity, incl uding KLK5 (SCTE), KLK7 (SCCE) and the newly identified elastase 2 (see poster # 435). These proteolytic hyperactivities resulted in desmosomal protein degradation (desmoglein-1 and desmopl akin) and accelerated pr oteolytic-processing of filaggrin3. In order to document the consequences of unregulated KLK5 activity in the terminal differentiated layers of the epidermis, we have developed a tissue-specific hKLK5 ( human form of KLK5 cDNA) transgenic mice ( TghKLK5) in which hKLK5 expression is under the control of the hum an invol ucrin promoter4.

a. Representation of the transgenic expression vector

Inv exon 1 SV 40 intron SV 40 polyA Figure 1 - Over-expression of active hKLK5 in suprabasal layer of mice epider mis hKLK5 cDNA a. Human KLK5 cDNA was fused to the FLAG epitope at its 3’ end pr ior to be cloned downstream of the regulator y sequences of the human involucrin pr omoter4. The construction was microinjected into pronuclei of fertilized Inv promoter Inv intron 1 FLAG SalI NotI NotI SalI mouse (F1 from C57Bl/6xCBA) oocytes. The embryos were implanted in the oviducts of pseudopregnant females 5 kb and allowed to develop to term. The transgenic mice were discriminated from wt animals by PCR using primers specific for the SV 40 intron and the FLAG epitope. Eight transgenic mice were obtained. b. KLK5 c. Protease activity b. Anti-KLK5 staining showed a restricted distribution of this protease at the GR-SC interface in wt epidermis. hKLK5 SC KLK5 staining was incr eased and extended to suprabasal cells and stratum corneum in the Tg epidermis. GR SC GR c. In situ zymography of serine protease activity, at pH8, showed an increased activity in the stratum corneum which extended to the granular layer of the Tg epidermis compar ed to wt epidermis. This result demonstrated that the heterologous hKLK5 was functional in the TghKLK5 mice epidermis. GR: granular layer; SC: stratum corneum

WT Tg wt Tg

a. Most severe: died at birth Longer living Tg-mice Figure 2 - The severity of the TghKLK5 mice phenotype correlates with transgene expression level a. Of the eight transgenic mice, five presented a wt Tg-1 Tg-2 Tg-3 Tg-4 Tg-5 dramatic skin fragility with superficial peeling and died Erythematous "Collodion" like NS like, died after 5 days Scaling, died after 10 days Peeling,euthanized at 115 days shortly after birth. Three other transgenic mice lived for a few days, developed exfoliative erythroderma and + hKLK5 expression level - scaling predominant on the back and the tail and displayed a permeability barrier defect (increased b. FLAG epitope TEWL, data not shown). b. Immunohistology analysis of the FLAG epitope revealed that transgene expression was discontinuous (patchy) and that the intensity of transgene expression correlated with phenotype severity. wt Tg-1 Tg-2 Tg-3 Tg-4 Tg-5

