Celecoxib Ameliorates Seizure Susceptibility in Autosomal Dominant Lateral Temporal Epilepsy

Total Page:16

File Type:pdf, Size:1020Kb

Celecoxib Ameliorates Seizure Susceptibility in Autosomal Dominant Lateral Temporal Epilepsy This Accepted Manuscript has not been copyedited and formatted. The final version may differ from this version. Research Articles: Neurobiology of Disease Celecoxib Ameliorates Seizure Susceptibility in Autosomal Dominant Lateral Temporal Epilepsy Lin Zhou1, Liang Zhou1, Li-da Su2, Sheng-Long Cao3, Ya-Jun Xie1, Na Wang4, Chong-Yu Shao1, Ya-Nan Wang1, Jia-Huan Zhou1, John K. Cowell5 and Ying Shen1 1Department of Neurobiology, Key Laboratory of Medical Neurobiology of the Ministry of Health, Zhejiang University School of Medicine, Hangzhou, China. 2Neuroscience Care Unit 3Department of Neurosurgery, Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, China. 4School of Medicine, Zhejiang University City College, Hangzhou, China. 5GRU Cancer Center, Augusta University, Augusta, GA, USA. DOI: 10.1523/JNEUROSCI.3245-17.2018 Received: 14 November 2017 Revised: 24 January 2018 Accepted: 20 February 2018 Published: 28 February 2018 Author contributions: Lin Zhou and Y.S. designed research; Lin Zhou, Liang Zhou, L.-D.S., S.C., Y.-J.X., N.W., C.-Y.S., Y.-N.W., and J.-H.Z. performed research; Lin Zhou, Liang Zhou, N.W., and Y.S. analyzed data; Lin Zhou, j.c., and Y.S. wrote the paper; j.c. contributed unpublished reagents/analytic tools. Conflict of Interest: The authors declare no competing financial interests. This work was supported by grants from the National Natural Science Foundation of China (81625006, 31471024, and 31571051) and the Natural Science Foundation of Zhejiang Province (Z15C090001). The generation of LGI1-null mice was supported by a grant from the National Institutes of Health to JKC (CA046706). We thank Dr. Z. Josh Huang (Cold Spring Harbor Laboratory, New York, NY) for providing the G42 mutant mice, the Core Facilities of Zhejiang University Institute of Neuroscience for technical assistance, Dr. Zhouyan Feng (Zhejiang University School of Biomedical Engineering, Hangzhou, China) for the suggestions in statistics, and Dr. Iain C. Bruce for reading the manuscript. Corresponding author: Ying Shen, 866 Yu Hang Tang Road, Hangzhou 310058, China. Tel: (86)571-88208240. Email: [email protected] Cite as: J. Neurosci ; 10.1523/JNEUROSCI.3245-17.2018 Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted version of this article is published. Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading process. Copyright © 2018 the authors 1 Celecoxib Ameliorates Seizure Susceptibility in Autosomal Dominant 2 Lateral Temporal Epilepsy 3 Lin Zhou,1,† Liang Zhou,1,† Li-da Su,2 Sheng-Long Cao,3 Ya-Jun Xie,1 Na Wang,4 4 Chong-Yu Shao,1 Ya-Nan Wang,1 Jia-Huan Zhou,1 John K. Cowell,5 Ying Shen1,* 5 6 1Department of Neurobiology, Key Laboratory of Medical Neurobiology of the Ministry of 7 Health, Zhejiang University School of Medicine, Hangzhou, China. 8 2Neuroscience Care Unit; 3Department of Neurosurgery, Second Affiliated Hospital of 9 Zhejiang University School of Medicine, Hangzhou, China. 10 4School of Medicine, Zhejiang University City College, Hangzhou, China. 11 5GRU Cancer Center, Augusta University, Augusta, GA, USA. 12 †These authors contributed equally to this work. 13 *Corresponding author: Ying Shen, 866 Yu Hang Tang Road, Hangzhou 310058, 14 China. Tel: (86)571-88208240. Email: [email protected]. 