DOCSLIB.ORG

Acute Effects of LGI1 on Network Excitability

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Acute Effects of LGI1 on Network Excitability Acute effects of LGI1 on network excitability Eleonora Lugarà A thesis submitted to University College London for the degree of Doctor of Philosophy University College London Department of Clinical and Experimental Epilepsy UCL Queen Square Institute of Neurology Queen Square London WC1N 3BG March 2019 1 Declaration I, Eleonora Lugarà, confirm that the work presented in this thesis is my own. When information has been derived from other sources or are from the contribution of others, I confirm that this has been clearly indicated in the thesis. 2 Abstract LGI1 (leucine rich glioma inactivated1) is a secreted trans-synaptic protein and is part of the brain extracellular matrix. LGI1 interacts presynaptically with Kv1.1 potassium channels and ADAM23, a structural transmembrane protein. Postsynaptically, LGI1 also influences AMPA and NMDA receptors via the ADAM22 adhesion protein. Mutations in the gene encoding LGI1 lead to temporal lobe epilepsy in humans and animal models. Autoantibodies against LGI1 have been detected in the serum of adult patients with limbic encephalitis and seizures. Although LGI1 is strongly implicated in the generation and spread of seizures in genetic and developmental forms of epilepsy, the mechanisms by which LGI1 affects neuronal networks are still debated. This thesis aimed to determine whether an acute reduction of LGI1 in the brain leads to network hyperactivity and epilepsy in rodent animals and the mechanisms behind it. Initially, in vivo experiments on rats demonstrated that LGI1 concentrations in the brain are reduced after generation of chronic seizures using the perforant path stimulation model. I then chose and validated a silencing RNA (shRNA) against LGI1 which reduced endogenous LGI1 levels in primary cultures. In the transduced neurons, spontaneous calcium activity was significantly higher, without affecting the viability of the cells. Also the MBR (mean bursting rate) of transduced neuronal cultures measured with a MEA (multielectrode arrays) system was increased. In ex vivo granule cells, shRNA-LGI1 increased neuronal firing. Local field potential (LFP) of ex vivo slices after injection of shRNA-LGI1 in the hippocampus, revealed an increase in the short-term facilitation of mossy fibers to CA3 pyramidal cell synapses. Application of Kv1 family blocker, αDendrotoxin, occluded the increased facilitation in shRNA-LGI1 injected mice. My results indicate that an acute reduction of LGI1 is sufficient to increase neuronal network excitability in in vitro and ex vivo systems and that LGI1 concentrations are reduced in the brains of animals during the development of epilepsy. 3 Impact Statement Epilepsy is a major health burden, affecting about 1% of the worldwide population. Although many are treated effectively by antiseizure drugs, approximately 30% have drug-resistant, refractory epilepsy. For these people, epilepsy can be a devastating condition with major consequences including unemployment, injuries, depression and increased mortality. The epilepsies have a multitude of causes from acquired brain lesions, developmental disorders and genetic mutations. My thesis focuses on LGI1 (leucine rich glioma inactivated protein 1) a brain protein which is part of a matrix which surrounds neurons. LGI1 has many interactions with pre and post synaptic ion channels and several trans-synaptic partners, important for brain and circuit development and neuronal transmission. Importantly, mutations in the gene encoding LGI1 lead to familial temporal lobe epilepsy with audiogenic features (ADTLE, autosomal dominant lateral temporal epilepsy). In recent years, specific auto antibodies against LGI1 have also been shown to be a cause of epilepsy, characterised by focal dystonic seizures and cognitive impairment. However, it is not clear whether it is the targeting of LGI1 by antibodies or the consequent inflammation that is the cause of the condition. The aim of my work was to identify the acute role of LGI1 in brain circuits and epilepsy. In particular, in this thesis I show that LGI1 is downregulated after acquired chronic epilepsy and this is associated with changes in network excitability associated with LGI1 partners. This indicates that loss of LGI1 may play a broader role in the epilepsies, and may be common feature amongst a number of aetiologies. I then validated a method to downregulate LGI1 in neuronal circuits and demonstrated that local alterations of LGI1 levels in specific brain circuits, affect network excitability. These novel findings confirm that reduction of LGI1 alone affects brain circuits and neuronal behaviour, suggesting a pathophysiological role in acquired epilepsy, a genetic epilepsy and acute limbic encephalitis due to IgG-LGI1. This work opens up promising prospects to develop protective strategies for epilepsy by redressing the loss of LGI1 4 through small molecule and gene delivery approaches. The insights from this thesis will, therefore, hopefully lead to improved therapies for those people with drug-resistant epilepsies. 