G1236 Phdadshuttle6

Total Page:16

File Type:pdf, Size:1020Kb

Load more

G1236 pHDAdShuttle6 Map of Construct: Sequence of Construct: 2553bp LacZa (for blue/white bacterial screening)- 146-499 MCS- 396-482 3’-Overhang- 637-680 Ori- 805-1393 5’overhang- 1439-1486 Amp resistance (complementary)- 1493-2353 Amp promoter BsiWI sites-CGTACG TCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACA GCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGG CGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATA TGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCA TTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCT GGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCAC GACGTTGTAAAACGACGGCCAGTGAATTCCCTGCAGGACGCGTGGTACCAGGGGATCCACTA GTTCTAGAGTCGACGGCATGCAAGCTTAGCGGCCGCGATATCAGATCTGGCGTAATCATGGT CATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGA AGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCG CTCACTGCCCGCTTTCCCTACCAGTAAAAAAGAAAACCTATTAAAAAAACACCACTCGACGT ACGATGAACGGTCTCTACGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAA CATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTT TCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAA ACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTG TTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTT CTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGT GTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCC AACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGC GAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAA GAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGC TCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGAT TACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTACGGGGTCTGACGCGAACTGCCGATA CCTCGTACGTGGAAAAAATCAACAAAGGGATCCCCCGGGCTGCAGGAATTCGATGGAGACAG TTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAG TTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGT GCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCA GCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAA TTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCA TTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCC CAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGG TCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCAC TGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCA ACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACG GGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGG GGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCA CCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAG GCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCC TTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGA ATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTG ACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCC TTTCGTC Confirmation Digest: Information and Cloning Suggestions for Working with pHDAdShuttle: Background: Adenoviruses are very important tools in basic research. They are used to identify a proteins role in different biological processes both in vivo and in vitro. Adenoviral vectors were first generated by deleting portions of the E1 and E3 genes. Helper dependent or “gutless” adenoviral vectors have been generated as the final generation of adenoviral vectors. Helper dependent adenoviral vectors have had all expressed viral proteins removed. The viral “genome” only contains the adenoviral packaging signal, an untranslated portion of the E4 gene, and stuffer sequences. The pHDAdShuttle is a simple plasmid to prepare a gene cassette for insertion into one of the helper dependent adenoviral backbones. The final viral backbone with gene cassette that will be used for viral construction should be between 28kbp and 38kbp, so there are different empty backbone plasmids to choose from. Backbone Insert size available pΔ28E4 0-9kb pΔ25E4 3-12kb pΔ21E4 7-16kb pΔ17E4 11-20kb pΔ12E4 16-25kb pΔ8E4 20-29kb Helper Dependent Adenoviral Vectors Characteristics: • Episomal gene expression. • Infects dividing and non-dividing cells. • Transient high-level protein expression. • Accommodates inserts of up to 30kb. • Preps are produced with a titer of: 1E+10 to 5E+10 IGU/ml. (infectious genome units per ml). • Limited host immune response based on the lack of viral protein products. Disadvantages and adverse effects: • Helper Dependent Adenoviral vectors are invariably contaminated with miniscule Adeno helper virus which can illicit an immune response. • Immune responses against the transgene can still illicit an immune response. • Viral particles can be neutralized by the host immune response. • Short-term expression of the transgene due to lack of integration into the host genome. Cloning Helper Dependent Adenovirus Plasmids: The helper dependent adenovirus system uses two cloning steps to generate the helper