DOCSLIB.ORG

Amplification of an Ancestral Mammalian LI Family of Long

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Amplification of an Ancestral Mammalian LI Family of Long Proc. Nati. A(-ad. Stci. USA Vol. 87, pp. 9481-9485, December 1990 Evolution Amplification of an ancestral mammalian LI family of long interspersed repeated DNA occurred just before the murine radiation (LINE sequence/murine evolution/transposons/taxonomy) ESTERINA PASCALE*, EULALIA VALLEt, AND ANTHONY V. FURANOt Section on Genomic Structure and Function, Laboratory of Biochemical Pharmacology, National Institute of Diabetes and Digestive and Kidney Diseases. National Institutes of Health, Building 8, Room 203, Bethesda, MD 20892 Communicated by Herbert Tabor, September 12, 1990 (re eiyedfor review July 2, 1990) ABSTRACT Each mammalian genus examined so far con- However, we report here that an ancestral rodent Li tains 50,000-100,000 members ofan Li (LINE 1) family oflong family, which we call Lx, was extensively amplified -=10 interspersed repeated DNA elements. Current knowledge on million years ago and that -60,000 copies of Lx are present the evolution of LI families presents a paradox because, in various modern murine genomes (Old World rats and although Li families have been in mammalian genomes since mice). The occurrence of this amplification identifies those before the mammalian radiation -80 million years ago, most murine genera that shared a common ancestry and, therefore, members of the Li families are only a few million years old. defines the murine node in the lineage of modern muroid Accordingly it has been suggested either that the extensive rodents. The possible mechanism and the implications of amplification that characterizes present-day Li families did not repeated amplification of Li elements are discussed. occur in the past or that old members were removed as new ones were generated. However, we show here that an ancestral MATERIALS AND METHODS rodent Li family was extensively amplified '10 million years ago and that the relics (""60,000 copies) of this amplification General. The preparation of clones, genomic DNA, hy- have persisted in modern murine genomes (Old World rats and bridization probes, agarose gels, nitrocellulose blots, and mice). This amplification occurredjust before the divergence of restriction enzyme digests was done using standard tech- modern murine genera from their common ancestor and niques (14). Hybridizations to blots were carried out at the identifies the murine node in the lineage of modern muroid temperatures indicated in the legend to Fig. 2 in a solution rodents. Our results suggest that repeated amplification of LI containing 0.5 mM Na2EDTA, 0.2 M sodium phosphate (pH elements is a feature of the evolution of mammalian genomes 6.8), 0.125% (wt/vol) SDS, denatured salmon sperm DNA at and that ancestral amplification events could provide a useful 50,4g/ml, 0.05% (wt/vol) Ficoll 400 (Pharmacia), and 0.05% tool for determining mammalian lineages. (wt/vol) polyvinylpyrrolidone. The polymerase chain reac- tion (PCR) (15) was performed by using a kit from Perkin- Elmer/Cetus and conditions suggested by the supplier. The All mammalian genomes studied to date contain 50,000- sequences of the primers used to amplify genomic Li se- 100,000 members of an Li (LINE 1) family of mobile DNA quences from the rat or mouse genomes were as follows: rat elements (1-3). Full-length elements are 6-7 kilobases (kb) LiRN C1, ATAGGATCCGCCCCACAGGTGGCCCAT, and contain two protein encoding regions [open reading and LiRN C2, ATAGGATCCAGTGGCTTAGTCCCTG- frame (ORF) I and ORF II, see Fig. 1A], which are highly GA; mouse L1MD C1, ATAGGATCCATACACTAGCAA- conserved among mammalian Li families and are presum- GATTTT, and L1MD C2, ATAGGATCCGTCAAGAGCTC- ably important for Li function (4-7). The putative protein CGGGGTA. The primers used to amplify Lx sequences from encoded by ORF II is homologous to proteins encoded by murine genomes were LX1B C1, ATAGGATCCCATCCA- transposable elements found in plants, fungi, as well as GAGACTACCTCACCT, and LX1 C2, ATAGGATCCTCT- insects and other invertebrates (8). All of them contain TCCTATGGGGTTGAAAAC. The first nine nucleotides of sequence motifs typical of DNA polymerases (8), and at least each primer are not complementary to either Li or Lx and one functions as a reverse transcriptase (9). Therefore Li contained an ATA followed by a BamHI site. This facilitated elements are apparently the mammalian counterpart of, or radiolabeling the ends of the amplified material by use of the were derived from, a genetic element that arose very early in Klenow polymerase after digestion with BamHI endonucle- evolution. ase. The present-day Li families evolved independently from DNA Melting Curves. An %=230-base-pair (bp) portion of Li an ancestral Li element that