Staufen 1 Does Not Play a Role in NPC Asymmetric Divisions but Regulates Cellular Positioning During Corticogenesis

Staufen 1 does not play a role in NPC asymmetric divisions but regulates cellular positioning during corticogenesis

Christopher Kuc

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Master of Science in Molecular and Cellular Biology

Guelph, Ontario, Canada

ABSTRACT

INVESTIGATING THE ROLE OF STAUFEN1 IN ASYMMETRIC NEURAL PRECURSOR CELL DIVISIONS IN THE DEVELOPING CEREBRAL CORTEX

Christopher Kuc Advisors: Dr. John Vessey University of Guelph, 2018

Cerebral cortex development relies on asymmetric divisions of neural precursor cells (NPCs) to produce a recurring NPC and a differentiated neuron. Asymmetric divisions are promoted by the differential localization of cell fate determinants between daughter cells. Staufen 1 (Stau1) is an

RNA-binding protein known to localize mRNA in mature hippocampal neurons. However, its expression pattern and role in the developing mammalian cortex remains unknown. In this study,

Stau1 mRNA and protein were found to be expressed in all cells examined and was temporally and spatially characterized across development. Upon shRNA-mediated knockdown of Stau1 in primary cortical cultures, NPCs retained the ability to self-renew and generate neurons despite the loss of Stau1 expression. This said, in vivo knockdown of Stau1 demonstrated that it may play a role in anchoring NPCs to the ventricular zone during cortical development.

ACKNOWLEDGMENTS

I would first like to thank my advisor Dr. John Vessey. Throughout these 2 years, you have provided me with an invaluable opportunity and played an instrumental role in shaping me as a scientist. The guidance, support and expertise you have provided me will be always appreciated and never forgotten.

I would next like to thank all the members of Vessey lab who I had a pleasure of knowing. Thank you for being everything I needed when I needed it, whether that be a supportive friend, competition or instructor. Thank you to Dendra for all your patience in training me when I was just beginning my adventure in the Vessey lab. Thank you to Hayley for sharing this experience with me side by side. I always felt that we were a team and could rely on you through thick and thin. I really appreciate all these great people I met and I hope we stay in touch.

Thank you to all the members of the molecular and cellular biology department. There are a lot of extraordinary people that I had the pleasure of calling my friends. Your laughter and companionship through my journey has helped me more than you could know.

Last but not least, I would like to thank my best friend Jennifer. I never met anyone like you who I could share anything and everything with. As we did our degree together we guided each other towards the finish line and supported each other when we needed it most. I will never forget our frustrating, yet enjoyable late night sessions in the lab. Without you, this experience would not be the same and for that I am forever thankful.

iii DECLARATION OF WORK PERFORMED I, Christopher Kuc, declare that all the work reported in this thesis was performed by me with the exception of the fluorescent in-situ hyrbidization performed by Julia Brott, the leptomycin B treatment performed by Anastasia Smart and the production of mature cortical culture performed by Hayley Thorpe.

iv TABLE OF CONTENTS

ABSTRACT ...... ii ACKNOWLEDGMENTS ...... iii DECLARATION OF WORK PERFORMED ...... iv TABLE OF CONTENTS ...... v LIST OF FIGURES ...... vi LIST OF ABBREVIATIONS ...... vii Chapter One: Introduction ...... 1 Development of the cerebral cortex ...... 1 Asymmetric divisions ...... 6 The Staufen family of RNA-binding proteins ...... 10 Staufen: Asymmetric divisions during neurogenesis ...... 11 Staufen: Synaptic plasticity and memory ...... 13 Staufen: Translational control ...... 15 Staufen: mRNA stability ...... 16 Staufen1-mediated decay regulates cortical neurogenesis ...... 17 Rationale ...... 19 Hypothesis...... 20 Objectives ...... 21 Chapter Two: Materials and Methods ...... 22 Animals ...... 22 Cell culture ...... 22 Western blotting ...... 24 RT-PCR ...... 24 Transient transfection of cultured cells ...... 25 In utero electroporation ...... 26 Immunocytochemistry and immunohistochemistry ...... 27 Microscopy and quantification ...... 28 Statistics ...... 29 Chapter Three: Results ...... 30 Stau1 mRNA and protein is expressed in NPCs, newly born neurons, and intermediate progenitors in the developing murine cortex ...... 30 Stau1 is expressed by all cells of the developing cortex, is predominantly cytoplasmic, and can shuttle in and out of the nucleus...... 33 Stau1 is dispensable for NPC self-renewal and for neuronal differentiation...... 41 Chapter Four: Discussion ...... 50 Chapter Five: Summary and Future Directions ...... 58 Future directions ...... 58 Summary ...... 59 References ...... 61 Appendix: Supplementary Data ...... 69

v LIST OF FIGURES

Figure 1.1. Cytoarchitecture of the developing cerebral cortex...... 4

Figure 1.2. Timeline of murine brain development...... 5

Figure 1.3. Structural comparison between Stau1 isoforms...... 12

Figure 3.1. stau1 mRNA and protein is expressed by NPCs and newborn neurons during

cortical development...... 31

Figure 3.2. Stau1 is expressed throughout the developing murine cortex...... 35

Figure 3.3. Stau1 is expressed in NPCs, as well as newborn and mature cortical neurons. 39

Figure 3.4. Stau1 shuttles between the cytoplasm and nucleus of NPCs...... 42

Figure 3.5. Stau1 shRNAs knock-down Stau1 protein in primary NPC cultures...... 45

Figure 3.6. Knockdown of Stau1 in primary cortical cultures produces no observable change

in NPC fate...... 48

Figure 5.1. Knock-down of Stau1 in-utero produces no observable change in neurogenesis.

...... 69

Figure 5.2. Knock-down of Stau1 in-utero produces changes in the positioning of transfected

cells within the cortical layers...... 70

vi LIST OF ABBREVIATIONS

Arf1 ADP-ribosylation factor 1

BCA bicinchoninic acid

BSA bovine serum albumin

C Celsius

CNS central nervous system

CP cortical plate d days dH2O distilled water dsRBD double stranded RNA-binding domain dsRNA double stranded RNA

E embryonic day

ECL enhanced chemiluminescence

EGF epidermal growth factor

EJC exon junction complex

ER endoplasmic reticulum

FGF fibroblast growth factor

FISH fluorescent in-situ hybridization

G gauge

GFP green fluorescent protein

GMC ganglion mother cell h hours

HBSS Hanks Balanced Salt Solution

vii IF immunofluorescence

IPC intermediate progenitor cell

IZ intermediate zone kDa kilodalton kg kilograms

LB lysogeny broth

LMB Leptomycin B

LTD long term depression

LTP long term potentiation

MAPK mitogen-activated protein kinase mg milligrams min minutes mL millilitres ms milliseconds

MS mass spectrometry mRNA messenger RNA nGFP nuclear green fluorescent protein

NB neuroblast

NEC neuroectoderm cells

NLS nuclear localization signal

NMD nonsense-mediated decay

NPC neural precursor cell

N.S. not significant

viii OCT optimal cutting temperature compound

Par partition defective complex

PBS phosphate buffered saline

Pros Prospero

PTC premature termination codon rpm revolutions per minute

RNP ribonucleoprotein

SEM standard error of the mean shctrl nonspecific scrambled control short hairpin RNA shRNA short hairpin RNA

SSM staufen-swapping motif

Stau1 Staufen 1

Stau2 Staufen 2

SVZ subventricular zone

TBST tris-buffered saline with Tween20

µg micrograms

µm micrometres

Upf helicase up-frameshift

UT untransfected

UTR untranslated region

V volts

VZ ventricular zone

SVZ sub-ventricular zone

ix w/v weight/volume

x Chapter One: Introduction

Development of the cerebral cortex

Proper development of the cerebral cortex is critical for higher order processes such as conscious thought, decision making, and reasoning (Kandel et al., 2013). Furthermore, aberrations in the molecular and cellular pathways governing cortical development have been linked to many neurodevelopmental disorders such as autism spectrum disorder (Wegiel et al.,

2010) and schizophrenia (Reif et al., 2007). For example, deficits in neurogenesis and subsequent neuronal migration have been linked to these aforementioned disorders by altering neural cell populations and their connectivity (Wegiel et al., 2010). Ultimately, without further comprehension of the molecular and cellular mechanisms underlying cortical development, the complexities of these disease states will mean that the development of treatments may not come to fruition.

During early embryogenesis, an event known as neural tube closure will form lateral ventricles and initiate cortical development (Franco and Müller, 2013). The lateral ventricles are composed of pluripotent cells known as neuroectoderm cells (NECs), which undergo rapid symmetric cellular divisions. These rapid symmetric divisions amplify the stem cell pool responsible for producing the entire cellular population of the developing cortex (Franco and

Müller, 2013). Upon reaching a state of quorum, NECs signal to each other to differentiate and form neural precursor cells (NPCs). Upon differentiation, NECs lose their epithelial characteristics and adopt a glial nature by anchoring themselves to the ventricular surface and basal lamina using adherens junctions and integrins, respectively (Radakovits et al., 2009;

1 Zhadanov et al., 1999). Through this morphological change, NPCs form the first cortical layer known as the ventricular zone (VZ), which lines the ventricle of the developing cortex (Figure

1.1; Florio and Huttner, 2014). Immediately basal to the VZ is the intermediate zone (IZ), which contains intermediate progenitor cells (IPC) undergoing symmetric divisions to increase neuronal output. The most basal layer is known as the cortical plate (CP), this layer houses terminally differentiated neurons (Florio and Huttner, 2014). NPCs in the VZ possess a long basal process that extends to the CP of the developing cortex, which is used as scaffolding during neuronal migration (Florio and Huttner, 2014; Rakic, 1990).

A murine model system is commonly used to study mammalian brain development due to short gestation times, ease of genetic manipulation, and homologous genes and cellular mechanisms that are analogous to those in humans (Perlman, 2016). In mice, embryonic day 12

(E12) marks the initiation of neurogenesis through a change in cellular divisions by NPCs

(Figure 1.2) (Finlay and Darlington, 1995; Florio and Huttner, 2014). While the NPC population is established via rapid symmetric divisions where both daughter cells retain the NPC cell fate, upon neurogenesis, NPCs undergo asymmetric divisions where only one daughter cell will self- renew and retain the NPC fate while the other daughter cell adopts a unique cell fate (Florio and

Huttner, 2014). NPCs produce all the cell types present in the developing cortex including neurons, IPCs and glia (Kriegstein and Alvarez-Buylla, 2009). IPCs are a subtype of stem cell found within the developing cortex. These cells undergo a terminal symmetric division that produces two neurons. As a result, IPCs rapidly amplify the neuronal cell population during cortical development by increasing neuronal output (Noctor et al., 2004).

As neurons form through NPC or IPC cell divisions, they must migrate away from the

VZ towards the CP, a process essential for proper cortical development (Figure 1.1; Marín et al.,

2 2010). Neuronal migration is facilitated by a long basal process extended by NPCs. Neurons migrate as a unit along the process of the NPC from which they were derived towards the CP

(Rakic, 1990). In this way, the cortex is formed in an inside-out fashion where newly differentiated neurons migrate past older neurons to form the most basal layers of the CP (Florio and Huttner, 2014).

The end of neurogenesis at ~ E18 signals the beginning of gliogenesis (Figure 1.2), where

NPCs divide to populate the cortex with glial cells that function to improve neural connectivity and health (Jäkel and Dimou, 2017; Miller and Gauthier, 2007). Gliogenesis also continues during postnatal development (Pressler and Auvin, 2013).

Figure 1.1. Cytoarchitecture of the developing cerebral cortex. Staining of the various cell types of the neocortex to outline the structural layers during neurogenesis. The yellow arrow in the brain section demonstrates the direction of neural cell migration during embryonic development, while the red asterisk indicates the lateral ventricles. Figure modified from Center for Integrative Brain Research (2014), Hutton & Pevny (2014), and Pacary et al. (2012).

Figure 1.2. Timeline of murine brain development. Neurogenesis begins at E12 and peaks at E15 where NPCs and neurons equally populate the cortex. Approaching E18, neurogenesis becomes less prominent and is followed by gliogenesis, which continues postnatally.

Asymmetric divisions

Asymmetric cell divisions play an integral role in neocortex development, but are also important in other tissues and organisms. These divisions are necessary in order to create cellular diversity, while also maintaining the stem cell population for further growth (Gönczy, 2008). For these divisions to occur, careful co-ordination of many complex molecular events takes place.

For instance, NPCs switch their divisions from proliferative, self-amplifying symmetric divisions to self-renewing, neurogenic divisions. This requires molecular reprogramming of one daughter cell, while maintaining the stem cell nature of the other (Morrison and Kimble, 2006).

In order to achieve asymmetric divisions, differential localization of molecular constituents within the dividing cell must occur to produce distinct daughter cells. Cellular polarity is imperative to this differential localization process, as it creates spatial differences within cells to unequally segregate and localize cellular components (Drubin and Nelson, 1996).

The partition defective (Par) complex consisting of PAR proteins 1-6 indirectly organizes the mitotic spindle and cleavage plane, achieving the polarity required to differentially segregate cell fate determinants between daughter cells (Chenn and McConnell, 1995; Goldstein and Macara,

2007; Inaba and Yamashita, 2012). The Par complex is thus known to play a role in cellular differentiation and asymmetric divisions that produce daughters with distinct cell fates, by organizing the cleavage plane and mitotic spindle (Chenn and McConnell, 1995).

Transcription factors commonly initiate differentiation by regulating instrumental genes of the designated cell type (Yamamizu et al., 2013). As a result, the mRNAs that code for these transcription factors are targets for differential segregation during asymmetric cell divisions

(Broadus et al., 1998; Gavis and Lehmann, 1994; Kugler and Lasko, 2009; Li et al., 1997;

6 Vessey et al., 2012). These cell fate determining mRNAs are localized within cells through the action of RNA-binding proteins (RBPs; Kiebler and Bassell, 2006). These RBPs serve a multitude of functions in RNA metabolism from the beginning of transcription to translation

(Holt and Bullock, 2009). In conjunction with cellular polarization, RBPs facilitate differential mRNA segregation among daughter cells along polarized microtubules (Holt and Bullock,

2009). mRNA localization also requires the formation of a ribonucleoprotein (RNP) complex that consists of multiple RBPs. Shortly after transcription, mRNA destined to be localized to a specific subcellular location will associate with RBPs through binding to cis-elements; this occurs in the nucleus and, less commonly, in the cytoplasm (Holt and Bullock, 2009). Binding of cis-factors can not only repress translation of the transcript but can also protect it from degradation upon entering the cytoplasm as well as relay localization information (Kuersten and

Goodwin, 2003). When shuttled into the cytoplasm, the complex associates with trans binding proteins, thus completing the RNP complex. When the RNP is fully formed, it can be transported either via active transport across microtubules or by passive diffusion and local anchorage at the subcellular compartment (Holt and Bullock, 2009). In the central nervous system (CNS), active transport is more common, perhaps due to the increased speed at which mRNA can be localized.