dependent adenoviral genome: 1. The Shuttle Plasmid: The shuttle plasmid is usually cloned by the investigator and contains the gene of interest driven by the desired promoter and any other elements needed for a single or bicistronic construct. The MCS of the shuttle plasmid is inserted into a LacZ ORF. This allows for simple white-blue screening using X-gal. The gene cassette must not contain a PmeI site and must be free of BsiWI sites. BsiWI is used to cut out the gene cassette in the shuttle prior to cloning into the viral backbone AscI site by Gibson Assembly. The shuttle vector contains two small sections of stuffer sequences that help facilitate Gibson cloning. Once cloning is complete, PmeI is used to linearize the viral backbone prior to the initial transfection. The VVC also offers limited cloning services for investigators. The gene cassette will be cloned into the appropriate backbone plasmid once the shuttle plasmid is received by the VVC. 2. The Viral Backbone Plasmid: This plasmid contains the adenoviral packaging signal, an untranslated portion of the E4 gene, and stuffer sequences. The investigator’s gene cassette is moved from the pHDAdShuttle into the appropriate backbone by restriction digest and then Gibson assembly. Insert Size: Helper dependent Adenovirus vectors can accommodate inserts of up to 30kb, this includes promoters, gene(s) of interest, and other elements. Multiple viral backbones are available with varying sizes of stuffer sequences. Choosing which backbone to use depends on the size of the gene cassettes that will be inserted into them. E. coli Competent Cell Recommendations: We recommend using DH5alpha cells to grow the plasmids. Recommended Plasmid Quality Control: Sequencing: It is highly recommended to sequence all genes inserted into the viral shuttle plasmid before it is sent to us for virus construction. M13F and M13R primers flank the multiple cloning site. Protein Expression: The pUC57 based HDAdShuttle6 plasmid can act as an expression plasmid and it is therefore highly recommended that the shuttle plasmid be tested for protein expression prior to sending it to the VVC. Integrity Digest: We recommend that submitted plasmids be checked by diagnostic digest as well as sequencing. We suggest single restriction enzyme digestions with enzymes that cut the insert and backbone in multiple places. Helper Dependent Production Services: 1. Recombination, amplification, purification & titer • Shuttle: A cloning/expression adenovirus shuttle vector (see list below) is provided free of charge (not including shipping fees) after a Material Transfer Agreement is signed. • Sample required: 40ug of helper dependent adenovirus shuttle plasmid expressing the gene of interest at a concentration greater than 0.25ug/ul. Please note that DNA quality greatly affects virus production. • Time line: 5-8 weeks from the time the plasmid is received. • Service: o Cloning of shuttle insert into viral backbone. o Transfection and recombination. o Large-scale amplification. o Purification by: - Double cesium chloride gradient - With every new lot an infectious titer (IGU/ml) is provided. o Each lot is checked quantitatively for Adeno helper virus contamination . • Material provided: 2ml and a 100ul tester at a concentration of 1E+10 to 5E+10 IGU/ml (Infectious Genome Units/ml) • Vehicle: Helper Dependent Adenovirus vectors are resuspended in A195 buffer (See reference below) • Stock: The vector is kept in stock. Additional 1ml aliquots can be purchased but they can take several weeks to make. References: Helper Dependent Adenovirus: Palmer JD, and Ng P. Rescue, Amplification, and Large-Scale Production of Helper-Dependent Adenovirual Vectors: Cold Spring Harb Protoc; 2011; doi:10.1101/pdb.prot5627 Palmer JD and Ng P. Characterization of Helper-Dependent Adenoviral Vectors: Cold Spring Harb Protoc; 2011; doi: 10.1101/pdb.prot5628 Gallaher SD, Berk AJ. A rapid Q-PCR titration protocol for adenovirus and helper- dependent adenovirus vectors that produces biologically relevant results. Journal of Virological Methods 192 (2013) 28-38. RapAdTM System: Anderson RD, Haskell RE, Xia H, Roessler BJ, Davidson BL. “A simple method for the rapid generation of recombinant adenovirus vectors”. Gene Ther. 2000 Jun;7(12):1034-8 A195 Buffer: Evans RK, Nawrocki DK, Isopi LA, Williams DM, Casimiro DR, Chin S, Chen M, Zhu DM, Shiver JW, Volkin DB. Development of stable liquid formulations for adenovirus-based vaccines. J Pharm Sci. 2004 Oct;93(10):2458-7 Contact Information: Viral Vector Core University of Iowa 500 Newton Road 221 Eckstein Medical Research Building Iowa City, IA 52242 Tel: (319) 335-6726 [email protected] *version 9/18/15 SJS .
Recommended publications
  • Chapitre Quatre La Spécificité D'hôtes Des Virophages Sputnik

