Strain-specific Detection of Kimchi Starter Leuconostoc mesenteroides WiKim33 using Multiplex PCR Moeun Lee, Jung Hee Song, Ji Min Park, Ji Yoon Chang* Advanced Process Technology and Fermentation Research Group, World Institute of Kimchi
Abstract
Leuconostoc spp. are generally utilized as kimchi starters, because these strains are expected to have beneficial effects on kimchi fermentation, including improvement of sensory characteristics. Here, we developed a detection method for verifying the presence of the kimchi starter Leuconostoc mesenteroides WiKim33, which is used for control of kimchi fermentation. A primer set for multiplex polymerase chain reaction was designed based on the nucleotide sequence of the plasmids in strain WiKim33, and their specificity was validated against 45 different strains of Leuconostoc spp. and 30 other strains. Furthermore, the starter strain consistently tested positive, regardless of the presence of other bacterial species in starter kimchi during the fermentation period. Our findings showed that application of a strain-specific primer set for strain WiKim33 presented a rapid, sensitive, and specific method for detection of this kimchi starter strain during natural kimchi fermentation. Key Words: Leuconostoc mesenteroides WiKim33, strain-specific primers, kimchi starter, multiplex polymerase chain reaction
I. Introduction maintenance. The majority of bacteria in kimchi can be cultured (Kim and Chun 2005); therefore, agar-plate Kimchi is fermented by lactic acid bacteria (LAB) at low culturing is typically used as a culture-dependent method for temperatures, ensuring proper ripening and preservation. For identifying and monitoring bacterial flora in samples. the manufacturing of commercial kimchi products, natural However, this method (plate culture method) requires a fermentation with unsterilized raw materials leads to the prolonged incubation time, uses a selective medium, and has growth of various microorganisms, making it difficult to the disadvantage that culture conditions must be specified. standardize the fermentation process. Natural fermentation Moreover, because the nutritional requirements and culture often results in final products exhibiting inconsistent product conditions of LAB strains are very similar, it is difficult to quality (Lee et al. 2015; Lee et al. 2018). Therefore, the use distinguish them from one another. Strain-specific identification of starter cultures is considered as an alternative to address was originally performed based on analysis of specific these problems (Jang et al. 2015; Kim et al. 2016). culture properties and has subsequently been achieved using Leuconostoc mesenteroides strains are some of the most DNA fingerprinting or enzyme-linked immunosorbent widely studied and commercialized strains in the kimchi assays with monoclonal antibodies. However, these methods manufacturing process. Although the inoculation of some are time-consuming and require experienced technicians starter strains can control kimchi fermentation, starter (Endo et al. 2012). dominance might change depending on the fermentation Polymerase chain reaction (PCR)-based methods for strain- conditions and based on various raw materials of kimchi. specific detection include random amplified polymorphic Consequently, a strain-specific identification system for the DNA-PCR, PCR-restriction fragment-length polymorphism, control and tracking of specific microorganisms (starter), and multiplex PCR, which are sensitive, selective, rapid, including verification of the presence of the strain in starter economical, and convenient (Juvonen et al. 2008; Maruo et kimchi, is a critical issue in terms of quality control and al. 2006). Among these methods, multiplex PCR can be used
*Corresponding author: Ji Yoon Chang, Advanced Process Technology and Fermentation Research Group, World Institute of Kimchi, Gwangju 61755, Republic of Korea Tel: +82-62-610-1765 Fax: +82-62-610-1853 E-mail: [email protected] Strain-specific detection of kimchi starter 209 to measure a large number of samples simultaneously, ethidium bromide. A 100-bp DNA ladder (Bioneer) was making it possible to distinguish between similar micro- used as a size marker. organisms (Kwon et al. 2005). A variety of Leuconostoc spp. have been identified in 3. Examination of sensitivity and specificity kimchi samples using molecular methods (Choi et al. 2003; The sensitivity of multiplex PCR was tested using a serial Kim et al. 2000). However, these methods are insufficient for dilution of Leu. mesenteroides WiKim33 prepared from detection of particular strains in kimchi. We have developed overnight cultures in MRS agar. The bacteria were serially Leu. mesenteroides WiKim33, which is used for the kimchi diluted in phosphate-buffered saline (PBS) or kimchi filtrate fermentation control. In this study, a strain-specific primer (early fermentation; pH 5.80; acidity: 0.32%). DNA was set was evaluated based on the complete genome sequence isolated from 1 mL of each dilution and subsequently tested of Leu. mesenteroides WiKim33 to provide future use in the using multiplex PCR. Specificity tests were performed by kimchi industry. colony PCR with 45 Leuconostoc spp. and 30 other strains.