15 16 Number of text pages: 49 / Figures: 6 / Tables: 7 17 Number of words for Abstract: 186 / Introduction: 428 / Discussion: 955 18 Abbreviated Title: Celecoxib ameliorates LGI1-related epilepsy 19 20 Acknowledgements 21 This work was supported by grants from the National Natural Science Foundation of 22 China (81625006, 31471024, and 31571051) and the Natural Science Foundation of 23 Zhejiang Province (Z15C090001). The generation of LGI1-null mice was supported by a 24 grant from the National Institutes of Health to JKC (CA046706). We thank Dr. Z. Josh 25 Huang (Cold Spring Harbor Laboratory, New York, NY) for providing the G42 mutant mice, 26 the Core Facilities of Zhejiang University Institute of Neuroscience for technical assistance, 1 27 Dr. Zhouyan Feng (Zhejiang University School of Biomedical Engineering, Hangzhou, 28 China) for the suggestions in statistics, and Dr. Iain C. Bruce for reading the manuscript. 2 29 Abstract 30 31 Autosomal dominant lateral temporal epilepsy (ADLTE) is an inherited syndrome caused 32 by mutations in the leucine-rich glioma inactivated 1 (LGI1) gene. It is known that 33 glutamatergic transmission is altered in LGI1 mutant mice and seizures can be reduced by 34 restoring LGI1 function. Yet, the mechanism underlying ADLTE is unclear. Here, we 35 propose that seizures in male LGI1-/- mice are due to non-synaptic epileptiform activity in 36 cortical neurons. We examined the intrinsic excitability of pyramidal neurons in the 37 temporal cortex of male LGI1-/- mice and found that the voltage-gated K+ channel Kv1.2 38 was significantly downregulated. We also found that cytosolic phospholipase A2 -/- 39 (cPLA2)-cyclooxygenase 2 (Cox2) signaling was enhanced in LGI1 mice. Interestingly, 40 Cox2 inhibition effectively restored the dysregulated Kv1.2 and reduced the intrinsic 41 excitability of pyramidal neurons. Moreover, in vivo injection of celecoxib, an 42 FDA-approved nonsteroidal anti-inflammatory drug, rescued the defective Kv1.2 (a 43 ~1.9-fold increase), thereby alleviating the seizure susceptibility and extending the life of 44 LGI1-/- mice by 5 days. In summary, we conclude that LGI1 deficiency dysregulates 45 cPLA2-Cox2 signaling to cause hyperexcitability of cortical pyramidal neurons, and 46 celecoxib is a potential agent to manage human ADLTE. 47 48 Key words: ADLTE; Cox2; epilepsy; Kv1.2; celecoxib 49 3 50 Significance statement 51 52 Haploinsufficiency of the leucine-rich glioma inactivated 1 (LGI1) gene is the major 53 pathogenic basis for ADLTE, an inherited syndrome with no cure to date. Existing studies 54 suggest that altered glutamatergic transmission in the hippocampus causes this disease, 55 but the data are paradoxical. We demonstrate that the loss of LGI1 decreases Kv1.2 56 expression, enhances intrinsic excitability, and thereby causes epilepsy. Interestingly, we 57 for the first time show that an FDA-approved drug, celecoxib, rescues the Kv1.2 defect and 58 alleviates seizure susceptibility in LGI1-/- mice, as well as improving their survival. Thus, 59 we suggest that celecoxib is a promising drug for the treatment of ADLTE patients. 