    Chapitre Quatre La Spécificité D'hôtes Des Virophages Sputnik

    AIX-MARSEILLE UNIVERSITE FACULTE DE MEDECINE DE MARSEILLE ECOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE THESE DE DOCTORAT Présentée par Morgan GAÏA Né le 24 Octobre 1987 à Aubagne, France Pour obtenir le grade de DOCTEUR de l’UNIVERSITE AIX -MARSEILLE SPECIALITE : Pathologie Humaine, Maladies Infectieuses Les virophages de Mimiviridae The Mimiviridae virophages Présentée et publiquement soutenue devant la FACULTE DE MEDECINE de MARSEILLE le 10 décembre 2013 Membres du jury de la thèse : Pr. Bernard La Scola Directeur de thèse Pr. Jean -Marc Rolain Président du jury Pr. Bruno Pozzetto Rapporteur Dr. Hervé Lecoq Rapporteur Faculté de Médecine, 13385 Marseille Cedex 05, France URMITE, UM63, CNRS 7278, IRD 198, Inserm 1095 Directeur : Pr. Didier RAOULT Avant-propos Le format de présentation de cette thèse correspond à une recommandation de la spécialité Maladies Infectieuses et Microbiologie, à l’intérieur du Master des Sciences de la Vie et de la Santé qui dépend de l’Ecole Doctorale des Sciences de la Vie de Marseille. Le candidat est amené à respecter des règles qui lui sont imposées et qui comportent un format de thèse utilisé dans le Nord de l’Europe permettant un meilleur rangement que les thèses traditionnelles. Par ailleurs, la partie introduction et bibliographie est remplacée par une revue envoyée dans un journal afin de permettre une évaluation extérieure de la qualité de la revue et de permettre à l’étudiant de commencer le plus tôt possible une bibliographie exhaustive sur le domaine de cette thèse. Par ailleurs, la thèse est présentée sur article publié, accepté ou soumis associé d’un bref commentaire donnant le sens général du travail.
  • Replication-Defective Chimeric Helper Proviruses and Factors Affecting Generation of Competent Virus

    Replication-Defective Chimeric Helper Proviruses and Factors Affecting Generation of Competent Virus

    MOLECULAR AND CELLULAR BIOLOGY, May 1987, p. 1797-1806 Vol. 7, No. 5 0270-7306/87/051797-10$02.00/0 Copyright © 1987, American Society for Microbiology Replication-Defective Chimeric Helper Proviruses and Factors Affecting Generation of Competent Virus: Expression of Moloney Murine Leukemia Virus Structural Genes via the Metallothionein Promoter ROBERT A. BOSSELMAN,* ROU-YIN HSU, JOAN BRUSZEWSKI, SYLVIA HU, FRANK MARTIN, AND MARGERY NICOLSON Amgen, Thousand Oaks, California 91320 Received 15 October 1986/Accepted 28 January 1987 Two chimeric helper proviruses were derived from the provirus of the ecotropic Moloney murine leukemia virus by replacing the 5' long terminal repeat and adjacent proviral sequences with the mouse metallothionein I promoter. One of these chimeric proviruses was designed to express the gag-pol genes of the virus, whereas the other was designed to express only the env gene. When transfected into NIH 3T3 cells, these helper proviruses failed to generate competent virus but did express Zn2 -inducible trans-acting viral functions needed to assemble infectious vectors. One helper cell line (clone 32) supported vector assembly at levels comparable to those supported by the Psi-2 and PA317 cell lines transfected with the same vector. Defective proviruses which carry the neomycin phosphotransferase gene and which lack overlapping sequence homology with the 5' end of the chimeric helper proviruses could be transfected into the helper cell line without generation of replication-competent virus. Mass cultures of transfected helper cells produced titers of about 104 G418r CFU/ml, whereas individual clones produced titers between 0 and 2.6 x 104 CFU/ml.
  • Viral Envelope Are Controlled by the Helper Virus Used to Activate The

