Repression of DNA-binding dependent glucocorticoid receptor-mediated gene expression Katy A. Muzikar, Nicholas G. Nickols, and Peter B. Dervan1 Division of Chemistry and Chemical Engineering, California Institute of Technology, Pasadena, CA 91125 Contributed by Peter B. Dervan, August 13, 2009 (sent for review June 4, 2009) The glucocorticoid receptor (GR) affects the transcription of genes genes—is the major mechanism by which GCs achieve their desired involved in diverse processes, including energy metabolism and the anti-inflammatory effect (5, 8, 9). immune response, through DNA-binding dependent and indepen- An understanding of the mechanisms of GR activity on target dent mechanisms. The DNA-binding dependent mechanism occurs by genes has been explored using a variety of approaches, including direct binding of GR to glucocorticoid response elements (GREs) at microarray analysis (10, 11); ChIP scanning (12); and modulation of regulatory regions of target genes. The DNA-binding independent GR activity using siRNA (13), genetic mutants (4), and ligands with mechanism involves binding of GR to transcription factors and coac- modified structures (14). However, these methods would not be tivators that, in turn, contact DNA. A small molecule that competes expected to differentiate explicitly between the direct and indirect with GR for binding to GREs could be expected to affect the DNA- DNA-binding mechanisms of GR action. A small molecule that dependent pathway selectively by interfering with the protein-DNA competes with GR for binding to the consensus GRE could be interface. We show that a DNA-binding polyamide that targets the expected to disrupt GR-DNA binding specifically and be used as a consensus GRE sequence binds the glucocorticoid-induced zipper tool to identify GR target genes whose regulation mechanism (GILZ) GRE, inhibits expression of GILZ and several other known GR depends on a direct protein-DNA interface. This differentiation of target genes, and reduces GR occupancy at the GILZ promoter. mechanisms of GR target gene regulation could contribute to Genome-wide expression analysis of the effects of this polyamide on efforts to develop more specific GR modulators that retain immu- a set of glucocorticoid-induced and -repressed genes could help to nosuppressant functions while minimizing side effects resulting from other GR targets (15). elucidate the mechanism of GR regulation for these genes. BIOCHEMISTRY N-methylpyrrole (Py)–N-methylimidazole (Im) polyamides are a gene regulation ͉ glucocorticoid response element ͉ nuclear receptor ͉ class of programmable DNA-binding ligands capable of binding protein-DNA interface ͉ Py-Im polyamide sequence specifically to DNA with affinities and specificities com- parable to those of natural DNA-binding proteins (16, 17). As oligomers composed of Im and Py heterocyclic rings, Py-Im poly- he glucocorticoid receptor (GR) is a member of the ligand- amides achieve sequence specificity via side-by-side pairings of the Tactivated nuclear receptor group of transcription factors that heterocyclic amino acids in the minor groove of DNA: Im paired bind with high affinity to glucocorticoids (GCs) such as cortisol and against Py distinguishes G⅐C from C⅐G, and Py paired against Py dexamethasone. GR is structurally similar to the androgen and binds both A⅐T and T⅐A (18, 19). Py-Im polyamides have previously progesterone receptors, containing a zinc-finger motif DNA- been used to modulate gene expression in cell culture via inhibition binding domain, a dimerization domain, and a ligand-binding of the transcription factor-DNA interface of both hypoxia inducible domain (1). Ligand binding releases GR from sequestration by factor (20, 21) and androgen receptor (22) to their respective DNA cytoplasmic heat shock proteins (2) and activates a series of cellular response elements. Interruption of the GR-DNA–binding interac- activities that lead to nuclear localization and homodimerization. tion by polyamides represents an opportunity to regulate a distinct Like other steroid hormone receptors, GR is known to modulate subset of the known binding sites for the protein. Because Py-Im gene transcription via the binding of receptor dimers to specific polyamides can be selectively programmed to recognize the known palindromic sequences called glucocorticoid response elements DNA-binding sequence of the GR, there is a unique opportunity to (GREs), usually located in the cis-regulatory region of target inhibit the DNA-binding dependent activity of endogenous GR genes—a mode of action termed transactivation. Additionally, the while leaving the protein-protein–mediated activity unaffected GR has been shown to exert its actions through an indirect (Fig. 1). non–DNA-binding mechanism, termed