DOCSLIB.ORG

Chromosomal Contact Permits Transcription Between Coregulated Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chromosomal Contact Permits Transcription Between Coregulated Genes Chromosomal Contact Permits Transcription between Coregulated Genes Stephanie Fanucchi,1 Youtaro Shibayama,1 Shaun Burd,1 Marc S. Weinberg,3,4 and Musa M. Mhlanga1,2,* 1Gene Expression and Biophysics Group, Synthetic Biology Emerging Research Area, Biosciences Unit, Council for Scientific and Industrial Research, Pretoria, Gauteng 0001, South Africa 2Unidade de Biofı´sica e Expressa˜ o Gene´ tica, Instituto de Medicina Molecular, Faculdade de Medicina, Universidade de Lisboa, Lisboa, 1649-028 Portugal 3Antiviral Gene Therapy Research Unit, Department of Molecular Medicine and Haematology, School of Pathology, Faculty of Health Sciences, University of the Witwatersrand, Johannesburg, Gauteng 2193, South Africa 4Department of Molecular and Experimental Medicine, The Scripps Research Institute, La Jolla, CA 92037, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.cell.2013.09.051 SUMMARY 2012). These highly sensitive assays can target either DNA or nascent mRNA and have revealed the colocalization between Transcription of coregulated genes occurs in the FISH foci in a fraction of the population (Schoenfelder et al., context of long-range chromosomal contacts that 2010; Papantonis et al., 2010). This suggests that a subset of form multigene complexes. Such contacts and cells within the population may be enriched for specific chromo- transcription are lost in knockout studies of tran- somal interactions. Chromosomes are large and constrained in scription factors and structural chromatin proteins. their ability to roam the entire nuclear volume (Strickfaden To ask whether chromosomal contacts are required et al., 2010; Barbieri et al., 2013). Thus, it is reasonable to surmise that the topological arrangements after each cellular for cotranscription in multigene complexes, we division shuffle chromosomal proximities such that their three- devised a strategy using TALENs to cleave and dimensional (3D) arrangements are altered in one-dimensional disrupt gene loops in a well-characterized multigene (1D) space (Gibcus and Dekker, 2013). This may lead to every complex. Monitoring this disruption using RNA FISH cell in the population possessing unique spatial arrangements and immunofluorescence microscopy revealed that of its chromosomes (Orlova et al., 2012). perturbing the site of contact had a direct effect on Enhancer-promoter interactions utilize chromatin looping to transcription of other interacting genes. Unex- trigger dynamic changes in transcription initiation (Osborne pectedly, this effect on cotranscription was hierar- et al., 2004; Deng et al., 2012). An example of this is the well- chical, with dominant and subordinate members of established model between the locus control region (LCR) and b the multigene complex engaged in both intra- and the promoter of the -globin gene (Osborne et al., 2004). In a tis- interchromosomal contact. This observation reveals sue-specific manner, the LCR has been shown to physically con- tact the promoter of the b-globin gene and initiate transcription the profound influence of these chromosomal con- (Deng et al., 2012). These LCR-mediated chromosomal interac- tacts on the transcription of coregulated genes in a tions have been shown to result in variability in b-globin gene multigene complex. transcript levels or variegated gene expression across the pop- ulation (Noordermeer et al., 2011). In an otherwise identical pop- INTRODUCTION ulation of cells, presumably through chromosomal interactions, such ‘‘jackpot’’ cells display higher levels of b-globin transcrip- Transcription is replete with proximal and distal chromatin loop- tion (Noordermeer et al., 2011). Accordingly, the specific set of ing interactions whose formation represents the basic organizing chromosomal interactions (and consequent gene expression principle of nuclear architecture and gene activity (Miele and that may depend on LCR-mediated interactions) will vary Dekker, 2008; Palstra et al., 2008; Tan-Wong et al., 