    Viral Envelope Are Controlled by the Helper Virus Used to Activate The

    DETERMINING FACTOR IN THE CAPACITY OF ROUS SARCOMA VIRUS TO INDUCE TUMORS IN MAMMALS* By HIDESABURO HANAFUSA AND TERUKO HANAFUSA COLLMGE DE FRANCE, LABORATOIRE DE MIDECINE EXPARIMENTALE, PARIS Communidated by Ahdre Lwoff, January 24, 1966 Since Zilber and Kriukoval and Svet-Moldavsky' demonstrated that some strains of Rous sarcoma virus (RSV) are capable of inducing hemorrhagic cysts or sarcomas in newborn rats, numerous attempts have been made to induce tumors by RSVin various species of mammals.3-9 One of the remarkable aspects revealed by these investigations is the strain differences in RSV for this capacity.6-9 Certain strains, such as the Schmidt-Ruppin strain, are active, while others, such as the Bryan strain, are generally inactive in mammals. The cause of such strain differ- ences has not been elucidated. Our previous studies have shown that the Bryan high-titer strain of RSV is a defective virus which cannot reproduce without the help of any one of the avian leukosis viruses.'0 The defectiveness derives from the inability of this strain of RSV to induce the synthesis of its own viral envelope."I An essential role played by the helper virus is to provide the envelope to the RSV genome, whose replica- tion occurs in the infected cells without the aid of helper virus. Thus, several properties of RSV which presumably depend in some way on the character of the viral envelope are controlled by the helper virus used to activate the RSV.11-13 These properties include the antigenicity, the sensitivity to the interference induced by the helper virus, and the host range among genetically different chick embryos.
  • Satellite RNA-Mediated Resistance to Turnip Crinkle Virus in Arabidopsis Lnvolves a Reduction in Virus Movement

    Satellite RNA-Mediated Resistance to Turnip Crinkle Virus in Arabidopsis Lnvolves a Reduction in Virus Movement

    The Plant Cell, Vol. 9, 2051-2063, November 1997 O 1997 American Society of Plant Physiologists Satellite RNA-Mediated Resistance to Turnip Crinkle Virus in Arabidopsis lnvolves a Reduction in Virus Movement Qingzhong Kong, Jianlong Wang, and Anne E. Simon’ Department of Biochemistry and Molecular Biology and Program in Molecular and Cellular Biology, University of Massachusetts, Amherst, Massachusetts O1 003-4505 Satellite RNAs (sat-RNAs) are parasites of viruses that can mediate resistance to the helper virus. We previously showed that a sat-RNA (sat-RNA C) of turnip crinkle virus (TCV), which normally intensifies symptoms of TCV, is able to attenuate symptoms when TCV contains the coat protein (CP) of cardamine chlorotic fleck virus (TCV-CPccw).We have now determined that sat-RNA C also attenuates symptoms of TCV containing an alteration in the initiating AUG of the CP open reading frame (TCV-CPm). TCV-CPm, which is able to move systemically in both the TCV-susceptible ecotype Columbia (Col-O) and the TCV-resistant ecotype Dijon (Di-O), produced a reduced level of CP and no detectable virions in infected plants. Sat-RNA C reduced the accumulation of TCV-CPm by <25% in protoplasts while reducing the level of TCV-CPm by 90 to 100% in uninoculated leaves of COLO and Di-O. Our results suggest that in the presence of a re- duced level of a possibly altered CP, sat-RNA C reduces virus long-distance movement in a manner that is independent of the salicylic acid-dependent defense pathway. INTRODUCTION Plants exhibit different types of resistance to plant viruses, on virus association for replication and spread in plants.
  • Helper-Dependent Adenoviral Vectors

    Helper-Dependent Adenoviral Vectors

    ndrom Sy es tic & e G n e e n G e f T o Rosewell, J Genet Syndr Gene Ther 2011, S:5 Journal of Genetic Syndromes h l e a r n a r p DOI: 10.4172/2157-7412.S5-001 u y o J & Gene Therapy ISSN: 2157-7412 Review Article Open Access Helper-Dependent Adenoviral Vectors Amanda Rosewell, Francesco Vetrini, and Philip Ng* Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX, 77030 USA Abstract Helper-dependent adenoviral vectors are devoid of all viral coding sequences, possess a large cloning capacity, and can efficiently transduce a wide variety of cell types from various species independent of the cell cycle to mediate long-term transgene expression without chronic toxicity. These non-integrating vectors hold tremendous potential for a variety of gene transfer and gene therapy applications. Here, we review the production technologies, applications, obstacles to clinical translation and their potential resolutions, and the future challenges and unanswered questions regarding this promising gene transfer technology. Introduction DNA polymerase and terminal protein precursor (pTP). The E3 region, which is dispensable for virus growth in cell culture, encodes at least Helper-dependent adenoviral vectors (HDAd) are deleted of all seven proteins most of which are involved in host immune evasion. The viral coding sequences, can efficiently transduce a wide variety of cell E4 region encodes at least six proteins, some functioning to facilitate types from various species independent of the cell cycle, and can result in DNA replication, enhance late gene expression and decrease host long-term transgene expression.
  • Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-Associated Virus Vectors of Serotypes 1 to 6 Dirk Grimm,1 Mark A

    Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-Associated Virus Vectors of Serotypes 1 to 6 Dirk Grimm,1 Mark A

    doi:10.1016/S1525-0016(03)00095-9 METHOD Helper Virus-Free, Optically Controllable, and Two-Plasmid-Based Production of Adeno-associated Virus Vectors of Serotypes 1 to 6 Dirk Grimm,1 Mark A. Kay,1,* and Juergen A. Kleinschmidt2 1 Department of Pediatrics and Department of Genetics, Stanford University School of Medicine, 300 Pasteur Drive, Stanford, California 94305 2 Department of Applied Tumor Virology, German Cancer Research Center, Im Neuenheimer Feld 242, D-69121 Heidelberg, Germany *To whom correspondence and reprint requests should be addressed. Fax: (650) 498-6540. E-mail: [email protected]. We present a simple and safe strategy for producing high-titer adeno-associated virus (AAV) vectors derived from six different AAV serotypes (AAV-1 to AAV-6). The method, referred to as “HOT,” is helper virus free, optically controllable, and based on transfection of only two plasmids, i.e., an AAV vector construct and one of six novel AAV helper plasmids. The latter were engineered to carry AAV serotype rep and cap genes together with adenoviral helper functions, as well as unique fluorescent protein expression cassettes, allowing confirmation of successful transfection and identification of the transfected plasmid. Cross-packaging of vector DNA derived from AAV-2, -3, or -6 was up to 10-fold more efficient using our novel plasmids, compared to a conservative adenovirus-dependent method. We also identified a variety of useful antibodies, allowing detec- tion of Rep or VP proteins, or assembled capsids, of all six AAV serotypes. Finally, we describe unique cell tropisms and kinetics of transgene expression for AAV serotype vectors in primary or transformed cells from four different species.
  • Aavpro® Helper Free System

    Aavpro® Helper Free System

    Cat. # 6230, 6652, 6655 For Research Use AAVpro® Helper Free System Product Manual v201503Da Cat. #6230, 6652, 6655 AAVpro® Helper Free System v201503Da Table of Contents I. Description ........................................................................................................... 4 II. Components ........................................................................................................ 6 III. Storage................................................................................................................... 9 IV. Materials Required but not Provided ........................................................ 9 V. Overview of AAV Particle Preparation .....................................................10 VI. Protocol ...............................................................................................................10 VII. Measurement of Virus Titer .........................................................................12 VIII. Reference Data .................................................................................................13 IX. References ..........................................................................................................17 X. Related Products ..............................................................................................17 2 URL:http://www.takara-bio.com Cat. #6230, 6652, 6655 AAVpro® Helper Free System v201503Da Safety & Handling of Adeno-Associated Virus Vectors The protocols in this User Manual require the handling of adeno-associated virus
  • Virophages Question the Existence of Satellites

    Virophages Question the Existence of Satellites

    CORRESPONDENCE LINK TO ORIGINAL ARTICLE LINK TO AUTHOR’S REPLY located in front of 12 out of 21 Sputnik coding sequences and all 20 Cafeteria roenbergensis Virophages question the virus coding sequences (both promoters being associated with the late expression of genes) existence of satellites imply that virophage gene expression is gov- erned by the transcription machinery of the Christelle Desnues and Didier Raoult host virus during the late stages of infection. Another point concerns the effect of the virophage on the host virus. It has been argued In a recent Comment (Virophages or satel- genome sequences of other known viruses that the effect of Sputnik or Mavirus on the lite viruses? Nature Rev. Microbiol. 9, 762– indicates that the virophages probably belong host is similar to that observed for STNV and 763 (2011))1, Mart Krupovic and Virginija to a new viral family. This is further supported its helper virus1. However, in some cases the Cvirkaite-Krupovic argued that the recently by structural analysis of Sputnik, which infectivity of TNV is greater when inoculated described virophages, Sputnik and Mavirus, showed that MCP probably adopts a double- along with STNV (or its nucleic acid) than should be classified as satellite viruses. In a jelly-roll fold, although there is no sequence when inoculated alone, suggesting that STNV response2, to which Krupovic and Cvirkaite- similarity between the virophage MCPs and makes cells more susceptible to TNV11. Such Krupovic replied3, Matthias Fisher presented those of other members of the bacteriophage an effect has never been observed for Sputnik two points supporting the concept of the PRD1–adenovirus lineage9.
  • Replication Strategies of RNA Viruses Requiring RNA-Directed Mrna 16 Transcription As CHAPTER the First Step in Viral Gene Expression