a Figure 3 - Desmoglein-1 and Filaggrin expression is reduced and promotes stratum corneu m detachment in TghKLK 5 hf a. Despite the heterogeneity of the TghKLK5 mice Conclusion Tg phenotype, these animals shared common histological In order to decipher the implication of each proteinase which is traits. Compared to wt, TghKLK5 epidermis was overactive in Spink5-/-, we have genetically modified mice b hyperplastic (acanthosis) and showed invagination into e SC SC which specifically over-express hKLK5 in the suprabasal layers the dermis (papillomatosis). Intercellular separation at of the epidermis. Our results show that KLK5 is directly the GR-SC interface or in the GR layer was observed. GR GR involved in the following features of the Netherton syndrome No ker atohyalin granule could be seen in the GR layer phenotype: of TghKLK5 mice. Hair follicle (hf) were significantly wt Tg wt Tg reduced in number and disorganized. • Asymetrical separation of desmosomes and b. Ultrastructure analysis showed asymetrical decreased Dsg-1 detection. All transgenic TghKLK5 mice Dsg-1 desmosome splits at the GR-SC interface in TghKLK5 Filaggrin showed scaling and stratum corneum detachment. The c epidermis (arrow head). c. Remarkably, the cell f cell-cell detachment occurred at the granular layer and dissociation was correlated with a marked reduction of stratum corneum interface as illustrated by the presence desmoglein-1 (Dsg-1) staining in suprabasal epidermis of split desmosomes. This establishes that KLK5 has a compared to wt. d. In contrast, Dsg-3 was dir ect role in the desquamation process. overexpressed in TghKLK5 epidermis. wt Tg wt Tg • Abnormal keratohyalin granules and reduced filaggrin e. Ultrastructural analysis showed a reduction in size immunostaining. Filaggrin expression and ker atohyalin Dsg-3 of keratohyalin granules (yellow arrow) which contain Loricrin granules were reduced in TghKLK5 mice epidermis filaggrin precursors. f. This observation correlated with suggesting that KLK5 could modulate the processing of hKLK5 d a markedly decreased filaggrin staining in Tg g pro-filaggrin into filaggrin monomers. This late terminal epidermis. g. In contrast, loricrin expression was not differentiation marker is the result of a complex proteolytic significantly different between wt and Tghklk 5 . Tg processing of profilaggrin by several enzymes. Our data suggest that KLK5 could play a direct role in pro-filaggrin wt Tg wt Tg processing, or could indir ectly activate proteases involved in filaggr in processing such as matriptase. • Abnormal hair follicle formation. In normal epidermis, KLK5 is expressed in the inner root sheath of the hair Tg-5 Tg-5 follicle. TghKLK5 mice showed hair growth retardation. Hair follicle were rare and disorganized . These anomalies are wt wt reminiscent of poor and sparse hair growth seen in Spink5-/ - mice and in individuals with Netherton syndrome. Tg-5 Tg-5 Tg-5 6 days 9 days 30 days 43 days 113 days Fine scaling Failure to thrive Localized scaling Pruritus and scratching Erosive and crusty lesions In conclusion, TghKLK5 mice reproduce the main features of Hair growth retardation Sp ink5 -/- mice. In contrast to the previously described Figure 4 - Phenotypic evolution of the less severe TghKLK5 mouse transgenic mice overexpressing hKLK7 which developed signs of itch with increasing age (7-8 weeks) with no stratum cor neum 5 This mouse (Tg-5) expressed the transgene at lower level and showed erythema and scaling predominant on the back few days after defect nor filaggrin anomaly , these results show that KLK5 birth. Hair growth was delayed. Scaling became more pronounced and was associated with failure to thrive. Subsequently, the mouse initiates the proteolytic cascade involved in the NS phenotype and identify KLK5 as a major t arget of LEKTI. showed signs of itch and developed alopecic lesions on the back resulting from intense scratching. Despite skin care, continuous phenotype and identify KLK5 as a major t arget of LEKTI. scratching resulted in chronic and extensive er osions and crusts.

REF EREN CE S 1. Chavanas S, Bodemer C, Rochat A, Hamel-Teillac D, Ali M, Irvine AD, Bonafe JL, Wilkinson J, Taieb A, Barrandon Y, Harper JI, de Prost Y, Hovnanian A. Mutations in SPINK5, encoding a serine protease i nhibitor, c ause Neth erto n s yndrome. Nat. Genet. (2000), 25(2):1 41-2. 2. Magert HJ, Standker L., Kreutzmann P., Zucht HD, Reinecke M., Sommerhoff CP, Fritz H., and Forssmann, WG. LEKTI, A novel 15-domain type of human serine. J. Biol. Chem. ( 1999), 274(31): 21499-502. 3. Descargues P, Deraison C, Bonnart C, Kreft M, Kishibe M, Ishida-Yamamoto A, Elias P, Barrandon Y, Zambruno G, Sonnenberg A, Hovnanian A. Spink5-deficient mice mimic Netherton syndrome through degradation of desmoglein 1 by epidermal protease hyperactivity. Nat Genet. (2005);37(1):56-65. 4. Carroll JM, Albers KM, Garlick JA, Harrington R, Taichman LB. Tissue- and stratum-specific expression of the human involucrin promoter in transgenic mice. PNAS (1993), 90, 10270-10274 5. Ny A, Egelrud T. Epidermal hyperproliferation and decreased skin barrier function in mice overexpressing Statum corneum chymotryptic enzyme. Acta Derm. Venereol. (2004), 84, 18-22