60 4 61 Introduction 62 63 Autosomal dominant lateral temporal epilepsy (ADLTE, also known as autosomal 64 dominant epilepsy with auditory features) is an inherited syndrome characterized by the 65 onset of temporal cortical seizures in adolescence or early adulthood (Ottman et al., 1995) 66 in the absence of structural abnormalities by magnetic resonance imaging (Michelucci et 67 al., 2003). ADLTE seizures occur at a low frequency (1-2 per month) and usually during 68 sleep (Michelucci et al., 2003; Michelucci et al., 2007). Aphasia and visual hallucinations 69 are reported in a minority of patients, either alone or accompanying auditory symptoms 70 (Michelucci et al., 2003; Michelucci et al., 2007). Haploinsufficiency of the leucine-rich 71 glioma-inactivated 1 (LGI1) gene is the major pathogenic basis for human ADLTE 72 (Kalachikov et al., 2002; Senechal et al., 2005; Fukata et al., 2006). Homozygous LGI1-/- 73 mice display generalized seizures and premature death (Chabrol et al., 2010; Fukata et al., 74 2010; Yu et al., 2010), while heterozygous LGI1+/- mice display increased seizure 75 susceptibility to acoustic stimuli (Chabrol et al., 2007) and the convulsant agent 76 pentylenetetrazole (PTZ) (Fukata et al., 2010). 77 Several functions of LGI1 in the central nervous system have been demonstrated: (i) 78 inhibiting the inactivation of the presynaptic K+ channel Kv1 (Schulte et al., 2006); (ii) 79 regulating the pruning of glutamatergic synapses in the hippocampus (Zhou et al., 2009) 80 through interaction with ADAM (a disintegrin and metalloproteinase) (Fukata et al., 2006; 81 Fukata et al., 2010; Ohkawa et al., 2013); (iii) increasing neuronal growth through an 82 interaction with Nogo receptors (Thomas et al., 2010); and (iv) causing subtle cortical 5 83 dyslamination (Silva et al., 2015) and reduced thickness of the external granule layer with 84 abnormal foliation in the embryonic cerebellum (Xie et al., 2015). Using conditional lines, 85 Boillot et al. demonstrated that glutamatergic neurons contribute to the seizure 86 phenotypes in LGI1-/- mice (Boillot et al., 2014). Similarly, two independent studies have 87 suggested that altered glutamatergic transmission is the pathologic basis for the seizure 88 phenotypes in LGI1-/- mice (Fukata et al., 2010; Yu et al., 2010). 89 However, how LGI1 deficiency leads to seizures remains unclear. In LGI1-/- mice, Yu 90 et al. (2010) showed enhanced glutamate transmission in the hippocampus, but Fukata et 91 al. (2010) suggested that it is reduced. While this discrepancy may be due to knockout 92 strategies, it is possible that hippocampal synaptic transmission is not the decisive factor 93 in ADLTE. In fact, increased epileptic discharges are evident characteristics of ADLTE 94 patients with LGI1 mutations (Ottman et al., 1995; Michelucci et al., 2009). Here, we set 95 out to investigate the intrinsic excitability of pyramidal neurons in the temporal lobe cortex 96 of LGI1-/- mice and the effects of celecoxib. 97 6 98 Materials and Methods 99 100 Animals. The animal experiments were approved by the Animal Experimentation Ethics 101 Committee of Zhejiang University. Wild-type (WT) and LGI1-/- mice were maintained at the 102 Experimental Animal Center of Zhejiang University and kept in temperature-controlled 103 conditions under a 12:12 h light/dark cycle with food and water ad libitum. Male mice were 104 used in all experiments. 105 106 Antibodies and reagents. Antibodies against Kv1.2 (#K14/16), Kv1.4 (#K13/31), Kv1.6 107 (#K19/36), Nav1.1 (#K74/71), Nav1.2 (#K69/3), and Nav1.6 (#K87a/10) were from 108 Neuromab (Davis, CA).