    Replication Strategies of RNA Viruses Requiring RNA-Directed Mrna 16 Transcription As CHAPTER the First Step in Viral Gene Expression

    WBV16 6/27/03 11:21 PM Page 257 Replication Strategies of RNA Viruses Requiring RNA-directed mRNA 16 Transcription as CHAPTER the First Step in Viral Gene Expression ✷ REPLICATION OF NEGATIVE-SENSE RNA VIRUSES WITH A MONOPARTITE GENOME ✷ The replication of vesicular stomatitis virus — a model for Mononegavirales ✷ Paramyxoviruses ✷ Filoviruses and their pathogenesis ✷ Bornaviruses ✷ INFLUENZA VIRUSES — NEGATIVE-SENSE RNA VIRUSES WITH A MULTIPARTITE GENOME ✷ Involvement of the nucleus in flu virus replication ✷ Generation of new flu nucleocapsids and maturation of the virus ✷ Influenza A epidemics ✷ OTHER NEGATIVE-SENSE RNA VIRUSES WITH MULTIPARTITE GENOMES ✷ Bunyaviruses ✷ Arenaviruses ✷ VIRUSES WITH DOUBLE-STRANDED RNA GENOMES ✷ Reovirus structure ✷ The reovirus replication cycle ✷ Pathogenesis ✷ SUBVIRAL PATHOGENS ✷ Hepatitis delta virus ✷ Viroids ✷ Prions ✷ QUESTIONS FOR CHAPTER 16 WBV16 6/27/03 3:58 PM Page 258 258 BASIC VIROLOGY A significant number of single-stranded RNA viruses contain a genome that has a sense opposite to mRNA (i.e., the viral genome is negative-sense RNA). To date, no such viruses have been found to infect bacteria and only one type infects plants. But many of the most important and most feared human pathogens, including the causative agents for flu, mumps, rabies, and a number of hemorrhagic fevers, are negative-sense RNA viruses. The negative-sense RNA viruses generally can be classified according to the number of segments that their genomes contain. Viruses with monopartite genomes contain a single piece of virion negative-sense RNA, a situation equivalent to that described for the positive-sense RNA viruses in the last chapter. A number of groups of negative-sense RNA viruses have multipartite (i.e., seg- mented ) genomes.
  • High-Capacity Adenoviral Vectors: Expanding the Scope of Gene Therapy

    High-Capacity Adenoviral Vectors: Expanding the Scope of Gene Therapy

    International Journal of Molecular Sciences Review High-Capacity Adenoviral Vectors: Expanding the Scope of Gene Therapy Ana Ricobaraza , Manuela Gonzalez-Aparicio, Lucia Mora-Jimenez, Sara Lumbreras and Ruben Hernandez-Alcoceba * Gene Therapy Program. University of Navarra-CIMA. Navarra Institute of Health Research, 31008 Pamplona, Spain; [email protected] (A.R.); [email protected] (M.G.-A.); [email protected] (L.M.-J.); [email protected] (S.L.) * Correspondence: [email protected]; Tel.: +34-948-194700 Received: 22 April 2020; Accepted: 19 May 2020; Published: 21 May 2020 Abstract: The adaptation of adenoviruses as gene delivery tools has resulted in the development of high-capacity adenoviral vectors (HC-AdVs), also known, helper-dependent or “gutless”. Compared with earlier generations (E1/E3-deleted vectors), HC-AdVs retain relevant features such as genetic stability, remarkable efficacy of in vivo transduction, and production at high titers. More importantly, the lack of viral coding sequences in the genomes of HC-AdVs extends the cloning capacity up to 37 Kb, and allows long-term episomal persistence of transgenes in non-dividing cells. These properties open a wide repertoire of therapeutic opportunities in the fields of gene supplementation and gene correction, which have been explored at the preclinical level over the past two decades. During this time, production methods have been optimized to obtain the yield, purity, and reliability required for clinical implementation. Better understanding of inflammatory responses and the implementation of methods to control them have increased the safety of these vectors. We will review the most significant achievements that are turning an interesting research tool into a sound vector platform, which could contribute to overcome current limitations in the gene therapy field.
  • An Introduction to Viral Vectors: Safety Considerations