ABSTRACT

Functional studies of LEKTI and its new target, pancreatic

elastase 2

Netherton syndrome (NS, OMIM 256500), is a severe autosomal recessive skin condition characterized by congenital erythoderma, a specific hair shaft defect (Trichorrhexis invaginata) and a broad range of atopic manifestations. In 2000, we identified SPINK5 (Serine protease inhibitor Kazal type 5) as the defective gene in NS. SPINK5 normally encodes LEKTI (Lympho-epithelial Kazal type inhibitor), which is expressed in the granular layer of the epidermis. In order to understand the role of LEKTI in skin homeostasis, we undertook structural and functional studies. We showed that LEKTI is expressed as three high molecular weight precursors rapidly cleaved by furin in the intracellular compartment of keratinocytes prior to its secretion. Proteolytic maturation of LEKTI gives birth to a panel of proteolytic fragments carrying their own inhibitory capacity profile against epidermal kallikreins (KLK) 5, 7 and 14. In order to investigate the role of LEKTI in vivo, and to understand the pathophysiological events underlying NS, we have genetically engineered mice with a targeted disruption of Spink5. Spink5 deficient newborn mice suffer from severe skin erosions due to excessive desmosomal component cleavage by unregulated KLK5 and KLK7 at the granular layer – stratum corneum interface. In addition, we have identified by mass spectrometry a new epidermal proteinase which is hyperactive in absence of LEKTI, pancreatic elastase 2 (Ela2). In order to know its biological role and to investigate its specific contribution to the development of NS phenotype, we engineered Ela2 transgenic mice. The study of these mice suggests that Ela2 is involved in several aspects of NS phenotype, and thus identifies a novel potential therapeutic target for the treatment of the disease.

183 AUTEUR : Chrystelle Bonnart

TITRE Etude fonctionnelle de LEKTI et de sa nouvelle cible, l’élastase 2 pancréatique

DIRECTEUR DE THESE : Pr. Alain Hovnanian

LIEU ET DATE DE SOUTENANCE : Hôpital Purpan, Toulouse, le 20 Novembre 2007

RESUME

Le syndrome de Netherton (SN, OMIM 256500) est une maladie génétique cutanée rare sévère de l’enfant, transmise selon le mode autosomique récessif, caractérisée par une érythrodermie desquamative congénitale, une dysplasie pilaire spécifique et une atopie sévère. Notre équipe a identifié le gène dont les mutations sont responsables de la maladie, SPINK5, qui code pour LEKTI, un inhibiteur de protéase à sérine exprimé dans la couche granuleuse de l’épiderme. Afin de mieux comprendre la fonction de LEKTI dans l’homéostasie épidermique, nos travaux ont porté sur la caractérisation structurale et fonctionnelle de LEKTI. Nous avons montré que LEKTI était produit sous la forme de trois précurseurs de haut poids moléculaire rapidement clivés dans les kératinocytes sous l’action protéolytique de la furine. Cette protéolyse scinde les précurseurs en de nombreux fragments qui présentent des capacités d’inhibition spécifiques vis-à-vis des kallikréines épidermiques (KLKs) 5, 7 et 14. Afin de mieux comprendre la physiopathologie du SN, nous avons généré un modèle murin Spink5-/-. Les nouveaux-nés KO présentent des érosions cutanées étendues résultant d’une dégradation excessive des composants des jonctions intercellulaires, les cornéodesmosomes, due à l’hyperactivité de KLK5 et KLK7. Nous avons identifié par spectrométrie de masse une troisième protéase hyperactive, l’élastase 2 pancréatique (Ela2), dont l’expression épidermique n’était pas connue. Afin de connaître son rôle biologique et son implication spécifique dans le développement du phénotype SN, nous avons généré des souris transgéniques pour Ela2. L’analyse de ces souris révèle que l’Ela2 joue un rôle essentiel dans la formation de la barrière cutanée et est impliquée dans le développement de nombreux aspects phénotypiques du SN. Ce travail identifie ainsi une nouvelle cible thérapeutique potentielle pour le traitement de cette maladie orpheline.

MOTS-CLES : Maladie génétique rare, syndrome de Netherton, épiderme, protéases, inhibiteurs de protéase

DISCIPLINE : Physiopathologie moléculaire, cellulaire et intégrée

INTITULE ET ADRESSE DU LABORATOIRE CHU Purpan Unité U563 CPTP Laboratoire du Pr Alain Hovnanian Département de Génétique fonctionnelle des maladies des épithéliums Bâtiment B – étage 5 Avenue de Grande Bretagne 31059 Toulouse Cedex 03

184