Recommended publications
  • Identification of Differentially Expressed Genes in Urinary Bladder Cancer by Meta-Analysis by Using a Bioinformatics Tool Sathya Mylsamy1* and K Devaki2
    Research Article iMedPub Journals Journal of Clinical & Experimental Nephrology 2019 http://www.imedpub.com/ Vol 5.No.5:95 ISSN 2472-5056 Identification of Differentially Expressed Genes in Urinary Bladder Cancer by Meta-Analysis by Using a Bioinformatics Tool Sathya Mylsamy1* and K Devaki2 1Department of Biochemistry, CMS College of Science and Commerce, Coimbatore, Tamil Nadu, India 2Department of Biochemistry, Karpagam Academy of Higher Education, Coimbatore, Tamil Nadu, India *Corresponding author: Sathya Mylsamy, CMS College of Science and Commerce, Tamil Nadu, India, Tel: (+91)7904349498; E-mail: [email protected] Received date: November 18, 2020 ; Accepted date: December 02, 2020 ; Published date: December 09, 2020 Citation: Mylsamy S, Devaki K (2020) Identification of Differentially Expressed Genes in Urinary Bladder Cancer by Meta-Analysis by using a Bioinformatics Tool. J Clin Exp Nephrol Vol.5 No.5:95. Copyright: © 2020 Mylsamy S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. understand the mechanism behind the tumor progression and its diagnosis. Abstract Background: Bladder cancer is the ninth most prevalent Keywords: Bladder cancer; GEO; CCNB2; NUSAP1; malignant disease globally, which ranges from mild with low ADAM22; KEGG; Gene ontology mortality rate to extremely high grade tumors associated with high mortality rate. The present study was aimed to identify the key genes associated with bladder cancer Introduction progression and later it may also be used as marker in the diagnosis and prognosis. The bladder is probably one of the few sites in the body where the environmental factors play an undeniable role in Materials and methods: The GSE3167, GSE7476, GSE68928 genesis of cancer [1].
    [Show full text]
  • Lgi1 (NM 145769) Rat Tagged ORF Clone – RR210565 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RR210565 Lgi1 (NM_145769) Rat Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Lgi1 (NM_145769) Rat Tagged ORF Clone Tag: Myc-DDK Symbol: Lgi1 Synonyms: MGC105310 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Lgi1 (NM_145769) Rat Tagged ORF Clone – RR210565 ORF Nucleotide >RR210565 representing NM_145769 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAATCAGAAAGCATCAGAAGGATGGGAAATGCCTGCATTCCCCTGAAAAGAATTGCCTATTTCCTAT GCCTCTTTTCTGTGGTTTTGCTGACTGAGGGGAAGAAACCAGCGAAGCCAAAATGCCCTGCTGTGTGTAC TTGTAGCAAAGATAACGCTTTATGTGAGAATGCGAGATCCATTCCACGCACCGTTCCTCCTGATGTTATC TCACTATCCTTTGTGAGATCTGGTTTTACTGAAATCTCAGAAGGGAGTTTCTTGTTCACACCATCGCTGC AGCTCTTGTTATTCACGTCGAACTCCTTTGATGTGATCAGTGACGATGCTTTTATTGGTCTTCCACACCT AGAATATTTATTCATAGAAAACAACAATATCAAGTCCATTTCAAGACATACTTTCCGGGGACTCAAGTCT CTGATTCACTTGAGTCTTGCAAACAACAATCTCCAGACACTCCCAAAAGACATTTTCAAAGGCCTGGATT CTTTAACAAATGTGGACCTAAGAGGGAACTCATTTAACTGTGACTGTAAACTGAAGTGGCTGGTGGAATG GCTCGGCCACACCAACGCAACCGTGGAAGACATCTACTGCGAAGGACCACCGGAGTATAAGAAACGTAAA
    [Show full text]
  • Product Description P408-A2 ADLTE-LGI1-V02
    MRC-Holland ® Product Description version A2-02; Issued 02 December 2020 MLPA Product Description SALSA® MLPA® Probemix P408-A2 ADLTE-LGI1 To be used with the MLPA General Protocol. Version A2. For complete product history see page 7. Catalogue numbers: • P408-025R: SALSA MLPA Probemix P408 ADLTE-LGI1, 25 reactions. • P408-050R: SALSA MLPA Probemix P408 ADLTE-LGI1, 50 reactions. • P408-100R: SALSA MLPA Probemix P408 ADLTE-LGI1, 100 reactions. To be used in combination with a SALSA MLPA reagent kit and Coffalyser.Net data analysis software. MLPA reagent kits are either provided with FAM or Cy5.0 dye-labelled PCR primer, suitable for Applied Biosystems and Beckman/SCIEX capillary sequencers, respectively (see www.mlpa.com). Certificate of Analysis: Information regarding storage conditions, quality tests, and a sample electropherogram from the current sales lot is available at www.mlpa.com. Precautions and warnings: For professional use only. Always consult the most recent product description AND the MLPA General Protocol before use: www.mlpa.com. It is the responsibility of the user to be aware of the latest scientific knowledge of the application before drawing any conclusions from findings generated with this product. General information: The SALSA MLPA Probemix P408 ADLTE-LGI1 is a research use only (RUO) assay for the detection of deletions or duplications in ADAM22, ADGRV1 (was GPR98), KCNA1, KCNA4, KCNAB1, LGI1, and PDYN genes, which are associated with autosomal dominant lateral temporal epilepsy (ADLTE). ADLTE, also known as autosomal dominant partial epilepsy with auditory features (ADPEAF), is a rare familial form of epilepsy likely arising from the lateral temporal lobe of the brain.