During active transport, RNPs associate with motor proteins, kinesin and dynein, to facilitate their movement within the cell along polarized microtubules. Once at their destination, RNPs are anchored until specific signals are received, which alter the RNP composition and allow for translation (Holt and Bullock, 2009).

There are two main advantages of using RBPs to localize mRNA within a cell. First, they act as spatial regulators of mRNA translation. Rather than translating protein diffusely and shuttling it to subcellular compartments, mRNA localization allows concentrated protein

7 expression in these compartments where they are required, resulting in less energy expenditure.

RBPs also act as temporal regulators of mRNA translation. Multiple RBPs form the RNP complex and these can elicit translational repression of the bound mRNA. Only when specific signals are received does the RNP change in RBP composition to permit active translation

(Buxbaum et al., 2014). Utilization of these characteristics is very common in the CNS. For example, memory formation requires synapse-specific protein synthesis at the site of synaptic activity. RBPs localize these mRNAs to the synapse, spatially regulating their translation in addition to ensuring translational repression until synaptic activity occurs (Buxbaum et al., 2014;

Heraud-Farlow et al., 2013).

RBPs are vital for RNA metabolism; they play a role in controlling gene expression through RNA localization, stabilization, repression, degradation, and processing (Turner and

DÍaz-Muñoz, 2018). Alternative splicing is also important to RNA metabolism and cellular differentiation. It allows for differential translation of a single pre-mRNA by the production of multiple spliced isoforms, which, when translated, have different functions within the cell. RBPs can associate with pre-mRNA within the nucleus and can regulate alternative splicing to enhance or suppress certain splice isoforms (Kelemen et al., 2013). Specifically, RBPs have been shown to regulate alternative splicing of key transcripts associated with asymmetric cell divisions and cellular differentiation. For example, RBPs MBNL1 and MBNL2 have been found to regulate alternative splicing of a key transcription factor called FOXP1, which upregulates the expression of pluripotency transcription factors while repressing genes associated with differentiation in embryonic stem cells. Experimental knockdown of MBNL1 and MBNL2 increased the inclusion of exon 18b in the foxp1 transcript, which is responsible for upregulating pluripotency transcripts. MBNL1 and MBNL2 are upregulated in differentiated cells. When upregulated, exon

8 18b is excluded in place of exon 16b, producing a protein that is unable to upregulate pluripotency genes, thus inducing differentiation of embryonic stem cells (Han et al., 2013).

The importance of RBPs in mRNA metabolism during development was initially discovered in Drosophila. Proper Drosophila development requires specialized cells known as nurse cells to manufacture and shuttle maternal mRNA into the oocyte (Bastock and St Johnston,

2008). Of these mRNA, bicoid, oskar, and nanos are critical for the proper development of the organism. These mRNAs code for protein morphogens that determine the fate of the daughter cells in which they are expressed. For example, bicoid mRNA codes for the protein morphogen that programs cells to become anterior structures, while oskar and nanos are both required to produce posterior structures (Gavis and Lehmann, 1994; Kugler and Lasko, 2009). For the

Drosophila embryo to develop properly, these protein morphogens must be correctly localized within the oocyte before fertilization (Kugler and Lasko, 2009). Therefore, in-situ hybridization experiments performed on wildtype Drosophila demonstrate that bicoid mRNA is localized at the anterior pole, while oskar and nanos mRNA are localized at the posterior pole of the oocyte

(Becalska et al., 2011; Rongo et al., 1995; Spirov et al., 2009). When flies containing homozygous bicoid mutations were examined, non-viable embryos were produced that were unable to develop anterior structures, such as the head (Telser, 2002). Furthermore, mislocalized expression of bicoid also resulted in non-viable embryos with the erroneous production of anterior structures in other areas of the embryo, including the posterior (Driever et al., 1990).

Mutations in the RBPs that bind these mRNAs, as well as mutations in the mRNA cis-elements that allow for RBP binding, resulted in similar phenotypes due to the mislocalization and expression of these morphogen mRNAs (Driever et al., 1990; Telser, 2002). These studies

9 provided the first insights into how essential spatial regulation of these mRNAs is for organism viability.

Overall, RBPs play a crucial role in development and asymmetric divisions via mRNA metabolism including roles in localization, splicing, stability, and repression. Specifically, during asymmetric NPC cell division, RBPs are crucial for cellular differentiation.

The Staufen family of RNA-binding proteins

While initially investigated in Drosophila development, the Staufen family of RBPs have been found to play a role in a multitude of cellular processes. In mammals, there are two Staufen protein paralogues, Staufen1 (Stau1) and Staufen2 (Stau2), while Drosophila only possess one

(Heraud-Farlow and Kiebler, 2014). Each paralogue is primarily defined by their double stranded

RNA-binding domains (dsRBD). Stau1 contains 3 splice isoforms—Stau163, Stau155, and

Stau1i—each containing 4 dsRBDs numbered 2-5 with respect to their homology to the

Drosophila protein (Duchaîne et al., 2000). Investigation of Stau1 dsRBDs revealed that double stranded RNA (dsRNA) binding is primarily accomplished using dsRBD3 and very weakly with dsRBD4 (Wickham et al., 1999). Stau163 is the largest isoform while Stau155 and Stau1i differ in the first 81 amino acids (aa) of their N-terminal domain. Furthermore, Stau1i contains a 6aa addition in its main RNA-binding domain dsRBD3, which results in a structural change that reduces its RNA-binding affinity. While suspected to be unable to bind RNA, Stau1i may regulate Stau1 RNP formation by complexing with Stau163 or Stau155 to modulate its localization and RNA-binding affinity (Duchaîne et al., 2000). Each isoform also contains a tubulin binding domain and a Staufen-swapping motif (SSM), which are used to bind tubulin and homodimerize, respectively. Lastly, Stau163 and Stau155 contain nuclear localization sequences adjacent to dsRBD3 (Bondy-Chorney et al., 2016).

10 Stau1 is ubiquitously expressed in most cell types, while its paralogue, Stau2, is enriched in the brain and expressed at low levels in other tissues. Stau1 and Stau2 are noted to localize to polysomes and the rough endoplasmic reticulum in the cell. Interestingly, both Staufen paralogues localize differently in neurons, where they form unique RNP complexes that have been shown to migrate in an anterograde and retrograde manner along neuronal dendrites

(Brendel et al., 2004).

Ultimately, while Stau1 and Stau2 have similar protein structures and domains, research has shown that they serve non-redundant functions in the CNS. These alternative, and at times opposing, functions are hypothesized to be a result of differential mRNA and protein associations (Heraud-Farlow et al., 2013; Lebeau et al., 2011, 2008; Park and Maquat, 2013).

Staufen: Asymmetric divisions during neurogenesis

Drosophila neurogenesis was the first model used to demonstrate Staufen’s role in asymmetric divisions (Heraud-Farlow and Kiebler, 2014). During Drosophila neurogenesis,

NPCs known as neuroblast (NB) cells divide asymmetrically to produce a daughter cell called a ganglion mother cell (GMC) and a self-renewed NB. GMCs will then go on to divide symmetrically to form two neurons, similar to the mammalian IPCs (Broadus et al., 1998).

Prospero (pros) is a pro-neurogenic transcript that, when translated, produces a transcription factor that represses the expression of genes important for stem cell and cell cycle function, while simultaneously activating genes important for a neuronal fate (Broadus et al., 1998; Choksi et al., 2006; Knoblich, 2008). Early studies indicate that Drosophila Staufen colocalizes with pros mRNA upon NB divisions, and that pros is asymmetrically distributed to

Figure 1.3. Structural comparison between Stau1 isoforms. All Stau1 isoforms contain dsRBD 2-5, SSM and TBDs. Stau163 processes an 81aa extension of its N-terminal domain compared to other isoforms. Stau163 and Stau153 contain an NLS adjacent to dsRBD3, however Staui contains an additional 6aa in this region, rendering its NLS and RNA binding domain inactive.

12 the daughter cell destined to differentiate into a GMC. Research has shown that both Stau and pros are required for proper asymmetric divisions regulating the GMC fate. Perturbations in either Stau or pros result in the mislocalization of pros and therefore asymmetric divisions do not occur (Broadus et al., 1998). It was further determined that inscuteable, a protein required to organize the mitotic spindle in NBs, is required to assist Stau localization of pros mRNA by active transport along microtubules (Li et al., 1997).

Staufen’s role in asymmetric divisions during Drosophila neurogenesis is highly conserved with respect to its mammalian homologue Stau2. Investigation of Stau2 mRNA targets reveals that Stau2 binds pro-neurogenic prox1 mRNA and that both Stau2 and prox1 are asymmetrically distributed upon NPC divisions in mice. Furthermore, knockdown of Stau2 and

RNP interactors Pum2 and DDX1 demonstrates that NPCs lose their ability to self-renew and prematurely differentiate into neurons. It was further concluded that upon short-hairpin RNA

(shRNA) mediated knockdown of Stau2, proper asymmetric distribution of prox1 mRNA did not occur. As a result, both daughter cells inherit prox1 and acquire a neuronal fate (Vessey et al.,

2012). All things considered, Staufen is a key contributor to RNA localization in multiple organisms and is known to directly function in cellular differentiation during asymmetric cell division.

Staufen: Synaptic plasticity and memory

Synaptic development and plasticity rely heavily on localized protein synthesis at the sites of synaptic activity. In fact, synaptic plasticity greatly exemplifies the opposing and non- redundant roles of Stau1 and Stau2 within the CNS. Long-term depression (LTD) is a form of synaptic plasticity characterized by the weakening of synapses when undergoing synaptic activity (Bliss and Cooke, 2011). Conversely, long-term potentiation (LTP) strengthens neuronal

13 synapses in response to synaptic activity (Bliss and Cooke, 2011). To examine Staufen’s role in these processes, small interfering RNA (siRNA) knockdown of both Stau1 and Stau2 was implemented and subsequent excitatory post synaptic potentials were measured. By this analysis, it was concluded that Stau1, but not Stau2, was required for LTP (Lebeau et al., 2008), while

Stau2, but not Stau1, was required for LTD (Lebeau et al., 2011). Further investigation demonstrated that Stau1 and Stau2 bind different mRNA targets that are required for these opposing roles in plasticity. For example, map1b is an mRNA target of Stau2 that has been shown to be crucial for LTD (Lebeau et al., 2011). These studies strongly support the idea that

Stau1 and Stau2 do not share compensatory roles within the CNS but rather have non-redundant and opposing functions.

Similarly to synaptic plasticity, memory formation is also dependent on spatial and temporal protein synthesis (Heraud-Farlow and Kiebler, 2014). Specifically, Staufen has been implicated in long term memory formation. In Drosophila, temperature sensitive mutants of Stau were used to uncover deficits in memory formation. Two groups of Drosophila were screened to determine genes associated with long term memory formation. One group of flies was trained to obtain long term memories, while a control group was not stimulated to form long term memories, identifying Staufen as a promising candidate (Dubnau et al., 2003). Staufen temperature-sensitive mutants were then trained at permissive and restrictive temperatures and memory retention was measured. Flies trained at restrictive temperatures were unable to form long term memories, whereas at the permissive temperatures, formation of long term memory was evident (Dubnau et al., 2003). In summary, Stau1 and Stau2 have conserved and non- redundant roles pertaining to spatial and temporal protein synthesis, vital to processes within the

CNS.

14 Staufen: Translational control

Staufen proteins are often associated with translational repression when associated with

RNP complexes. Within the CNS, it is hypothesized that two distinct fractions of Staufen exist: one that is bound to the endoplasmic reticulum (ER) and is associated with active translation, and another non-membrane bound Staufen that is associated with RNPs. In order to analyze protein interactors of Stau2 in RNP complexes while excluding membrane bound Stau2, Fritzsche et al.

(2013) performed density gradient centrifugation to produce purified RNP fractions that were free of ER and membrane bound contaminants from E17 rat whole brain lysates. These fractions were then purified to exclude non-Stau2 related RNPs using monoclonal Stau2-antibody immunoprecipitation. Using mass spectrometry (MS), protein interactors of Stau2 RNPs were then identified. Cap binding protein CBP80, PABPN1, and known translational repressors

FMRP, Pura, and DDX6 were detected from purified Stau2 RNP granules (Fritzsche et al.,

2013). During transcription, newly synthesized transcripts undergo nuclear processing that involves associations with exon-junction complex (EJC) proteins, cap binding proteins CBP80-

CBP20 that form the cap-binding complex, and poly-A binding protein PABPN1. These proteins are found on transcripts prior to the pioneer round of translation. After the initial round of translation, the CBP80 is replaced with translation initiation factor eIF4E, EJC components are ejected by ribosomes, and PABPN1 is exchanged with PABPC1 (Maquat et al., 2010). Although

EJC components could not be found associated with Stau2-RNPs, detection of CBP80, PABPN1, and known translational repressors FMRP, Pura, and DDX6, in addition to the absence of eIF4E, provides evidence to suggest that Stau2 bound mRNAs are translationally repressed (Fritzsche et al., 2013). There are many examples of Staufen’s role in translational control. As previously mentioned, prox1 is an endogenous target of Stau2. Following Stau2 knockdown in utero, Prox1

15 protein levels appeared to double in transfected cells, illustrating the loss of translational control upon Stau2 reduction within NPCs (Vessey et al., 2012).

Staufen: mRNA stability

Transcript quality and stability within cells are governed by RBPs, specifically, Staufen has been implicated in these processes. Gene mutations can result in mRNA that possesses a premature termination codon (PTC). When expressed, these mRNA have the potential of being harmful to the cell by producing truncated and potentially cytotoxic proteins. Nonsense-mediated decay (NMD) is a mechanism employed to degrade such mRNA that relies heavily on the recruitment of helicase up-frameshift proteins 1-3 (Upf) to mutant mRNAs. Upf1 and other Upf members recognize these transcripts by association with EJC components found upstream of

PTCs that were not ejected after the pioneer round of translation or through recognition of abnormally long 3' untranslated regions resulting from PTCs (He and Jacobson, 2015). Upf1 will then recruit degradation machinery to erroneous transcripts. Other degradation pathways exist that rely heavily on RBPs.

Staufen proteins are involved in a process to degrade transcripts independently of NMD pathways. Initial research found that Stau1 and Stau2 physically interact with Upf1.

Interestingly, other Upf proteins that regulate NMD are not found to associate with Stau1 or

Stau2 (Kim et al., 2005). In association with Upf1, Stau1 and Stau2 elicit a distinct mechanism of mRNA decay for certain transcripts. This decay mechanism is known as Staufen-mediated decay (SMD; Park and Maquat, 2013). SMD was first studied in conjunction with ADP- ribosylation factor 1 (Arf1). Arf1 mRNA is an endogenous target of Stau1 and is regulated by

SMD. Researchers found that transiently expressed arf1 devoid of introns, EJC components, and

PTCs was degraded in a Staufen-dependent manner (Kim et al., 2005). Furthermore, knockdown

16 of either Upf1 or Stau1, but not other Upf proteins, upregulated its expression (Kim et al., 2005).

