Intracellular Occurrence of Ε-Proteobacterial 16S Rdna Sequences in the Vestimentiferan Trophosome

Journal of Oceanography, Vol. 53, pp. 193 to 197. 1997

Intracellular Occurrence of ε-Proteobacterial 16S rDNA Sequences in the Vestimentiferan Trophosome

1,2 2 2 3 2 TAKESHI NAGANUMA , CHIAKI K ATO , HISAKO H IRAYAMA , NOBUO M ORIYAMA , JUN H ASHIMOTO 2 and KOKI HORIKOSHI

1Faculty of Applied Biological Science, Hiroshima University, 1-4-4 Kagamiyama, Higashi-Hiroshima 739, Japan 2Japan Marine Science and Technology Center, Yokosuka 237, Japan 3Department of Urology, Faculty of Medicine, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan

(Received 17 July 1996; in revised form 1 September 1996; accepted 23 September 1996)

Endosymbionts of vestimentiferan tubeworms are generally thought to be γ-Proteobacterial Keywords: sulfur oxidizers. We have identified two novel 16S ribosomal RNA genes (rDNA), ⋅ Vestimentifera, presumably of ε-Proteobacteria, from the trophosome content of a vestimentiferan ⋅ tubeworm, ⋅ symbiotic, tubeworm. Phylogenetic analysis suggested that the 16S rDNAs were closely related to ⋅ those of Arcobacter, most of which are known to be associated with animal hosts but are bacteria, ⋅ Arcobacter, non-chemosynthetic. Intracellular localizations of the 16S rDNAs were confirmed by in ⋅ ε-Proteobacteria. situ hybridization using their specific probes. This is the first report of ε-Proteobacterial 16S rDNAs associated with a vestimentiferan tubeworm.

1. Introduction 2. Materials and Methods Vestimentiferan tubeworms typically inhabit sulfide- and methane-rich environments such as hydrothermal vents 2.1 Tubeworm collection and DNA extraction and cold seeps. The worms have a unique strategy of life, in Individuals of Lamellibrachia sp. were collected from which they lack digestive organs but harbor chemoautotro- a methane seep, 1167 to 1170 m deep, in Sagami Bay, Japan phic (mainly thiotrophic) bacteria in a specialized tissue, the (Masuzawa et al., 1992), during the 722nd dive by the trophosome (Fisher, 1990). Reportedly more than 3 × 109 submersible Shinkai 2000 of the Japan Marine Science and bacteria were packed in 1 g (wet) of trophosome of a Technology Center. Immediately after retrieval, fresh tubeworm, Riftia pachyptila (Cavanaugh et al., 1981). trophosome specimens were fixed with 4% paraformalde- Trophosome mass, in turn, accounts for 40 to 60% of total hyde in phosphate-buffered saline (PBS, pH 7.4), in worm bodymass (Felbeck and Childress, 1988), which makes preparation for in situ hybridization. After one week, fixed the worm a chemoautotrophic animal. trophosomes were dehydrated in ethanol, and embedded in Microscopic observations suggested more than one paraffin. Immediately after tubeworm collection, part of the endosymbiont morphotype for vestimentiferan worms specimens were frozen and stored at Ð80°C until DNA (Cavanaugh et al., 1981; de Burgh et al., 1989; Fisher, 1990) extraction. Trophosome content was aseptically extracted and a gutless annelid (Dubilier et al., 1995). However, and centrifuged at 10,000 × g for 15 min. The pellets were morphotypes were often ascribed to pleomorphism of a treated with lysozyme and proteinase K. High molecular single species. Ribosomal RNA analyses suggested that the mass DNA was isolated from the lysate and purified by trophosomal endosymbionts are monospecific, or at least anion exchange column chromatography using ASAP 90% homogeneous, and related to chemoautotrophic sulfur- Genomic DNA Isolation Kit (Boehringer-Mannheim), in oxidizing bacteria (Stahl et al., 1984; Distel et al., 1988; preparation for DNA amplification by the polymerase chain Dubilier et al., 1995). In contrast, we have identified more reaction (PCR). Phenol/chloroform extraction resulted in than one 16S rDNA sequence from the trophosome content DNA of poor quality, due to organic contaminants. of the vestimentiferan tubeworm Lamellibrachia sp. This communication reports the intracellular localizations of the 2.2 Amplification, cloning and sequencing of 16S rDNA 16S rDNA sequences and their phylogenetic relation to About 1.4 kb fragments of 16S rDNA were amplified Arcobacter, a member of the epsilon subdivision of by PCR with Taq polymerase using the primers of Eubac27F Proteobacteria (ε-Proteobacteria). (AGAGTTTGATCCTGGCTCAG) and 1492R

193 Copyright  The Oceanographic Society of Japan. Fig. 1. Unrooted dendrogram showing the phylogenetic positions of the 16S rDNA sequences, TW-1 and TW-2, retrieved from the tissue of the vestimentiferan tubeworm Lamellibrachia sp. The source of other bacterial 16S rDNA sequences are shown in parentheses (EMBL/GenBank accession numbers).