II. Material and Methods 4. Preparation of kimchi Vegetables, including cabbage, and other seasonings were 1. Leu. mesenteroides WiKim33-specific primer design obtained from local grocery stores. Kimchi samples were The complete genome sequence was obtained using a categorized depending on the addition of Leu. mesenteroides PacBio RSII instrument (Pacific Biosciences, Menlo Park, WiKim33 (1×107 CFU/g kimchi) as a starter culture, and CA, USA). A total of 189,111 reads (mean read length: each sample was labeled as CTL (kimchi without starter) or 11,305 bp) were obtained, and four contigs were formed (1 S (kimchi with starter). The temperature during the entire chromosomal DNA and 3 plasmid DNA). Four pairs of fermentation process was maintained at 2.0±0.5, 0.0±0.5, primer sets were designed based on the plasmid DNA 6.0±0.5, or 10.0±0.5oC for 84 days. sequence of strain WiKim33 using the National Center for Biotechnology Information Primer-Blast Tool (http://www. 5. pH and acidity ncbi.nlm.nih.gov/tools/primer-blast/), and Macrogen, Ltd. Kimchi samples (500 g) were blended using a hand (Seoul, Korea) synthesized all primers used in this study. The blender (HR1372/90; Philips, Amsterdam, Netherlands) and primer sequences are shown in Table 2 along with their filtered through sterilized gauze before their chemical corresponding GenBank accession numbers (CP021492- characteristics were analyzed. The pH values of the kimchi CP021494) and predicted product sizes. filtrates were determined using a pH meter (Orion 3-Star; Thermo Fisher Scientific, Waltham, MA, USA). The kimchi 2. DNA extraction and amplification by multiplex PCR filtrate was then titrated with 0.1 N NaOH to pH 8.3 to The kimchi samples were ground and filtered twice determine the titratable total acidity, which was estimated in through sterilized gauze, and genomic DNA was extracted previous study (Lee et al. 2018). from the kimchi soup using a genomic DNA prep kit for bacteria (Qiagen, Valencia, CA, USA) according to manufacturer 6. Total viable bacteria, LAB counts, and WiKim33 instructions. The 20-µL reaction volume contained 10 ng population ratio in kimchi samples genomic DNA, 1×PCR buffer, dNTP mixture (2.5 mM Microorganisms in the kimchi liquids were counted each), and 0.5 U of AccuPower Multiplex PCR DNA according to a standard plate-count procedure and the polymerase (Bioneer, Daejeon, Korea). All multiplex PCRs microbial counts in the kimchi samples were determined as were performed in a thermal cycler (Bio-Rad, Hercules, CA, the number of CFUs per milliliter. Total viable bacteria, and USA) with the following protocol: pre-incubation at 95oC for LAB enumeration were carried out as described previously 10 min, followed by 35 cycles of denaturation at 95oC for (Lee et al. 2017). The colonies formed on the agar plates 30 s, annealing at 60oC for 30 s, and extension at 72oC for were applied to a WiKim33-specific detection system to 1 min, with a final elongation at 72oC for 5 min. PCR count WiKim33 colonies. The ratio of WiKim33 cells to products were analyzed by agarose gel electrophoresis, total viable bacterial is shown as the starter domination which was performed on 1.2% (w/v) UltraPure Agarose gels value. (Invitrogen, Carlsbad, CA, USA) containing 0.1 µg/mL 210 韓韓韓韓韓韓韓韓韓韓 Vol. 34, No. 2 (2019)
III. Results and Discussion
1. Design of the multiplex primer set for Leu. mesenteroides WiKim33 detection Multiplex PCR primers (4 sets) for Leu. mesenteroides
Summarya of bacterial strains used in the PCR specificity test.