Further research into understanding SMD mechanisms uncovered that dimerization of Stau1 with itself or its paralogue Stau2 via SSMs elicits the SMD response by recruiting Upf1 (Park and

Maquat, 2013). After the initial discovery of SMD, it has subsequently been documented to play vital roles in most cell types. For example, SMD regulates myoblast and adipocyte differentiation in addition to keratinocyte motility (Cho et al., 2012; Gong et al., 2009; Gong and

Maquat, 2011). Therefore, although Stau1 has been documented to form RNPs and localize mRNA, it is equally likely that SMD may function in the differentiation of NPCs by targeted degradation of cell fate determining mRNAs during neurogenesis.

While studies have shown that Staufen proteins are involved in mRNA decay, competing research also demonstrates that certain mRNA transcripts are stabilized in a Staufen-mediated manner. Stau2-mediated mRNA regulation was examined by comparing global mRNA levels between control and Stau2 knockdown neurons. Compared to controls, Stau2 knockdown samples contained 349 mRNAs with reduced levels while 99 transcripts increased in abundance.

Overall, 77% of neuronal transcripts appeared to be stabilized in a Staufen-mediated manner. If

Stau2 were primarily degrading transcripts via SMD, it would be expected that upon Stau2 knockdown, more transcripts would be found to be upregulated (Heraud-Farlow et al., 2013).

While it is still unknown how Staufen-bound mRNA is targeted for decay or stabilization, current research demonstrates the non-redundant and opposing nature of Staufen paralogs.

Although Stau2-mediated mRNA decay is documented, a large majority of transcripts associated with Stau2 are stabilized, while Stau1 is largely implicated in SMD of its mRNA targets.

Staufen1-mediated decay regulates cortical neurogenesis

Recently, Stau1 has been directly implicated in regulating cortical neurogenesis via

17 SMD. Initial investigation by Moon et al. (2018) involved uncovering the role of kruppel-like factor 4 (Klf4), a transcription factor that plays a role in proliferation, differentiation and apoptosis, during cortical development. Two methods were utilized to examine the role of Klf4 during neurogenesis: a conditional knockout mouse and shRNA knockdown. Both experiments indicated that neuronal differentiation was upregulated at the expense of the NPC population.

Increases in neurogenesis were further followed by upregulation of neuronal transcripts such as

Dlx1, Dlx2, and Tuj1. To identify protein associations occurring with Klf4, MS on knockout mice expressing FLAG-Klf4 identified Stau1 and DEAD box RNA helicases Ddx5 and Ddx17 as protein interactors. (Moon et al., 2018).

To uncover the roles of the protein interactors, lentiviral shRNA was used to knockdown

Stau1 in vitro and in utero. Stau1 knockdown was found to phenocopy that of Klf4 knockdowns.

The opposite phenotype was observed upon overexpression of Klf4 or Stau1. Interestingly, Stau1 knockdown, rescued the Klf4 overexpression phenotype (Moon et al., 2018). Since Stau1 is a

RBP associated with SMD, Moon et al. (2018) examined the expression of neuronal transcripts

Dlx1, Dlx2, and Tuj1 that were previously upregulated in Klf4 knockdown experiments. Stau1 was found to bind these transcripts in HEK293T cells and overexpression increased the rate of their degradation. However, Klf4 knockdown rescued this phenotype (Moon et al., 2018).

While Upf1 was not identified as a protein partner of Klf4, DDX5 and DDX17 were examined as candidates for a novel SMD-like mechanism. To examine their role, shRNA knockdown of these helicases was done. DDX5 and DDX17 shRNAs were transfected into

NPCs overexpressing Stau1 or Klf4. Knockdown of DDX5 and DDX17 rescued changes in neurogenesis and the increased degradation of neuronal transcripts due to Klf4 or Stau1 overexpression. Lastly, photoactivatable ribonucleoside-enhanced crosslinking and

18 immunoprecipitation was performed on shKlf4 transfected cells. Klf4 knockdown decreased enrichment of neuronal transcripts bound by Stau1. Taken together, Moon et al. (2018) proposed that Klf4 recruits Stau1 to bind target transcripts and utilizes DDX5 and DDX17 in a SMD-like mechanism for degradation.

Rationale

Although Stau1 and Stau2 paralogues are ~50% identical and share common dsRBDs

(Park et al., 2013), multiple studies have indicated that they act non-redundantly during development (Heraud-Farlow et al., 2013; Lebeau et al., 2011, 2008; Park and Maquat, 2013).

Moreover, in terms of synaptic plasticity and mRNA stability, Stau1 and Stau2 act in opposition to each other (Lebeau et al., 2011, 2008). While Stau2 has been thoroughly characterized during neurogenesis and is known to promote neuronal differentiation by asymmetrically localizing prox1 mRNA to daughter cells (Vessey et al., 2012), little is known about Stau1 during neurogenesis.

Our initial investigation revealed that Stau1 shows increased expression in NPCs compared to differentiated neurons, the opposite to what is observed for Stau2. Therefore, our preliminary hypothesis was that Stau1 may play a role in stem cell renewal by localizing alternative mRNA targets.

Recent evidence demonstrates that Stau1 may direct neurogenesis through the action of

SMD (Moon et al., 2018). However, this research leaves some unanswered questions. Moon et al

(2018) examined Klf4, Ddx5, Ddx17 and Stau1 in the context of corticogenesis. However, these proteins have been studied to play integral roles in other differentiation processes. As a result, while Moon et al (2018) demonstrates that knockdown of these proteins display phenotypes in terms of differences in NPC’s ability to renew or differentiate, this may be due to independent

19 processes that these proteins govern. For example, While the authors suggest that Ddx5 and

Ddx17 elicit mRNA decay by their helicase activity, they have been also implicated in cellular differentiation by regulating alternative splicing in the epithelial to mesenchymal transition, and coregulating the transcriptional activation of master transcription factors during this process

(Dardenne et al., 2014). As a result, knockdown of these helicases may serve a function independent of SMD during corticogenesis, proposed by Moon et al (2018) and may explain the phenotype observed. Furthermore, Upf1 has been extensively studied to be vital for the SMD process, however, was not identified as a protein interactor by Moon et al (2018). As a result, it remains unexplored how Klf4, Ddx5, and Ddx17 recruit degradation machinery to target transcripts.

Stau1 has also been implicated in a multitude of processes in the CNS. Stau1 has the potential of binding multiple transcripts to target them for degradation, localization, and/or translational repression. The multitude of targets and functions of Stau1 were not fully explored, thus the phenotypes observed in earlier studies could be caused by perturbations in multiple processes. Lastly, Stau1 expression throughout cortical development has not been fully characterized.

Therefore, we aimed to more fully characterize Stau1 expression throughout cortical development. Moreover, we sought to replicate experiments performed by Moon et al. (2018) and further elucidate the mechanisms and roles of Stau1 in murine cortical development.

Hypothesis

Stau1 plays a critical role in NPC renewal, rather than differentiation, by regulating multiple facets of mRNA metabolism of targets that function in maintaining pluripotency in NPCs.

Objectives

1. Temporally and spatially characterize Stau1 expression throughout the timepoints of

cortical development.

2. Replicate and corroborate Stau1 in vitro and in utero knockdown experiments previously

performed

3. Elucidate other protein interactors of Stau1 to identify other cellular mechanisms vital to

NPCs during neurogenesis

21 Chapter Two: Materials and Methods

Animals

Timed pregnant (+/- 8 hours) CD1 mice were purchased from Charles River Laboratories

(Sherbrooke, Quebec) and housed at the University of Guelph Central Animal Facility. All housing and experiments involving mice complied with the guidelines and regulations outlined by the Canadian Council on Animal Care. CD1 mice were chosen as they are a wildtype outbred strain. As a result, deficits in cortical development were minimized compared to mice that have undergone successive rounds of inbreeding (Crawley et al., 1997).

Cell culture

Prior to cortical dissection, 12 mm German glass coverslips (Electron Microscopy

Sciences) were flame sterilized and coated in 24-well plates (Nuclon Delta Surface,

ThermoFisher) using 4% laminin (Corning) and 2% poly-D-lysine (Sigma Aldrich) in sterile water (GE Healthcare) for 24h. Prior to seeding, coverslips were washed twice in sterile water.

Timed pregnant E12 CD1 mice were euthanized with CO2 (4 L/min; Linde), transferred to a dissection hood (HeraGuard Eco, Thermo Fisher) and topically sterilized using 70% ethanol.

The uterine horns were exposed with a midline abdominal incision and removed into a 10cm petri dish with 1x PBS pH 7.4 (Life Technologies). Individual embryos were then removed from their amniotic sac, and placed in individual 35 mm petri dishes with 1x PBS pH 7.4. Embryos were then immobilized in the dish using 21G needles (PrecisionGlide, BD). Under a dissecting light microscope (Nikon SMZ 745T), skin, skull and meninges were removed using forceps

(Fine Science Tools) to expose the developing cerebral cortex. Cortical tissue was carefully removed and placed into ice cold primary culture media (NeuroCult media plus 10% neural stem

22 cell proliferation supplement, 0.02 µg/mL EGF, 0.01 µg/mL FGF, and 1% penicillin/streptomycin (Sigma Aldrich); StemCell Technologies). Using a disposable transfer pipette, cortical tissue was disassociated in primary culture media by pipetting up and down several times until large clumps of tissue were not observed. Cells were counted on a hemocytometer and plated in a 24 well plate at 175,000 cells/well in 1mL of primary culture

o media and grown for 3 DIV (37 C, 5% CO2; FORMA Series II Water Jacket CO2 Incubator,

Thermo Scientific). Leptomycin B (LMB) experiments were performed on 2 DIV NPC culture.

Preliminary experiments analyzing a protein expressed by NPCs and known to undergo nuclear import (Cyclin B) determined that 120 nM of LMB for 15 hours was most effective (data not shown). Experiments were then performed using this paradigm and included a vehicle control

(70% methanol solution). Subsequent immunocytochemistry (see below) and analysis was performed.

HEK293T cells were cultured on 10 cm tissue culture dishes (Corning). Cells were plated at an average density of 1,000,000 cells/mL in Dulbecco’s Modified Eagle’s Medium Nutrient

Mixture F-12 HAM (Sigma Aldrich) with 10% bovine calf serum (Sigma Aldrich) and 1%

0 penicillin/streptomycin (Sigma Aldrich) and were incubated at 37 C under 5% CO2 (FORMA

Series II Water Jacket CO2 Incubator, Thermo Scientific). Confluent plates were passaged at a

1:10 dilution, which occurred twice weekly. For transfection experiments, a confluent 10 cm plate of HEK293T cells was passaged to a 1:3 dilution onto 6-well plates (Nuclon Delta Surface,

Thermo Fisher) and transfected 24 h later.

23 Western blotting

Cortical tissue extracted from CD1 mice from ages E12-E18 or transfected HEK293T cells were collected in ice-cold RIPA buffer (1% Nonidet P40, 0.5% sodium deoxychorate, 0.1%

SDS dissolved in PBS) supplemented with a protease inhibitor tablet (Protease Inhibitor Mini

Tablets, Thermo Scientific Pierce). Tissue or cells were sonicated (Amplitude 20% 1 sec pulse, 1 sec off, 3 sec total, ) then centrifuged (10 min, 10 000 rpm, 4oC) to removed cellular debris.

Protein lysates were quantified in triplicate using a Micro BCA Protein Assay kit (Thermo

Scientific Pierce). Prior to use, sample buffer was added (2M Tris pH 6.8, glycerol, SDS, pyronin Y, β-mercaptoethanol; Sigma Aldrich) to a 1x concentration and boiled (950C, 10 min) to denature proteins prior to Western blotting.

Protein lysates (10-20 µg) were run on SDS-PAGE (10% resolving, 4% stacking) and wet transferred to a nitrocellulose membrane (BioRad). Blots were cut and blocked in 5% BSA dissolved in 1x TBST (Sigma Aldrich). Primary antibodies were diluted in 1% BSA to their working concentrations (See Antibody Table) and were incubated with membranes overnight with shaking at 4oC. Following primary antibody incubation, membranes were washed 3x 8 min in 1x TBST, incubated with horseradish peroxidase secondary antibodies (BioRad) for 1 h, at room temperature, then washed 3x 8 min in 1x TBST. Proteins were detected using enhanced chemiluminescence (ECL Prime, GE Healthcare) and development on film (Clinicselect blue X- ray film, Carestream; SRX-101A developer, Konica Minolta).

RT-PCR

Cortical tissue was homogenized in TRIzol reagent (Invitrogen) and total RNA was extracted following the manufacturer’s directions. RNA was reverse-transcribed using a

24 QuantiTect Reverse Transcription Kit (Qiagen). PCR was completed using Taq PCR Master Mix

Kit (Qiagen) according to the manufacturer’s instructions. Denaturation occurred at 94oC, annealing at primer-specific temperatures near 60°C, and extension at 72oC to produce products ranging from 200-600 base pairs. Thirty five reaction cycles were used to amplify products of interest, which were resolved on 1% agarose gels (for primer sequences see appendix).

Transient transfection of cultured cells

mStau1 shRNA and FLAG-overexpression vectors were purchased from Origene.

ShRNA sequences were compared to known stau1 mRNA transcripts to ensure all stau1 transcripts were targeted (BLAST, NCBI). Amplification of constructs occurred in E. coli

(subcloning efficiency DH5α competent cells, Invitrogen) using heat-shock (45oC for 20 seconds) and plated on 30 µg/mL kanamycin agar plates (Sigma Aldrich). After 24 h incubation, one colony was extracted and grown in LB (Sigma Aldrich) with 30 µg/mL kanamycin overnight at 370C. Constructs were purified using an Endofree and High Speed Maxi Kit (Qiagen) and

DNA concentration was subsequently measured using a Nanodrop. Knockdown efficiency of shRNA was validated in HEK293T cells due to its higher transfection efficiency. Stau1 shRNA

(750 ng/well) and Stau1 FLAG-overexpression (250 ng/well) were co-transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) and incubated for 2 DIV (37°C, 5% CO2; FORMA

Series II Water Jacket CO2 Incubator, Thermo Scientific). A scrambled 29-mer shRNA was used as a control. ShRNA efficacy was evaluated by western blotting. The most efficient Stau1 shRNA was used for all subsequent knockdown experiments.

Transfection of primary culture took place 3-6h after initial seeding with transfection reagent FuGENE 6 (Promega). Validated Stau1 shRNA and nuclear GFP (nGFP; courtesy of Dr.

25 Freda Miller, SickKids, Toronto) were co-transfected together to knockdown endogenous Stau1.

ShRNA (750 ng/well) and nGFP (250 ng/well) were mixed to a 3:1 ratio to ensure that cells which receive the nGFP construct are highly likely to acquire the shRNA construct. nGFP was used as a marker of successful shRNA transfection and transfection mixture was added dropwise to culture media. Cultures were incubated for 3 DIV prior to fixation in 4% paraformaldehyde

0 and subsequent immunocytochemistry (37 C, 5% CO2; FORMA Series II Water Jacket CO2

Incubator, Thermo Scientific; see Immunocytochemistry and immunohistochemistry).