2012). between cells across the population (Strickfaden et al., 2010). Loop-mediated chromosomal contacts are usually identified This heterogeneity reveals the absolute requirement of single- on a genome-wide scale using population-based ‘‘chromosome cell analysis in global interactome and gene loop studies. conformation capture’’ (3C) technologies (Dekker et al., 2002; Looping also brings distal genes into close proximity, enabling Fullwood et al., 2009; Lieberman-Aiden et al., 2009; Li et al., chromosomal contact in ‘‘multigene complexes’’ at a single 2012). Analyses of 3C-based data reveal a large heterogeneity focus of multiple RNA polymerases (Schoenfelder et al., 2010; in global chromatin interactions (Fullwood et al., 2009; Noorder- Papantonis et al., 2012; Li et al., 2012). Numerous studies have meer et al., 2011; Li et al., 2012). Therefore, interacting DNA demonstrated that the formation of loop-mediated contact coin- elements identified by 3C-based technologies are verified at cides with alterations in gene expression (Spilianakis et al., 2005; the single-cell level using fluorescent in situ hybridization Apostolou and Thanos, 2008; Fullwood et al., 2009; Schoen- (FISH) assays (Schoenfelder et al., 2010; Papantonis et al., felder et al., 2010). Indeed, chromosomal contacts in multigene 606 Cell 155, 606–620, October 24, 2013 ª2013 Elsevier Inc. complexes appear to be the main modality of transcription in engaged in intrachromosomal contact at distances >48 Mbp, metazoan cells, as they are associated with >95% of transcrip- as well as interchromosomal interactions. Furthermore, restora- tional activity (Li et al., 2012; Sandhu et al., 2012). In a compara- tion of a disrupted gene loop re-established both chromosomal ble manner to enhancer-promoter interactions, specific chro- contacts and transcription of interacting genes in a sequence- matin interactions in multigene complexes are detected in a independent manner. The unexpected hierarchical organization subset of cells within the population (Schoenfelder et al., 2010; within the TNFa-induced multigene complex reveals the unprec- Papantonis et al., 2010). Genome-wide chromatin interaction edented level of influence of these chromosomal contacts on the analysis with paired end tags (ChIA-PET) uncovered a multigene transcription of coregulated genes in a multigene complex. complex, including the GREB1 locus and three other genes (Li et al., 2012). Of the four interacting genes, only GREB1 transcrip- RESULTS tion is activated by the estrogen receptor-a (ERa)(Li et al., 2012). Intriguingly, despite the fact that this multigene complex may not The Transcriptional Response of Coregulated Genes in a assemble in every cell in the population, siRNAs targeting ERa Multigene Complex Is Asymmetric disrupted all four interacting genes (Li et al., 2012). Therefore, TNFa has been shown to rapidly and synchronously shape the even though these chromosomal contacts may only occur in a transcriptional response in early passage human umbilical vein fraction of the population, they clearly play a significant role in endothelial cells (HUVECs) by systematically inducing the forma- gene regulation. Moreover, this data supports a model of syner- tion of a large variety of different multigene complexes (Papan- gistic transcription in which chromosomal contact influences the tonis et al., 2012). Interacting genes in TNFa-induced multigene transcription of the interacting genes. This would connote that complexes are activated by NF-kB(Papantonis et al., 2010). The the topological framework for transcriptional regulation is phys- SAMD4A, TNFAIP2, and SLC6A5 genes associate in a NF-kB- ical contact via chromosomal looping in multigene complexes. dependent multigene complex (Figure 1A), which has been Current siRNA and 3C-based experimental approaches extensively characterized by 3C, 4C (3C capture-on-chip), tiling cannot be applied to multigene complexes in which all interact- microarray, and FISH and thus is an ideal model to interrogate ing genes are activated by the same transcription factor. Tumor the role that chromosomal contacts play in cotranscription at a