    [Show full text]
  • LGI1–ADAM22–MAGUK Configures Transsynaptic Nanoalignment for Synaptic Transmission and Epilepsy Prevention
    LGI1–ADAM22–MAGUK configures transsynaptic nanoalignment for synaptic transmission and epilepsy prevention Yuko Fukataa,b,1, Xiumin Chenc,d,1, Satomi Chikenb,e, Yoko Hiranoa,f, Atsushi Yamagatag, Hiroki Inahashia, Makoto Sanboh, Hiromi Sanob,e, Teppei Gotoh, Masumi Hirabayashib,h, Hans-Christian Kornaui,j, Harald Prüssi,k, Atsushi Nambub,e, Shuya Fukail, Roger A. Nicollc,d,2, and Masaki Fukataa,b,2 aDivision of Membrane Physiology, Department of Molecular and Cellular Physiology, National Institute for Physiological Sciences, National Institutes of Natural Sciences, Aichi 444-8787, Japan; bDepartment of Physiological Sciences, School of Life Science, SOKENDAI (The Graduate University for Advanced Studies), Aichi 444-8585, Japan; cDepartment of Cellular and Molecular Pharmacology, University of California, San Francisco, CA 94158; dDepartment of Physiology, University of California, San Francisco, CA 94158; eDivision of System Neurophysiology, Department of System Neuroscience, National Institute for Physiological Sciences, National Institutes of Natural Sciences, Aichi 444-8585, Japan; fDepartment of Pediatrics, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655, Japan; gLaboratory for Protein Functional and Structural Biology, RIKEN Center for Biosystems Dynamics Research, Kanagawa 230-0045, Japan; hCenter for Genetic Analysis of Behavior, National Institute for Physiological Sciences, National Institutes of Natural Sciences, Okazaki 444-8787, Japan; iGerman Center for Neurodegenerative Diseases (DZNE), 10117 Berlin, Germany; jNeuroscience Research Center, Cluster NeuroCure, Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany; kDepartment of Neurology and Experimental Neurology, Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany; and lDepartment of Chemistry, Graduate School of Science, Kyoto University, 606-8502 Kyoto, Japan Contributed by Roger A. Nicoll, December 1, 2020 (sent for review October 29, 2020; reviewed by David S.
    [Show full text]
  • Quantitative Proteomics Reveals Significant Differences
    cells Article Quantitative Proteomics Reveals Significant Differences between Mouse Brain Formations in Expression of Proteins Involved in Neuronal Plasticity during Aging Dominika Drulis-Fajdasz 1,† , Kinga Gostomska-Pampuch 2,3,† , Przemysław Duda 1 , Jacek Roman Wi´sniewski 2 and Dariusz Rakus 1,* 1 Department of Molecular Physiology and Neurobiology, University of Wrocław, Sienkiewicza 21, 50-335 Wrocław, Poland; [email protected] (D.D.-F.); [email protected] (P.D.) 2 Biochemical Proteomics Group, Department of Proteomics and Signal Transduction, Max Planck Institute of Biochemistry, 82152 Martinsried, Germany; [email protected] (K.G.-P.); [email protected] (J.R.W.) 3 Department of Biochemistry and Immunochemistry, Wrocław Medical University, Chałubi´nskiego10, 50-368 Wrocław, Poland * Correspondence: [email protected] † The authors participated equally. Abstract: Aging is associated with a general decline in cognitive functions, which appears to be due to alterations in the amounts of proteins involved in the regulation of synaptic plasticity. Here, we present a quantitative analysis of proteins involved in neurotransmission in three brain regions, namely, the hippocampus, the cerebral cortex and the cerebellum, in mice aged 1 and 22 months, Citation: Drulis-Fajdasz, D.; using the total protein approach technique. We demonstrate that although the titer of some proteins Gostomska-Pampuch, K.; Duda, P.; involved in neurotransmission and synaptic plasticity is affected by aging in a similar manner Wi´sniewski,J.R.; Rakus, D. Quantitative Proteomics Reveals in all the studied brain formations, in fact, each of the formations represents its own mode of Significant Differences between aging.