In utero electroporation

In-utero electroporation was performed by Charly McKenna (Central Animal Facility,

University of Guelph). Stau1 shRNA and nGFP plasmids were combined at a ratio of 3 µg of shRNA: 1 µg of nGFP to ensure that GFP-transfected cells were likely to contain shRNA vectors. The DNA mixture also contained 0.05% trypan blue (Sigma Aldrich) to visualize, and ensure precision of, DNA injections. E13 timed pregnant CD1 mice (Charles River Laboratories,

Sherbrooke, Quebec) were given a 20 mg/kg carprofen injection 30 mins prior to surgery. Mice were anaesthetized with isoflurane (2%-1.5%, Baxter Corporation) plus O2 (0.8L) followed by a shave and 3-prep surgical scrub (4% chlorhexide gluconate antimicrobial cleanser, wiped with

70% isopropyl alcohol, then again with a 70% alcohol, 0.5% chlorhexidine solution). A midline incision along the abdomen was made and the uterus was exposed. Embryos were then manipulated using ring forceps and a single injection through the uterus, the yolk sac and the developing cortical wall was performed using a polished glass capillary micropipette, which had been pre-loaded with the plasmid solution. Embryos adjacent to the birth canal were not treated to prevent induction of abortion. Immediately following DNA injection, electroporation was then carried out using electrodes, placed outside of the uterus on both sides of the embryo head, and

26 five 50 ms pulses of 50 V at 950 ms intervals were applied. Electroporation allowed the NPCs lining the ventricle to take up the injected plasmids. An attempt to inject every embryo was made within an appropriate surgical time period (approximately 20-30 minutes), after which the uterus was reintroduced into the abdomen and the abdominal wall of the pregnant mouse was sutured.

Mice were then given a subcutaneous injection of warm saline (0.5mL) and allowed to recover in a clean cage on a heat pad for 3 days, after which the pregnant dam was euthanized by CO2 inhalation (4 L/min; Linde). Whole brains were removed from embryos for immunohistochemistry (see Immunocytochemistry and immunohistochemistry)

Immunocytochemistry and immunohistochemistry

Primary cells were cultured for 3 DIV then fixed in 4% paraformaldehyde (Electron

Microscopy Sciences) diluted in HBSS (Thermo Fisher) for 10 minutes. Cells were then permeabilized in 0.2% Nonidet P-40 in HBSS (Thermo Fisher) for 5 minutes. Cultures were blocked in 5% BSA (Sigma Aldrich), 6% Normal Goat Serum (Jackson ImmunoResearch) in

HBSS (Thermo Fisher) for 1 h prior to a 2 h incubation in primary antibody diluted in 0.5x block solution (see Antibody Table). Following primary antibody incubation, coverslips were washed

3x in HBSS (Thermo Fisher) and incubated with fluorescent secondary antibodies for 1 h (Alexa

Fluor anti-mouse and anti-rabbit 488 and 555; Life Technologies, 1:1000 dilution in 0.5x block).

Cells were stained with Hoechst nuclear stain (Sigma Aldrich, 1ug/mL in HBSS) and coverslips were mounted onto microscope slides (Selectfrost, Thermo Fisher) using Permafluor mounting reagent (Thermo Fisher).

Embryonic whole brains for cryosections were taken from E12 and E18 mice and flash frozen in 2-methylbutane incubated in dry ice. Frozen brains were embedded in OCT

27 (TissueTek) and sectioned at 20 µm intervals on a cryotome in the coronal plane (Leica CM1860 cryostat). Sections were mounted onto gelatin-coated (0.5% gelatin and 0.05% chromium potassium sulphate in milliQ H2O; Sigma Aldrich) microscope slides (Selectfrost, Thermo

Fisher) and fixed in 4% paraformaldehyde for 10 minutes. Antigen retrieval was performed using sodium citrate at 800C (10 mM pH 6.0; Sigma Aldrich). Slices were then blocked in 4% BSA

(Sigma Aldrich), 6% Normal Goat Serum (Jackson ImmunoResearch), and 0.3% Triton X

(Sigma Aldrich) in 1X PBS pH 7 (Life Technologies) and primary antibody incubation was completed overnight in half-block solution. Immunohistochemistry of in-utero electroporated brains followed the same procedure as for primary cultures, with the exception that the brains were immersion fixed in 4% paraformaldehyde rather than flash frozen in 2-methylbutane.

Microscopy and quantification

Primary cultures and stained histological slices for Stau1 expression and co-stain markers were qualitatively assessed and imaged using epifluorescent light microscopy (Zeiss Axio

Observer Z.1; Hamamatsu ORCA-Flash 4.0LT C11440 camera).

All cell quantification was performed by a single individual who was blinded to the conditions for which the cells were treated and ~200 healthy cells (lacking a condensed or fragmented nucleus; with visible nucleoli present) per replicate and condition were quantified.

Coverslips were scanned across multiple fields of view at 20x magnification (Nikon Eclipse 50i epifluorescent microscope). To validate Stau1 shRNA knockdown in primary cultures, nGFP positive transfected cells were visually assessed for Stau1 expression intensity and scored as normal for Stau1 expression (mStau1++), reduced for Stau1 expression (mStau1+) or negative for Stau1 (mStau1-). To assess changes in cell populations due to Stau1 knockdown, transfected

28 cells were identified by nGFP expression and scored as positive or negative for cellular markers of NPCs, neurons or IPCs. All quantifications were averaged across 3 biological replicates and expressed as a mean +/- SEM. ShRNA-induced apoptotic cell death was assessed by counting

GFP-positive cells that possessed condensed nuclei. No significant differences were seen between control and Stau1 shRNAs (data not shown).

In-vivo quantification of embryonic coronal slices from E16 electroporated embryos were imaged using epifluorescent light microscopy (Zeiss Axio Observer Z.1; Hamamatsu ORCA-

Flash 4.0LT C11440 camera). Images were cropped to produce an image that included tissue from the ventricle to the CP and possessed GFP+ cells that spanned the entirety of the cortex and present in all cortical layers. Cortical layers were distinguished by observing changes in cellular density visible in the Hoechst channel and borders between the layers were drawn in ImageJ

(National Institutes of Health). GFP+ cells were then assigned to a specific cortical layer and scored for cellular markers.

Statistics

Statistics were performed in GraphPad (Prism) using t-tests. Data were presented as mean

± SEM. All differences were considered significant for p<0.05.

29 Chapter Three: Results

Stau1 mRNA and protein is expressed in NPCs, newly born neurons, and intermediate progenitors in the developing murine cortex

We first sought to determine if stau1 is expressed during cortical development. Using reverse transcription PCR (rt-PCR) on total RNA isolated from E12-E18 cortices and amplifying for stau1, we determined that it is indeed expressed during the early and late stages of neurogenesis (Fig. 3.1 A). The early neurogenic phase was confirmed via detection of nestin, an intermediate filament protein exclusively expressed by NPCs in the developing brain (Lendahl et al., 1990; Zhang and Jiao, 2015). We also investigated bIII-tubulin, another intermediate filament protein exclusively expressed by newly-born neurons (Zhang and Jiao, 2015). A reaction omitting the reverse transcriptase (no-RT) was used as a negative control (Fig. 3.1A).

A heterogeneous population of NPCs and newly-born neurons is found in the cortex at

E12 (Noctor et al., 2004, 2001). To determine which cell types express stau1, we performed single molecule fluorescent in situ hybridization (FISH) for stau1 and combined this with immunostaining to identify cell type. This was done on primary NPC cultures prepared on E12 and maintained for 3 days in vitro (DIV). stau1 mRNA was found in all cell types analyzed, including Nestin-positive (Nestin+) NPCs, bIII-tubulin-positive (bIII-tubulin+) neurons, and

Tbr2-positive (Tbr2+) intermediate progenitor cells (Fig. 3.1 B). In order to temporally characterize Stau1 protein expression throughout cortical development, we first confirmed the

Stau1 antibody specificity by probing E18 cortical lysates via western blotting. One band at the expected molecular weight of 55kDa was observed (Fig. 3.1C). We next collected protein

30 Figure 3.1. stau1 mRNA and protein is expressed by NPCs and newborn neurons during cortical development.

A: rt-PCR for stau1 and precursor/neuronal markers nestin and bIII-tubulin from E12-18 cortices. No RT was used as a negative control. B: FISH for stau1 (red, panel ii,vi & x) using 3

DIV cultures of primary NPCs isolated at E12. NPCs were identified using Nestin (green, panel i), newly born neurons using bIII-Tubulin (green, panel v) and intermediate progenitors using

Tbr2 (green, panel ix). Nuclei are visualized with DAPI (blue). An enlargement of a single cell

(white dashed box in panel iii, vii & xi) is shown in panel iv, viii & xii respectively. Scale bar =

10 µm. C: The anti-Stau1 antibody (a-Stau1) detects one band at approximately 55 kDa in lysates from E18 cortices. Molecular weight markers shown on the left. D, E: Stau1 protein expression during key stages of murine cortical development. Whole brain lysates were prepared from E12, E15, and E18 and probed with a-Stau1 antibodies (top blot) and anti-a-Histone H3 antibodies as a protein loading control (bottom blot). E: Western blots were quantified by densitometry, expressed relative to Histone H3, and normalized to E12 lysates. Values are means

± SEMs of three technical replicates.

32 extracts from embryonic whole brain at key embryonic time points: initiation of neurogenesis

(E12), mid-neurogenesis (E15), and late-stage neurogenesis (E18) (Costa et al., 2009; Van den

Ameele et al., 2014). We observed Stau1 expression at all time points and determined that its relative expression level remained constant throughout (Fig. 3.1D and E). This finding differs from that of its paralogue, Stau2, which increases during these same stages of cortical development (Vessey et al., 2012).

Stau1 is expressed by all cells of the developing cortex, is predominantly cytoplasmic, and can shuttle in and out of the nucleus

Our next objective was to characterize the expression pattern of Stau1 in the developing cortex, both in vivo and in vitro. We wanted to determine which cells express it and its subcellular localization within those cells. Coronal sections of E12 and E18 cortices were stained with the validated anti-Stau1 antibody and markers of NPCs or newly-born neurons (Fig. 3.2).

The staining of Stau1 in both E12 and E18 coronal cryosections demonstrated strong

Stau1 expression throughout all of the cortical layers, except the intermediate zone where cell density is far lower (Fig. 3.2Aiii and xii and Fig. 3.2Biii and xii). At higher magnification, it was apparent that Stau1 was predominately cytoplasmic with a small amount of nuclear expression

(Fig. 3.2Avi, vii, viii and ix and Fig. 3.2Bvi, vii, viii and ix). These enlargements are from cells in both the cortical plate (CP) and ventricular zone/subventricular zone (VZ/SVZ), indicating that

Stau1 localization does not change between cell types or cortical layers.

To visualize NPCs, both E12 and E18 cortical sections were co-stained with Nestin. The cell bodies of NPCs are found in the VZ and SVZ and they extend a long basal process to the pial surface (Florio and Huttner, 2014). Therefore, Nestin is detectible in all cortical layers, with

33 clear expression in the cell bodies of NPCs in the VZ/SVZ and filamentous organization in their basal processes (indicated by the white arrows in Fig. 3.2Aii and 3.2Bii). Stau1 colocalizes with

Nestin in the cell bodies of NPCs in the VZ/SVZ at both E12 and E18 (Fig. 3.2Av and 3.2Bv).

We also co-stained E12 and E18 cryosections with bIII-Tubulin, a cytoskeletal protein unique to newly born neurons (Fig. 3.2Axi and 3.2Bxi) (Zhang and Jiao, 2015). At E12, neurogenesis has just begun and only a small number of neurons have migrated to the CP (Fig. 3.2Aix). Stau1 colocalizes with these newly born neurons (Fig. 3.2Axiv), indicating that its expression in cortical neurons likely begins at the time of their birth. At E18, the CP has increased in thickness due to ongoing neurogenesis and Stau1 expression is robust in all bIII-Tubulin+ cells (Fig.

3.2Bxiv). Taken together, these results demonstrate that Stau1 is expressed in the cell bodies of both NPCs and newly-born neurons at both early and late stages of neurogenesis in the developing cortex.

We next sought to confirm the cell types within the cortex that express Stau1, and to attempt to overcome the cell density issues encountered in vivo that prevented us from fully characterizing the subcellular localization of Stau1. To do so, we generated primary cultures of

NPCs isolated from E12 cortices (Vessey et al., 2012). These were maintained for 3 DIV and then fixed and stained for Stau1 and markers for both NPCs and neurons (Fig. 3.3A). We repeated staining for Nestin (Fig. 3.3Ai) and co-stained for Stau1 (Fig. 3.3Aii). Stau1 was robustly expressed in the cell bodies of all Nestin+ NPCs. In NPCs that had extended a process, we could detect Stau1 proteins in the proximal regions of these extensions (white arrows, Fig.

3.3Ai, ii and iii). Stau1 expression appeared to decrease the more distal the process extended from the cell body of the NPC (white arrow heads, Fig. 3.3Ai, ii and iii); however, we cannot

34 Figure 3.2. Stau1 is expressed throughout the developing murine cortex.

Immunohistochemistry was performed on 18 to 20 µm thick coronal cryosections of developing murine cerebral cortices. The layers are indicated on the left (CP: cortical plate, IZ: intermediate zone, SVZ/VZ: subventricular/ventricular zone). All scale bars = 20 µm. A: E12 cortices, nuclei stained with DAPI (blue, panels i, and x). Nestin (panel ii) marks NPCs, while bIII-Tubulin

(b3T, panel xi) marks immature neurons. White arrows on panel ii indicate the Nestin-containing basal processes of NPCs. Stau1 protein is shown in red (panels iii and xii). Upper white dashed boxes (panels iii and iv) correspond to cortical plate enlargements indicating subcellular Stau1 localization (panels vi and vii), while lower white dashed boxes (panels iii and iv) correspond to ventricular zone enlargements indicating subcellular Stau1 localization (panels viii and ix). B:

E18 cortices, nuclei stained with DAPI (blue, panels i and x). Nestin (panel ii) marks NPCs while bIII-Tubulin (b3T, panel xi) marks immature neurons. White arrows on panel ii indicate the

Nestin-containing basal processes of NPCs. Stau1 protein is shown in red (panels iii and xii).

Upper white dashed boxes (panels iii and iv) correspond to cortical plate enlargements indicating subcellular Stau1 localization (panels vi and vii), while lower white dashed boxes (panels iii and iv) correspond to ventricular zone enlargements indicating subcellular Stau1 localization (panels viii and ix).

36 exclude that it is expressed in these regions, but at a level below the limit of detection. We also stained these cultures with anti-Sox2 antibodies (Fig. 3.3Aiv). Sox2 is a transcription factor that is robustly expressed by pluripotent cells, including NPCs (Ellis et al., 2004; Zhang and Jiao,

2015). Stau1 was expressed by all Sox2-positive (Sox2+) cells (Fig. 3.3Av and vi), further confirming that Stau1 is present in the NPCs of the developing cortex. We again observed Stau1 expression in the proximal regions of processes emanating from Sox2+ cells (white arrows, Fig.

3.3Av and vi), further demonstrating that Stau1 does localize within the processes of NPCs.

Co-staining for bIII-Tubulin and Stau1 was also performed (Fig. 3,3Avii and viii).