Name No. strains (n=75) Leuconostoc spp. 45 Lactobacillus spp. 17 Agarose gel electrophoresis of multiplex PCR prod- Lactococcus spp. 3 ucts obtained from pure cultures of Leuconostoc mesen- Pediococcus spp. 2 teroides WiKim33 in MRS broth. Lane M, size marker (100-bpladder); lane 1, primer 1; lane 2, primer 2; Weissella spp. 8 lane 3, primer 3; lane 4, primer 4; lane 5, integrated aFor a detailed description of each strain, see Supplementary Table primers. S1.
Specificity test of the designed primer set. Lane M, size marker (100-bp ladder); lane 1, WiKim33; lanes 2-45, Leu- constoc spp.; lanes 46-76, other strains . Strain-specific detection of kimchi starter 211
WiKim33 were designed from plasmid base sequences. The strain-specific primer sets yielded four amplicons at each of the expected sizes (585, 703, 884, and 1217 bp)
. Generally, Multiplex PCR targets the chromosomal 16S rRNA gene (Grahn et al. 2003). However, in the case of LAB, the homology between chromosomal DNA sequences among species is so high that it is difficult to identify a specific base sequence capable of distinguishing a specific strain (Collins et al. 1991). Plasmids are DNA sequences that can be propagated independently from the chromosome in a bacterial cell (Cohen et al. 1973; Tenover et al. 1995). Although plasmids are more unstable than chromosomes, passage stability of the plasmid was confirmed by PCR with the primer set after 70 consecutive subcultures, and four strain-specific amplicons were clearly detected (data not
Determination of the detection limit of the WiKim33- specific primer set. (A) Dilution with distilled water at shown). the indicated concentrations. Lane M, size marker The specificity of the designed primer set was validated (100-bpladder); lanes 1-10, 1.8×109 CFU/mL (277 ng against 45 Leuconostoc spp. and 30 other LAB strains. of DNA) to 1.8×100 CFU/mL (0.000277 pg of DNA). (B) Although seven Leuconostoc spp. produced single amplicons Diluted with kimchi filtrate (10 ng of DNA for each sam- ple). Lane M, size marker (100-bp ladder); lanes 1-10, in the PCR product of 884 bp or 585 bp, none of the strains 9 0 kimchi filtrate with 1.8×10 CFU/mL to 1.8×10 CFU/mL produced four amplicons simultaneously. Moreover, 30 non- of WiKim33. Leuconostoc spp. strains did not produce any amplicons
. These results indicated that the designed primers were highly specific for amplicons were present. As shown in
, strain the target species. WiKim33 could be detected clearly after 0- to 5-fold dilutions (with PBS) or 4- to 5-fold dilutions (with kimchi 2. Detection limit of the designed primer set filtrate). The sensitivity of the detection primer set for the The detection limit of the WiKim33-specific PCR method WiKim33 strain was estimated at 1.8×104 CFU/mL (2.77 pg was measured using serial dilutions in PBS or kimchi filtrate. DNA) for the PBS-diluted solution and 1.8× 105 CFU/mL Leu. mesenteroides WiKim33 (undiluted solution: 1.8×109 for the diluted kimchi filtrate. Therefore, we assumed that CFU/mL) was serially diluted 10-fold, and each dilution was strain WiKim33 was present at more than the detection limit subjected to multiplex PCR to determine whether the four when applied to kimchi.
Multiplex PCR primer sets used in this study
No. Description Sequence (53) Target site a Amplicon size (bp) Referenceb Forward AGGTTCAGGTATGAATAC AATAGCA 1 19,667~20,252 585 CP021493 Reverse AGTGACGGTTTGCATAGCCA Forward AGTACATTCCTTAAATCAGGGGCT 2 12,989~13,692 703 CP021492 Reverse AGCACATAGTCTTCCACGGC Forward CCTGTTGCAGCGGGTATTCT 3 13,672~14,556 884 CP021492 Reverse TCGAGGCTAATATGTCAGTCTTCC Forward CAGGATTTGGCAGAGAGTCCA 4 17,467~18,684 1217 CP021494 Reverse GATGACGGTCAGCCCCTTAG aEach target site indicates the start and end point of the sequences annealing the forward and reverse primer, respectively. All sequences were numbered based on the whole-genome sequence of Leu.mesenteroides WiKim33. bFrom the sequence data of the Leu.mesenteroides WiKim33 plasmid (GeneBank accession nos. CP021492-CP021494). 212 韓韓韓韓韓韓韓韓韓韓 Vol. 34, No. 2 (2019)
Fermentation characteristics of starter kimchi containing Leuconostoc mesenteroides WiKim33. (A) pH profiles and titratable acidity. (B) Total viable bacteria and LAB counts of kimchi according to storage temperature.