necrosis factor alpha (TNFa) has been shown to induce the for- single-cell level (Wada et al., 2009; Papantonis et al., 2010; mation of such multigene complexes in which all interacting Papantonis et al., 2012). HUVECs were arrested in the G0 phase genes are activated by NF-kB(Papantonis et al., 2012). Ten of the cell cycle by serum deprivation (Larkin et al., 2012). Impor- minutes after TNFa stimulation, the promoters of genes located tantly, the transcription of SAMD4A, TNFAIP2, and SLC6A5 is on the same chromosome (SAMD4A and TNFAIP2) and on a rapidly induced 10 min post-TNFa stimulation (Figure 1B; different chromosome (SLC6A5) associate to form part of a Papantonis et al., 2010). Concurrent to their expression at NF-kB-dependent multigene complex (Papantonis et al., 2010). 10 min, prior 3C data, including our own (data not shown; Papan- RNA FISH assays targeting the approximate sites of interaction tonis et al., 2010), indicate that chromosomal contacts between identified by 3C suggest an association between the formation these genes occur at sites 1.5 kbp downstream of the TSS (Fig- of this NF-kB-regulated multigene complex and the cotranscrip- ure 1B). To interrogate whether the formation of these contacts is tion of interacting genes (Papantonis et al., 2010). However, both associated with cotranscription, we designed RNA FISH probes 3C and FISH approaches fail to reveal the necessity of chromo- to target the
Load more

Recommended publications
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • A Crosstalk Between the RNA Binding Protein Smaug and the Hedgehog Pathway Links Cell Signaling to Mrna Regulation in Drosophila Lucía Bruzzone
    A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila Lucía Bruzzone To cite this version: Lucía Bruzzone. A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in drosophila. Cellular Biology. Université Sorbonne Paris Cité, 2018. English. NNT : 2018USPCC234. tel-02899776 HAL Id: tel-02899776 https://tel.archives-ouvertes.fr/tel-02899776 Submitted on 15 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Thèse de doctorat de l’Université Sorbonne Paris Cité Préparée à l’Université Paris Diderot Ecole doctorale HOB n° 561 Institut Jacques Monod / Equipe Développement, Signalisation et Trafic A crosstalk between the RNA binding protein Smaug and the Hedgehog pathway links cell signaling to mRNA regulation in Drosophila Lucía Bruzzone Thèse de doctorat de Biologie Dirigée par Anne Plessis Présentée et soutenue publiquement à Paris le 19 mars 2018 Président du jury: Alain Zider / Professeur Université Paris Diderot
    [Show full text]
  • Module Analysis Using Single-Patient Differential Expression Signatures
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.05.894931; this version posted January 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Module analysis using single-patient differential expression signatures improve the power of association study for Alzheimer's disease Jialan Huang1, Dong Lu1, and Guofeng Meng1,∗ 1Institute of interdisciplinary integrative Medicine Research, shanghai University of Traditional Chinese Medicine, shanghai, China Abstract The causal mechanism of Alzheimer's disease is extremely complex. It usually requires a huge number of samples to achieve a good statistical power in association studies. In this work, we illustrated a different strategy to identify AD risk genes by clustering AD patients into modules based on their single-patient differential expression signatures. Evaluation suggested that our method could enrich AD patients with common clinical manifestations. Applying it to a cohort of only 310 AD patients, we identified 175 AD risk loci at a strict threshold of empirical p < 0:05 while only two loci were identified using all the AD patients. As an evaluation, we collected 23 AD risk genes reported in a recent large-scale meta-analysis and found that 18 of them were re-discovered by association studies using clustered AD patients, while only three of them were re-discovered using all AD patients. Functional annotation suggested that AD associated genetic variants mainly disturbed neuronal/synaptic function.
