DOCSLIB.ORG

Repression of DNA-Binding Dependent Glucocorticoid Receptor-Mediated Gene Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Repression of DNA-Binding Dependent Glucocorticoid Receptor-Mediated Gene Expression Repression of DNA-binding dependent glucocorticoid receptor-mediated gene expression Katy A. Muzikar, Nicholas G. Nickols, and Peter B. Dervan1 Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125 Contributed by Peter B. Dervan, August 13, 2009 (sent for review June 4, 2009) The glucocorticoid receptor (GR) affects the transcription of genes genes—is the major mechanism by which GCs achieve their desired involved in diverse processes, including energy metabolism and the anti-inflammatory effect (5, 8, 9). immune response, through DNA-binding dependent and indepen- An understanding of the mechanisms of GR activity on target dent mechanisms. The DNA-binding dependent mechanism occurs by genes has been explored using a variety of approaches, including direct binding of GR to glucocorticoid response elements (GREs) at microarray analysis (10, 11); ChIP scanning (12); and modulation of regulatory regions of target genes. The DNA-binding independent GR activity using siRNA (13), genetic mutants (4), and ligands with mechanism involves binding of GR to transcription factors and coac- modified structures (14). However, these methods would not be tivators that, in turn, contact DNA. A small molecule that competes expected to differentiate explicitly between the direct and indirect with GR for binding to GREs could be expected to affect the DNA- DNA-binding mechanisms of GR action. A small molecule that dependent pathway selectively by interfering with the protein-DNA competes with GR for binding to the consensus GRE could be interface. We show that a DNA-binding polyamide that targets the expected to disrupt GR-DNA binding specifically and be used as a consensus GRE sequence binds the glucocorticoid-induced zipper tool to identify GR target genes whose regulation mechanism (GILZ) GRE, inhibits expression of GILZ and several other known GR depends on a direct protein-DNA interface. This differentiation of target genes, and reduces GR occupancy at the GILZ promoter. mechanisms of GR target gene regulation could contribute to Genome-wide expression analysis of the effects of this polyamide on efforts to develop more specific GR modulators that retain immu- a set of glucocorticoid-induced and -repressed genes could help to nosuppressant functions while minimizing side effects resulting from other GR targets (15). elucidate the mechanism of GR regulation for these genes. BIOCHEMISTRY N-methylpyrrole (Py)–N-methylimidazole (Im) polyamides are a gene regulation ͉ glucocorticoid response element ͉ nuclear receptor ͉ class of programmable DNA-binding ligands capable of binding protein-DNA interface ͉ Py-Im polyamide sequence specifically to DNA with affinities and specificities com- parable to those of natural DNA-binding proteins (16, 17). As oligomers composed of Im and Py heterocyclic rings, Py-Im poly- he glucocorticoid receptor (GR) is a member of the ligand- amides achieve sequence specificity via side-by-side pairings of the Tactivated nuclear receptor group of transcription factors that heterocyclic amino acids in the minor groove of DNA: Im paired bind with high affinity to glucocorticoids (GCs) such as cortisol and against Py distinguishes G⅐C from C⅐G, and Py paired against Py dexamethasone. GR is structurally similar to the androgen and binds both A⅐T and T⅐A (18, 19). Py-Im polyamides have previously progesterone receptors, containing a zinc-finger motif DNA- been used to modulate gene expression in cell culture via inhibition binding domain, a dimerization domain, and a ligand-binding of the transcription factor-DNA interface of both hypoxia inducible domain (1). Ligand binding releases GR from sequestration by factor (20, 21) and androgen receptor (22) to their respective DNA cytoplasmic heat shock proteins (2) and activates a series of cellular response elements. Interruption of the GR-DNA–binding interac- activities that lead to nuclear localization and homodimerization. tion by polyamides represents an opportunity to regulate a distinct Like other steroid hormone receptors, GR is known to modulate subset of the known binding sites for the protein. Because Py-Im gene transcription via the binding of receptor dimers to specific polyamides can be selectively programmed to recognize the known palindromic sequences called glucocorticoid response elements DNA-binding sequence of the GR, there is a unique opportunity to (GREs), usually located in the cis-regulatory region of target inhibit the DNA-binding dependent activity of endogenous GR genes—a mode of action termed transactivation. Additionally, the while leaving the protein-protein–mediated activity unaffected GR has been shown to exert its actions through an indirect (Fig. 1). non–DNA-binding mechanism, termed transrepression, in which In this study, we designed a polyamide targeted to the sequence transcriptional modulation is achieved through cross-talk between 5Ј-WGWWCW-3Ј (where W represents either a T⅐AoranA⅐T base GR and other transcription factors such as NF-␬B (3), activator pair) found in the consensus GRE, with the goal of disrupting protein-1 (AP-1) (4, 5), Sma and Mad-related protein, and mem- GR-GRE binding (Fig. 2A, polyamide 1). This polyamide binds the bers of the STAT family (6). This protein-protein cross-talk does 2 known GREs found in the promoter of the well-characterized not require the DNA-binding activity of the GR, because GR GC-induced leucine zipper (GILZ) gene, inhibits expression of mutants that are deficient in dimerization function have been shown GILZ and 17% of transcripts induced by dexamethasone in cul- to lose DNA-binding ability as well as simple GRE-mediated tured alveolar epithelial cells (A549), and reduces GR occupancy transcription function but retain their transrepression activity (4, 7). at the GILZ promoter in vivo. A ‘‘mismatch’’ polyamide that targets Because many GR target genes are immune modulators, syn- thetic GR agonists such as dexamethasone are among the most Author contributions: K.A.M., N.G.N., and P.B.D. designed research; K.A.M. and N.G.N. effective anti-inflammatory drugs available for the treatment of a performed research; K.A.M., N.G.N., and P.B.D. analyzed data; and K.A.M., N.G.N., and variety of chronic and acute inflammatory diseases. Unfortunately, P.B.D. wrote the paper. because of the functions of other GR target genes, long-term The authors declare no conflict of interest. treatment with corticosteroids results in metabolic and behavioral Freely available online through the PNAS open access option. derangements that can be treatment limiting. Although the GR Data deposition: The data reported in this paper have been deposited in the Gene Expression targets involved in inflammatory and immune regulation have not Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE17307). been comprehensively defined, there is a great deal of evidence 1To whom correspondence should be addressed. E-mail: [email protected]. ␬ suggesting that transrepression—GR interaction with NF- B This article contains supporting information online at www.pnas.org/cgi/content/full/ and/or AP-1 and the subsequent suppression of their target 0909192106/DCSupplemental. www.pnas.org͞cgi͞doi͞10.1073͞pnas.0909192106 PNAS Early Edition ͉ 1of6 Downloaded by guest on October 1, 2021 DNA-binding dependent transcriptional control A pGR_GILZ GRE1 GRE 2 GR GR + + GR GR + polyamide + GRE1 GRE 2 GRE GRE *5'..TAG CCTGCACTTTGTTCT GTCTACTACACATGTCTTAGTG CAAACACCGTGTTCA GA..3' DNA-binding independent transcriptional control 3’..ATC GGACGTGAAACAAGA CAGATGATGTGTACAGAATCAC GTTTGTGGCACAAGT