Similar to our observations made in cultured NPCs, there was strong Stau1 expression in the cell bodies of all cultured bIII-Tubulin+ neurons. Some of these neurons had started to mature morphologically and had produced immature processes. Again, reminiscent of our observations in processes of NPCs, we found Stau1 in the proximal regions of these extensions; however, limits of detection prevent us from conclusively stating that Stau1 is not present in the more distal regions of processes of newly born neurons. We also labelled our cortical cultures with

SatB2, a transcription factor expressed by most neurons in the cortex (Fig. 3.3Ax) (Britanova et al., 2008; Zhang and Jiao, 2015). Stau1 was expressed by all SatB2-positive (SatB2+) cells (Fig.

3.3Axi and xii). The SatB2+ neurons pictured (Fig. 3.3Axii) display the more prevalent morphology that we observed in our cultures. These newly born neurons are yet to produce processes like the neurons shown in Fig. 3.3Aix.

Both Stau paralogues have been reported in distal dendrites of hippocampal neurons and are postulated to play a role in RNA localization within these cells (Goetze et al., 2006; Vessey

37 et al., 2008). To determine whether Stau1 localized to the distal dendrites of mature cortical neurons, we prepared primary cultures of E18 cortical tissue. At E18, the cortex consists primarily of neurons with a diminishing population of NPCs. Gliogenesis has either not started or is occurring at a very low rate (Costa et al., 2009). These cultures were maintained for 14

DIV, followed by staining for both Stau1 and Map2, a microtubule-associated protein found in the dendrites of mature neurons (Cassimeris and Spittle, 2001). Stau1 was detectible in all

Map2+ cells (Fig. 3.3B). Staining was robust in the cell bodies (Fig. 3.3Bi, ii and iii), but with increased exposure time, we detected Stau1 expression in the distal dendrites of cortical neurons

(Fig. 3.3Biv, v and vi). The staining for Stau1 was punctate and largely associated with the Map2 staining (white arrow heads, Fig. 3.3Bv and vi). These two observations suggest that Stau1 is in an RNP and potentially playing a role in RNA regulation in distal dendrites of mature neurons

(Köhrmann et al., 1999; Vessey et al., 2012).

While observing Stau1 expression patterns in primary cortical cultures, we noticed that there was detectable Stau1 expression in most nuclei (Fig. 3.2 and 3.3). Both Stau1 and Stau2 contain nuclear localization signals (NLSs) and have been reported to translocate to and from the nucleus (Martel et al., 2006; Monshausen et al., 2004). Since this function of Stau1 has not been examined in NPCs of the developing cortex, we performed experiments on our primary NPC cultures to determine if Stau1 undergoes nuclear/cytoplasmic shuttling. We treated cells with the nuclear export inhibitor, Leptomycin B (LMB), and followed with staining for both Stau1 and

Nestin (Kudo et al., 1999). While Stau1 localization is predominantly cytosolic in vehicle-treated

38 Figure 3.3. Stau1 is expressed in NPCs, as well as newborn and mature cortical neurons. A: Primary NPC cultures were prepared at E12 and maintained for 3 DIV. NPCs are identified via immunostaining for Nestin or Sox2 (green, panel i & iv respectively). Newly born neurons are identified via bIII-Tubulin or SatB2 (green, panel vii & x respectively). Stau1 is shown in red

(panels ii, v, viii and xi). Merges of Stau1 and the cell-type markers are shown in panels iii, vi, ix and xii. White arrows indicate Stau1 in proximal regions of processes emerging from NPCs or immature neurons. B: Primary cortical neuronal cultures were prepared at E18 and maintained for 14 DIV. Dendrites were visualized via Map2 (green, panel i) and Stau1 in red (panel ii). The merge is shown in panel iii. To highlight dendritic localization of Stau1, an enlargement of the dendritic arbour (white dashed box, panel i) is shown in panels iv through vi. White arrowheads indicate punctate Stau1 staining co-localizing with Map2 in the distal dendrites. All scale bars =

10 µm.

40 Nestin+ NPCs (Fig. 3.4Ai-iv), upon treatment with 120 nM LMB, we observed an increase in

Stau1 localization within the nucleus of Nestin+ NPCs (Fig. 3.4Av-viii). To quantify this observation, we scored Stau1 expression in Nestin+ NPCs as being predominantly cytoplasmic, equally cytoplasmic and nuclear, or predominantly nuclear. Treatment with LMB led to a significantly reduced number of cells that displayed a predominantly cytoplasmic Stau1 expression profile, from 93.67 +/- 2.31% to 49.33 +/- 2.89% (p < 0.01; Fig. 3.4B).

Concomitantly, LMB treatment significantly increased the percentage of cells that displayed an equivalent cytoplasmic and nuclear expression pattern of Stau1 from 6.33 +/- 2.31% to 47.67 +/-

4.73% (p < 0.001; Fig. 3.4B). No significant changes were observed in cells displaying a prominently nuclear distribution of Stau1 after treatment with LMB.

Stau1 is dispensable for NPC self-renewal and for neuronal differentiation

Having characterized the expression of Stau1 in cells of the developing cortex, we next set out to determine its role in these cell types, specifically within NPCs. Our strategy was to knockdown Stau1 expression in cultures of NPCs via transient transfection of shRNAs targeting the stau1 mRNA, a technique successfully employed in the past to determine the role of Stau2 in these cells (Vessey et al., 2012). We first validated commercially available shRNA vectors by testing their ability to knockdown exogenously expressed murine Stau1tv2-FLAG in HEK293T cells (Fig. 3.5A). Four conditions were run in parallel and subjected to Western blotting: an untransfected negative control, Stau1tv2-FLAG + shControl, Stau1tv2-FLAG + shUnrelated and,

Stau1tv2-FLAG + shStau1. The shControl is a non-effective scrambled 29-mer, while shUnrelated was a previously validated shRNA known to knockdown hnRNPQ, a protein

41 Figure 3.4. Stau1 shuttles between the cytoplasm and nucleus of NPCs. A: Representative images of Stau1 localization within NPCs in the absence (top row, panels i, ii, iii, and iv) or presence (bottom row, panels v, vi, vii, and viii) of LMB. NPCs were identified via

Nestin staining (green, panels i and v) and their nuclei via DAPI (blue, panels ii and vi), with

Stau1 in red (panels iii and vii). Merges of both Stau1 and nuclei are shown in panels iv and viii.

Scale bars = 10 µm. B: Cytoplasmic localization of Stau1 in Nestin+ cells was scored as predominantly cytoplasmic (black bars, panels 5Aiii and 5Aiv), equally cytoplasmic and nuclear

(white bars, panels 5Avii and 5Aviii) or predominantly nuclear (grey bars) in either vehicle

(Control) or in the presence of LMB. Data is represented as % cellular localization, +/- SEM (n =

3, ***: p ≤ 0.001).

100 *** Control Leptomycin B 80 NPCs + 60 ***

20 of Stau1 in Nestin % Localization of Pattern n.s

Nuclear Cytoplasmic

Cytoplasmic/Nuclear

43 unrelated to Stau1. Vinculin was used as a protein loading control. Comparing levels of the bands detected by the anti-FLAG antibody, it is evident that shStau1 is knocking down the exogenous Stau1 protein (Fig 3.5A and B). Specifically, a ~10 fold decrease was observed upon shStau1 transfection compared to shControl and unrelated controls (Fig 3.5B).

Next, we sought to determine if the same shRNAs would be effective in knocking down endogenous Stau1 in our primary E12 cortical cultures. Immediately after dissociation and plating of the cells, we co-transfected the cultures with a nuclear-EGFP (nEGFP) construct and either shControl or shStau1. The nEGFP served as a marker for transfection and was mixed with the various shRNAs at a ratio of 1:3 so we could be confident that cells expressing nEGFP were also transfected with the shRNA construct. Cultures were maintained for 3 DIV and stained for both Stau1 and GFP to enhance our detection rate of successfully transfected cells (Fig. 3.5C).

We divided Stau1 expression levels in nEGFP+ cells into three categories: normal Stau1 expression, reduced Stau1 expression, and no detectable Stau1 expression. Upon quantification, shControl resulted in 86.4% of cells with normal Stau1 expression, 12.6% of cells with reduced

Stau1 expression, and 1.1% of cells with no detectable Stau1. shStau1 significantly reduced the number of cells with normal Stau1 levels to 14.7% (p < 0.05) and significantly increased the number of cells with no detectable Stau1 to 55.9% (p < 0.05). These observations demonstrate that our shRNA constructs targeting stau1 are effective in knocking down endogenous Stau1 protein levels.

We next set out to determine the effects of Stau1 knockdown on the biology of NPCs in culture. We were interested in whether loss of Stau1 expression would lead to changes in the

44 Figure 3.5. Stau1 shRNAs knock-down Stau1 protein in primary NPC cultures. A: Western blot analysis of HEK293T cells that were untransfected (lane 1) or co-transfected with Stau1tv2-FLAG and either a control shRNA (shCon, Lane 2), shRNA targeting an unrelated mRNA (shUR, lane 3), or Stau1 specific shRNA (shStau1, Lane 4). Top blot probed with vinculin as a protein loading control. B: Western blots (Fig 3.5A) were quantified by densitometry, expressed relative to vinculin and normalized to shCon lysates. Values are means

± SEMs of three biological replicates. C: Representative images of primary cortical cultures prepared at E12 and transfected with both nEGFP and either shStau1 or shControl. After transfection, cells were maintained for 3 DIV. Transfected cells were identified via nEGFP expression (green) and Stau1 expression (red) was quantified in transfected, nEGFP+ cells as normal (top row), reduced, or not detectable (negative; bottom row). Scale bar = 10 µm D:

Quantification of nEGFP+ cells that exhibited either normal (black bars), reduced (white bars), or no detectable Stau1 expression (grey bars) after transfection with the control shRNA (shControl), shStau1-A, or shStau1-B. Data is presented +/- SEM, (n = 3, **: p ≤ 0.01, ****: p ≤ 0.0001).

46 ability of NPCs to maintain their population via self-renewal and/or their ability to generate neurons. We repeated the protocol employed for Fig. 3.5C and D but stained our cultures for either Nestin, bIII-Tubulin, or Tbr2 after 3 DIV. In cultures transfected with nEGFP and shControl, we observed approximately 66% nEGFP+/Nestin+ cells (Fig. 3.6A and B, n=3; representative images shown in Fig. 3.6A). This coincides with previously published results using the same protocol. Surprisingly, cultures transfected with nEGFP and shStau1 did not display any differences in the amount of nEGFP+/Nestin+ cells, with both treatments resulting in the same approximate number of NPCs. We also found no differences in the numbers of nEGFP+/bIII-Tubulin+ cells upon knockdown of Stau1 (Fig. 3.6C and D, n = 3; representative images shown in Fig. 3.6C). Control cultures produced approximately 42% nEGFP+/bIII-

Tubulin+ cells. Transfection with shStau1 did not change this percentage of post-mitotic neurons in our cultures. Lastly, among Tbr2+ intermediate progenitor cells, no changes in the numbers of nEGFP+/Tbr2+ cells were observed upon shStau1 transfection. Both shControl and shStau1 transfected cultures had an approximate 6% population of nEGFP+/Tbr2+ transfected cells (Fig.

3.6E and F, n = 3; representative images shown in Fig. 3.6E). These unexpected results indicate that Stau1 may be dispensable for the normal function of NPCs.

47 Figure 3.6. Knockdown of Stau1 in primary cortical cultures produces no observable change in NPC fate.

A, C, E: Representative images of NPCs cultured and transfected with either shControl or shStau1 at E12 and fixed and stained after 3 DIV. Transfected cells were identified via nEGFP expression (green). A: NPCs were identified by Nestin expression, C: newly born neurons with bIII-Tubulin expression, and E: intermediate progenitors with Tbr2 expression. Transfected cells positive for the cell marker are indicated with white asterisks. A, C: Scale bar = 10 µm E: Scale bar = 20 µm. B, D, F: All nEGFP+ cells were quantified for either B: Nestin, D: bIII-Tubulinin or F: Tbr2 expression in shControl (black bar) and shStau1 (white bar) transfected cultures. Data is n = 3 and presented as +/- SEM.

49 Chapter Four: Discussion

In this study, we have explored the expression profile of the RNA-binding protein

Stau1 in the developing mouse cerebral cortex and attempted to elucidate its role in the various cell types present. While research has been conducted to uncover the role of Stau1 during neurogenesis, there was poor characterization of Stau1 throughout cortical development.

Furthermore, we wanted to replicate recent experimental findings and further investigate the role of Stau1 during corticogenesis.

We characterized stau1 mRNA expression by rt-PCR on total RNA extracts from cortical tissue dissected from E12-E18, to measure the relative expression of stau1 across cortical development. We suspected that if Stau1 operates in stem cell renewal, that stau1 expression would be highest at the start of neurogenesis and decrease around E18 when asymmetric divisions become less prevalent. Interestingly, stau1 mRNA levels appear to be relatively constant throughout cortical development, which led us to believe that Stau1 may be involved in a variety of processes that are not restricted to neurogenesis. We further wanted to examine the cell types that express stau1 mRNA. Single-molecule FISH showed that NPCs, neurons, and

IPCs possess stau1 mRNA granules. Stau1 levels did not appear to change throughout cortical development as different cell populations emerged. This is not surprising as Stau1 expression has been observed in most cell types (Kim et al., 2005).

The NPCs that build the cortex are born at approximately E10 (Franco and Müller, 2013) and we found that Stau1 is highly expressed at this timepoint, remaining constant throughout cortical development. This early and high level of expression is unlike its paralogue Stau2, which is only minimally detectable at the onset of neurogenesis (Vessey et al., 2012). Previously published studies demonstrate that these two proteins have opposing functions in other cell types.

50 For example, in hippocampal slice cultures, loss of Stau1 produced deficits in protein synthesis– dependent long-term potentiation, while loss of Stau2 led to deficits in protein synthesis– dependent long-term depression (Lebeau et al., 2011, 2008). It has been suggested that these divergent roles are the result of Stau1 and Stau2 interacting with different RNA targets (Furic et al., 2007). This led us to believe that Stau1 and Stau2 may play opposing roles in NPCs.

We characterized the subcellular expression of the Stau1 protein. These experiments revealed a predominantly cytoplasmic localization of Stau1 with some nuclear accumulation.

These findings are consistent with previous studies carried out in HeLa and COS1 cells (Martel et al., 2006) as well as mouse myoblasts (Ravel-Chapuis et al., 2012). While we could not determine if Stau1 was present in the protrusions of both NPCs and neurons in vivo, we were able to observe its presence in these structures in primary cultures of NPCs. We postulate that its presence in these protrusions is an indication that Stau1 plays a role in the localization of certain mRNAs to these regions. Stau1 is known to degrade transcripts in a manner similar to nonsense- mediate decay (Kim et al., 2005; Park and Maquat, 2013), however there is no evidence to suggest that this Stau1-mediated decay (SMD) occurs in distal protrusions of cells. It is more likely that SMD occurs in the soma, in close proximity to the nucleus so that erroneous transcripts can be detected and degraded immediately after nuclear export (Lykke-Andersen et al., 2000). Therefore, we speculate that the predominant role of Stau1 in NPCs and the neurons that they generate is mRNA localization. It is, however, possible that Stau1 supports multiple functions.