    [Show full text]
  • Nonspecific Bridging-Induced Attraction Drives Clustering of DNA
    Nonspecific bridging-induced attraction drives PNAS PLUS clustering of DNA-binding proteins and genome organization Chris A. Brackleya, Stephen Taylorb, Argyris Papantonisc,d, Peter R. Cookc,1, and Davide Marenduzzoa,1 aScottish Universities Physics Alliance (SUPA), School of Physics, University of Edinburgh, Edinburgh EH9 3JZ, United Kingdom; bComputational Research Biology Group and cSir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom; and dCenter for Molecular Medicine, University of Cologne, 50931 Cologne, Germany Edited by Charles S. Peskin, New York University, Manhattan, NY, and approved August 5, 2013 (received for review February 19, 2013) Molecular dynamics simulations are used to model proteins that Results diffuse to DNA, bind, and dissociate; in the absence of any explicit Clustering of Bridging Proteins on Binding to Naked DNA. We first interaction between proteins, or between templates, binding spon- consider a solution of spherical DNA-binding proteins (con- taneously induces local DNA compaction and protein aggregation. centration, 0.02% in volume or 42.5 μM and therefore within the Small bivalent proteins form into rows [as on binding of the bacterial range found in vivo) that bind nonspecifically to naked DNA histone-like nucleoid-structuring protein (H-NS)], large proteins (36.7 kbp), modeled as a semiflexible string of spherical mono- into quasi-spherical aggregates (as on nanoparticle binding), and mers (persistence length, 50 nm) (18) confined within a cube cylinders with eight binding sites (representing octameric nucleo- (250 × 250 × 250 nm). Both proteins and monomers have somal cores) into irregularly folded clusters (like those seen in diameters of 2.5 nm, each DNA monomer represents ∼7.35 bp, nucleosomal strings).
    [Show full text]
  • Supplementary Data
    Supplemental figures Supplemental figure 1: Tumor sample selection. A total of 98 thymic tumor specimens were stored in Memorial Sloan-Kettering Cancer Center tumor banks during the study period. 64 cases corresponded to previously untreated tumors, which were resected upfront after diagnosis. Adjuvant treatment was delivered in 7 patients (radiotherapy in 4 cases, cyclophosphamide- doxorubicin-vincristine (CAV) chemotherapy in 3 cases). 34 tumors were resected after induction treatment, consisting of chemotherapy in 16 patients (cyclophosphamide-doxorubicin- cisplatin (CAP) in 11 cases, cisplatin-etoposide (PE) in 3 cases, cisplatin-etoposide-ifosfamide (VIP) in 1 case, and cisplatin-docetaxel in 1 case), in radiotherapy (45 Gy) in 1 patient, and in sequential chemoradiation (CAP followed by a 45 Gy-radiotherapy) in 1 patient. Among these 34 patients, 6 received adjuvant radiotherapy. 1 Supplemental Figure 2: Amino acid alignments of KIT H697 in the human protein and related orthologs, using (A) the Homologene database (exons 14 and 15), and (B) the UCSC Genome Browser database (exon 14). Residue H697 is highlighted with red boxes. Both alignments indicate that residue H697 is highly conserved. 2 Supplemental Figure 3: Direct comparison of the genomic profiles of thymic squamous cell carcinomas (n=7) and lung primary squamous cell carcinomas (n=6). (A) Unsupervised clustering analysis. Gains are indicated in red, and losses in green, by genomic position along the 22 chromosomes. (B) Genomic profiles and recurrent copy number alterations in thymic carcinomas and lung squamous cell carcinomas. Gains are indicated in red, and losses in blue. 3 Supplemental Methods Mutational profiling The exonic regions of interest (NCBI Human Genome Build 36.1) were broken into amplicons of 500 bp or less, and specific primers were designed using Primer 3 (on the World Wide Web for general users and for biologist programmers (see Supplemental Table 2) [1].