3. Application of WiKim33-specific PCR for sensing To evaluate the possibility of applying the strain-specific starter-inoculated kimchi detection system in the field, kimchi was manufactured and LAB successions can differ depending on fermentation stored at different temperatures. Specific PCR was performed temperature, despite the use of the same raw materials and for kimchi, including the WiKim33 strain, and products were preparation methods (Jung et al. 2014). Moreover, kimchi is stored at 2, 0, 6, and 10oC for 8 weeks. The physicochemical generally prepared at room temperature, immediately cooled (pH and acidity) microbial enumeration (total viable bacteria to below 8oC, and then distributed. Fermentation occurs and LAB) showed different fermentation aspects according during distribution or the period in which the food is kept to fermentation temperature . under refrigeration at the market (4oC) (Eom et al. 2007), and The starter WiKim33 strain-population ratios varied consumers can store kimchi at low temperatures (2 or 0oC) according to temperature conditions, but more than 105 CFU/ after purchase. Therefore, it is necessary to accurately detect mL was detected during the entire fermentation period only the starter strain in various microbial-community . Moreover, in Figure 3A, which shows the structures according to various temperature conditions. number of WiKim33 strain against the total viable of Strain-specific detection of kimchi starter 213
Application of kimchi to the WiKim33-specific detection system. (A) Analysis of the dominance ratio by measuring total viable bac- teria and WiKim33 counts in kimchi. (B) Application of the multiplex PCR system to starter kimchi.
bacteria, the population ratio of WiKim33 strain was Although, species specific detection methods have been gradually decreased as the fermentation progresses. Our reported in food products (Sheng et al. 2018), the specialty of multiplex PCR system did not show amplicons for kimchi our assay was strain-specific and was sufficiently sensitive to without the starter in each temperature condition (control kimchi products. kimchi) ; however, for kimchi supplemented In addition, when this detection system is applied to the with the WiKim33 starter strain, the four different PCR plate culture, precise quantitative analysis of living WiKim33 amplicons were clearly detected at different fermentation- strain actually in kimchi is possible and it is useful to monitor storage temperatures during the entire fermentation period the inoculated starter strain by calculating the dominance rate despite the complex microbial composition . for the total viable bacteria. 214 韓韓韓韓韓韓韓韓韓韓 Vol. 34, No. 2 (2019)
Bacterial strains used in the PCR specificity test
IV. Summary and Conclusion monitoring of the starter. The results of this study suggested that future studies are required to quantify In this study, we developed a strain-specific primer set populations of the WiKim33 strain in complex microbiota based on the complete genome sequence of Leu. mesenteroides compositions. WiKim33 for applications in the kimchi industry. Our Multiplex PCR detection system allows rapid identification Acknowledgments of and high specificity for only specific strain in kimchi in a single reaction. This primer set could be used to detect This research was supported by a grant from the World the WiKim33 strain specifically in kimchi samples, Institute of Kimchi (KE1901-1-1) funded by the Ministry of establishing a novel tool for quality management through Science and ICT, Republic of Korea. 216 韓韓韓韓韓韓韓韓韓韓 Vol. 34, No. 2 (2019)