predated the mammalian radi- or Lx DNA beginning =='100 bp 3' of ORF II (see Fig. 1A) was ation 80-100 million years ago (3). However, in spite of their amplified from various genomes by PCR using oligonucleo- length oftime in the genome each present-day family is rather tides specific for each family. A- small portion of each DNA new-i.e., the DNA sequences of most of the randomly was radiolabeled at the 3' end with the Klenow polymerase. sampled members are >90% identical, indicating that these members were generated withinjust the last few million years Abbreviations: ORF, open reading frame; PCR, polymerase chain (7, 10-12). To account for this apparent paradox it has been reaction; tim melting temperature (of double-stranded nucleic acid). suggested that either extensive amplification of Li did not Li or LINE 1, family of long interspersed repeated DNA elements; occur in the past (1, 13) or that old members are removed as L1Rn, rat (Rattus norvlegic us) Li family; LlMd, mouse (Mus new ones are generated (7, 11, 12). domesticus) Li family; Lx, ancestral rodent Li family. *Present address: Cattedra di Chimica e Microscopia Clinica, Uni- versita degli Studi, L'Aquila, Italy. The publication costs of this article were defrayed in part by page charge TPresent address: Department of Functional Biology, Faculty of payment. This article must therefore be hereby marked "advertisement" Medicine, c/Julian Claveria S/N, 33071, Oviedo, Spain. in accordance with 18 U.S.C. §1734 solely to indicate this fact. TTo whom reprint requests should be addressed. 9481 Downloaded by guest on September 30, 2021 9482 Evolution: Pascale et al. Proc. Natl. Acad. Sci. USA 87 (1990) After denaturation by boiling for 10 min each DNA was Fig. 1A shows a diagram of an Lx element (Lxi) compared hybridized in 0.3 M sodium phosphate buffer, pH 6.8, at with a typical rat Li element. Lxi is 1.5 kb, and the first 770 either 550C or 650C until at least 10 times the Cot1/2 was bp of Lx is homologous to the last one-fifth of the ORF II attained. Cot is the product of the initial concentration of region of the rat or mouse (Mus domesticus) Li elements DNA (in mol of nucleotide per liter) and the time of hybrid- (LiRn and LlMd, respectively; see Fig. 1B). An ancestral ization (in sec). The Cot1/2 is that value by which 50% of the relationship between Lx and both the LiRn and LlMd starting DNA has formed duplex (16). The samples were elements is evident when the DNA sequences 3' of the diluted to 0.12 M sodium phosphate buffer and applied to a termination codon of ORF II are compared. Lxi is more jacketed hydroxyapatite column equilibrated in the same closely related to LiRn 3 or LlMd A2 than either is to each buffer at 50'C. The temperature was then raised in 3YC other (see Fig 1B 3, 4, and 1, respectively). In terms of increments, and the amount of eluted DNA was determined percent similarity, the Lx sequence 3' of ORF II is -65% at each step. At least 95% of the radioactivity that bound to similar to either LiRn or LlMd, whereas the corresponding each column was recovered. regions ofthese sequences are only 55% similar to each other (see legend to Fig. 1). Fig. 1B2 shows the relationship between two typical members of the LiRn family, and a RESULTS similar relationship is found when typical members of the Identification of an Ancestral Li Element. In studying LlMd family are compared (12). different genomic clones of the rat (Rattus norvegicus) L1 In the remainder of this paper we shall show that Lxi family (LlRn), we determined the DNA sequence of several belongs to a family of sequences amplified much earlier than DNA elements (unpublished work) that were homologous to the present-day Li families of rat or mouse. Therefore, the LiRn but were not typical members of the LiRn family. Lx family is an old or ancestral rodent Li family from which Typical LlRn members are at least 90% identical with each the present-day rat and mouse Li families descended. To other, whereas these elements, which we've called Lx ele- facilitate discussion we shall refer to this ancestral Li family ments, were only -65% or 85% identical to LiRn members, and its members as Lx and to the present-day rat or mouse depending on the region compared. Li family and its members as LiRn or LlMd, respectively. A reqg on compared aqrt RE Pr I I I1 in-LZIORF LaiZORF 1 kb I - B FIG. 1. Dot-matrix analysis of the rat Li (LlRn), mouse Li (LlMd), and Lx nucleo- ' tide sequences. (A) Schematic representa- 3 and] tion of an archetypical full-length rat Li element and of the Lxi sequence shown below. Pr, promoter; Pu:Py tract, polypu- 3'ad rine:polypyrimidine region; A-rich tail, ade- sr.i nine-rich region. Although most LiRn ele- ments are full-length as depicted, ORFs ofall ~odon rat elements sequenced so far are interrupted by one or more genetic defects.