    [Show full text]
  • UNIVERSITY of CALIFORNIA Los Angeles a Sterile Alpha Motif
    UNIVERSITY OF CALIFORNIA Los Angeles A Sterile Alpha Motif Domain Network Involved in Kidney Development A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biochemistry and Molecular Biology by Catherine Nicole Leettola 2015 ABSTRACT OF THE DISSERTATION A Sterile Alpha Motif Domain Network Involved in Kidney Development by Catherine Nicole Leettola Doctor of Philosophy in Biochemistry and Molecular Biology University of California, Los Angeles, 2015 Professor James U. Bowie, Chair Cystic kidney diseases including polycystic kidney disease (PKD) and nephronophthisis (NPHP) are the most common genetic disorders leading to end-stage renal failure in humans. Animal models and human cases of PKD and NPHP have implicated the sterile alpha motif (SAM) domain containing proteins bicaudal C homolog 1 (BICC1) and ankyrin repeat and SAM- domain containing protein 6 (ANKS6) as being involved in these conditions and important for renal development. SAM domains are known protein-protein interaction domains that are capable of binding each other to form polymers and heterodimers. Using a negGFP native gel assay, we have identified the SAM domain of the previously uncharacterized protein ankyrin repeat and SAM-domain containing protein 3 (ANKS3) as a direct binding partner of the BICC1 and ANKS6 SAM domains. We found the ANKS3 SAM domain to polymerize with moderate affinity and determined the ANKS6 SAM domain can bind to a single end of this polymer. Crystal structures of the ANKS3 SAM domain polymer and the ANKS3 SAM-ANKS6 SAM ii heterodimer are presented to reveal typical ML-EH SAM domain interaction interfaces with a pronounced charge complementarity.
    [Show full text]
  • Heterogeneity Between Primary Colon Carcinoma and Paired Lymphatic and Hepatic Metastases
    MOLECULAR MEDICINE REPORTS 6: 1057-1068, 2012 Heterogeneity between primary colon carcinoma and paired lymphatic and hepatic metastases HUANRONG LAN1, KETAO JIN2,3, BOJIAN XIE4, NA HAN5, BINBIN CUI2, FEILIN CAO2 and LISONG TENG3 Departments of 1Gynecology and Obstetrics, and 2Surgical Oncology, Taizhou Hospital, Wenzhou Medical College, Linhai, Zhejiang; 3Department of Surgical Oncology, First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang; 4Department of Surgical Oncology, Sir Run Run Shaw Hospital, College of Medicine, Zhejiang University, Hangzhou, Zhejiang; 5Cancer Chemotherapy Center, Zhejiang Cancer Hospital, Zhejiang University of Chinese Medicine, Hangzhou, Zhejiang, P.R. China Received January 26, 2012; Accepted May 8, 2012 DOI: 10.3892/mmr.2012.1051 Abstract. Heterogeneity is one of the recognized characteris- Introduction tics of human tumors, and occurs on multiple levels in a wide range of tumors. A number of studies have focused on the Intratumor heterogeneity is one of the recognized charac- heterogeneity found in primary tumors and related metastases teristics of human tumors, which occurs on multiple levels, with the consideration that the evaluation of metastatic rather including genetic, protein and macroscopic, in a wide range than primary sites could be of clinical relevance. Numerous of tumors, including breast, colorectal cancer (CRC), non- studies have demonstrated particularly high rates of hetero- small cell lung cancer (NSCLC), prostate, ovarian, pancreatic, geneity between primary colorectal tumors and their paired gastric, brain and renal clear cell carcinoma (1). Over the past lymphatic and hepatic metastases. It has also been proposed decade, a number of studies have focused on the heterogeneity that the heterogeneity between primary colon carcinomas and found in primary tumors and related metastases with the their paired lymphatic and hepatic metastases may result in consideration that the evaluation of metastatic rather than different responses to anticancer therapies.