5 Acknowledgements This work would not have been possible without the input, help and supervision of many people. I dedicate this thesis to all of you, who enlightened these years in London and my daily life. First and foremost, I am very grateful to Professor Matthew Walker for giving me the chance to work in his lab, for teaching me so much about epilepsy and the brain, and for being such a positive and supportive supervisor. Thank you for having always patience with me for all the failed experiments and for all the right advices during these years. You are a role model by whom I will always be inspired. A sincere and invaluable thanks to Dr. Gabriele Lignani, my secondary supervisor, mentor and friend. Gabriele hugely contributed to shape this project and get me through tough times, helping me with every aspect of the project and encouraging me to think critically. Thank you for involving me in many collaborative works and for all the coffees we shared. Any student who has and will have the chance to be guided by you is a lucky student. Thanks to all the Epilepsy Department (DCEE), it has been a great family with which I spent a lot of time during these three and half years. A special mention to Professor Dimitri Kullmann for adopting me in his weekly lab meetings and supporting part of the in vivo works. A warm acknowledgement to Dr. Gareth Morris, for all the coffees and help with electrophysiology, English and broccoli, but especially for the latter ones. Thanks to Dr. Erica Tagliatti, for her advices on molecular biology, immunohistochemistry, imaging and uncountable other topics. Good luck for your promising future career. Thanks to Jenna Carpenter, for the precious help with virus design, cell cultures and long talks during weekends and nights at work. Thanks to Dr. Tawfeeq Shekh-Ahmad, for his great help in calcium imaging, in vivo works, ugly molarity calculations and the delicious baklava. Thanks to (Dr.) Sylvain Rama, Marion Mercier, Vincent Magloire, Tom Jensen, Edward Maguire for all the patch clamp and LFP tips. Thanks to my previous colleagues 6 in Walker’s lab: (Dr.) Amy Nick, Pi-Shan Chang, Ramona Eckel and Sophie Williams for being so nice to me. Thanks to Dr. Elodie Chabrol, for teaching me the value of communicating science in an accessible and creative way. Thanks to Dr. Nicol Birsa, Dr. Carmelo Milioto and Dr. Nancy Malintan for their insights into western blot. Thanks to Dr. Sarah Crisp and Dr. Michael Chou for their help with the autoantibody work. Thanks to Dr. Jonathan Cornford, Yichen Qiu, Dr. Christine Dixon, Dr. Andreas Lieb, Dr. Albert Snowball, Dr. Elizabeth Nicholson, Dr. Bao-Luen Chang, Dr. Mikail Weston, Steffan Jones, Olga Tiurikova, Dr. Janosch Heller and many many many other colleagues in the Department and in the Institute of Neurology. I am very grateful for having had the chance to contribute to a fantastic PhD program founded by the Marie Skłodowska-Curie Actions (ECMED project). I had the pleasure to know irreplaceable fellows with which I have built a relationship that goes well beyond collaborations, borders and research projects. Thanks to Antonia, Mehwish, Eduardo, Sandra, Shaobo, Anatoly, Danylo, Alessandra R., Marion, Alessandra P., Armand, Anvesh and Greg. I look forward to see you all again. Thanks to my brilliant students, Elizabeth Brockman and Liam Colclough. These teaching experiences have been a journey from which I have learnt a lot as well. Thanks to my lifetime friends: Sara, Francesca, Valentina, Guendalina, Cristina, Emily, Valentina (Valigia), Roberta (Sbomb), Francesca (Pepper), Chiaretta & Mattia. I cannot wait to buy a teleportation machine to be closer to all of you. Thanks to newer friends which make my life in London rich and vibrant: Carolina, Ilaria & Michele, Karine and Xun. Thanks to Dr. Marco Leite, for all the discussions about statistics, for the Python scripts, for your endless curiosity and your kindness: you are a wonderful human being. A heartfelt thanks to my beloved family: Silvia, Leonardo, Beatrice, Nonna Mary, Elena, Adriano and Claudia. I bring you always in my heart and despite the distance you always found creative ways to support me and send me your love. 7 Table of Content Declaration .................................................................................................................. 2 Abstract ....................................................................................................................... 3 Impact Statement .......................................................................................................