After demonstrating that Stau1 can undergo nuclear import and export in NPCs, we set out to determine its precise molecular function. Our initial strategy was to utilize shRNAs to knockdown Stau1 in NPC cultures, an established technique used to investigate the role of

51 proteins in these cells, including Stau2 (Amadei et al., 2015; Bartkowska et al., 2007; Dugani et al., 2010, 2009; Gallagher et al., 2015; Gauthier-Fisher et al., 2009; Kusek et al., 2012; Tsui et al., 2014, 2013; Vessey et al., 2012; Yang et al., 2014; Zander et al., 2014). After validating that our shRNA vectors knockdown endogenous Stau1, we were surprised to find that loss of Stau1 had no observable effect on the ability of NPCs to either self-renew or generate neurons and

IPCs. In addition, we did not observe any changes in cell death upon Stau1 knockdown (data not shown).

This lack of observable phenotype upon disruption of Stau1 is consistent with a previous report showing that a loss-of-function allele for Stau1 produced no overt phenotype in mice homozygous for the allele (Vessey et al., 2008). Although the authors did not assess cortical development directly, behavioral studies on homozygous mutant adult mice did not reveal any cognitive impairments, only small deficits in locomotor activity. Although we considered the results of this study when forming our hypothesis, there were some unusual aspects surrounding this mutant Stau1 mouse since it was not a null allele. The targeting strategy aimed at terminating translation upstream of the crucial dsRBD3 however, the targeting cassette introduced an unpredicted splicing event that resulted in an in-frame splice product encoding a

Stau1 protein that was only missing dsRBD3 (Vessey et al., 2008). The authors demonstrated that this Stau1 variant could not bind RNA in-vitro, but did not assess this function in-vivo. Any phenotype they observed was in cultured neurons with over-expressed clones of the mutant

Stau1 protein (Vessey et al., 2008). Thus, we were expecting that full knockdown of Stau1 in

NPCs would lead to an observable phenotype.

Contrarily, Moon et al. (2018) demonstrated that knockdown of Stau1 caused an increase in neurogenesis at the expense of NPC renewal. This differs from our results as we were unable

52 to see a change in NPCs, neurons, or IPCs upon Stau1 knockdown. This may be due to differences between our methodologies. First, while Moon et al. (2018) use different culture media, and initiate differentiation of NPCs by seeding cells in the absence of FGF, our primary cultures are supplemented with EGF and FGF and are capable of spontaneous differentiation immediately after seeding. Second, Stau1 knockdown experiments conducted by Moon et al. utilized a combination of two shRNA constructs transfected together to achieve sufficient knockdown of Stau1. Both shRNAs utilized were 21-mer sequences that are of usual length of miRNAs. Although both 21-mers share 100% sequence complementarity to all stau1 mRNA transcripts, they also demonstrate 13-14bp complementation to other CNS specific RNA upon a sequence BLAST. For example, between both shRNA constructs used, off-target binding could be predicted to knockdown zinc finger protein 711 (zfp711), a largely unstudied presumptive transcription factor that is highly upregulated in the CNS from E11.5 with highest expression at

E18. Furthermore, this transcription factor maintains its expression in adult mice, specifically in the brain, with enrichment in the cortex and frontal lobe. Other possible off-target genes include zinc finger and BTB domain containing 45 (Zbtb45) and Tetratricopeptide repeat domain 37

(Ttc37). Zbtb45 has been studied to be essential for gliogenesis of NPCs, causing increased production of astrocytes at the expense of NPCs upon knockdown (Södersten et al., 2010). Tct37 was also identified to potentially interact with Stau1 shRNAs. Ttc37 is ubiquitously expressed in most tissue and is suspected to function in mRNA decay of abnormal or excess transcripts (Fabre et al., 2012). Mutations in this gene are associated with trichohepatoenteric syndrome. While this disease is primarily classified by abnormalities in hair, liver and intestines, it has been documented that around half of the children with the disease possess intellectual disabilities

(Hartley et al., 2010). Stau1 shRNA used by Moon et al. also complemented with two neuronal

53 specific ncRNA, Gm31152 and Gm41694. While unstudied, they demonstrate strong expression during cortical timepoints E11-E18 and persist in adulthood, almost exclusively in the cortex and frontal lobe.

Complementarity of shRNA to numerous embryonic and CNS related RNA could clearly be problematic. Research has shown that off-target knockdown by si- or shRNA is widespread and mimics miRNA mediated knockdown via miRNA-mRNA complementation of the seed region (Jackson et al., 2006). miRNA seed regions have been documented to be most effective at their 5’ end and possess 8-mers to target mRNA for degradation or inhibition, typically by recognizing the 3’UTR (Catalanotto et al., 2016; Jackson et al., 2006). Uncommon miRNA mediated effects include binding of 6 and 7-mers, miRNA binding to the coding region and strong 3’ seed regions of miRNA (Agarwal et al., 2015; Catalanotto et al., 2016). While the exact criteria for miRNA-mRNA targeting are unknown, there is evidence to suggest that shRNA- mediated knockdown could elicit phenotypes through off-target degradation of RNA.

In contrast to previous studies, our study utilized a single 29-mer shRNA. Our construct is able to complement all transcript variants of stau1 and is also subjected to off-target binding of mRNA. Upon a sequence BLAST of our 29-mer shRNA, some off-target genes were found,

Gm29260 and Gm39447. Gm29260 is a ncRNA that is highly expressed in the CNS during cortical development, however, out of 8 predicted transcript variants, our shRNA only targets one. This is also observed with ncRNA Gm39447 where its expression is embryonic and adult

CNS specific, however the base pair complementarity is not specific to the 5’ or 3’ end of the shRNA, typical of miRNA mediated knockdown. Other potential targets were either not expressed during embryonic development or were not CNS-specific or, if expressed in the CNS, were not previously demonstrated to play a regulatory role during neurogenesis. Additionally,

54 while the off-target capabilities between 21-mer and 29-mer shRNAs have not be compared, research has demonstrated that 29-mer synthetic shRNAs are more potent at inducing gene silencing compared to siRNAs (Siolas et al., 2005). Overall the use of a single 29-mer shRNA in our study effectively knocked down Stau1 protein in our model system without the confounding off-target effects of potentially seen by Moon et al. 2018. Different, or lack of, off-target effects could explain the lack of phenotype observed in our study.

To further validate the lack of phenotype we observed in vitro, we performed in-utero electroporation to observe Stau1-mediated knockdown using our shRNA construct in an in-vivo setting. Comparatively, few differences between the in utero electroporations performed by our lab and Moon et al (2018) exist and is a better model to observe the consequences of Stau1 knockdown. In utero knockdown of Stau1 also has its advantages over in vitro transfection.

Firstly, some knockdown phenotypes are not observable in an in vitro system. In addition, changes in cortical layer thickness, migration and transfected cell position within the cortex can be examined using this approach. While sufficient replicates have not been performed, certain trends and significance could already be observed. Firstly, upon examining transfected cells for markers of neurons or IPCs, no difference was observed between control shRNA and Stau1 shRNA (Fig 5.1 A and B). This result is similar to the absence of a phenotype in our in-vitro

Stau1 knockdown in primary cultures. While staining for markers for NPCs has not been performed, typically changes in neurons and IPCs come at the expense of NPCs. We therefore expect that staining for NPC markers would demonstrate the same lack of phenotype in-vivo as neurons and IPCs.

While no change is observed with respect to the cell fate of Stau1 knockdown cells, differences were seen as to where Stau1 knockdown cells populated the cortex. In control

55 embryos, transfected cells populated the entirety of the VZ/SVZ. However, upon Stau1 knockdown, examination of cortical sections showed an accumulation of transfected cells at the border between the SVZ and the IZ. We therefore divided the VZ into two equal halves, and binned them as upper and lower ventricular zone. Quantification of these sections demonstrated that there is a significant decrease in transfected cells that populate the lower ventricular zone compared to the control (Fig 5.2 B). While more replicates are needed to corroborate the data, this initial observation of changes in the position of transfected cells within the cortex provides evidence that Stau1 may play a role in neuronal migration or in maintaining the position of NPCs within the VZ. Stau1 localizes to distal processes of NPCs and is unlikely to be involved in SMD in those processes since SMD is thought to occur close to the soma in order to degrade transcripts upon nuclear shuttling. Our novel in-vivo data suggests that Stau1 may be localizing mRNA to distal protrusions of NPCs to assist in migration of neurons to the CP. These mRNA may code for proteins that are used as substrates by neurons to adhere and migrate upon asymmetric divisions. Additionally, these mRNA may code for adhesion proteins that anchor

NPCs to the VZ/SVZ.

In summary, two independent studies have found that perturbations in Stau1 expression produce no overt changes in cortical neurogenic fate. Firstly, Vessey et al. 2008 attempted to engineer a null allele of Stau1, however a unanticipated splicing event produced a protein in which only dsRBD3 was deleted. DsRBD3 is the main domain used by Stau1 to bind RNA and its RNA-binding function was lost in-vitro. Homozygous mice expressing Stau1 with negligible

RNA-binding activity demonstrated no overt behavioural phenotype; a suspected result likely to occur during erroneous corticogenesis (Vessey et al., 2008). Secondly, our study applied the same Stau1 knockdown strategy used by Moon et al. (2018), but with different shRNA

56 constructs. Therefore, in-utero electroporations were utilized to directly compare shRNA knockdown of Stau1 presented here compared to Moon et al (2018) in a in-vivo system. While hard to compare different genetic models, our results, alongside Vessey et al. (2008) corroborate that Stau1 may be dispensable for roles involved in neurogenesis and asymmetric divisions, but rather be involved in other processes such as neuronal migration and NPC anchoring. Results obtained by Moon et al. (2018) should not be disregarded, however, differences in our shRNA constructs could account for disparity in phenotypes as a result of off-target degradation of transcripts. Therefore, further research would need to be conducted to identify if other developmental processes are being altered as a result of Stau1 knockdown via shRNA.

57 Chapter Five: Summary and Future Directions

Future directions

Our data suggests that Stau1 is dispensable for neurogenesis but plays one or more roles in migration or NPC anchoring. Further experiments are necessary to verify those findings and further elucidate the mechanisms. Specifically, additional in-utero electroporation replicates must be conducted to verify our preliminary data. Transfected cells in these experiments will also be assessed for cellular markers of NPCs, neurons and IPCs to more fully characterize the effects on cell fate. Additionally, cortical layer thickness and GFP+ transfected cell position within the cortex will be analysed to determine if Stau1 knockdown leads to deficits in neuronal migration or loss of NPCs from the VZ or SVZ.

We hypothesize that Stau1 may be localizing mRNA to distal protrusions of NPCs or neurons to facilitate neuronal migration or anchoring of these cells. Our characterization of Stau1 protein localization demonstrate that Stau1 localizes to distal protrusions of both neurons and

NPCs, while also undergoing nuclear shuttling, suggesting that Stau1 may bind targets in the nucleus and shuttle them to these distal protrusions. Furthermore, SMD is typically thought to occur around the soma of the cell, suggesting roles other than mRNA degradation (Lykke-

Andersen et al., 2000). Therefore, future experiments would attempt to elucidate potential mRNA targets of Stau1 that may explain the phenotype observed in vivo. RNA-IPs would be performed to elucidate Stau1 RNA targets. Extracted RNA would then be converted to cDNA and identified via microarray or next-generation sequencing. Utilizing this information, we would then look at ideal RNA candidates, confirm RNA binding interactions using a gel shift assay and FISH to demonstrate Stau1 and candidate RNA co-localization. Further experiments could entail performing knockdown experiments to observe if knockdown of RNA candidates

58 phenocopy Stau1 knockdown. immunocytochemistry would then be performed to visualize candidate protein in the distal protrusions of NPCs or neurons and their mislocalization upon

Stau1 knockdown. Additionally, Stau1 protein binding partners could also be identified using co-

IPs and subsequent MS. These binding partners could also be subjected to shRNA knockdown to identify if mislocalization of mRNA occurs and if binding partner knockdown produces a phenotype to that of Stau1 knockdown.

Moon et al. (2018) have provided an alternative hypothesis as to the function of Stau1 and Klf4 in neurogenesis. We aimed to replicate knockdown experiments and our analysis demonstrated no phenotype in terms of perturbations in neurogenesis. As a result, we suspect that the differences in knockdown shRNA constructs used by Moon et al (2018) had the potential of knocking down unstudied CNS specific genes, which may explain the differences in phenotypes. Future experiments should aim to illustrate that the shRNA used are not causing off target knockdown of suspected transcripts. This would confirm that the phenotype presented by

Moon et al. (2018) is specific to Stau1 knockdown. Furthermore, a true Stau1 knockout mouse or

CNS conditional knockout mouse could be utilized to resolve disputes of resulting phenotypes upon Stau1 knockdown.

Summary

In this study, we have determined that Stau1 is non-essential for cell fate decisions during neurogenesis and asymmetric cell divisions of NPCs. Temporal examination of Stau1 protein and mRNA expression showed that Stau1 was found to be expressed throughout all stages of cortical development. This differs from the expression of Stau2, which demonstrates heightened expression throughout later stages of neurogenesis. We further characterized Stau1 expression spatially using immunocytochemistry and immunohistochemistry and found that Stau1

59 demonstrates a predominantly cytosolic localization that extends into distal protrusions of NPCs and neurons, accompanied by weak nuclear staining. Stau1 was also found to be expressed by all cell types present during corticogenesis and is abundant in all cortical layers. Upon shRNA knockdown of Stau1 in primary cultures, no overt phenotype was observed with respect to stem cell renewal or neuronal differentiation. Depletion of Stau1 by shRNA knockdown in-vivo caused no change in cortical cell fates. Stau1 knockdown cells do seem to be displaced from the lower VZ and migrate towards the upper VZ compared to control. Since Stau1 localizes to distal protrusions of NPCs and neurons, it is unlikely that SMD is occurring. In addition to its nuclear shuttling, we propose that Stau1 is required to asymmetrically localize proteins required for neuronal migration or NPC anchorage to the cortical plate. Future studies will be designed to elucidate Stau1’s role in neuronal migration/anchorage and reconcile the different conclusions drawn from the multiple loss-of-function Stau1 studies.