    [Show full text]
  • Neurology Genetics
    An Official Journal of the American Academy of Neurology Neurology.org/ng • Online ISSN: 2376-7839 Volume 3, Number 4, August 2017 Genetics Functionally pathogenic ExACtly zero or once: Clinical and experimental EARS2 variants in vitro A clinically helpful guide studies of a novel P525R may not manifest a to assessing genetic FUS mutation in amyotrophic phenotype in vivo variants in mild epilepsies lateral sclerosis Table of Contents Neurology.org/ng Online ISSN: 2376-7839 Volume 3, Number 4, August 2017 THE HELIX e171 Autopsy case of the C12orf65 mutation in a patient e175 What does phenotype have to do with it? with signs of mitochondrial dysfunction S.M. Pulst H. Nishihara, M. Omoto, M. Takao, Y. Higuchi, M. Koga, M. Kawai, H. Kawano, E. Ikeda, H. Takashima, and T. Kanda EDITORIAL e173 This variant alters protein function, but is it pathogenic? M. Pandolfo e174 Prevalence of spinocerebellar ataxia 36 in a US Companion article, e162 population J.M. Valera, T. Diaz, L.E. Petty, B. Quintáns, Z. Yáñez, ARTICLES E. Boerwinkle, D. Muzny, D. Akhmedov, R. Berdeaux, e162 Functionally pathogenic EARS2 variants in vitro may M.J. Sobrido, R. Gibbs, J.R. Lupski, D.H. Geschwind, not manifest a phenotype in vivo S. Perlman, J.E. Below, and B.L. Fogel N. McNeill, A. Nasca, A. Reyes, B. Lemoine, B. Cantarel, A. Vanderver, R. Schiffmann, and D. Ghezzi Editorial, e173 e170 Loss-of-function variants of SCN8A in intellectual disability without seizures e163 ExACtly zero or once: A clinically helpful guide to J.L. Wagnon, B.S. Barker, M.
    [Show full text]
  • LGI1 Gene Leucine Rich Glioma Inactivated 1
    LGI1 gene leucine rich glioma inactivated 1 Normal Function The LGI1 gene provides instructions for making a protein called leucine-rich glioma inactivated 1 (Lgi1) or epitempin. This protein is found primarily in nerve cells (neurons) in the brain, including a part of the brain called the lateral temporal lobe. The temporal lobe of the brain is involved in hearing, speech, memory, and emotion. Although researchers have proposed several functions for epitempin, its precise role in the brain remains uncertain. This protein is probably involved in normal brain development. Some studies have suggested that epitempin plays a role in the normal function of potassium channels in neurons. These channels are embedded in the cell membrane, where they transport charged potassium atoms (potassium ions) out of neurons. Potassium channels are critical for normal electrical signaling in these cells. Other studies have found that epitempin is transported (secreted) out of neurons. The function of this protein outside cells is unclear. Epitempin may also help regulate the communication between neurons. Researchers have determined that epitempin attaches (binds) to a receptor protein called ADAM22 on the surface of neurons. Together, these proteins help control the release of certain brain chemicals called neurotransmitters. These chemicals allow neighboring neurons to communicate with each other, which is how signals are relayed throughout the brain. Health Conditions Related to Genetic Changes Autosomal dominant partial epilepsy with auditory features At least 22 mutations in the LGI1 gene have been identified in people with autosomal dominant partial epilepsy with auditory features (ADPEAF). Some LGI1 mutations change a single protein building block (amino acid) in the epitempin protein, which alters the protein's structure.