Load more

Recommended publications
  • Identification of Differentially Expressed Genes in Urinary Bladder Cancer by Meta-Analysis by Using a Bioinformatics Tool Sathya Mylsamy1* and K Devaki2
    Research Article iMedPub Journals Journal of Clinical & Experimental Nephrology 2019 http://www.imedpub.com/ Vol 5.No.5:95 ISSN 2472-5056 Identification of Differentially Expressed Genes in Urinary Bladder Cancer by Meta-Analysis by Using a Bioinformatics Tool Sathya Mylsamy1* and K Devaki2 1Department of Biochemistry, CMS College of Science and Commerce, Coimbatore, Tamil Nadu, India 2Department of Biochemistry, Karpagam Academy of Higher Education, Coimbatore, Tamil Nadu, India *Corresponding author: Sathya Mylsamy, CMS College of Science and Commerce, Tamil Nadu, India, Tel: (+91)7904349498; E-mail: [email protected] Received date: November 18, 2020 ; Accepted date: December 02, 2020 ; Published date: December 09, 2020 Citation: Mylsamy S, Devaki K (2020) Identification of Differentially Expressed Genes in Urinary Bladder Cancer by Meta-Analysis by using a Bioinformatics Tool. J Clin Exp Nephrol Vol.5 No.5:95. Copyright: © 2020 Mylsamy S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. understand the mechanism behind the tumor progression and its diagnosis. Abstract Background: Bladder cancer is the ninth most prevalent Keywords: Bladder cancer; GEO; CCNB2; NUSAP1; malignant disease globally, which ranges from mild with low ADAM22; KEGG; Gene ontology mortality rate to extremely high grade tumors associated with high mortality rate. The present study was aimed to identify the key genes associated with bladder cancer Introduction progression and later it may also be used as marker in the diagnosis and prognosis. The bladder is probably one of the few sites in the body where the environmental factors play an undeniable role in Materials and methods: The GSE3167, GSE7476, GSE68928 genesis of cancer [1].
    [Show full text]
  • Lgi1 (NM 145769) Rat Tagged ORF Clone – RR210565 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RR210565 Lgi1 (NM_145769) Rat Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Lgi1 (NM_145769) Rat Tagged ORF Clone Tag: Myc-DDK Symbol: Lgi1 Synonyms: MGC105310 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Lgi1 (NM_145769) Rat Tagged ORF Clone – RR210565 ORF Nucleotide >RR210565 representing NM_145769 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAATCAGAAAGCATCAGAAGGATGGGAAATGCCTGCATTCCCCTGAAAAGAATTGCCTATTTCCTAT GCCTCTTTTCTGTGGTTTTGCTGACTGAGGGGAAGAAACCAGCGAAGCCAAAATGCCCTGCTGTGTGTAC TTGTAGCAAAGATAACGCTTTATGTGAGAATGCGAGATCCATTCCACGCACCGTTCCTCCTGATGTTATC TCACTATCCTTTGTGAGATCTGGTTTTACTGAAATCTCAGAAGGGAGTTTCTTGTTCACACCATCGCTGC AGCTCTTGTTATTCACGTCGAACTCCTTTGATGTGATCAGTGACGATGCTTTTATTGGTCTTCCACACCT AGAATATTTATTCATAGAAAACAACAATATCAAGTCCATTTCAAGACATACTTTCCGGGGACTCAAGTCT CTGATTCACTTGAGTCTTGCAAACAACAATCTCCAGACACTCCCAAAAGACATTTTCAAAGGCCTGGATT CTTTAACAAATGTGGACCTAAGAGGGAACTCATTTAACTGTGACTGTAAACTGAAGTGGCTGGTGGAATG GCTCGGCCACACCAACGCAACCGTGGAAGACATCTACTGCGAAGGACCACCGGAGTATAAGAAACGTAAA
    [Show full text]
  • Product Description P408-A2 ADLTE-LGI1-V02