Conflict of Interest 125(2):162-169 Kim HY, Bong YJ, Jeong JK, Lee S, Kim BY, Park KY. 2016. No potential conflict of interest relevant to this article Heterofermentative lactic acid bacteria dominate in was reported. Korean commercial kimchi. Food Sci. Biotechnol., 25(2):541-545 References Kim J, Chun J, Han HU. 2000. Leuconostoc kimchii sp. nov., a new species from kimchi. Int. J. Syst. Evol. Microbiol., 50 Pt 5:1915-1919 Choi IK, Jung SH, Kim BJ, Park SY, Kim J, Han HU. 2003. Kim M, Chun J. 2005. Bacterial community structure in kimchi, a Novel Leuconostoc citreum starter culture system for the Korean fermented vegetable food, as revealed by 16S fermentation of kimchi, a fermented cabbage product. rRNA gene analysis. Int. J. Food Microbiol., 103(1):91-96 Antonie Van Leeuwenhoek, 84(4):247-253 Kwon HS, Yang EH, Lee SH, Yeon SW, Kang BH, Kim TY. Cohen SN, Chang AC, Boyer HW, Helling RB. 1973. 2005. Rapid identification of potentially probiotic Construction of biologically functional bacterial plasmids Bifidobacterium species by multiplex PCR using species- in vitro. Proc. Natl. Acad. Sci. U S A, 70(11):3240-3244 specific primers based on the region extending from 16S Collins MD, Rodrigues U, Ash C, Aguirre M, Farrow JAE, rRNA through 23S rRNA. FEMS microbiol. lett., Martinez-Murcia A, Phillips BA, Williams AM, 250(1):55-62 Wallbanks S. 1991. Phylogenetic analysis of the genus Lee ME, Jang JY, Lee JH, Park HW, Choi HJ, Kim TW. 2015. Lactobacillus and related lactic acid bacteria as Starter cultures for kimchi fermentation. J. Microbiol. determined by reverse transcriptase sequencing of 16S Biotechnol., 25(5):559-568 rRNA. FEMS Microbiol. Letters, 77(1):5-12 Lee ME, Song JH, Jung MY, Lee SH, Chang JY. 2017. Large- Endo A, Aakko J, Salminen S. 2012. Evaluation of strain-specific scale targeted metagenomics analysis of bacterial ecological primers for identification of Lactobacillus rhamnosus GG. changes in 88 kimchi samples during fermentation. Food FEMS Microbiol. Lett, 337(2):120-125 Microbiol., 66:173-183 Eom HJ, Seo DM, Han NS. 2007. Selection of psychrotrophic Lee ME, Song JH, Lee SH, Jung MY, Chang JY. 2018. Effect of Leuconostoc spp. producing highly active dextransucrase seasonal production on bacterial communities in Korean from lactate fermented vegetables. Int. J. Food Microbiol., industrial kimchi fermentation. Food Control, 91:381-389 117(1):61-67 Maruo T, Sakamoto M, Toda T, Benno Y. 2006. Monitoring the Grahn N, Olofsson M, Ellnebo-Svedlund K, Monstein HJ, cell number of Lactococcus lactis subsp. cremoris FC in Jonasson J. 2003. Identification of mixed bacterial DNA human feces by real-time PCR with strain-specific contamination in broad-range PCR amplification of 16S primers designed using the RAPD technique. Int. J. Food rDNA V1 and V3 variable regions by pyrosequencing of Microbiol., 110(1):69-76 cloned amplicons. FEMS Microbiol. Lett, 219(1):87-91 Sheng J, Tao T, Zhu X, Bie X, Lv F, Zhao H, Lu Z. 2018. A Jang JY, Lee ME, Lee HW, Lee JH, Park HW, Choi HJ, Pyun multiplex PCR detection method for milk based on novel YR, Kim TW. 2015. Extending the shelf life of kimchi primers specific for Listeria monocytogenes 1/2a with Lactococcus lactis strain as a starter culture. Food serotype. Food control, 86:183-190 Sci. Biotechnol., 24(3):1049-1053 Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Jung JY, Lee SH, Jeon CO. 2014. Kimchi microflora: history, Persing DH, Swaminathan B. 1995. Interpreting current status, and perspectives for industrial kimchi chromosomal DNA restriction patterns produced by production. Appl. Microbiol. Biotechnol., 98(6):2385- pulsed-field gel electrophoresis: criteria for bacterial strain 2393 typing. J. Clin. Microbiol., 33(9):2233-2239 Juvonen R, Koivula T, Haikara A. 2008. Group-specific PCR- RFLP and real-time PCR methods for detection and Received March 21, 2019; revised April 19, 2019; accepted tentative discrimination of strictly anaerobic beer-spoilage April 22, 2019 bacteria of the class Clostridia. Int. J. Food Microbiol.,