    [Show full text]
  • Global Proteomic Analysis of Extracellular Matrix in Mouse And
    Edinburgh Research Explorer Global proteomic analysis of extracellular matrix in mouse and human brain highlights relevance to cerebrovascular disease Citation for published version: Pokhilko, A, Brezzo, G, Handunnetthi, L, Heilig, R, Lennon, R, Smith, C, Allan, SM, Granata, A, Sinha, S, Wang, T, Markus, HS, Naba, A, Fischer, R, Van Agtmael, T, Horsburgh, K & Cader, MZ 2021, 'Global proteomic analysis of extracellular matrix in mouse and human brain highlights relevance to cerebrovascular disease', Journal of Cerebral Blood Flow and Metabolism, vol. 41, no. 9, pp. 2423–2438. https://doi.org/10.1177/0271678X211004307 Digital Object Identifier (DOI): 10.1177/0271678X211004307 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Journal of Cerebral Blood Flow and Metabolism General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct.
    [Show full text]
  • Similarity of Molecular Phenotype Between Known Epilepsy Gene LGI1 and Disease Candidate Gene LGI2
    Limviphuvadh et al. BMC Biochemistry 2010, 11:39 http://www.biomedcentral.com/1471-2091/11/39 RESEARCH ARTICLE Open Access Similarity of molecular phenotype between known epilepsy gene LGI1 and disease candidate gene LGI2 Vachiranee Limviphuvadh1†, Ling Ling Chua1†, Rabi ’Atul’ Adawiyah Bte Rahim1, Frank Eisenhaber1,2,3, Sebastian Maurer-Stroh1,4, Sharmila Adhikari1* Abstract Background: The LGI2 (leucine-rich, glioma inactivated 2) gene, a prime candidate for partial epilepsy with pericentral spikes, belongs to a family encoding secreted, beta-propeller domain proteins with EPTP/EAR epilepsy- associated repeats. In another family member, LGI1 (leucine-rich, glioma inactivated 1) mutations are responsible for autosomal dominant lateral temporal epilepsy (ADLTE). Because a few LGI1 disease mutations described in the literature cause secretion failure, we experimentally analyzed the secretion efficiency and subcellular localization of several LGI1 and LGI2 mutant proteins corresponding to observed non-synonymous single nucleotide polymorphisms (nsSNPs) affecting the signal peptide, the leucine-rich repeats and the EAR propeller. Results: Mapping of disease-causing mutations in the EAR domain region onto a 3D-structure model shows that many of these mutations co-localize at an evolutionary conserved surface region of the propeller. We find that wild-type LGI2 is secreted to the extracellular medium in glycosylated form similarly to LGI1, whereas several mutant proteins tested in this study are secretion-deficient and accumulate in the endoplasmic reticulum. Interestingly, mutations at structurally homologous positions in the EAR domain have the same effect on secretion in LGI1 and LGI2. Conclusions: This similarity of experimental mislocalization phenotypes for mutations at homologous positions of LGI2 and the established epilepsy gene LGI1 suggests that both genes share a potentially common molecular pathogenesis mechanism that might be the reason for genotypically distinct but phenotypically related forms of epilepsy.