    [Show full text]
  • A Wave of Nascent Transcription on Activated Human Genes
    A wave of nascent transcription on activated human genes Youichiro Wadaa,1, Yoshihiro Ohtaa,1, Meng Xub, Shuichi Tsutsumia, Takashi Minamia, Kenji Inouea, Daisuke Komuraa, Jun’ichi Kitakamia, Nobuhiko Oshidaa, Argyris Papantonisb, Akashi Izumia, Mika Kobayashia, Hiroko Meguroa, Yasuharu Kankia, Imari Mimuraa, Kazuki Yamamotoa, Chikage Matakia, Takao Hamakuboa, Katsuhiko Shirahigec, Hiroyuki Aburatania, Hiroshi Kimurad, Tatsuhiko Kodamaa,2, Peter R. Cookb,2, and Sigeo Iharaa aLaboratory for Systems Biology and Medicine, Research Center for Advanced Science and Technology, The University of Tokyo, 4-6-1, Komaba, Meguro-ku, Tokyo 153-8904, Japan; bSir Williams Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom; cGraduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259, Ngatsuda, Midori-ku, Yokohama 226-8501, Japan; and dGraduate School of Frontier Biosciences, Osaka University, 1-3, Yamadaoka, Suita, Osaka 565-0871, Japan Edited by Richard A. Young, Whitehead Institute, Cambridge, MA, and accepted by the Editorial Board September 1, 2009 (received for review March 12, 2009) Genome-wide studies reveal that transcription by RNA polymerase II sites where the RAD21 subunit of cohesin and CCCTC-binding (Pol II) is dynamically regulated. To obtain a comprehensive view of factor (CTCF) bind (19, 20). a single transcription cycle, we switched on transcription of five long human genes (>100 kbp) with tumor necrosis factor-␣ (TNF␣) and Results monitored (using microarrays, RNA fluorescence in situ hybridization, A Wave of premRNA Synthesis That Sweeps Down Activated Genes. At and chromatin immunoprecipitation) the appearance of nascent RNA, different times after stimulation with TNF␣, total nuclear RNA changes in binding of Pol II and two insulators (the cohesin subunit was purified and hybridized to a tiling microarray bearing RAD21 and the CCCTC-binding factor CTCF), and modifications of oligonucleotides complementary to SAMD4A, a long gene of 221 histone H3.
    [Show full text]
  • CREB-Dependent Transcription in Astrocytes: Signalling Pathways, Gene Profiles and Neuroprotective Role in Brain Injury
    CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Tesis doctoral Luis Pardo Fernández Bellaterra, Septiembre 2015 Instituto de Neurociencias Departamento de Bioquímica i Biologia Molecular Unidad de Bioquímica y Biologia Molecular Facultad de Medicina CREB-dependent transcription in astrocytes: signalling pathways, gene profiles and neuroprotective role in brain injury. Memoria del trabajo experimental para optar al grado de doctor, correspondiente al Programa de Doctorado en Neurociencias del Instituto de Neurociencias de la Universidad Autónoma de Barcelona, llevado a cabo por Luis Pardo Fernández bajo la dirección de la Dra. Elena Galea Rodríguez de Velasco y la Dra. Roser Masgrau Juanola, en el Instituto de Neurociencias de la Universidad Autónoma de Barcelona. Doctorando Directoras de tesis Luis Pardo Fernández Dra. Elena Galea Dra. Roser Masgrau In memoriam María Dolores Álvarez Durán Abuela, eres la culpable de que haya decidido recorrer el camino de la ciencia. Que estas líneas ayuden a conservar tu recuerdo. A mis padres y hermanos, A Meri INDEX I Summary 1 II Introduction 3 1 Astrocytes: physiology and pathology 5 1.1 Anatomical organization 6 1.2 Origins and heterogeneity 6 1.3 Astrocyte functions 8 1.3.1 Developmental functions 8 1.3.2 Neurovascular functions 9 1.3.3 Metabolic support 11 1.3.4 Homeostatic functions 13 1.3.5 Antioxidant functions 15 1.3.6 Signalling functions 15 1.4 Astrocytes in brain pathology 20 1.5 Reactive astrogliosis 22 2 The transcription