Load more

Recommended publications
  • PLAGUE STUDIES * 6. Hosts of the Infection R
    Bull. Org. mond. Sante 1 Bull. World Hlth Org. 1952, 6, 381-465 PLAGUE STUDIES * 6. Hosts of the Infection R. POLLITZER, M.D. Division of Epidemiology, World Health Organization Manuscript received in April 1952 RODENTS AND LAGOMORPHA Reviewing in 1928 the then rather limited knowledge available concerning the occurrence and importance of plague in rodents other than the common rats and mice, Jorge 129 felt justified in drawing a clear-cut distinction between the pandemic type of plague introduced into human settlements and houses all over the world by the " domestic " rats and mice, and " peste selvatique ", which is dangerous for man only when he invades the remote endemic foci populated by wild rodents. Although Jorge's concept was accepted, some discussion arose regarding the appropriateness of the term " peste selvatique" or, as Stallybrass 282 and Wu Lien-teh 318 translated it, " selvatic plague ". It was pointed out by Meyer 194 that, on etymological grounds, the name " sylvatic plague " would be preferable, and this term was widely used until POzzO 238 and Hoekenga 105 doubted, and Girard 82 denied, its adequacy on the grounds that the word " sylvatic" implied that the rodents concerned lived in forests, whereas that was rarely the case. Girard therefore advocated the reversion to the expression "wild-rodent plague" which was used before the publication of Jorge's study-a proposal it has seemed advisable to accept for the present studies. Much more important than the difficulty of adopting an adequate nomenclature is that of distinguishing between rat and wild-rodent plague- a distinction which is no longer as clear-cut as Jorge was entitled to assume.
    [Show full text]
  • CRICETID RODENTS from Siwallk DEPOSITS NEAR CHINJI VILLAGE
    CRICETID RODENTS FROM SIWALlK DEPOSITS NEAR CHINJI VILLAGE. PART I: MEGACRICETODONTINAE, MYOCRICETODONTINAE AND DENDROMURINAE. by Everet! H. LINDSA Y· SOMMAlRE Page Abstract 96 Introduction ............................................................................................................... 96 Systematics ............................................................................................................... 99 Cricetid Dental Terminology ...................................................................... 99 Megacricetodontinae ............................................................................................ 101 Megacricetodon ag uilari. n. sp ................................................................... .. 103 Megacricetodon sivalensis. n. sp ................................................................. 106 Megacricetodon daamsi. n. sp ..................................................................... 108 Megacricetodon mythikos. n. sp ................................................................. 110 Punjabemys. n. gen ...................................................................................... .. 112 Punjabemys downsi. n. gen & n. sp ........................................................... .. 113 Punjabemys leptos. n. gen. & n. sp ........................................................... .. 115 Punjabemys mikros. n. gen. & n. sp ........................................................... 117 Myocricetodontinae ............................................................................................
