DOCSLIB.ORG

The Microtubule Skeleton and the Evolution of Neuronal Complexity in Vertebrates

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Microtubule Skeleton and the Evolution of Neuronal Complexity in Vertebrates Biol. Chem. 2019; 400(9): 1163–1179 Nataliya I. Trushina, Armen Y. Mulkidjanian and Roland Brandt* The microtubule skeleton and the evolution of neuronal complexity in vertebrates https://doi.org/10.1515/hsz-2019-0149 Received February 4, 2019; accepted April 17, 2019; previously Introduction published online May 22, 2019 The complexity of the nervous system permits the devel- Abstract: The evolution of a highly developed nervous opment of sophisticated behavioral repertoires, such as system is mirrored by the ability of individual neurons to language, tool use, self-awareness, symbolic thought, develop increased morphological complexity. As microtu- cultural learning and consciousness. The basis for the bules (MTs) are crucially involved in neuronal development, development of such a complexity is a high neuronal het- we tested the hypothesis that the evolution of complexity is erogeneity caused by neuronal diversification on the one driven by an increasing capacity of the MT system for regu- hand and a large interconnectivity between the individual lated molecular interactions as it may be implemented by neurons on the other hand (Muotri and Gage, 2006). In a higher number of molecular players and a greater ability addition, the brain constantly needs to adapt to func- of the individual molecules to interact. We performed bio- tional challenges of various kinds during development informatics analysis on different classes of components of and adulthood by a process called neural plasticity (Zilles, the vertebrate neuronal MT cytoskeleton. We show that the 1992). At a single cell level, neural plasticity involves number of orthologs of tubulin structure proteins, MT-bind- changes in the number or the strength of synaptic con- ing proteins and tubulin-sequestering proteins expanded tacts between individual neurons thereby changing the during vertebrate evolution. We observed that protein extent of their interconnectivity. diversity of MT-binding and tubulin-sequestering proteins Thus, it is conceivable that the evolution of a complex increased by alternative splicing. In addition, we found that and adaptable nervous system is mirrored by the ability regions of the MT-binding protein tau and MAP6 displayed a of individual neurons to develop high and variable mor- clear increase in disorder extent during evolution. The data phological complexity, e.g. with respect to the extent of provide evidence that vertebrate evolution is paralleled by their axonal and dendritic arborization as a prerequisite gene expansions, changes in alternative splicing and evolu- to establish and modulate a large number of synaptic tion of coding sequences of components of the MT system. contacts. Differences in the total dendritic length and the The results suggest that in particular evolutionary changes number of branches – together with the diameter of the in tubulin-structure proteins, MT-binding proteins and dendrites – also affect the electrical, biochemical and tubulin-sequestering proteins were prominent drivers for biophysical properties of the synaptic inputs of neurons the development of increased neuronal complexity. (reviewed in Spruston, 2008). Therefore, variations in these parameters reflect differences in the complexity Keywords: microtubule-associated proteins; microtubules; and information processing of neuronal circuits between neuronal complexity; stathmins; tau; tubulin. species, which probably have important implications for cognitive functions. Indeed, a recent study showed corre- *Corresponding author: Roland Brandt, Department of lation between single-cell phenotype and cognitive func- Neurobiology, University of Osnabrück, Barbarastraße 11, D-49076 tioning in humans (Goriounova et al., 2018). Osnabrück, Germany; Center for Cellular Nanoanalytics, University Purkinje cells of the cerebellar cortex are an informa- of Osnabrück, Barbarastraße 11, D-49076 Osnabrück, Germany; tive example of neurons with a high interconnectivity. and Institute of Cognitive Science, University of Osnabrück, Barbarastraße 11, D-49076 Osnabrück, Germany, They belong to the largest neurons in the human brain and e-mail: [email protected] establish the most extensive dendritic arborization in the Nataliya I. Trushina: Department of Neurobiology, University of central nervous system (CNS), which allows for the forma- Osnabrück, Barbarastraße 11, D-49076 Osnabrück, Germany tion of up to 200 000 synaptic inputs per neuron (Tyrrell Armen Y. Mulkidjanian: Department of Physics, University of and Willshaw, 1992). The cerebellum is a major part of the Osnabrück, Barbarastraße 7, D-49076 Osnabrück, Germany; and A.N. Belozersky Institute of Physico-Chemical Biology and School hindbrain, which represents an evolutionary old part of of Bioengineering and Bioinformatics, Lomonosov Moscow State the brain and may have first evolved in the last common University, Moscow 119991, Russia ancestor of chordates and arthropods between 570 and Open Access. © 2019 Nataliya I. Trushina et al., published by De Gruyter. This work is licensed under the Creative Commons Attribution- NonCommercial-NoDerivatives 4.0 License. 