    MRC-Holland ® Product Description version A2-02; Issued 02 December 2020 MLPA Product Description SALSA® MLPA® Probemix P408-A2 ADLTE-LGI1 To be used with the MLPA General Protocol. Version A2. For complete product history see page 7. Catalogue numbers: • P408-025R: SALSA MLPA Probemix P408 ADLTE-LGI1, 25 reactions. • P408-050R: SALSA MLPA Probemix P408 ADLTE-LGI1, 50 reactions. • P408-100R: SALSA MLPA Probemix P408 ADLTE-LGI1, 100 reactions. To be used in combination with a SALSA MLPA reagent kit and Coffalyser.Net data analysis software. MLPA reagent kits are either provided with FAM or Cy5.0 dye-labelled PCR primer, suitable for Applied Biosystems and Beckman/SCIEX capillary sequencers, respectively (see www.mlpa.com). Certificate of Analysis: Information regarding storage conditions, quality tests, and a sample electropherogram from the current sales lot is available at www.mlpa.com. Precautions and warnings: For professional use only. Always consult the most recent product description AND the MLPA General Protocol before use: www.mlpa.com. It is the responsibility of the user to be aware of the latest scientific knowledge of the application before drawing any conclusions from findings generated with this product. General information: The SALSA MLPA Probemix P408 ADLTE-LGI1 is a research use only (RUO) assay for the detection of deletions or duplications in ADAM22, ADGRV1 (was GPR98), KCNA1, KCNA4, KCNAB1, LGI1, and PDYN genes, which are associated with autosomal dominant lateral temporal epilepsy (ADLTE). ADLTE, also known as autosomal dominant partial epilepsy with auditory features (ADPEAF), is a rare familial form of epilepsy likely arising from the lateral temporal lobe of the brain.
    [Show full text]
  • LGI1–ADAM22–MAGUK Configures Transsynaptic Nanoalignment for Synaptic Transmission and Epilepsy Prevention
    LGI1–ADAM22–MAGUK configures transsynaptic nanoalignment for synaptic transmission and epilepsy prevention Yuko Fukataa,b,1, Xiumin Chenc,d,1, Satomi Chikenb,e, Yoko Hiranoa,f, Atsushi Yamagatag, Hiroki Inahashia, Makoto Sanboh, Hiromi Sanob,e, Teppei Gotoh, Masumi Hirabayashib,h, Hans-Christian Kornaui,j, Harald Prüssi,k, Atsushi Nambub,e, Shuya Fukail, Roger A. Nicollc,d,2, and Masaki Fukataa,b,2 aDivision of Membrane Physiology, Department of Molecular and Cellular Physiology, National Institute for Physiological Sciences, National Institutes of Natural Sciences, Aichi 444-8787, Japan; bDepartment of Physiological Sciences, School of Life Science, SOKENDAI (The Graduate University for Advanced Studies), Aichi 444-8585, Japan; cDepartment of Cellular and Molecular Pharmacology, University of California, San Francisco, CA 94158; dDepartment of Physiology, University of California, San Francisco, CA 94158; eDivision of System Neurophysiology, Department of System Neuroscience, National Institute for Physiological Sciences, National Institutes of Natural Sciences, Aichi 444-8585, Japan; fDepartment of Pediatrics, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655, Japan; gLaboratory for Protein Functional and Structural Biology, RIKEN Center for Biosystems Dynamics Research, Kanagawa 230-0045, Japan; hCenter for Genetic Analysis of Behavior, National Institute for Physiological Sciences, National Institutes of Natural Sciences, Okazaki 444-8787, Japan; iGerman Center for Neurodegenerative Diseases (DZNE), 10117 Berlin, Germany; jNeuroscience Research Center, Cluster NeuroCure, Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany; kDepartment of Neurology and Experimental Neurology, Charité-Universitätsmedizin Berlin, 10117 Berlin, Germany; and lDepartment of Chemistry, Graduate School of Science, Kyoto University, 606-8502 Kyoto, Japan Contributed by Roger A. Nicoll, December 1, 2020 (sent for review October 29, 2020; reviewed by David S.