    [Show full text]
  • Skeletal Muscle Transcriptome in Healthy Aging
    ARTICLE https://doi.org/10.1038/s41467-021-22168-2 OPEN Skeletal muscle transcriptome in healthy aging Robert A. Tumasian III 1, Abhinav Harish1, Gautam Kundu1, Jen-Hao Yang1, Ceereena Ubaida-Mohien1, Marta Gonzalez-Freire1, Mary Kaileh1, Linda M. Zukley1, Chee W. Chia1, Alexey Lyashkov1, William H. Wood III1, ✉ Yulan Piao1, Christopher Coletta1, Jun Ding1, Myriam Gorospe1, Ranjan Sen1, Supriyo De1 & Luigi Ferrucci 1 Age-associated changes in gene expression in skeletal muscle of healthy individuals reflect accumulation of damage and compensatory adaptations to preserve tissue integrity. To characterize these changes, RNA was extracted and sequenced from muscle biopsies col- 1234567890():,; lected from 53 healthy individuals (22–83 years old) of the GESTALT study of the National Institute on Aging–NIH. Expression levels of 57,205 protein-coding and non-coding RNAs were studied as a function of aging by linear and negative binomial regression models. From both models, 1134 RNAs changed significantly with age. The most differentially abundant mRNAs encoded proteins implicated in several age-related processes, including cellular senescence, insulin signaling, and myogenesis. Specific mRNA isoforms that changed sig- nificantly with age in skeletal muscle were enriched for proteins involved in oxidative phosphorylation and adipogenesis. Our study establishes a detailed framework of the global transcriptome and mRNA isoforms that govern muscle damage and homeostasis with age. ✉ 1 National Institute on Aging–Intramural Research Program, National
    [Show full text]
  • Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands That Promote Axonal Growth
    Research Article: New Research Development Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands that Promote Axonal Growth Jeremy S. Toma,1 Konstantina Karamboulas,1,ª Matthew J. Carr,1,2,ª Adelaida Kolaj,1,3 Scott A. Yuzwa,1 Neemat Mahmud,1,3 Mekayla A. Storer,1 David R. Kaplan,1,2,4 and Freda D. Miller1,2,3,4 https://doi.org/10.1523/ENEURO.0066-20.2020 1Program in Neurosciences and Mental Health, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada, 2Institute of Medical Sciences University of Toronto, Toronto, Ontario M5G 1A8, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario M5G 1A8, Canada, and 4Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1A8, Canada Abstract Peripheral nerves provide a supportive growth environment for developing and regenerating axons and are es- sential for maintenance and repair of many non-neural tissues. This capacity has largely been ascribed to paracrine factors secreted by nerve-resident Schwann cells. Here, we used single-cell transcriptional profiling to identify ligands made by different injured rodent nerve cell types and have combined this with cell-surface mass spectrometry to computationally model potential paracrine interactions with peripheral neurons. These analyses show that peripheral nerves make many ligands predicted to act on peripheral and CNS neurons, in- cluding known and previously uncharacterized ligands. While Schwann cells are an important ligand source within injured nerves, more than half of the predicted ligands are made by nerve-resident mesenchymal cells, including the endoneurial cells most closely associated with peripheral axons. At least three of these mesen- chymal ligands, ANGPT1, CCL11, and VEGFC, promote growth when locally applied on sympathetic axons.
    [Show full text]
  • Acute Effects of LGI1 on Network Excitability
    Acute effects of LGI1 on network excitability Eleonora Lugarà A thesis submitted to University College London for the degree of Doctor of Philosophy University College London Department of Clinical and Experimental Epilepsy UCL Queen Square Institute of Neurology Queen Square London WC1N 3BG March 2019 1 Declaration I, Eleonora Lugarà, confirm that the work presented in this thesis is my own. When information has been derived from other sources or are from the contribution of others, I confirm that this has been clearly indicated in the thesis. 2 Abstract LGI1 (leucine rich glioma inactivated1) is a secreted trans-synaptic protein and is part of the brain extracellular matrix. LGI1 interacts presynaptically with Kv1.1 potassium channels and ADAM23, a structural transmembrane protein. Postsynaptically, LGI1 also influences AMPA and NMDA receptors via the ADAM22 adhesion protein. Mutations in the gene encoding LGI1 lead to temporal lobe epilepsy in humans and animal models. Autoantibodies against LGI1 have been detected in the serum of adult patients with limbic encephalitis and seizures. Although LGI1 is strongly implicated in the generation and spread of seizures in genetic and developmental forms of epilepsy, the mechanisms by which LGI1 affects neuronal networks are still debated. This thesis aimed to determine whether an acute reduction of LGI1 in the brain leads to network hyperactivity and epilepsy in rodent animals and the mechanisms behind it. Initially, in vivo experiments on rats demonstrated that LGI1 concentrations in the brain are reduced after generation of chronic seizures using the perforant path stimulation model. I then chose and validated a silencing RNA (shRNA) against LGI1 which reduced endogenous LGI1 levels in primary cultures.
    [Show full text]