CT..5' B GR GR GR GR 100 nM 100 nM 1 pM 1 1 pM 2 TF + TF Intact G A DNase Intact G A DNase + 12345678910111213 12345678910111213 polyamide TFRE TFRE Fig. 1. Effect of polyamide-DNA binding on the 2 major modes of gene regulation demonstrated by the GR. (Top) Direct mechanism is dependent on GR-DNA binding at the GRE. (Bottom) Indirect mechanism is dependent on GR binding to another protein, indicated here as a general transcription factor (TF) [with binding site TF response element (TFRE)]. A sequence-specific polyamide designed to bind to the GRE but not to the TFRE would alter gene expression controlled by the DNA-binding dependent mechanism but not by the DNA- G G binding independent mechanism. R R E E 2 2 the sequence 5Ј-WGWCGW-3Ј (Fig. 2A, polyamide 2) is used as a control for non–GRE-binding polyamide effects. The subset of G G GR-regulated genes uniquely affected by the GRE-targeted poly- R R E E 1 1 O N A O NH N O N H H 1 N N O N N H H NH3 -O O N N O N N H H N N O H N O N O Fig. 3. DNAse I footprinting of GILZ promoter region. (A) Sequence of the H N HN N N O pGR࿝GILZ plasmid insert. (B) Storage phosphor autoradiograms from quantita- H + N IPA O + tive DNase I footprint titrations of polyamides 1 and 2. Lane 1, intact DNA; lane 2, G reaction; lane 3, A reaction; lane 4, DNase control; lanes 5–13, DNase I O digestion products in the presence of 1, 3, 10, 30, 100, or 300 pM or 1, 3, 10, 30, N O NH or 100 nM polyamide, respectively. N N O N H H N N O N NH - H H 3 O O 2 N N O N N N H H N N O amide may represent a set of genes regulated by GR through direct H N O N O H N GR-GRE binding. HN N N O H N + IPA O + Results Binding Affinities of Py-Im Polyamides to GRE1 and GRE2 of the GILZ B GILZ Promoter. The proximal GILZ promoter contains 2 functional GREs (12) (GRE1: 5Ј-CCTGCActtTGTTCT-3Ј and GRE2: 5Ј- GRE 1 22 bpGRE 2 2438 bp AAACAccgTGTTCA-3Ј) spaced 22 bp apart Ϸ2,500 bp upstream of the transcription start site (Fig.
Load more

Recommended publications
  • Dedifferentiation by Adenovirus E1A Due to Inactivation of Hippo Pathway Effectors YAP and TAZ
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Dedifferentiation by adenovirus E1A due to inactivation of Hippo pathway effectors YAP and TAZ Nathan R. Zemke, Dawei Gou, and Arnold J. Berk Molecular Biology Institute, University of California at Los Angeles, Los Angeles, California 90095, USA Adenovirus transformed cells have a dedifferentiated phenotype. Eliminating E1A in transformed human embryonic kidney cells derepressed ∼2600 genes, generating a gene expression profile closely resembling mesenchymal stem cells (MSCs). This was associated with a dramatic change in cell morphology from one with scant cytoplasm and a globular nucleus to one with increased cytoplasm, extensive actin stress fibers, and actomyosin-dependent flat- tening against the substratum. E1A-induced hypoacetylation at histone H3 Lys27 and Lys18 (H3K27/18) was reversed. Most of the increase in H3K27/18ac was in enhancers near TEAD transcription factors bound by Hippo signaling-regulated coactivators YAP and TAZ. E1A causes YAP/TAZ cytoplasmic sequestration. After eliminating E1A, YAP/TAZ were transported into nuclei, where they associated with poised enhancers with DNA-bound TEAD4 and H3K4me1. This activation of YAP/TAZ required RHO family GTPase signaling and caused histone acetylation by p300/CBP, chromatin remodeling, and cohesin loading to establish MSC-associated enhancers and then superenhancers. Consistent results were also observed in primary rat embryo kidney cells, human fibroblasts, and human respiratory tract epithelial cells. These results together with earlier studies suggest that YAP/TAZ function in a developmental checkpoint controlled by signaling from the actin cytoskeleton that prevents differ- entiation of a progenitor cell until it is in the correct cellular and tissue environment.