    [Show full text]
  • Quantitative Proteomics Reveals Significant Differences
    cells Article Quantitative Proteomics Reveals Significant Differences between Mouse Brain Formations in Expression of Proteins Involved in Neuronal Plasticity during Aging Dominika Drulis-Fajdasz 1,† , Kinga Gostomska-Pampuch 2,3,† , Przemysław Duda 1 , Jacek Roman Wi´sniewski 2 and Dariusz Rakus 1,* 1 Department of Molecular Physiology and Neurobiology, University of Wrocław, Sienkiewicza 21, 50-335 Wrocław, Poland; [email protected] (D.D.-F.); [email protected] (P.D.) 2 Biochemical Proteomics Group, Department of Proteomics and Signal Transduction, Max Planck Institute of Biochemistry, 82152 Martinsried, Germany; [email protected] (K.G.-P.); [email protected] (J.R.W.) 3 Department of Biochemistry and Immunochemistry, Wrocław Medical University, Chałubi´nskiego10, 50-368 Wrocław, Poland * Correspondence: [email protected] † The authors participated equally. Abstract: Aging is associated with a general decline in cognitive functions, which appears to be due to alterations in the amounts of proteins involved in the regulation of synaptic plasticity. Here, we present a quantitative analysis of proteins involved in neurotransmission in three brain regions, namely, the hippocampus, the cerebral cortex and the cerebellum, in mice aged 1 and 22 months, Citation: Drulis-Fajdasz, D.; using the total protein approach technique. We demonstrate that although the titer of some proteins Gostomska-Pampuch, K.; Duda, P.; involved in neurotransmission and synaptic plasticity is affected by aging in a similar manner Wi´sniewski,J.R.; Rakus, D. Quantitative Proteomics Reveals in all the studied brain formations, in fact, each of the formations represents its own mode of Significant Differences between aging.
    [Show full text]
  • Neurology Genetics
    An Official Journal of the American Academy of Neurology Neurology.org/ng • Online ISSN: 2376-7839 Volume 3, Number 4, August 2017 Genetics Functionally pathogenic ExACtly zero or once: Clinical and experimental EARS2 variants in vitro A clinically helpful guide studies of a novel P525R may not manifest a to assessing genetic FUS mutation in amyotrophic phenotype in vivo variants in mild epilepsies lateral sclerosis Table of Contents Neurology.org/ng Online ISSN: 2376-7839 Volume 3, Number 4, August 2017 THE HELIX e171 Autopsy case of the C12orf65 mutation in a patient e175 What does phenotype have to do with it? with signs of mitochondrial dysfunction S.M. Pulst H. Nishihara, M. Omoto, M. Takao, Y. Higuchi, M. Koga, M. Kawai, H. Kawano, E. Ikeda, H. Takashima, and T. Kanda EDITORIAL e173 This variant alters protein function, but is it pathogenic? M. Pandolfo e174 Prevalence of spinocerebellar ataxia 36 in a US Companion article, e162 population J.M. Valera, T. Diaz, L.E. Petty, B. Quintáns, Z. Yáñez, ARTICLES E. Boerwinkle, D. Muzny, D. Akhmedov, R. Berdeaux, e162 Functionally pathogenic EARS2 variants in vitro may M.J. Sobrido, R. Gibbs, J.R. Lupski, D.H. Geschwind, not manifest a phenotype in vivo S. Perlman, J.E. Below, and B.L. Fogel N. McNeill, A. Nasca, A. Reyes, B. Lemoine, B. Cantarel, A. Vanderver, R. Schiffmann, and D. Ghezzi Editorial, e173 e170 Loss-of-function variants of SCN8A in intellectual disability without seizures e163 ExACtly zero or once: A clinically helpful guide to J.L. Wagnon, B.S. Barker, M.
    [Show full text]
  • LGI1 Gene Leucine Rich Glioma Inactivated 1
    LGI1 gene leucine rich glioma inactivated 1 Normal Function The LGI1 gene provides instructions for making a protein called leucine-rich glioma inactivated 1 (Lgi1) or epitempin. This protein is found primarily in nerve cells (neurons) in the brain, including a part of the brain called the lateral temporal lobe. The temporal lobe of the brain is involved in hearing, speech, memory, and emotion. Although researchers have proposed several functions for epitempin, its precise role in the brain remains uncertain. This protein is probably involved in normal brain development. Some studies have suggested that epitempin plays a role in the normal function of potassium channels in neurons. These channels are embedded in the cell membrane, where they transport charged potassium atoms (potassium ions) out of neurons. Potassium channels are critical for normal electrical signaling in these cells. Other studies have found that epitempin is transported (secreted) out of neurons. The function of this protein outside cells is unclear. Epitempin may also help regulate the communication between neurons. Researchers have determined that epitempin attaches (binds) to a receptor protein called ADAM22 on the surface of neurons. Together, these proteins help control the release of certain brain chemicals called neurotransmitters. These chemicals allow neighboring neurons to communicate with each other, which is how signals are relayed throughout the brain. Health Conditions Related to Genetic Changes Autosomal dominant partial epilepsy with auditory features At least 22 mutations in the LGI1 gene have been identified in people with autosomal dominant partial epilepsy with auditory features (ADPEAF). Some LGI1 mutations change a single protein building block (amino acid) in the epitempin protein, which alters the protein's structure.