1164 N. I. Trushina et al.: Microtubules and the evolution of neuronal complexity 555 million years ago (Ghysen, 2003). Thus, the morpho- logical complexity of the dendritic arbor of Purkinje cells can be compared from the brain of simple vertebrates such as lamprey to primates including humans. Deter- mination of the fractal dimensions of Purkinje cells as a measure for dendritic arborization has been performed for some representative species and revealed an increase over evolutionary time (Figure 1A) consistent with an increase of morphological complexity of neurons during evolution; it should however be noted that a regression analysis with a higher number of species did not reveal a significant increase of the fractal dimensions of Purkinje cells for dif- ferent water creatures, suggesting that also other variables besides evolutionary time need to be taken into account, at least with respect to the development of the cerebellum (Krauss et al., 1994). Pyramidal neurons of the cerebral cortex may be another informative example for changes in morphologi- cal complexity during evolution. In contrast to the cere- bellum, the cerebral cortex has evolved most recently and shows the biggest evolutionary variation (Rakic, 2009). It is the largest site of neuronal integration in the brain and plays a key role in higher cognitive functions such as memory and attention. During mammalian evolution, the cerebral cortex has established a large relative expansion with an allocation of approximately eight neurons in the cerebral cortex for every neuron allocated to the rest of the Figure 1: The morphological complexity of neurons increases over brain (Herculano-Houzel et al., 2014). The most abundant evolutionary time. cortical neurons (estimated as 70–80% of the total neural (A) Fractal dimension of Purkinje cells as a measure for the extent of dendritic arborization are plotted from selected species. The plot population) represent the pyramidal cells (Defelipe, 2011). is based on data obtained by (Krauss et al., 1994), which include a A cortical brain region with a well-defined cytoarchitecture re-examination of data by (Takeda et al., 1992); both data sets are and connectivity is the hippocampus, which is involved in shown in the graph and indicate an increased fractal dimension the consolidation of information from short-term to long- over evolutionary time. (B) Morphological parameters of CA1 term memory. Pyramidal neurons in the hippocampal pyramidal neurons of the hippocampus. A typical reconstruction of subfield CA1 tend to be the most homogeneous popula- the morphology of a CA1 neuron from the mouse hippocampus is shown on top. The selected neuron is indicated by a yellow arrow in tion in the hippocampus with respect to their morphologi- the stitched image (top left). Apical dendrites of the reconstructed cal variation within a species (Ishizuka et al., 1995). In neuron are shown in red, basal dendrites in blue (top right). humans, CA1 pyramidal neurons are considered to have The length of the dendrites and the number of branching points a critical role in autobiographical memory retrieval and from three different species are shown in the table below. The for re-experiencing detailed episodic memories (Bartsch numbers are based on data from the evaluation of eight fluorescent neurons from the hippocampus of a GFP-expressing mouse line et al., 2011). Also, these neurons show an increase in (14–20 weeks old male mice; Schob et al., 2019), 20 horseradish dendritic length and arborization from mouse to rats to peroxidase injected CA1 neurons from the rat hippocampus monkeys, with a more than 3-fold increase in total den- (33–57 days old female rats; Ishizuka et al., 1995), and 30 biocytin- dritic length and an almost doubling in branching points labeled CA1 neurons from 11 months to 24-year-old Macaca mulatta (Figure 1B). Thus, these numbers are also in agreement and M. fascicularis (Altemus et al., 2005). Mean ± SEM are shown. with the view that the evolution of higher cognitive func- tions is paralleled by an increased morphological com- plexity on the level of individual neurons and support the Most excitatory synapses in the cerebellar and cerebral view that human neurons are not just ‘scaled-up’ versions cortex end at small dendritic protrusions, called dendritic of rodent or macaque neurons, but have unique structural spines (Yuste, 2010).