    [Show full text]
  • Quaternary Murid Rodents of Timor Part I: New Material of Coryphomys Buehleri Schaub, 1937, and Description of a Second Species of the Genus
    QUATERNARY MURID RODENTS OF TIMOR PART I: NEW MATERIAL OF CORYPHOMYS BUEHLERI SCHAUB, 1937, AND DESCRIPTION OF A SECOND SPECIES OF THE GENUS K. P. APLIN Australian National Wildlife Collection, CSIRO Division of Sustainable Ecosystems, Canberra and Division of Vertebrate Zoology (Mammalogy) American Museum of Natural History ([email protected]) K. M. HELGEN Department of Vertebrate Zoology National Museum of Natural History Smithsonian Institution, Washington and Division of Vertebrate Zoology (Mammalogy) American Museum of Natural History ([email protected]) BULLETIN OF THE AMERICAN MUSEUM OF NATURAL HISTORY Number 341, 80 pp., 21 figures, 4 tables Issued July 21, 2010 Copyright E American Museum of Natural History 2010 ISSN 0003-0090 CONTENTS Abstract.......................................................... 3 Introduction . ...................................................... 3 The environmental context ........................................... 5 Materialsandmethods.............................................. 7 Systematics....................................................... 11 Coryphomys Schaub, 1937 ........................................... 11 Coryphomys buehleri Schaub, 1937 . ................................... 12 Extended description of Coryphomys buehleri............................ 12 Coryphomys musseri, sp.nov.......................................... 25 Description.................................................... 26 Coryphomys, sp.indet.............................................. 34 Discussion . ....................................................
    [Show full text]
  • Differential Effects of Fire on Small Mammal Communities in the Busanga Flood Plain, Zambia
    Research Article Tropical Conservation Science Volume 10: 1–13 Differential Effects of Fire on Small Mammal ! The Author(s) 2017 Reprints and permissions: Communities in the Busanga Flood Plain, sagepub.com/journalsPermissions.nav DOI: 10.1177/1940082917725439 Zambia journals.sagepub.com/home/trc Ngawo Namukonde1,2, Daniel Kuebler3, and Jo¨rg U. Ganzhorn1 Abstract We assessed effects of vegetation and fire on small mammals in open vegetation formations of the Busanga Flood Plain (Kafue National Park, Zambia) in areas of low and high fire recurrence. The impact of fire was related further to the time elapsed between the last fire and the time of trapping (fire age). Sampling sites covered three management zones: intensive utilization (tourist areas), wild (less used), and wilderness (no road access). Vegetation type, fire recurrence, fire age, and management zone were independent variables. Communities were similar in grassland and on termitaria but differed from miombo. Species richness was highest on termitaria, followed by grassland and miombo. Species numbers declined with increasing fire frequency but were unaffected by fire age. In contrast, the average body mass of species occurring at any one site (only adult individuals considered) declined with the time elapsed between the time of capture and the last fire (the longer the time interval, the lower the body mass of species averaged over the species found at the site). This response implies higher vulnerability of the smaller species to fire and slower recolonization potential of smaller species after fire. The interactions between fire, vegetation characteristics, and small mammals need to be reviewed, given their importance in the functionality of this ecosystem.