    [Show full text]
  • Metallothionein Monoclonal Antibody, Clone N11-G
    Metallothionein monoclonal antibody, clone N11-G Catalog # : MAB9787 規格 : [ 50 uL ] List All Specification Application Image Product Rabbit monoclonal antibody raised against synthetic peptide of MT1A, Western Blot (Recombinant protein) Description: MT1B, MT1E, MT1F, MT1G, MT1H, MT1IP, MT1L, MT1M, MT2A. Immunogen: A synthetic peptide corresponding to N-terminus of human MT1A, MT1B, MT1E, MT1F, MT1G, MT1H, MT1IP, MT1L, MT1M, MT2A. Host: Rabbit enlarge Reactivity: Human, Mouse Immunoprecipitation Form: Liquid Enzyme-linked Immunoabsorbent Assay Recommend Western Blot (1:1000) Usage: ELISA (1:5000-1:10000) The optimal working dilution should be determined by the end user. Storage Buffer: In 20 mM Tris-HCl, pH 8.0 (10 mg/mL BSA, 0.05% sodium azide) Storage Store at -20°C. Instruction: Note: This product contains sodium azide: a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only. Datasheet: Download Applications Western Blot (Recombinant protein) Western blot analysis of recombinant Metallothionein protein with Metallothionein monoclonal antibody, clone N11-G (Cat # MAB9787). Lane 1: 1 ug. Lane 2: 3 ug. Lane 3: 5 ug. Immunoprecipitation Enzyme-linked Immunoabsorbent Assay ASSP5 MT1A MT1B MT1E MT1F MT1G MT1H MT1M MT1L MT1IP Page 1 of 5 2021/6/2 Gene Information Entrez GeneID: 4489 Protein P04731 (Gene ID : 4489);P07438 (Gene ID : 4490);P04732 (Gene ID : Accession#: 4493);P04733 (Gene ID : 4494);P13640 (Gene ID : 4495);P80294 (Gene ID : 4496);P80295 (Gene ID : 4496);Q8N339 (Gene ID : 4499);Q86YX0 (Gene ID : 4490);Q86YX5
    [Show full text]
  • Regulation of Cdc42 and Its Effectors in Epithelial Morphogenesis Franck Pichaud1,2,*, Rhian F
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs217869. doi:10.1242/jcs.217869 REVIEW SUBJECT COLLECTION: ADHESION Regulation of Cdc42 and its effectors in epithelial morphogenesis Franck Pichaud1,2,*, Rhian F. Walther1 and Francisca Nunes de Almeida1 ABSTRACT An overview of Cdc42 Cdc42 – a member of the small Rho GTPase family – regulates cell Cdc42 was discovered in yeast and belongs to a large family of small – polarity across organisms from yeast to humans. It is an essential (20 30 kDa) GTP-binding proteins (Adams et al., 1990; Johnson regulator of polarized morphogenesis in epithelial cells, through and Pringle, 1990). It is part of the Ras-homologous Rho subfamily coordination of apical membrane morphogenesis, lumen formation and of GTPases, of which there are 20 members in humans, including junction maturation. In parallel, work in yeast and Caenorhabditis elegans the RhoA and Rac GTPases, (Hall, 2012). Rho, Rac and Cdc42 has provided important clues as to how this molecular switch can homologues are found in all eukaryotes, except for plants, which do generate and regulate polarity through localized activation or inhibition, not have a clear homologue for Cdc42. Together, the function of and cytoskeleton regulation. Recent studies have revealed how Rho GTPases influences most, if not all, cellular processes. important and complex these regulations can be during epithelial In the early 1990s, seminal work from Alan Hall and his morphogenesis. This complexity is mirrored by the fact that Cdc42 can collaborators identified Rho, Rac and Cdc42 as main regulators of exert its function through many effector proteins.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genome-Wide Analysis of Transcriptional Bursting-Induced Noise in Mammalian Cells