Load more

Recommended publications
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name katanin p80 (WD repeat containing) subunit B 1 Gene Symbol KATNB1 Organism Human Gene Summary Microtubules polymers of alpha and beta tubulin subunits form the mitotic spindle of a dividing cell and help to organize membranous organelles during interphase. Katanin is a heterodimer that consists of a 60 kDa ATPase (p60 subunit A 1) and an 80 kDa accessory protein (p80 subunit B 1). The p60 subunit acts to sever and disassemble microtubules while the p80 subunit targets the enzyme to the centrosome. Katanin is a member of the AAA family of ATPases. Gene Aliases KAT RefSeq Accession No. NC_000016.9, NT_010498.15 UniGene ID Hs.275675 Ensembl Gene ID ENSG00000140854 Entrez Gene ID 10300 Assay Information Unique Assay ID qHsaCIP0026589 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000379661 Amplicon Context Sequence CACCAAGACAGCCTGGAAGTTGCAAGAGATCGTCGCGCATGCCAGCAACGTGT CCTCACTGGTGCTGGGCAAAGCCTCCGGGCGGCTGCTGGCTACAGGCGGGGAT GACTGCCGCGTCAACCTGTGGTCCATCAACAAGCCCAACTGCATCATGAGCCTG ACG Amplicon Length (bp) 132 Chromosome Location 16:57771173-57778314 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 100 R2 0.9991 cDNA Cq 21.47 cDNA Tm (Celsius) 89 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 35.43 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report KATNB1, Human Amplification
    [Show full text]
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Analysis of Trans Esnps Infers Regulatory Network Architecture
    Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2014 Anat Kreimer All rights reserved ABSTRACT Analysis of trans eSNPs infers regulatory network architecture Anat Kreimer eSNPs are genetic variants associated with transcript expression levels. The characteristics of such variants highlight their importance and present a unique opportunity for studying gene regulation. eSNPs affect most genes and their cell type specificity can shed light on different processes that are activated in each cell. They can identify functional variants by connecting SNPs that are implicated in disease to a molecular mechanism. Examining eSNPs that are associated with distal genes can provide insights regarding the inference of regulatory networks but also presents challenges due to the high statistical burden of multiple testing. Such association studies allow: simultaneous investigation of many gene expression phenotypes without assuming any prior knowledge and identification of unknown regulators of gene expression while uncovering directionality. This thesis will focus on such distal eSNPs to map regulatory interactions between different loci and expose the architecture of the regulatory network defined by such interactions. We develop novel computational approaches and apply them to genetics-genomics data in human. We go beyond pairwise interactions to define network motifs, including regulatory modules and bi-fan structures, showing them to be prevalent in real data and exposing distinct attributes of such arrangements. We project eSNP associations onto a protein-protein interaction network to expose topological properties of eSNPs and their targets and highlight different modes of distal regulation.
    [Show full text]
  • The Molecular Genetic Architecture of Attention Deficit Hyperactivity Disorder
    Molecular Psychiatry (2015) 20, 289–297 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp EXPERT REVIEW The molecular genetic architecture of attention deficit hyperactivity disorder Z Hawi1, TDR Cummins1, J Tong1, B Johnson1, R Lau1, W Samarrai2 and MA Bellgrove1 Attention deficit hyperactivity disorder (ADHD) is a common childhood behavioral condition which affects 2–10% of school age children worldwide. Although the underlying molecular mechanism for the disorder is poorly understood, familial, twin and adoption studies suggest a strong genetic component. Here we provide a state-of-the-art review of the molecular genetics of ADHD incorporating evidence from candidate gene and linkage designs, as well as genome-wide association (GWA) studies of common single-nucleotide polymorphisms (SNPs) and rare copy number variations (CNVs). Bioinformatic methods such as functional enrichment analysis and protein–protein network analysis are used to highlight biological processes of likely relevance to the aetiology of ADHD. Candidate gene associations of minor effect size have been replicated across a number of genes including SLC6A3, DRD5, DRD4, SLC6A4, LPHN3, SNAP-25, HTR1B, NOS1 and GIT1. Although case-control SNP-GWAS have had limited success in identifying common genetic variants for ADHD that surpass critical significance thresholds, quantitative trait designs suggest promising associations with Cadherin13 and glucose–fructose oxidoreductase domain 1 genes. Further, CNVs mapped to glutamate receptor genes (GRM1, GRM5, GRM7 and GRM8) have been implicated in the aetiology of the disorder and overlap with bioinformatic predictions based on ADHD GWAS SNP data regarding enriched pathways. Although increases in sample size across multi-center cohorts will likely yield important new results, we advocate that this must occur in parallel with a shift away from categorical case-control approaches that view ADHD as a unitary construct, towards dimensional approaches that incorporate endophenotypes and statistical classification methods.