    [Show full text]
  • Dental Adaptation in Murine Rodents (Muridae): Assessing Mechanical Predictions Stephanie A
    Florida State University Libraries Electronic Theses, Treatises and Dissertations The Graduate School 2010 Dental Adaptation in Murine Rodents (Muridae): Assessing Mechanical Predictions Stephanie A. Martin Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected] THE FLORIDA STATE UNIVERSITY COLLEGE OF ARTS AND SCIENCES DENTAL ADAPTATION IN MURINE RODENTS (MURIDAE): ASSESSING MECHANICAL PREDICTIONS By STEPHANIE A. MARTIN A Thesis in press to the Department of Biological Science in partial fulfillment of the requirements for the degree of Master of Science Degree Awarded: Spring Semester, 2010 Copyright©2010 Stephanie A. Martin All Rights Reserved The members of the committee approve the thesis of Stephanie A. Martin defended on March 22, 2010. ______________________ Scott J. Steppan Professor Directing Thesis _____________________ Gregory Erickson Committee Member _____________________ William Parker Committee Member Approved: __________________________________________________________________ P. Bryant Chase, Chair, Department of Biological Science The Graduate School has verified and approved the above-named committee members. ii TABLE OF CONTENTS List of Tables......................................................................................................................iv List of Figures......................................................................................................................v Abstract...............................................................................................................................vi
    [Show full text]
  • Rodent Assemblages in the Mosaic of Habitat Types in the Zambezian Bioregion
    diversity Article Rodent Assemblages in the Mosaic of Habitat Types in the Zambezian Bioregion Vincent R. Nyirenda 1,* , Ngawo Namukonde 1 , Matamyo Simwanda 2 , Darius Phiri 2, Yuji Murayama 3 , Manjula Ranagalage 3,4 and Kaula Milimo 5 1 Department of Zoology and Aquatic Sciences, School of Natural Resources, Copperbelt University, P.O. Box 21692, Kitwe 10101, Zambia; [email protected] 2 Department of Plant and Environmental Sciences, School of Natural Resources, Copperbelt University, P.O. Box 21692, Kitwe 10101, Zambia; [email protected] (M.S.); [email protected] (D.P.) 3 Faculty of Life and Environmental Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba City, Ibaraki 305-8572, Japan; [email protected] (Y.M.); [email protected] (M.R.) 4 Department of Environmental Management, Faculty of Social Sciences and Humanities, Rajarata University of Sri Lanka, Mihintale 50300, Sri Lanka 5 Department of National Parks and Wildlife, Ministry of Tourism and Arts, Private Bag 1, Chilanga 10100, Zambia; [email protected] * Correspondence: [email protected]; Tel.: +260-977-352035 Received: 12 July 2020; Accepted: 21 September 2020; Published: 23 September 2020 Abstract: Rodent assemblages have ecological importance in ecosystem functioning and protected area management. Our study examines the patterns of assemblages of rodents across four habitat types (i.e., Miombo woodland, Acacia woodland, grasslands and farmlands) in the savanna environment. Capture-mark-recapture (CMR) methods were applied for data collection across the Chembe Bird Sanctuary (CBS) landscape. The Non-metric Multi-Dimensional Scaling (NMDS) was used for exploratory data analysis, followed by Analysis of Variance (ANOVA) and Tukey–Kramer’s Honestly Significant Difference (HSD) post-hoc tests.
    [Show full text]
  • Mystromys Albicaudatus – White-Tailed Rat
    Mystromys albicaudatus – White-tailed Rat Fynbos biomes; Dean 1978) and is endemic to South Africa and Lesotho. Although it occurs widely across the assessment region, it has an extremely patchy and fragmented area of occupancy due to its preference for microhabitats within vegetation types and transitory habitats created after fire. Out of a total area of 417,452 km2 broadly available to the species, we inferred an effective occupancy of only 3,719–12,061 km2. They are one of the rarest species in the small mammal community, as demonstrated by consistently low trapping records. Given estimated densities ranging from 0.9– 37 colonies (breeding pairs) / km2, the most likely mature population size is 6,997–13,648 individuals. Using Patrick O’Farrell grassland vegetation type as a proxy for subpopulation delineation, subpopulation size averages 178 ± 177 colonies and ranges from 1–760 colonies, which means Red List status (2016) Vulnerable C2a(i)*† the largest subpopulation is likely to be 712–1,521 mature Red List status (2008) Endangered A3c individuals. There is an inferred continuing decline from grassland habitat loss (due to expansion in crop Reasons for change Non-genuine change: agriculture, urban and industrial development, and climate New information change) and grassland habitat degradation, primarily from Red List status (2004) Endangered A3c suppression of natural fire regimens. This may represent an emerging threat to this species if fire is increasingly TOPS listing (NEMBA) (2007) None suppressed or controlled with the rise of intensive wildlife CITES listing None breeding. Grasslands are the most threatened biome in the assessment region with at least 33% transformed Endemic No already.