    bioRxiv preprint doi: https://doi.org/10.1101/736207; this version posted August 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Title: Genome-wide analysis of transcriptional bursting-induced noise in mammalian cells Authors: Hiroshi Ochiai1*, Tetsutaro Hayashi2, Mana Umeda2, Mika Yoshimura2, Akihito Harada3, Yukiko Shimizu4, Kenta Nakano4, Noriko Saitoh5, Hiroshi Kimura6, Zhe Liu7, Takashi Yamamoto1, Tadashi Okamura4,8, Yasuyuki Ohkawa3, Itoshi Nikaido2,9* Affiliations: 1Graduate School of Integrated Sciences for Life, Hiroshima University, Higashi-Hiroshima, Hiroshima, 739-0046, Japan 2Laboratory for Bioinformatics Research, RIKEN BDR, Wako, Saitama, 351-0198, Japan 3Division of Transcriptomics, Medical Institute of Bioregulation, Kyushu University, Fukuoka, Fukuoka, 812-0054, Japan 4Department of Animal Medicine, National Center for Global Health and Medicine (NCGM), Tokyo, 812-0054, Japan 5Division of Cancer Biology, The Cancer Institute of JFCR, Tokyo, 135-8550, Japan 6Graduate School of Bioscience and Biotechnology, Tokyo Institute of Technology, Yokohama, Kanagawa, 226-8503, Japan 7Janelia Research Campus, Howard Hughes Medical Institute, Ashburn, VA, 20147, USA 8Section of Animal Models, Department of Infectious Diseases, National Center for Global Health and Medicine (NCGM), Tokyo, 812-0054, Japan 9Bioinformatics Course, Master’s/Doctoral Program in Life Science Innovation (T-LSI), School of Integrative and Global Majors (SIGMA), University of Tsukuba, Wako, 351-0198, Japan *Corresponding authors Corresponding authors e-mail addresses Hiroshi Ochiai, [email protected] Itoshi Nikaido, [email protected] bioRxiv preprint doi: https://doi.org/10.1101/736207; this version posted August 15, 2019.
    [Show full text]
  • Identification of 10 Hub Genes Related to the Progression of Colorectal
    Identification of 10 Hub genes related to the progression of colorectal cancer by co-expression analysis Jie Meng1,2, Rui Su2, Yun Liao2, Yanyan Li2 and Ling Li2 1 Department of Pharmacy, Anhui University of Chinese Medicine, Hefei, China 2 Department of Pharmacy, Tongren Hospital, Shanghai Jiaotong University School of Medicine, Shanghai, China ABSTRACT Background: Colorectal cancer (CRC) is the third most common cancer in the world. The present study is aimed at identifying hub genes associated with the progression of CRC. Method: The data of the patients with CRC were obtained from the Gene Expression Omnibus (GEO) database and assessed by weighted gene co-expression network analysis (WGCNA), Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses performed in R by WGCNA, several hub genes that regulate the mechanism of tumorigenesis in CRC were identified. Differentially expressed genes in the data sets GSE28000 and GSE42284 were used to construct a co-expression network for WGCNA. The yellow, black and blue modules associated with CRC level were filtered. Combining the co-expression network and the PPI network, 15 candidate hub genes were screened. Results: After validation using the TCGA-COAD dataset, a total of 10 hub genes (MT1X, MT1G, MT2A, CXCL8, IL1B, CXCL5, CXCL11, IL10RA, GZMB, KIT) closely related to the progression of CRC were identified. The expressions of MT1G, CXCL8, IL1B, CXCL5, CXCL11 and GZMB in CRC tissues were higher than normal tissues (p-value < 0.05). The expressions of MT1X, MT2A, IL10RA and KIT in CRC tissues were lower than normal tissues (p-value < 0.05).