    [Show full text]
  • KIAA0556 Is a Novel Ciliary Basal Body Component Mutated in Joubert Syndrome Anna A
    Sanders et al. Genome Biology (2015) 16:293 DOI 10.1186/s13059-015-0858-z RESEARCH Open Access KIAA0556 is a novel ciliary basal body component mutated in Joubert syndrome Anna A. W. M. Sanders1†, Erik de Vrieze2,3†, Anas M. Alazami4†, Fatema Alzahrani4, Erik B. Malarkey5, Nasrin Sorusch6, Lars Tebbe6, Stefanie Kuhns1, Teunis J. P. van Dam7, Amal Alhashem8, Brahim Tabarki8, Qianhao Lu9,10, Nils J. Lambacher1, Julie E. Kennedy1, Rachel V. Bowie1, Lisette Hetterschijt2,3, Sylvia van Beersum3,11, Jeroen van Reeuwijk3,11, Karsten Boldt12, Hannie Kremer2,3,11, Robert A. Kesterson13, Dorota Monies4, Mohamed Abouelhoda4, Ronald Roepman3,11, Martijn H. Huynen7, Marius Ueffing12, Rob B. Russell9,10, Uwe Wolfrum6, Bradley K. Yoder5, Erwin van Wijk2,3*, Fowzan S. Alkuraya4,14* and Oliver E. Blacque1* Abstract Background: Joubert syndrome (JBTS) and related disorders are defined by cerebellar malformation (molar tooth sign), together with neurological symptoms of variable expressivity. The ciliary basis of Joubert syndrome related disorders frequently extends the phenotype to tissues such as the eye, kidney, skeleton and craniofacial structures. Results: Using autozygome and exome analyses, we identified a null mutation in KIAA0556 in a multiplex consanguineous family with hallmark features of mild Joubert syndrome. Patient-derived fibroblasts displayed reduced ciliogenesis potential and abnormally elongated cilia. Investigation of disease pathophysiology revealed that Kiaa0556-/- null mice possess a Joubert syndrome-associated brain-restricted phenotype. Functional studies in Caenorhabditis elegans nematodes and cultured human cells support a conserved ciliary role for KIAA0556 linked to microtubule regulation. First, nematode KIAA0556 is expressed almost exclusively in ciliated cells, and the worm and human KIAA0556 proteins are enriched at the ciliary base.
    [Show full text]
  • Dual Proteome-Scale Networks Reveal Cell-Specific Remodeling of the Human Interactome
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Dual Proteome-scale Networks Reveal Cell-specific Remodeling of the Human Interactome Edward L. Huttlin1*, Raphael J. Bruckner1,3, Jose Navarrete-Perea1, Joe R. Cannon1,4, Kurt Baltier1,5, Fana Gebreab1, Melanie P. Gygi1, Alexandra Thornock1, Gabriela Zarraga1,6, Stanley Tam1,7, John Szpyt1, Alexandra Panov1, Hannah Parzen1,8, Sipei Fu1, Arvene Golbazi1, Eila Maenpaa1, Keegan Stricker1, Sanjukta Guha Thakurta1, Ramin Rad1, Joshua Pan2, David P. Nusinow1, Joao A. Paulo1, Devin K. Schweppe1, Laura Pontano Vaites1, J. Wade Harper1*, Steven P. Gygi1*# 1Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA. 2Broad Institute, Cambridge, MA, 02142, USA. 3Present address: ICCB-Longwood Screening Facility, Harvard Medical School, Boston, MA, 02115, USA. 4Present address: Merck, West Point, PA, 19486, USA. 5Present address: IQ Proteomics, Cambridge, MA, 02139, USA. 6Present address: Vor Biopharma, Cambridge, MA, 02142, USA. 7Present address: Rubius Therapeutics, Cambridge, MA, 02139, USA. 8Present address: RPS North America, South Kingstown, RI, 02879, USA. *Correspondence: [email protected] (E.L.H.), [email protected] (J.W.H.), [email protected] (S.P.G.) #Lead Contact: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.01.19.905109; this version posted January 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Effects of Activation of the LINE-1 Antisense Promoter on the Growth of Cultured Cells