    [Show full text]
  • Peromyscus Newsletter
    PEROMYSCUS NEWSLETTER NUMBER THIRTY-EIGHT AUTUMN 2004 Cover: A Deer Mouse (Peromyscus maniculatus rufinus) with a striking "blazed" head pattern. See entry by Katy Mirowsky and Brian Hjelle pp. 22 this issue. PN 38 - This issue of PEROMYSCUS NEWSLETTER follows soon after the mailing of the triennial "Genetics and Genomics" issue, and includes correspondents' entries received earlier in 2004 that we did not have space for in that previous issue. And we thank those who kindly responded to our request for information about activities in their research programs. PN is published twice annually by the Peromyscus Genetic Stock Center at the University of South Carolina. Please notice that effective January 2005 that charges for many of our stocks and materials have been increased due to greater costs of maintenance and shipping. In this issue we report progress in developing a phylogenetic tree for peromyscine rodents. We intend the tree to serve as a useful reference for all with interest in any aspect of peromyscine biology, and not specifically for systematic and evolutionary biologists (See p. 7). The Stock Center had an excellent year in 2004 supplying a record number of animals and materials for research and education to institutions around the world. Stock Center utilization over the nineteen years of its existence in numbers of animals and specimens supplied is shown in the graph on page 7. The Stock Center also provides numerous animals and related materials for in-house research at the University of South Carolina. The Stock Center is funded by grants from NSF and NIH, user fees (sales), University in-house funds and donations.
    [Show full text]
  • Steatomys Krebsii – Krebs's Fat Mouse
    Steatomys krebsii – Krebs’s Fat Mouse usually 35–60% of their head and body length (Monadjem et al. 2015). In parts of its range, S. krebsii overlaps with S. pratensis and these species are not easily distinguished, although S. krebsii has eight nipples, while S. pratensis has 10–14 (Monadjem et al. 2015). Photograph Assessment Rationale wanted This species is currently listed as Least Concern due to its wide distribution within the assessment region and its potential ability to survive in modified landscapes, such as fallow fields. However, it is naturally rare and trap-shy and thus population size may be fairly small. Further taxonomic resolution is required as this species, due to its disjunct distribution within the assessment region, may represent several endemic species, some of which may Regional Red List status (2016) Least Concern* potentially be threatened. For example, S. krebsii was not National Red List status (2004) Least Concern recorded during a recent survey in North West Province. Reassessment should follow once molecular and Reasons for change No change additional field data are available. Density and occupancy Global Red List status (2016) Least Concern should also be calculated to facilitate more accurate future revision. It is uncertain whether there are any threats to TOPS listing (NEMBA) (2007) None this species but presumably habitat loss is causing local CITES listing None and regional declines. Endemic No Regional population effects: This species has a scattered, disjunct distribution through southern Africa. *Watch-list Data Limited dispersal may be possible between South Africa There is a substantial degree of colour variation in and Botswana across the Molopo River, although the this species based on its geographic distribution, species was not recorded in North West Province during a ranging from an orange colouration in the recent survey (Power 2014).
    [Show full text]
  • Micromammal Paleoecology
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CU Scholar Institutional Repository University of Colorado, Boulder CU Scholar Anthropology Graduate Theses & Dissertations Anthropology Spring 1-1-2011 Micromammal Paleoecology: Theory, Methods, and Application to Modern and Fossil Assemblages in The rC adle of Humankind World Heritage Site, South Africa Jennifer Nicole Leichliter University of Colorado at Boulder, [email protected] Follow this and additional works at: http://scholar.colorado.edu/anth_gradetds Part of the Biological and Physical Anthropology Commons Recommended Citation Leichliter, Jennifer Nicole, "Micromammal Paleoecology: Theory, Methods, and Application to Modern and Fossil Assemblages in The Cradle of Humankind World Heritage Site, South Africa" (2011). Anthropology Graduate Theses & Dissertations. Paper 7. This Thesis is brought to you for free and open access by Anthropology at CU Scholar. It has been accepted for inclusion in Anthropology Graduate Theses & Dissertations by an authorized administrator of CU Scholar. For more information, please contact [email protected]. Micromammal Paleoecology: Theory, Methods, and Application to Modern and Fossil Assemblages in The Cradle of Humankind World Heritage Site, South Africa by Jennifer Leichliter B.A., Colorado College, 2008 A thesis submitted to the Faculty of the Graduate School of the University of Colorado in partial fulfillment of the requirement for the degree of Master’s of Anthropology Department of Anthropology 2011 This thesis entitled: Micromammal Paleoecology: Theory, Methods, and Application to Modern and Fossil Assemblages in The Cradle of Humankind World Heritage Site, South Africa written by Jennifer Nicole Leichliter has been approved for the Department Anthropology ________________________________________________ Dr.