    [Show full text]
  • Understanding the Role of the Chromosome 15Q25.1 in COPD Through Epigenetics and Transcriptomics
    European Journal of Human Genetics (2018) 26:709–722 https://doi.org/10.1038/s41431-017-0089-8 ARTICLE Understanding the role of the chromosome 15q25.1 in COPD through epigenetics and transcriptomics 1 1,2 1,3,4 5,6 5,6 Ivana Nedeljkovic ● Elena Carnero-Montoro ● Lies Lahousse ● Diana A. van der Plaat ● Kim de Jong ● 5,6 5,7 6 8 9 10 Judith M. Vonk ● Cleo C. van Diemen ● Alen Faiz ● Maarten van den Berge ● Ma’en Obeidat ● Yohan Bossé ● 11 1,12 12 1 David C. Nickle ● BIOS Consortium ● Andre G. Uitterlinden ● Joyce J. B. van Meurs ● Bruno C. H. Stricker ● 1,4,13 6,8 5,6 1 1 Guy G. Brusselle ● Dirkje S. Postma ● H. Marike Boezen ● Cornelia M. van Duijn ● Najaf Amin Received: 14 March 2017 / Revised: 6 November 2017 / Accepted: 19 December 2017 / Published online: 8 February 2018 © The Author(s) 2018. This article is published with open access Abstract Chronic obstructive pulmonary disease (COPD) is a major health burden in adults and cigarette smoking is considered the most important environmental risk factor of COPD. Chromosome 15q25.1 locus is associated with both COPD and smoking. Our study aims at understanding the mechanism underlying the association of chromosome 15q25.1 with COPD through epigenetic and transcriptional variation in a population-based setting. To assess if COPD-associated variants in 1234567890();,: 15q25.1 are methylation quantitative trait loci, epigenome-wide association analysis of four genetic variants, previously associated with COPD (P < 5 × 10−8) in the 15q25.1 locus (rs12914385:C>T-CHRNA3, rs8034191:T>C-HYKK, rs13180: C>T-IREB2 and rs8042238:C>T-IREB2), was performed in the Rotterdam study (n = 1489).
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Emerging Roles of Metallothioneins in Beta Cell Pathophysiology: Beyond and Above Metal Homeostasis and Antioxidant Response
    biology Review Emerging Roles of Metallothioneins in Beta Cell Pathophysiology: Beyond and above Metal Homeostasis and Antioxidant Response Mohammed Bensellam 1,* , D. Ross Laybutt 2,3 and Jean-Christophe Jonas 1 1 Pôle D’endocrinologie, Diabète et Nutrition, Institut de Recherche Expérimentale et Clinique, Université Catholique de Louvain, B-1200 Brussels, Belgium; [email protected] 2 Garvan Institute of Medical Research, Sydney, NSW 2010, Australia; [email protected] 3 St Vincent’s Clinical School, UNSW Sydney, Sydney, NSW 2010, Australia * Correspondence: [email protected]; Tel.: +32-2764-9586 Simple Summary: Defective insulin secretion by pancreatic beta cells is key for the development of type 2 diabetes but the precise mechanisms involved are poorly understood. Metallothioneins are metal binding proteins whose precise biological roles have not been fully characterized. Available evidence indicated that Metallothioneins are protective cellular effectors involved in heavy metal detoxification, metal ion homeostasis and antioxidant defense. This concept has however been challenged by emerging evidence in different medical research fields revealing novel negative roles of Metallothioneins, including in the context of diabetes. In this review, we gather and analyze the available knowledge regarding the complex roles of Metallothioneins in pancreatic beta cell biology and insulin secretion. We comprehensively analyze the evidence showing positive effects Citation: Bensellam, M.; Laybutt, of Metallothioneins on beta cell function and survival as well as the emerging evidence revealing D.R.; Jonas, J.-C. Emerging Roles of negative effects and discuss the possible underlying mechanisms. We expose in parallel findings Metallothioneins in Beta Cell from other medical research fields and underscore unsettled questions.