    www.nature.com/scientificreports OPEN Efects of activation of the LINE‑1 antisense promoter on the growth of cultured cells Tomoyuki Honda1*, Yuki Nishikawa1, Kensuke Nishimura1, Da Teng1, Keiko Takemoto2 & Keiji Ueda1 Long interspersed element 1 (LINE‑1, or L1) is a retrotransposon that constitutes ~ 17% of the human genome. Although ~ 6000 full‑length L1s spread throughout the human genome, their biological signifcance remains undetermined. The L1 5′ untranslated region has bidirectional promoter activity with a sense promoter driving L1 mRNA production and an antisense promoter (ASP) driving the production of L1‑gene chimeric RNAs. Here, we stimulated L1 ASP activity using CRISPR‑Cas9 technology to evaluate its biological impacts. Activation of the L1 ASP upregulated the expression of L1 ASP‑driven ORF0 and enhanced cell growth. Furthermore, the exogenous expression of ORF0 also enhanced cell growth. These results indicate that activation of L1 ASP activity fuels cell growth at least through ORF0 expression. To our knowledge, this is the frst report demonstrating the role of the L1 ASP in a biological context. Considering that L1 sequences are desilenced in various tumor cells, our results indicate that activation of the L1 ASP may be a cause of tumor growth; therefore, interfering with L1 ASP activity may be a potential strategy to suppress the growth. Te human genome contains many transposable element-derived sequences, such as endogenous retroviruses and long interspersed element 1 (LINE-1, or L1). L1 is one of the major classes of retrotransposons, and it constitutes ~ 17% of the human genome1. Full-length L1 consists of a 5′ untranslated region (UTR), two open reading frames (ORFs) that encode the proteins ORF1p and ORF2p, and a 3′ UTR with a polyadenylation signal.
    [Show full text]
  • The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid
    The Capacity of Long-Term in Vitro Proliferation of Acute Myeloid Leukemia Cells Supported Only by Exogenous Cytokines Is Associated with a Patient Subset with Adverse Outcome Annette K. Brenner, Elise Aasebø, Maria Hernandez-Valladares, Frode Selheim, Frode Berven, Ida-Sofie Grønningsæter, Sushma Bartaula-Brevik and Øystein Bruserud Supplementary Material S2 of S31 Table S1. Detailed information about the 68 AML patients included in the study. # of blasts Viability Proliferation Cytokine Viable cells Change in ID Gender Age Etiology FAB Cytogenetics Mutations CD34 Colonies (109/L) (%) 48 h (cpm) secretion (106) 5 weeks phenotype 1 M 42 de novo 241 M2 normal Flt3 pos 31.0 3848 low 0.24 7 yes 2 M 82 MF 12.4 M2 t(9;22) wt pos 81.6 74,686 low 1.43 969 yes 3 F 49 CML/relapse 149 M2 complex n.d. pos 26.2 3472 low 0.08 n.d. no 4 M 33 de novo 62.0 M2 normal wt pos 67.5 6206 low 0.08 6.5 no 5 M 71 relapse 91.0 M4 normal NPM1 pos 63.5 21,331 low 0.17 n.d. yes 6 M 83 de novo 109 M1 n.d. wt pos 19.1 8764 low 1.65 693 no 7 F 77 MDS 26.4 M1 normal wt pos 89.4 53,799 high 3.43 2746 no 8 M 46 de novo 26.9 M1 normal NPM1 n.d. n.d. 3472 low 1.56 n.d. no 9 M 68 MF 50.8 M4 normal D835 pos 69.4 1640 low 0.08 n.d.
    [Show full text]
  • Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
    animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest.