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name sterile alpha motif domain containing 4A Gene Symbol SAMD4A Organism Human Gene Summary Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element which was named after the Drosophila Smaug protein (Baez and Boccaccio 2005 Gene Aliases DKFZp434H0350, DKFZp686A1532, KIAA1053, SAMD4, SMG, SMGA, Smaug, Smaug1 RefSeq Accession No. NC_000014.8, NT_026437.12 UniGene ID Hs.98259 Ensembl Gene ID ENSG00000020577 Entrez Gene ID 23034 Assay Information Unique Assay ID qHsaCED0003246 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000554335, ENST00000251091, ENST00000555192, ENST00000392067, ENST00000305831, ENST00000357634 Amplicon Context Sequence ATCTTCAGGGTTGCACAGAATCCTCCAAGATACTTTGCAGCCTTTTTTCCCCCTG GTCCCTCTCCCGTTTTGATTTTGTGAGAGCGTAGGTCATCCTCGTAAACATATCA GTAGA Amplicon Length (bp) 85 Chromosome Location 14:55255726-55255840 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9998 cDNA Cq 22.09 cDNA Tm (Celsius) 81 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 23.37 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report SAMD4A, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard
    [Show full text]
  • MAFB Determines Human Macrophage Anti-Inflammatory
    MAFB Determines Human Macrophage Anti-Inflammatory Polarization: Relevance for the Pathogenic Mechanisms Operating in Multicentric Carpotarsal Osteolysis This information is current as of October 4, 2021. Víctor D. Cuevas, Laura Anta, Rafael Samaniego, Emmanuel Orta-Zavalza, Juan Vladimir de la Rosa, Geneviève Baujat, Ángeles Domínguez-Soto, Paloma Sánchez-Mateos, María M. Escribese, Antonio Castrillo, Valérie Cormier-Daire, Miguel A. Vega and Ángel L. Corbí Downloaded from J Immunol 2017; 198:2070-2081; Prepublished online 16 January 2017; doi: 10.4049/jimmunol.1601667 http://www.jimmunol.org/content/198/5/2070 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2017/01/15/jimmunol.160166 Material 7.DCSupplemental References This article cites 69 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/198/5/2070.full#ref-list-1 by guest on October 4, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
    [Show full text]
  • Exploiting Native Forces to Capture Chromosome Conformation in Mammalian Cell Nuclei
    Edinburgh Research Explorer Exploiting native forces to capture chromosome conformation in mammalian cell nuclei Citation for published version: Brant, L, Georgomanolis, T, Nikolic, M, Brackley, CA, Kolovos, P, van Ijcken, W, Grosveld, FG, Marenduzzo, D & Papantonis, A 2016, 'Exploiting native forces to capture chromosome conformation in mammalian cell nuclei', Molecular Systems Biology, vol. 12, no. 12, pp. 891. https://doi.org/10.15252/msb.20167311 Digital Object Identifier (DOI): 10.15252/msb.20167311 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Molecular Systems Biology General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 07. Oct. 2021 Published online: December 9, 2016 Report Exploiting native forces to capture chromosome conformation in mammalian cell nuclei Lilija Brant1, Theodore Georgomanolis1,†, Milos Nikolic1,†, Chris A Brackley2, Petros Kolovos3, Wilfred van Ijcken4 , Frank G Grosveld3, Davide Marenduzzo2 & Argyris Papantonis1,* Abstract et al, 2013; Pombo & Dillon, 2015; Denker & de Laat, 2016) and allowed us to address diverse biological questions (e.g., Tolhuis et al, Mammalian interphase chromosomes fold into a multitude of 2002; Papantonis et al, 2012; Zhang et al, 2012; Naumova et al, loops to fit the confines of cell nuclei, and looping is tightly 2013; Rao et al, 2014).
    [Show full text]