    [Show full text]
  • Global Proteomic Analysis of Extracellular Matrix in Mouse And
    Edinburgh Research Explorer Global proteomic analysis of extracellular matrix in mouse and human brain highlights relevance to cerebrovascular disease Citation for published version: Pokhilko, A, Brezzo, G, Handunnetthi, L, Heilig, R, Lennon, R, Smith, C, Allan, SM, Granata, A, Sinha, S, Wang, T, Markus, HS, Naba, A, Fischer, R, Van Agtmael, T, Horsburgh, K & Cader, MZ 2021, 'Global proteomic analysis of extracellular matrix in mouse and human brain highlights relevance to cerebrovascular disease', Journal of Cerebral Blood Flow and Metabolism, vol. 41, no. 9, pp. 2423–2438. https://doi.org/10.1177/0271678X211004307 Digital Object Identifier (DOI): 10.1177/0271678X211004307 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Journal of Cerebral Blood Flow and Metabolism General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct.
    [Show full text]
  • Similarity of Molecular Phenotype Between Known Epilepsy Gene LGI1 and Disease Candidate Gene LGI2
    Limviphuvadh et al. BMC Biochemistry 2010, 11:39 http://www.biomedcentral.com/1471-2091/11/39 RESEARCH ARTICLE Open Access Similarity of molecular phenotype between known epilepsy gene LGI1 and disease candidate gene LGI2 Vachiranee Limviphuvadh1†, Ling Ling Chua1†, Rabi ’Atul’ Adawiyah Bte Rahim1, Frank Eisenhaber1,2,3, Sebastian Maurer-Stroh1,4, Sharmila Adhikari1* Abstract Background: The LGI2 (leucine-rich, glioma inactivated 2) gene, a prime candidate for partial epilepsy with pericentral spikes, belongs to a family encoding secreted, beta-propeller domain proteins with EPTP/EAR epilepsy- associated repeats. In another family member, LGI1 (leucine-rich, glioma inactivated 1) mutations are responsible for autosomal dominant lateral temporal epilepsy (ADLTE). Because a few LGI1 disease mutations described in the literature cause secretion failure, we experimentally analyzed the secretion efficiency and subcellular localization of several LGI1 and LGI2 mutant proteins corresponding to observed non-synonymous single nucleotide polymorphisms (nsSNPs) affecting the signal peptide, the leucine-rich repeats and the EAR propeller. Results: Mapping of disease-causing mutations in the EAR domain region onto a 3D-structure model shows that many of these mutations co-localize at an evolutionary conserved surface region of the propeller. We find that wild-type LGI2 is secreted to the extracellular medium in glycosylated form similarly to LGI1, whereas several mutant proteins tested in this study are secretion-deficient and accumulate in the endoplasmic reticulum. Interestingly, mutations at structurally homologous positions in the EAR domain have the same effect on secretion in LGI1 and LGI2. Conclusions: This similarity of experimental mislocalization phenotypes for mutations at homologous positions of LGI2 and the established epilepsy gene LGI1 suggests that both genes share a potentially common molecular pathogenesis mechanism that might be the reason for genotypically distinct but phenotypically related forms of epilepsy.