60 References

Agarwal, V., Bell, G.W., Nam, J.W., Bartel, D.P., 2015. Predicting effective microRNA target sites in mammalian mRNAs. Elife. https://doi.org/10.7554/eLife.05005 Amadei, G., Zander, M.A., Yang, G., Dumelie, J.G., Vessey, J.P., Lipshitz, H.D., Smibert, C.A., Kaplan, D.R., Miller, F.D., 2015. A Smaug2-Based Translational Repression Complex Determines the Balance between Precursor Maintenance versus Differentiation during Mammalian Neurogenesis. J. Neurosci. 35, 15666–15681. https://doi.org/10.1523/JNEUROSCI.2172-15.2015 Bartkowska, K., Paquin, A., Gauthier, A.S., Kaplan, D.R., Miller, F.D., 2007. Trk signaling regulates neural precursor cell proliferation and differentiation during cortical development. Development 134, 4369–4380. https://doi.org/10.1242/dev.008227 Bastock, R., St Johnston, D., 2008. Drosophila oogenesis. Curr. Biol. https://doi.org/10.1016/j.cub.2008.09.011 Becalska, A.N., Kim, Y.J.R., Belletier, N.G., Lerit, D.A., Sinsimer, K.S., Gavis, E.R., 2011. Aubergine is a component of a nanos mRNA localization complex. Dev. Biol. https://doi.org/10.1016/j.ydbio.2010.10.002 Bliss, T.V.P., Cooke, S.F., 2011. Long-term potentiation and long-term depression: a clinical perspective. Clinics. https://doi.org/10.1590/S1807-59322011001300002 Bondy-Chorney, E., Crawford Parks, T.E., Ravel-Chapuis, A., Jasmin, B.J., Côté, J., 2016. Staufen1s role as a splicing factor and a disease modifier in Myotonic Dystrophy Type I. Rare Dis. https://doi.org/10.1080/21675511.2016.1225644 BRENDEL, C., REHBEIN, M., KREIENKAMP, H.-J., BUCK, F., RICHTER, D., KINDLER, S., 2004. Characterization of Staufen 1 ribonucleoprotein complexes. Biochem. J. https://doi.org/10.1042/BJ20040812 Britanova, O., de Juan Romero, C., Cheung, A., Kwan, K.Y., Schwark, M., Gyorgy, A., Vogel, T., Akopov, S., Mitkovski, M., Agoston, D., Šestan, N., Molnár, Z., Tarabykin, V., 2008. Satb2 Is a Postmitotic Determinant for Upper-Layer Neuron Specification in the Neocortex. Neuron 57, 378–392. https://doi.org/10.1016/j.neuron.2007.12.028 Broadus, J., Fuerstenberg, S., Doe, C.Q., 1998. Staufen-dependent localization of prospero mRNA contributes to neuroblast daughter-cell fate. Nature 391, 792–795. https://doi.org/10.1038/35861 Buxbaum, A.R., Haimovich, G., Singer, R.H., 2014. In the right place at the right time: visualizing and understanding mRNA localization. Nat. Rev. Mol. Cell Biol. 16, 95–109. https://doi.org/10.1038/nrm3918 Cassimeris, L., Spittle, C., 2001. Regulation of microtubule-associated proteins. Int. Rev. Cytol. https://doi.org/10.1016/S0074-7696(01)10006-9 Catalanotto, C., Cogoni, C., Zardo, G., 2016. MicroRNA in control of gene expression: An overview of nuclear functions. Int. J. Mol. Sci. https://doi.org/10.3390/ijms17101712 Chenn, A., McConnell, S.K., 1995. Cleavage orientation and the asymmetric inheritance of

61 notchl immunoreactivity in mammalian neurogenesis. Cell. https://doi.org/10.1016/0092- 8674(95)90035-7 Cho, H., Kim, K.M., Han, S., Choe, J., Park, S.G., Choi, S.S., Kim, Y.K., 2012. Staufen1- Mediated mRNA Decay Functions in Adipogenesis. Mol. Cell 46, 495–506. https://doi.org/10.1016/j.molcel.2012.03.009 Choksi, S.P., Southall, T.D., Bossing, T., Edoff, K., de Wit, E., Fischer, B.E.E., van Steensel, B., Micklem, G., Brand, A.H., 2006. Prospero Acts as a Binary Switch between Self-Renewal and Differentiation in Drosophila Neural Stem Cells. Dev. Cell 11, 775–789. https://doi.org/10.1016/j.devcel.2006.09.015 Costa, M.R., Bucholz, O., Schroeder, T., Götz, M., 2009. Late origin of glia-restricted progenitors in the developing mouse cerebral cortex. Cereb. Cortex 19. https://doi.org/10.1093/cercor/bhp046 Crawley, J.N., Belknap, J.K., Collins, A., Crabbe, J.C., Frankel, W., Henderson, N., Hitzemann, R.J., Maxson, S.C., Miner, L.L., Silva, A.J., Wehner, J.M., Wynshaw-Boris, A., Paylor, R., 1997. Behavioral phenotypes of inbred mouse strains: Implications and recommendations for molecular studies. Psychopharmacology (Berl). https://doi.org/10.1007/s002130050327 Dardenne, E., PolayEspinoza, M., Fattet, L., Germann, S., Lambert, M.P., Neil, H., Zonta, E., Mortada, H., Gratadou, L., Deygas, M., Chakrama, F.Z., Samaan, S., Desmet, F.O., Tranchevent, L.C., Dutertre, M., Rimokh, R., Bourgeois, C.F., Auboeuf, D., 2014. RNA Helicases DDX5 and DDX17 Dynamically Orchestrate Transcription, miRNA, and Splicing Programs in Cell Differentiation. Cell Rep. https://doi.org/10.1016/j.celrep.2014.05.010 Driever, W., Siegel, V., Nüsslein-Volhard, C., 1990. Autonomous determination of anterior structures in the early Drosophila embryo by the bicoidDriever, W., Siegel, V., & Nüsslein- Volhard, C. (1990). Autonomous determination of anterior structures in the early Drosophila embryo by the bicoid morphogen. Dev. Development 109, 811–20. Drubin, D.G., Nelson, W.J., 1996. Origins of cell polarity. Cell. https://doi.org/10.1016/S0092- 8674(00)81278-7 Dubnau, J., Chiang, A.S., Grady, L., Barditch, J., Gossweiler, S., McNeil, J., Smith, P., Buldoc, F., Scott, R., Certa, U., Broger, C., Tully, T., 2003. The staufen/pumilio pathway is involved in drosophila long-term memory. Curr. Biol. https://doi.org/10.1016/S0960- 9822(03)00064-2 Duchaîne, T., Wang, H.J., Luo, M., Steinberg, S. V, Nabi, I.R., DesGroseillers, L., 2000. A novel murine Staufen isoform modulates the RNA content of Staufen complexes. Mol Cell Biol. https://doi.org/10.1128/MCB.20.15.5592-5601.2000.Updated Dugani, C.B., Paquin, A., Fujitani, M., Kaplan, D.R., Miller, F.D., 2009. p63 Antagonizes p53 to Promote the Survival of Embryonic Neural Precursor Cells. J. Neurosci. 29, 6710–6721. https://doi.org/10.1523/JNEUROSCI.5878-08.2009 Dugani, C.B., Paquin, A., Kaplan, D.R., Miller, F.D., 2010. Coffin-Lowry syndrome: A role for RSK2 in mammalian neurogenesis. Dev. Biol. 347, 348–359. https://doi.org/10.1016/j.ydbio.2010.08.035 Ellis, P., Fagan, B.M., Magness, S.T., Hutton, S., Taranova, O., Hayashi, S., McMahon, A., Rao,

62 M., Pevny, L., 2004. SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult. Dev. Neurosci. 26, 148–165. https://doi.org/10.1159/000082134 Fabre, A., Charroux, B., Martinez-Vinson, C., Roquelaure, B., Odul, E., Sayar, E., Smith, H., Colomb, V., Andre, N., Hugot, J.P., Goulet, O., Lacoste, C., Sarles, J., Royet, J., Levy, N., Badens, C., 2012. SKIV2L mutations cause syndromic diarrhea, or trichohepatoenteric syndrome. Am. J. Hum. Genet. https://doi.org/10.1016/j.ajhg.2012.02.009 Finlay, B.L., Darlington, R.B., 1995. Linked regularities in the development and evolution of mammalian brains. Science 268, 1578–84. https://doi.org/10.1126/science.7777856 Florio, M., Huttner, W.B., 2014. Neural progenitors, neurogenesis and the evolution of the neocortex. Development 141, 2182–94. https://doi.org/10.1242/dev.090571 Franco, S.J., Müller, U., 2013. Shaping Our Minds: Stem and Progenitor Cell Diversity in the Mammalian Neocortex. Neuron. https://doi.org/10.1016/j.neuron.2012.12.022 Fritzsche, R., Karra, D., Bennett, K.L., Ang, F., Heraud-Farlow, J.E., Tolino, M., Doyle, M., Bauer, K.E., Thomas, S., Planyavsky, M., Arn, E., Bakosova, A., Jungwirth, K., Hörmann, A., Palfi, Z., Sandholzer, J., Schwarz, M., Macchi, P., Colinge, J., Superti-Furga, G., Kiebler, M.A., 2013. Interactome of two diverse RNA granules links mRNA localization to translational repression in neurons. Cell Rep. 5, 1749–1762. https://doi.org/10.1016/j.celrep.2013.11.023 Furic, L., Maher-Laporte, M., DesGroseillers, L., 2007. A genome-wide approach identifies distinct but overlapping subsets of cellular mRNAs associated with Staufen1- and Staufen2- containing ribonucleoprotein complexes. RNA 14, 324–335. https://doi.org/10.1261/rna.720308 Gallagher, D., Voronova, A., Zander, M.A., Cancino, G.I., Bramall, A., Krause, M.P., Abad, C., Tekin, M., Neilsen, P.M., Callen, D.F., Scherer, S.W., Keller, G.M., Kaplan, D.R., Walz, K., Miller, F.D., 2015. Ankrd11 is a chromatin regulator involved in autism that is essential for neural development. Dev. Cell 32, 31–42. https://doi.org/10.1016/j.devcel.2014.11.031 Gauthier-Fisher, A., Lin, D.C., Greeve, M., Kaplan, D.R., Rottapel, R., Miller, F.D., 2009. Lfc and Tctex-1 regulate the genesis of neurons from cortical precursor cells. Nat. Neurosci. 12, 735–744. https://doi.org/10.1038/nn.2339 Gavis, E.R., Lehmann, R., 1994. Translational regulation of nanos by RNA localization. Nature 369, 315–318. https://doi.org/10.1038/369315a0 Goetze, B., Tuebing, F., Xie, Y., Dorostkar, M.M., Thomas, S., Pehl, U., Boehm, S., Macchi, P., Kiebler, M.A., 2006. The brain-specific double-stranded RNA-binding protein Staufen2 is required for dendritic spine morphogenesis. J. Cell Biol. 172, 221–231. https://doi.org/10.1083/jcb.200509035 Goldstein, B., Macara, I.G., 2007. The PAR Proteins: Fundamental Players in Animal Cell Polarization. Dev. Cell. https://doi.org/10.1016/j.devcel.2007.10.007 Gönczy, P., 2008. Mechanisms of asymmetric cell division: Flies and worms pave the way. Nat. Rev. Mol. Cell Biol. https://doi.org/10.1038/nrm2388 Gong, C., Kim, Y.K., Woeller, C.F., Tang, Y., Maquat, L.E., 2009. SMD and NMD are

63 competitive pathways that contribute to myogenesis: Effects on PAX3 and myogenin mRNAs. Genes Dev. 23, 54–66. https://doi.org/10.1101/gad.1717309 Gong, C., Maquat, L.E., 2011. lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3′ UTRs via Alu elements. Nature 470, 284–288. https://doi.org/10.1038/nature09701 Han, H., Irimia, M., Ross, P.J., Sung, H.K., Alipanahi, B., David, L., Golipour, A., Gabut, M., Michael, I.P., Nachman, E.N., Wang, E., Trcka, D., Thompson, T., O’Hanlon, D., Slobodeniuc, V., Barbosa-Morais, N.L., Burge, C.B., Moffat, J., Frey, B.J., Nagy, A., Ellis, J., Wrana, J.L., Blencowe, B.J., 2013. MBNL proteins repress ES-cell-specific alternative splicing and reprogramming. Nature. https://doi.org/10.1038/nature12270 Hartley, J.L., Zachos, N.C., Dawood, B., Donowitz, M., Forman, J., Pollitt, R.J., Morgan, N. V., Tee, L., Gissen, P., Kahr, W.H.A., Knisely, A.S., Watson, S., Chitayat, D., Booth, I.W., Protheroe, S., Murphy, S., de Vries, E., Kelly, D.A., Maher, E.R., 2010. Mutations in TTC37 Cause Trichohepatoenteric Syndrome (Phenotypic Diarrhea of Infancy). Gastroenterology. https://doi.org/10.1053/j.gastro.2010.02.010 He, F., Jacobson, A., 2015. Nonsense-Mediated mRNA Decay: Degradation of Defective Transcripts Is Only Part of the Story. Annu. Rev. Genet. https://doi.org/10.1146/annurev- genet-112414-054639 Heraud-Farlow, J.E., Kiebler, M.A., 2014. The multifunctional Staufen proteins: Conserved roles from neurogenesis to synaptic plasticity. Trends Neurosci. https://doi.org/10.1016/j.tins.2014.05.009 Heraud-Farlow, J.E., Sharangdhar, T., Li, X., Pfeifer, P., Tauber, S., Orozco, D., Hörmann, A., Thomas, S., Bakosova, A., Farlow, A.R., Edbauer, D., Lipshitz, H.D., Morris, Q.D., Bilban, M., Doyle, M., Kiebler, M.A., 2013. Staufen2 regulates neuronal target RNAs. Cell Rep. 5, 1511–1518. https://doi.org/10.1016/j.celrep.2013.11.039 Holt, C.E., Bullock, S.L., 2009. Subcellular mRNA localization in animal cells and why it matters. Science 326, 1212–6. https://doi.org/10.1126/science.1176488 Inaba, M., Yamashita, Y.M., 2012. Asymmetric stem cell division: Precision for robustness. Cell Stem Cell. https://doi.org/10.1016/j.stem.2012.09.003 Jackson, A.L., Burchard, J., Schelter, J., Chau, B.N., Cleary, M., Lim, L., Linsley, P.S., 2006. Widespread siRNA “off-target” transcript silencing mediated by seed region sequence complementarity. RNA. https://doi.org/10.1261/rna.25706 Kandel, E.R., Schwartz, J.H., Jessell, T.M., Siegelbaum, S.A., Hudspeth, A.J., 2013. Principles of Neural Science, Fifth Edition, The McGraw-Hill Companies, Inc. https://doi.org/10.1036/0838577016 Kelemen, O., Convertini, P., Zhang, Z., Wen, Y., Shen, M., Falaleeva, M., Stamm, S., 2013. Function of alternative splicing. Gene. https://doi.org/10.1016/j.gene.2012.07.083 Kiebler, M.A., Bassell, G.J., 2006. Neuronal RNA Granules: Movers and Makers. Neuron. https://doi.org/10.1016/j.neuron.2006.08.021 Kim, Y.K., Furic, L., DesGroseillers, L., Maquat, L.E., 2005. Mammalian Staufen1 recruits Upf1 to specific mRNA 3’UTRs so as to elicit mRNA decay. Cell 120, 195–208.