    An Introduction to Viral Vectors: Safety Considerations

    An Introduction to Viral Vectors: Safety Considerations Dawn P. Wooley, Ph.D., SM(NRCM), RBP, CBSP Learning Objectives Recognize hazards associated with viral vectors in research and animal testing laboratories. Interpret viral vector modifications pertinent to risk assessment. Understand the difference between gene delivery vectors and viral research vectors. 2 Outline Introduction to Viral Vectors Retroviral & Lentiviral Vectors (+RNA virus) Adeno and Adeno-Assoc. Vectors (DNA virus) Novel (-)RNA virus vectors NIH Guidelines and Other Resources Conclusions 3 Increased Use of Viral Vectors in Research Difficulties in DNA delivery to mammalian cells <50% with traditional transfection methods Up to ~90% with viral vectors Increased knowledge about viral systems Commercialization has made viral vectors more accessible Many new genes identified and cloned (transgenes) Gene therapy 4 5 6 What is a Viral Vector? Viral Vector: A viral genome with deletions in some or all essential genes and possibly insertion of a transgene Plasmid: Small (~2-20 kbp) circular DNA molecules that replicates in bacterial cells independently of the host cell chromosome 7 Molecular Biology Essentials Flow of genetic information Nucleic acid polarity Infectivity of viral genomes Understanding cDNA cis- vs. trans-acting sequences cis (Latin) – on the same side trans (Latin) – across, over, through 8 Genetic flow & nucleic acid polarity Coding DNA Strand (+) 5' 3' 5' 3' 5' 3' 3' 5' Noncoding DNA Strand (-) mRNA (+) RT 3' 5' cDNA(-) Proteins (Copy DNA aka complementary DNA) 3' 5' 3' 5' 5' 3' mRNA (+) ds DNA in plasmid 9 Virology Essentials Replication-defective vs. infectious virus Helper virus vs. helper plasmids Pathogenesis Original disease Disease caused by transgene Mechanisms of cancer Insertional mutagenesis Transduction 10 Viral Vector Design and Production 1 + Vector Helper Cell 2 + Helper Constructs Vector 3 + + Vector Helper Constructs Note: These viruses are replication-defective but still infectious.
  • STRUCTURE of VIRUSES: Defective Viruses Defective Viruses Are Those Virus Particles Whose Genome Lacks a Specific Gene Or Genes Due to Either Mutation Or Deletion

    STRUCTURE of VIRUSES: Defective Viruses Defective Viruses Are Those Virus Particles Whose Genome Lacks a Specific Gene Or Genes Due to Either Mutation Or Deletion

    STRUCTURE OF VIRUSES: Defective Viruses Defective viruses are those virus particles whose genome lacks a specific gene or genes due to either mutation or deletion. As a result, defective viruses are not capable of undergoing a productive life cycle in cells. However, if the cell infected with the defective virus is co- infected with a "helper virus", the gene product lacking in the defective one is complemented by the helper and defective virus can replicate. Interestingly, for some viruses, during infection a greater quantity of defective virions is produced than infectious virions (as much as 100:1). The production of defective particles is a characteristic of some virus species and is believed to moderate the severity of the infection/disease in vivo. Pseudovirions Pseudovirions may be produced during viral replication when the host genome is fragmented. As a result of this process, host DNA fragments are incorporated into the capsid instead of viral DNA. Thus, pseudovirions possess the viral capsid to which antibodies may bind and facilitate attachment and penetration into a host cell, but they cannot replicate once they have gained access to a host cell, as they have none of the essential viral genes for the process. Prions Prions are proteinaceous infectious particles associated with transmissible spongiform encephalopathies (TSE) of humans and animals. TSEs include the Creutzfeldt-Jacob disease of humans, scrapie of sheep and bovine spongiform encephalopathy. At postmortem, the brain has large vacuoles in the cortex and cerebellum regions an thus prion diseases are called "spongiform encephalopathies". Closer examination of brain tissue reveals the accumulation of prion-protein associated fibrils and amyloid plaques.