    [Show full text]
  • Laikipia – a Natural History Guide
    LAIKIPIA – A NATURAL HISTORY GUIDE LAIKIPIA – A NATURAL HISTORY GUIDE A publication of the LAIKIPIA WILDLIFE FORUM First published in 2011 by Laikipia Wildlife Forum P O Box 764 NANYUKI – 10400 Kenya Website: www.laikipia.org With support from the Embassy of the Kingdom of the Netherlands in Nairobi, Kenya Text: Copyright © Laikipia Wildlife Forum 2011 Artwork: Copyright © Lavinia Grant 2011 Illustration (p. 33): © Jonathan Kingdon Illustration (p. 78): © Stephen D Nash / Conservation International Illustrations (pp. 22, 45, 46): © Dino J Martins Maps: Copyright © Laikipia Wildlife Forum 2011 All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form, or by any means – electronic, mechanical, photocopy, recording, or otherwise – without the prior consent of the publisher. ISBN 978–9966–05–363–3 Editor: Gordon Boy Contributing writers: Anthony King (AK); Chris Disclaimer: The Laikipia Wildlife Forum has made Thouless (CT); Dino J Martins (DJM); Patrick every effort to ensure the information conveyed in K Malonza (PKM); Margaret F Kinnaird (MFK); this guide is accurate in all respects. The Forum Anne Powys (AP); Phillipa Bengough (PB); cannot accept responsibility for consequences Gordon Boy (GB) (including loss, injury, or inconvenience) arising from use of this information. Original paintings by Lavinia Grant, reproduced with the kind permission of the artist Printed on Avalon paper – 100 % chlorine free, made from 60 % bagasse waste derived from Maps: Phillipa Bengough, Job Ballard sustainable afforestation. Design: Job Ballard Printed by The Regal Press Kenya Limited, P O Box Coordination: Phillipa Bengough 4166; 00100 – NAIROBI, Kenya Cover: African Wild Dogs against the backdrop of Mount Kenya.
    [Show full text]
  • Phylogenetic Relationships and Divergence Times in Rodents Based on Both Genes and Fossils Ryan Norris University of Vermont
    University of Vermont ScholarWorks @ UVM Graduate College Dissertations and Theses Dissertations and Theses 2009 Phylogenetic Relationships and Divergence Times in Rodents Based on Both Genes and Fossils Ryan Norris University of Vermont Follow this and additional works at: https://scholarworks.uvm.edu/graddis Recommended Citation Norris, Ryan, "Phylogenetic Relationships and Divergence Times in Rodents Based on Both Genes and Fossils" (2009). Graduate College Dissertations and Theses. 164. https://scholarworks.uvm.edu/graddis/164 This Dissertation is brought to you for free and open access by the Dissertations and Theses at ScholarWorks @ UVM. It has been accepted for inclusion in Graduate College Dissertations and Theses by an authorized administrator of ScholarWorks @ UVM. For more information, please contact [email protected]. PHYLOGENETIC RELATIONSHIPS AND DIVERGENCE TIMES IN RODENTS BASED ON BOTH GENES AND FOSSILS A Dissertation Presented by Ryan W. Norris to The Faculty of the Graduate College of The University of Vermont In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Specializing in Biology February, 2009 Accepted by the Faculty of the Graduate College, The University of Vermont, in partial fulfillment of the requirements for the degree of Doctor of Philosophy, specializing in Biology. Dissertation ~xaminationCommittee: w %amB( Advisor 6.William ~il~atrickph.~. Duane A. Schlitter, Ph.D. Chairperson Vice President for Research and Dean of Graduate Studies Date: October 24, 2008 Abstract Molecular and paleontological approaches have produced extremely different estimates for divergence times among orders of placental mammals and within rodents with molecular studies suggesting a much older date than fossils. We evaluated the conflict between the fossil record and molecular data and find a significant correlation between dates estimated by fossils and relative branch lengths, suggesting that molecular data agree with the fossil record regarding divergence times in rodents.
    [Show full text]