64 https://doi.org/10.1016/j.cell.2004.11.050 Knoblich, J.A., 2008. Mechanisms of Asymmetric Stem Cell Division. Cell. https://doi.org/10.1016/j.cell.2008.02.007 Köhrmann, M., Luo, M., Kaether, C., DesGroseillers, L., Dotti, C.G., Kiebler, M. a, 1999. Microtubule-dependent recruitment of Staufen-green fluorescent protein into large RNA- containing granules and subsequent dendritic transport in living hippocampal neurons. Mol. Biol. Cell 10, 2945–2953. https://doi.org/10.1091/mbc.10.9.2945 Kriegstein, A., Alvarez-Buylla, A., 2009. The glial nature of embryonic and adult neural stem cells. Annu. Rev. Neurosci. 32, 149–84. https://doi.org/10.1146/annurev.neuro.051508.135600 Kudo, N., Matsumori, N., Taoka, H., Fujiwara, D., Schreiner, E.P., Wolff, B., Yoshida, M., Horinouchi, S., 1999. Leptomycin B inactivates CRM1/exportin 1 by covalent modification at a cysteine residue in the central conserved region. Proc. Natl. Acad. Sci. U. S. A. 96, 9112–7. https://doi.org/10.1073/pnas.96.16.9112 Kuersten, S., Goodwin, E.B., 2003. The power of the 3’ UTR: translational control and development. Nat. Rev. Genet. 4, 626–637. https://doi.org/10.1038/nrg1125 Kugler, J.M., Lasko, P., 2009. Localization, anchoring and translational control of oskar, gurken, bicoid and nanos mRNA during drosophila oogenesis. Fly (Austin). https://doi.org/10.4161/fly.3.1.7751 Kusek, G., Campbell, M., Doyle, F., Tenenbaum, S.A., Kiebler, M., Temple, S., 2012. Asymmetric segregation of the double-stranded RNA binding protein Staufen2 during mammalian neural stem cell divisions promotes lineage progression. Cell Stem Cell 11, 505–516. https://doi.org/10.1016/j.stem.2012.06.006 Lebeau, G., Maher-Laporte, M., Topolnik, L., Laurent, C.E., Sossin, W., Desgroseillers, L., Lacaille, J.C., 2008. Staufen1 regulation of protein synthesis-dependent long-term potentiation and synaptic function in hippocampal pyramidal cells. Mol Cell Biol 28, 2896– 2907. https://doi.org/10.1128/mcb.01844-07 Lebeau, G., Miller, L.C., Tartas, M., McAdam, R., Laplante, I., Badeaux, F., DesGroseillers, L., Sossin, W.S., Lacaille, J.-C., 2011. Staufen 2 regulates mGluR long-term depression and Map1b mRNA distribution in hippocampal neurons. Learn. Mem. 18, 314–26. https://doi.org/10.1101/lm.2100611 Lendahl, U., Zimmerman, L.B., McKay, R.D., 1990. CNS stem cells express a new class of intermediate filament protein. Cell 60, 585–595. https://doi.org/10.1016/0092- 8674(90)90662-X Li, P., Yang, X., Wasser, M., Cai, Y., Chiat, W., 1997. Inscuteable and staufen mediate asymmetric localization and segregation of prospero RNA during drosophila neuroblast cell divisions. Cell 90, 437–447. https://doi.org/10.1016/S0092-8674(00)80504-8 Lykke-Andersen, J., Shu, M. Di, Steitz, J.A., 2000. Human Upf proteins target an mRNA for nonsense-mediated decay when downstream of a termination codon. Cell 103, 1121–1131. https://doi.org/10.1016/S0092-8674(00)00214-2 Maquat, L.E., Tarn, W.Y., Isken, O., 2010. The pioneer round of translation: Features and

65 functions. Cell. https://doi.org/10.1016/j.cell.2010.07.022 Marín, O., Valiente, M., Ge, X., Tsai, L.H., 2010. Guiding neuronal cell migrations. Cold Spring Harb. Perspect. Biol. https://doi.org/10.1101/cshperspect.a001834 Martel, C., Macchi, P., Furic, L., Kiebler, M.A., Desgroseillers, L., 2006. Staufen1 is imported into the nucleolus via a bipartite nuclear localization signal and several modulatory determinants. Biochem. J. 393, 245–254. https://doi.org/10.1042/BJ20050694 Monshausen, M., Gehring, N.H., Kosik, K.S., 2004. The mammalian RNA-binding protein Staufen2 links nuclear and cytoplasmic RNA processing pathways in neurons. Neuromolecular Med. 6, 127–44. https://doi.org/10.1385/NMM:6:2-3:127 Moon, B.S., Bai, J., Cai, M., Liu, C., Shi, J., Lu, W., 2018. Kruppel-like factor 4-dependent Staufen1-mediated mRNA decay regulates cortical neurogenesis. Nat. Commun. https://doi.org/10.1038/s41467-017-02720-9 Morrison, S.J., Kimble, J., 2006. Asymmetric and symmetric stem-cell divisions in development and cancer. Nature 441, 1068–1074. https://doi.org/10.1038/nature04956 Noctor, S.C., Flint, A.C., Weissman, T.A., Dammerman, R.S., Kriegstein, A.R., 2001. Neurons derived from radial glial cells establish radial units in neocortex. Nature 409, 714–720. https://doi.org/Doi 10.1038/35055553 Noctor, S.C., Martínez-Cerdeño, V., Ivic, L., Kriegstein, A.R., Martinez-Cerdeno, V., Ivic, L., Kriegstein, A.R., 2004. Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat Neurosci 7, 136–144. https://doi.org/10.1038/nn1172 Park, E., Gleghorn, M.L., Maquat, L.E., 2013. Staufen2 functions in Staufen1-mediated mRNA decay by binding to itself and its paralog and promoting UPF1 helicase but not ATPase activity. Proc. Natl. Acad. Sci. 110, 405–412. https://doi.org/10.1073/pnas.1213508110 Park, E., Maquat, L.E., 2013. Staufen-mediated mRNA decay. Wiley Interdiscip. Rev. RNA 4, 423–435. https://doi.org/10.1002/wrna.1168 Perlman, R.L., 2016. Mouse Models of Human Disease: An Evolutionary Perspective. Evol. Med. Public Heal. https://doi.org/10.1093/emph/eow014 Radakovits, R., Barros, C.S., Belvindrah, R., Patton, B., Müller, U., 2009. Regulation of radial glial survival by signals from the meninges. J. Neurosci. 29, 7694–705. https://doi.org/10.1523/JNEUROSCI.5537-08.2009 Rakic, P., 1990. Principles of neural cell migration. Experientia 46, 882–891. https://doi.org/10.1007/BF01939380 Ravel-Chapuis, A., Bélanger, G., Yadava, R.S., Mahadevan, M.S., DesGroseillers, L., Côté, J., Jasmin, B.J., 2012. The RNA-binding protein Staufen1 is increased in DM1 skeletal muscle and promotes alternative pre-mRNA splicing. J. Cell Biol. 196, 699–712. https://doi.org/10.1083/jcb.201108113 Reif, A., Schmitt, A., Fritzen, S., Lesch, K.P., 2007. Neurogenesis and schizophrenia: Dividing neurons in a divided mind? Eur. Arch. Psychiatry Clin. Neurosci. 257, 290–299. https://doi.org/10.1007/s00406-007-0733-3

66 Rongo, C., Gavis, E.R., Lehmann, R., 1995. Localization of oskar RNA regulates oskar translation and requires Oskar protein. Development. Siolas, D., Lerner, C., Burchard, J., Ge, W., Linsley, P.S., Paddison, P.J., Hannon, G.J., Cleary, M.A., 2005. Synthetic shRNAs as potent RNAi triggers. Nat. Biotechnol. https://doi.org/10.1038/nbt1052 Södersten, E., Lilja, T., Hermanson, O., 2010. The novel BTB/POZ and zinc finger factor Zbtb45 is essential for proper glial differentiation of neural and oligodendrocyte progenitor cells. Cell Cycle. https://doi.org/10.4161/cc.9.24.14154 Spirov, A., Fahmy, K., Schneider, M., Frei, E., Noll, M., Baumgartner, S., 2009. Formation of the bicoid morphogen gradient: an mRNA gradient dictates the protein gradient. Development. https://doi.org/10.1242/dev.031195 Telser, A., 2002. Molecular Biology of the Cell, 4th Edition. Shock. https://doi.org/10.1097/00024382-200209000-00015 Tsui, D., Vessey, J.P., Tomita, H., Kaplan, D.R., Miller, F.D., 2013. FoxP2 Regulates Neurogenesis during Embryonic Cortical Development. J. Neurosci. 33, 244–258. https://doi.org/10.1523/JNEUROSCI.1665-12.2013 Tsui, D., Voronova, A., Gallagher, D., Kaplan, D.R., Miller, F.D., Wang, J., 2014. CBP regulates the differentiation of interneurons from ventral forebrain neural precursors during murine development. Dev. Biol. 385, 230–241. https://doi.org/10.1016/j.ydbio.2013.11.005 Turner, M., DÍaz-Muñoz, M.D., 2018. RNA-binding proteins control gene expression and cell fate in the immune system review-article. Nat. Immunol. https://doi.org/10.1038/s41590- 017-0028-4 Van den Ameele, J., Tiberi, L., Vanderhaeghen, P., Espuny-Camacho, I., 2014. Thinking out of the dish: What to learn about cortical development using pluripotent stem cells. Trends Neurosci. https://doi.org/10.1016/j.tins.2014.03.005 Vessey, J.P., Amadei, G., Burns, S.E., Kiebler, M.A., Kaplan, D.R., Miller, F.D., 2012. An asymmetrically localized Staufen2-dependent RNA complex regulates maintenance of mammalian neural stem cells. Cell Stem Cell 11, 517–528. https://doi.org/10.1016/j.stem.2012.06.010 Vessey, J.P., Macchi, P., Stein, J.M., Mikl, M., Hawker, K.N., Vogelsang, P., Wieczorek, K., Vendra, G., Riefler, J., Tübing, F., Aparicio, S. a J., Abel, T., Kiebler, M. a, 2008. A loss of function allele for murine Staufen1 leads to impairment of dendritic Staufen1-RNP delivery and dendritic spine morphogenesis. Proc. Natl. Acad. Sci. U. S. A. 105, 16374–9. https://doi.org/10.1073/pnas.0804583105 Wegiel, J., Kuchna, I., Nowicki, K., Imaki, H., Wegiel, J., Marchi, E., Ma, S.Y., Chauhan, A., Chauhan, V., Bobrowicz, T.W., De Leon, M., Louis, L.A. Saint, Cohen, I.L., London, E., Brown, W.T., Wisniewski, T., 2010. The neuropathology of autism: Defects of neurogenesis and neuronal migration, and dysplastic changes. Acta Neuropathol. 119, 755– 770. https://doi.org/10.1007/s00401-010-0655-4 Wickham, L., Duchaîne, T., Luo, M., Nabi, I.R., DesGroseillers, L., 1999. Mammalian Staufen Is a Double-Stranded-RNA- and Tubulin-Binding Protein Which Localizes to the Rough

67 Endoplasmic Reticulum. Mol. Cell. Biol. https://doi.org/10.1128/MCB.19.3.2220 Yamamizu, K., Piao, Y., Sharov, A.A., Zsiros, V., Yu, H., Nakazawa, K., Schlessinger, D., Ko, M.S.H., 2013. Identification of transcription factors for lineage-specific ESC differentiation. Stem Cell Reports. https://doi.org/10.1016/j.stemcr.2013.10.006 Yang, G., Smibert, C.A., Kaplan, D.R., Miller, F.D., 2014. An eIF4E1/4E-T complex determines the genesis of neurons from precursors by translationally repressing a proneurogenic transcription program. Neuron 84, 723–739. https://doi.org/10.1016/j.neuron.2014.10.022 Zander, M.A., Burns, S.E., Yang, G., Kaplan, D.R., Miller, F.D., 2014. Snail coordinately regulates downstream pathways to control multiple aspects of mammalian neural precursor development. J. Neurosci. 34, 5164–75. https://doi.org/10.1523/JNEUROSCI.0370-14.2014 Zhadanov, A.B., Provance, D.W., Speer, C.A., Coffin, J.D., Goss, D., Blixt, J.A., Reichert, C.M., Mercer, J.A., 1999. Absence of the tight junctional protein AF-6 disrupts epithelial cell-cell junctions and cell polarity during mouse development. Curr. Biol. 9, 880–888. https://doi.org/10.1016/S0960-9822(99)80392-3 Zhang, J., Jiao, J., 2015. Molecular Biomarkers for Embryonic and Adult Neural Stem Cell and Neurogenesis. Biomed Res. Int. https://doi.org/10.1155/2015/727542

68 Appendix: Supplementary Data

80 100 SatB2 Positive A TBR2 Positive B SatB2 Negative 80 TBR2 Negative60 60 100 80 40 TBR2 Positive SatB2 Positive 40 80 TBR2 Negative SatB2 Negative 60

%SatB2/nGFP+ 20 %TBR2/nGFP+ 20 60 0 40 0 40 Ctrl Ctrl shStau1 %TBR2/nGFP+

%SatB2/nGFP+ 20 20 shStau1

0 0

Ctrl Ctrl shStau1 shStau1

Figure 5.1. Knock-down of Stau1 in-utero produces no observable change in neurogenesis. Sections of in-utero brains were stained and quantified for nGFP+ as a marker of transfection, in

addition to cortical cell markers. A) Tbr2 was quantified to measure changes in IPCs or B) Satb2

as a marker for neurons between control or shStau1 conditions. A: Ctrl n=3 and shStau1 n=2 B:

Ctrl n=3 and shStau1 n=1. All data is presented as +/- SEM.

A Cortical Plate B Upper VZ Intermediate Zone Lower VZ Ventricular Zone 40 * 60

30 40 20

20 %GFP+ Cells

%GFP+ Cells 10

0 0 Ctrl Ctrl shStau1 shStau1

Figure 5.2. Knock-down of Stau1 in-utero produces changes in the positioning of transfected cells within the cortical layers.

Sections of in-utero brains were stained and quantified for nGFP+ as a marker of transfection relative to their position in the cortex. A) nGFP+ cells were quantified relative to their global position within the three cortical layers between control and shStau1 treated brains B) VZ was divided into two equal parts and nGFP+ cells were quantified relative to their position within the upper or lower ventricular zone. Control n=6 and shStau1 n=3. All data is presented as +/- SEM.

* represents p<0.05

Table 1. Primary Antibodies

Western Immuno- Immuno- Antigen Host Company blotting cytochemistry histochemistry Nestin Mouse R&D Systems 1:500 1:200 ßIII- 1:2000 1:4000 Mouse Biolegend tubulin Sox2 Mouse Abcam 1:250 SatB2 Mouse Abcam 1:250 GFP Chicken Abcam 1:1000 1:1000 Stau1 Rabbit Abcam 1:2000 1:250 1:100 FLAG Mouse Sigma 1:5000 Histone H3 Rabbit Abcam 1:1000 MAP2 Mouse Abcam 1:1000 Tbr2 Rabbit Abcam 1:200 1:100

shRNA Sequence (Origene, TG513920) shStau1: CAGAGATGCCAAGAACAGGAAATGGACCA

Table 2. Primer Sequences

Primer Forward Reverse Stau1 GGACCCTCACTCTCGGATG TTCTGGCAGGGGTTCACTCT Nestin CCCTGAAGTCGAGGAGCTG CTGCTGCACCTCTAAGCGA ßIII-tubulin TAGACCCCAGCGGCAACTAT GTTCCAGGTTCCAAGTCCACC