    [Show full text]
  • IL21R Expressing CD14+CD16+ Monocytes Expand in Multiple
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX IL21R expressing CD14 +CD16 + monocytes expand in multiple myeloma patients leading to increased osteoclasts Marina Bolzoni, 1 Domenica Ronchetti, 2,3 Paola Storti, 1,4 Gaetano Donofrio, 5 Valentina Marchica, 1,4 Federica Costa, 1 Luca Agnelli, 2,3 Denise Toscani, 1 Rosanna Vescovini, 1 Katia Todoerti, 6 Sabrina Bonomini, 7 Gabriella Sammarelli, 1,7 Andrea Vecchi, 8 Daniela Guasco, 1 Fabrizio Accardi, 1,7 Benedetta Dalla Palma, 1,7 Barbara Gamberi, 9 Carlo Ferrari, 8 Antonino Neri, 2,3 Franco Aversa 1,4,7 and Nicola Giuliani 1,4,7 1Myeloma Unit, Dept. of Medicine and Surgery, University of Parma; 2Dept. of Oncology and Hemato-Oncology, University of Milan; 3Hematology Unit, “Fondazione IRCCS Ca’ Granda”, Ospedale Maggiore Policlinico, Milan; 4CoreLab, University Hospital of Parma; 5Dept. of Medical-Veterinary Science, University of Parma; 6Laboratory of Pre-clinical and Translational Research, IRCCS-CROB, Referral Cancer Center of Basilicata, Rionero in Vulture; 7Hematology and BMT Center, University Hospital of Parma; 8Infectious Disease Unit, University Hospital of Parma and 9“Dip. Oncologico e Tecnologie Avanzate”, IRCCS Arcispedale Santa Maria Nuova, Reggio Emilia, Italy ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2016.153841 Received: August 5, 2016. Accepted: December 23, 2016. Pre-published: January 5, 2017. Correspondence: [email protected] SUPPLEMENTAL METHODS Immunophenotype of BM CD14+ in patients with monoclonal gammopathies. Briefly, 100 μl of total BM aspirate was incubated in the dark with anti-human HLA-DR-PE (clone L243; BD), anti-human CD14-PerCP-Cy 5.5, anti-human CD16-PE-Cy7 (clone B73.1; BD) and anti-human CD45-APC-H 7 (clone 2D1; BD) for 20 min.
    [Show full text]
  • IER3 Is a Crucial Mediator of Tap73b-Induced Apoptosis In
    OPEN IER3 is a crucial mediator of SUBJECT AREAS: TAp73b-induced apoptosis in cervical CELL DEATH TUMOUR SUPPRESSORS cancer and confers etoposide sensitivity Hanyong Jin1*, Dae-Shik Suh2*, Tae-Hyoung Kim3, Ji-Hyun Yeom4, Kangseok Lee4 & Jeehyeon Bae5 Received 14 September 2014 1Department of Pharmacy, CHA University, Seongnam, 463-836, Korea, 2Department of Obstetrics and Gynecology, Asan Accepted Medical Center, University of Ulsan College of Medicine, 3Department of Biochemistry, Chosun University School of Medicine, 4 5 9 January 2015 Gwangju 501-759, Korea, Department of Life Science, Chung-Ang University, Seoul, 156-756, Korea, School of Pharmacy, Chung-Ang University, Seoul, 156-756, Korea. Published 10 February 2015 Infection with high-risk human papillomaviruses (HPVs) causes cervical cancer. E6 oncoprotein, an HPV gene product, inactivates the major gatekeeper p53. In contrast, its isoform, TAp73b, has become increasingly important, as it is resistant to E6. However, the intracellular signaling mechanisms that account Correspondence and for TAp73b tumor suppressor activity in cervix are poorly understood. Here, we identified that IER3 is a requests for materials novel target gene of TAp73b. In particular, TAp73b exclusively transactivated IER3 in cervical cancer cells, should be addressed to whereas p53 and TAp63 failed to do. IER3 efficiently induced apoptosis, and its knockdown promoted K.L. (kangseok@cau. survival of HeLa cells. In addition, TAp73b-induced cell death, but not p53-induced cell death, was inhibited ac.kr) or J.B. upon IER3 silencing. Moreover, etoposide, a DNA-damaging chemotherapeutics, upregulated TAp73b and IER3 in a c-Abl tyrosine kinase-dependent manner, and the etoposide chemosensitivity of HeLa cells was ([email protected]) largely determined by TAp73b-induced IER3.
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]