    [Show full text]
  • Atrazine and Cell Death Symbol Synonym(S)
    Supplementary Table S1: Atrazine and Cell Death Symbol Synonym(s) Entrez Gene Name Location Family AR AIS, Andr, androgen receptor androgen receptor Nucleus ligand- dependent nuclear receptor atrazine 1,3,5-triazine-2,4-diamine Other chemical toxicant beta-estradiol (8R,9S,13S,14S,17S)-13-methyl- Other chemical - 6,7,8,9,11,12,14,15,16,17- endogenous decahydrocyclopenta[a]phenanthrene- mammalian 3,17-diol CGB (includes beta HCG5, CGB3, CGB5, CGB7, chorionic gonadotropin, beta Extracellular other others) CGB8, chorionic gonadotropin polypeptide Space CLEC11A AW457320, C-type lectin domain C-type lectin domain family 11, Extracellular growth factor family 11, member A, STEM CELL member A Space GROWTH FACTOR CYP11A1 CHOLESTEROL SIDE-CHAIN cytochrome P450, family 11, Cytoplasm enzyme CLEAVAGE ENZYME subfamily A, polypeptide 1 CYP19A1 Ar, ArKO, ARO, ARO1, Aromatase cytochrome P450, family 19, Cytoplasm enzyme subfamily A, polypeptide 1 ESR1 AA420328, Alpha estrogen receptor,(α) estrogen receptor 1 Nucleus ligand- dependent nuclear receptor estrogen C18 steroids, oestrogen Other chemical drug estrogen receptor ER, ESR, ESR1/2, esr1/esr2 Nucleus group estrone (8R,9S,13S,14S)-3-hydroxy-13-methyl- Other chemical - 7,8,9,11,12,14,15,16-octahydro-6H- endogenous cyclopenta[a]phenanthren-17-one mammalian G6PD BOS 25472, G28A, G6PD1, G6PDX, glucose-6-phosphate Cytoplasm enzyme Glucose-6-P Dehydrogenase dehydrogenase GATA4 ASD2, GATA binding protein 4, GATA binding protein 4 Nucleus transcription TACHD, TOF, VSD1 regulator GHRHR growth hormone releasing
    [Show full text]
  • Staufen 1 Does Not Play a Role in NPC Asymmetric Divisions but Regulates Cellular Positioning During Corticogenesis
    Staufen 1 does not play a role in NPC asymmetric divisions but regulates cellular positioning during corticogenesis by Christopher Kuc A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Master of Science in Molecular and Cellular Biology Guelph, Ontario, Canada © Christopher Kuc, September 2018 ABSTRACT INVESTIGATING THE ROLE OF STAUFEN1 IN ASYMMETRIC NEURAL PRECURSOR CELL DIVISIONS IN THE DEVELOPING CEREBRAL CORTEX Christopher Kuc Advisors: Dr. John Vessey University of Guelph, 2018 Cerebral cortex development relies on asymmetric divisions of neural precursor cells (NPCs) to produce a recurring NPC and a differentiated neuron. Asymmetric divisions are promoted by the differential localization of cell fate determinants between daughter cells. Staufen 1 (Stau1) is an RNA-binding protein known to localize mRNA in mature hippocampal neurons. However, its expression pattern and role in the developing mammalian cortex remains unknown. In this study, Stau1 mRNA and protein were found to be expressed in all cells examined and was temporally and spatially characterized across development. Upon shRNA-mediated knockdown of Stau1 in primary cortical cultures, NPCs retained the ability to self-renew and generate neurons despite the loss of Stau1 expression. This said, in vivo knockdown of Stau1 demonstrated that it may play a role in anchoring NPCs to the ventricular zone during cortical development. ACKNOWLEDGMENTS I would first like to thank my advisor Dr. John Vessey. Throughout these 2 years, you have provided me with an invaluable opportunity and played an instrumental role in shaping me as a scientist. The guidance, support and expertise you have provided me will be always appreciated and never forgotten.
    [Show full text]
  • TRPV4: a Physio and Pathophysiologically Significant Ion Channel
    International Journal of Molecular Sciences Review TRPV4: A Physio and Pathophysiologically Significant Ion Channel Tamara Rosenbaum 1,* , Miguel Benítez-Angeles 1, Raúl Sánchez-Hernández 1, Sara Luz Morales-Lázaro 1, Marcia Hiriart 1 , Luis Eduardo Morales-Buenrostro 2 and Francisco Torres-Quiroz 3 1 Departamento de Neurociencia Cognitiva, División Neurociencias, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Mexico City 04510, Mexico; [email protected] (M.B.-A.); [email protected] (R.S.-H.); [email protected] (S.L.M.-L.); [email protected] (M.H.) 2 Departamento de Nefrología y Metabolismo Mineral, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, Mexico City 14080, Mexico; [email protected] 3 Departamento de Bioquímica y Biología Estructural, División Investigación Básica, Instituto de Fisiología Celular, Universidad Nacional Autónoma de México, Mexico City 04510, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +52-555-622-56-24; Fax: +52-555-622-56-07 Received: 3 May 2020; Accepted: 24 May 2020; Published: 28 May 2020 Abstract: Transient Receptor Potential (TRP) channels are a family of ion channels whose members are distributed among all kinds of animals, from invertebrates to vertebrates. The importance of these molecules is exemplified by the variety of physiological roles they play. Perhaps, the most extensively studied member of this family is the TRPV1 ion channel; nonetheless, the activity of TRPV4 has been associated to several physio and pathophysiological processes, and its dysfunction can lead to severe consequences. Several lines of evidence derived from animal models and even clinical trials in humans highlight TRPV4 as a therapeutic target and as a protein that will receive even more attention in the near future, as will be reviewed here.
    [Show full text]