    [Show full text]
  • Skeletal Muscle Transcriptome in Healthy Aging
    ARTICLE https://doi.org/10.1038/s41467-021-22168-2 OPEN Skeletal muscle transcriptome in healthy aging Robert A. Tumasian III 1, Abhinav Harish1, Gautam Kundu1, Jen-Hao Yang1, Ceereena Ubaida-Mohien1, Marta Gonzalez-Freire1, Mary Kaileh1, Linda M. Zukley1, Chee W. Chia1, Alexey Lyashkov1, William H. Wood III1, ✉ Yulan Piao1, Christopher Coletta1, Jun Ding1, Myriam Gorospe1, Ranjan Sen1, Supriyo De1 & Luigi Ferrucci 1 Age-associated changes in gene expression in skeletal muscle of healthy individuals reflect accumulation of damage and compensatory adaptations to preserve tissue integrity. To characterize these changes, RNA was extracted and sequenced from muscle biopsies col- 1234567890():,; lected from 53 healthy individuals (22–83 years old) of the GESTALT study of the National Institute on Aging–NIH. Expression levels of 57,205 protein-coding and non-coding RNAs were studied as a function of aging by linear and negative binomial regression models. From both models, 1134 RNAs changed significantly with age. The most differentially abundant mRNAs encoded proteins implicated in several age-related processes, including cellular senescence, insulin signaling, and myogenesis. Specific mRNA isoforms that changed sig- nificantly with age in skeletal muscle were enriched for proteins involved in oxidative phosphorylation and adipogenesis. Our study establishes a detailed framework of the global transcriptome and mRNA isoforms that govern muscle damage and homeostasis with age. ✉ 1 National Institute on Aging–Intramural Research Program, National
    [Show full text]
  • Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands That Promote Axonal Growth
    Research Article: New Research Development Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands that Promote Axonal Growth Jeremy S. Toma,1 Konstantina Karamboulas,1,ª Matthew J. Carr,1,2,ª Adelaida Kolaj,1,3 Scott A. Yuzwa,1 Neemat Mahmud,1,3 Mekayla A. Storer,1 David R. Kaplan,1,2,4 and Freda D. Miller1,2,3,4 https://doi.org/10.1523/ENEURO.0066-20.2020 1Program in Neurosciences and Mental Health, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada, 2Institute of Medical Sciences University of Toronto, Toronto, Ontario M5G 1A8, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario M5G 1A8, Canada, and 4Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1A8, Canada Abstract Peripheral nerves provide a supportive growth environment for developing and regenerating axons and are es- sential for maintenance and repair of many non-neural tissues. This capacity has largely been ascribed to paracrine factors secreted by nerve-resident Schwann cells. Here, we used single-cell transcriptional profiling to identify ligands made by different injured rodent nerve cell types and have combined this with cell-surface mass spectrometry to computationally model potential paracrine interactions with peripheral neurons. These analyses show that peripheral nerves make many ligands predicted to act on peripheral and CNS neurons, in- cluding known and previously uncharacterized ligands. While Schwann cells are an important ligand source within injured nerves, more than half of the predicted ligands are made by nerve-resident mesenchymal cells, including the endoneurial cells most closely associated with peripheral axons. At least three of these mesen- chymal ligands, ANGPT1, CCL11, and VEGFC, promote growth when locally applied on sympathetic axons.
    [Show full text]
  • Epilepsy with Auditory Features a Heterogeneous Clinico-Molecular Disease
    Epilepsy with auditory features A heterogeneous clinico-molecular disease Tommaso Pippucci, PhD ABSTRACT Laura Licchetta, MD Objective: To identify novel genes implicated in epilepsy with auditory features (EAF) in phenotyp- Sara Baldassari, BSc ically heterogeneous families with unknown molecular basis. Flavia Palombo, BSc Methods: We identified 15 probands with EAF in whom an LGI1 mutation had been excluded. We Veronica Menghi, MD performed electroclinical phenotyping on all probands and available affected relatives. We used Romina D’Aurizio, PhD whole-exome sequencing (WES) in 20 individuals with EAF (including all the probands and 5 rela- Chiara Leta, MD tives) to identify single nucleotide variants, small insertions/deletions, and copy number variants. Carlotta Stipa, MD Giovanni Boero, MD Results: WES revealed likely pathogenic variants in genes that had not been previously associated CNTNAP2 DEPDC5 Giuseppe d’Orsi, MD with EAF: a intragenic deletion, 2 truncating mutations of , and a missense SCN1A Alberto Magi, PhD change. Ingrid Scheffer, PhD, MD Conclusions: EAF is a clinically and molecularly heterogeneous disease. The association of EAF Marco Seri, MD with CNTNAP2, DEPDC5,andSCN1A mutations widens the phenotypic spectrum related to Paolo Tinuper, MD these genes. CNTNAP2 encodes CASPR2, a member of the voltage-gated potassium channel Francesca Bisulli, PhD, complex in which LGI1 plays a role. The finding of a CNTNAP2 deletion emphasizes the impor- MD tance of this complex in EAF and shows biological convergence. Neurol Genet
    [Show full text]