transrepression, in which In this study, we designed a polyamide targeted to the sequence transcriptional modulation is achieved through cross-talk between 5Ј-WGWWCW-3Ј (where W represents either a T⅐AoranA⅐T base GR and other transcription factors such as NF-␬B (3), activator pair) found in the consensus GRE, with the goal of disrupting protein-1 (AP-1) (4, 5), Sma and Mad-related protein, and mem- GR-GRE binding (Fig. 2A, polyamide 1). This polyamide binds the bers of the STAT family (6). This protein-protein cross-talk does 2 known GREs found in the promoter of the well-characterized not require the DNA-binding activity of the GR, because GR GC-induced leucine zipper (GILZ) gene, inhibits expression of mutants that are deficient in dimerization function have been shown GILZ and 17% of transcripts induced by dexamethasone in cul- to lose DNA-binding ability as well as simple GRE-mediated tured alveolar epithelial cells (A549), and reduces GR occupancy transcription function but retain their transrepression activity (4, 7). at the GILZ promoter in vivo. A ‘‘mismatch’’ polyamide that targets Because many GR target genes are immune modulators, syn- thetic GR agonists such as dexamethasone are among the most Author contributions: K.A.M., N.G.N., and P.B.D. designed research; K.A.M. and N.G.N. effective anti-inflammatory drugs available for the treatment of a performed research; K.A.M., N.G.N., and P.B.D. analyzed data; and K.A.M., N.G.N., and variety of chronic and acute inflammatory diseases. Unfortunately, P.B.D. wrote the paper. because of the functions of other GR target genes, long-term The authors declare no conflict of interest. treatment with corticosteroids results in metabolic and behavioral Freely available online through the PNAS open access option. derangements that can be treatment limiting. Although the GR Data deposition: The data reported in this paper have been deposited in the Gene Expression targets involved in inflammatory and immune regulation have not Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE17307). been comprehensively defined, there is a great deal of evidence 1To whom correspondence should be addressed. E-mail: [email protected]. ␬ suggesting that transrepression—GR interaction with NF- B This article contains supporting information online at www.pnas.org/cgi/content/full/ and/or AP-1 and the subsequent suppression of their target 0909192106/DCSupplemental. www.pnas.org͞cgi͞doi͞10.1073͞pnas.0909192106 PNAS Early Edition ͉ 1of6 Downloaded by guest on October 1, 2021 DNA-binding dependent transcriptional control A pGR_GILZ GRE1 GRE 2 GR GR + + GR GR + polyamide + GRE1 GRE 2 GRE GRE *5'..TAG CCTGCACTTTGTTCT GTCTACTACACATGTCTTAGTG CAAACACCGTGTTCA GA..3' DNA-binding independent transcriptional control 3’..ATC GGACGTGAAACAAGA CAGATGATGTGTACAGAATCAC GTTTGTGGCACAAGT CT..5' B GR GR GR GR 100 nM 100 nM 1 pM 1 1 pM 2 TF + TF Intact G A DNase Intact G A DNase + 12345678910111213 12345678910111213 polyamide TFRE TFRE Fig. 1. Effect of polyamide-DNA binding on the 2 major modes of gene regulation demonstrated by the GR. (Top) Direct mechanism is dependent on GR-DNA binding at the GRE. (Bottom) Indirect mechanism is dependent on GR binding to another protein, indicated here as a general transcription factor (TF) [with binding site TF response element (TFRE)]. A sequence-specific polyamide designed to bind to the GRE but not to the TFRE would alter gene expression controlled by the DNA-binding dependent mechanism but not by the DNA- G G binding independent mechanism. R R E E 2 2 the sequence 5Ј-WGWCGW-3Ј (Fig. 2A, polyamide 2) is used as a control for non–GRE-binding polyamide effects. The subset of G G GR-regulated genes uniquely affected by the GRE-targeted poly- R R E E 1 1 O N A O NH N O N H H 1 N N O N N H H NH3 -O O N N O N N H H N N O H N O N O Fig. 3. DNAse I footprinting of GILZ promoter region. (A) Sequence of the H N HN N N O pGR࿝GILZ plasmid insert. (B) Storage phosphor autoradiograms from quantita- H + N IPA O + tive DNase I footprint titrations of polyamides 1 and 2. Lane 1, intact DNA; lane 2, G reaction; lane 3, A reaction; lane 4, DNase control; lanes 5–13, DNase I O digestion products in the presence of 1, 3, 10, 30, 100, or 300 pM or 1, 3, 10, 30, N O NH or 100 nM polyamide, respectively. N N O N H H N N O N NH - H H 3 O O 2 N N O N N N H H N N O amide may represent a set of genes regulated by GR through direct H N O N O H N GR-GRE binding. HN N N O H N + IPA O + Results Binding Affinities of Py-Im Polyamides to GRE1 and GRE2 of the GILZ B GILZ Promoter. The proximal GILZ promoter contains 2 functional GREs (12) (GRE1: 5Ј-CCTGCActtTGTTCT-3Ј and GRE2: 5Ј- GRE 1 22 bpGRE 2 2438 bp AAACAccgTGTTCA-3Ј) spaced 22 bp apart Ϸ2,500 bp upstream of the transcription start site (Fig.