Fig. 2. In situ hybridization to localize symbiotic 16S rDNAs in the cross-sections of the vestimentiferan tubeworm Lamellibrachia sp. Top left, a cross-section of trophosome stained with hematoxylin-eosin. Lobular intrastructure of the trophosome is shown. Top right, negative control with an antisense probe from the human prostate-specific antigen gene. Bottom left, hybrids of the symbiont- specific probe TW-1R localized in periphery of inner lobules. Bottom right, hybrids of the symbiont-specific probe TW-2R localized in periphery of inner and outer lobules. Scale bars, 50 µm.

194 T. Naganuma et al. (GGTTACCTTGTTACGACTT) (DeLong, 1992). An ini- 3. Results and Discussion tial step of 94°C for 1.5 min was followed by 40 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min. The 3.1 Analysis of 16S rDNA sequence PCR amplicons were blunt-ended with Klenow polymerase The 16S rDNA-based analysis has been widely ac- and ligated to an Eco RV-digested pBluescript II plasmid cepted in bacterial taxonomy and phylogenetics (Woese, (Stratagene). E. coli SURE cells (Stratagene) were trans- 1987), and a number of 16S ribosomal data are being formed with ligated plasmid. DNA from selected recombinant integrated in the Ribosomal Database Project (RDP; Maidak colonies was sequenced by the dideoxy cycle-sequencing et al., 1994). On the basis of the on-going trend, the amplified method using a model 373A DNA sequencer (Applied 16S rDNA fragments were cloned and sequenced. Two of a Biosystems, Inc.). Sequences of two different 16S rDNA total of 20 clones were successfully sequenced and related amplicons, designated TW-1 and TW-2, were determined. to a novel bacterial group in association with vestimentiferan tubeworms. The other cloned sequences are being analysed, 2.3 Design and labeling of specific probes but they are unlikely to be in close relation with the two Sequence-specific oligonucleotide probes for TW-1 clones; the sequences of the other clones will be reported and TW-2 were designed based on the TW-1 and TW-2 elsewhere. sequences and other endosymbiotic 16S rDNA sequences Two 16S rDNA sequences in intracellular association (shown in Fig. 1). A TW-1-specific probe (TW-1R) with a vestimentifera were sequenced and designated as TTTCCAGGCCCGAAGGC (antisense to the E. coli 16S TW-1 and TW-2 (EMBL/GenBank accession numbers are rDNA position from 1042 to 1025) and a TW-2-specific D83060 and D83061). The matching between TW-1 and probe (TW-2R) AGAAGCTTTAGTAAACTA (antisense TW-2 was 95%, which suggests that the two belong to to the E. coli 16S rDNA position from 1041 to 1024) were different species but the same genus. Both TW-1 and TW- synthesized on an Applied Biosystems automated DNA 2 were most closely related to Arcobacter nitrofigilis (87Ð synthesizer. The oligonucleotide probes were then purified 88% matching), and to those of A. cryaerophilus and A. on 20% polyacrylamide gels and recovered by elution. In butzlerii (86Ð88% matching), all of which fell in the epsilon addition, a negative probe was designed from the human subgroup of the class Proteobacteria, or ε-Proteobacteria prostate-specific antigen gene (EMBL/GenBank X14810) (Vandamme et al., 1991). An unrooted dendrogram based that has been found only in primates. The sequence of the on the neighbor-joining method (Saitou and Nei, 1987) was negative probe was CGAGATGCTATACTCGGAGG- constructed to position TW-1 and TW-2 in comparison with ACTTCTTAGCTAAGGAGTCC, antisense to the base the Arcobacter-Campylobacter-Helicobacter cluster and positions 3477 to 3763 of the gene. The specific and nega- other chemosynthetic symbionts (Fig. 1). tive probes were labeled enzymatically with digoxygenin- 11-dUTP by terminal deoxynucleotidyl transferase 3.2 In situ localization (Boehringer-Mannheim). Intracellular localization of ε-Proteobacterial 16S rDNA sequences, TW-1 and TW-2, was demonstrated by in situ 2.4 In situ hybridization hybridization, but it does not exclude the possibility of the The intracellular localizations of TW-1 and TW-2 were presence of other true endosymbionts such as sulfur-oxidizing confirmed by in situ hybridization (Heiles et al., 1988) on γ-Proteobacteria. Sulfur oxidizers would have been domi- cross-sections of tubeworm trophosome, according to the nant as previously reported (Stahl et al., 1984; Distel et al., method of Cary et al. (1993). Prior to hybridization, serial 1988; Dubilier et al., 1995); their occurrence in our cross-sections were cut from the paraffin-embedded vestimentiferans will be discussed elsewhere. trophosomes, deparaffinized in xylene, rehydrated in 100% Vestimentiferan trophosome had lobular intrastructure, ethanol, treated with proteinase K, and pre-heated to 100°C and TW-1R hybrid and TW-2R hybrid were detected in the for 5 min. Digoxygenin-labeled probes (see above) were periphery of the lobules (Fig. 2). TW-1R hybrid was localized added to sections and incubated for 18 h at 45°C. Hybrids in inner lobules, while TW-2R hybrid was detected in inner were detected by immunostaining with anti-digoxygenin- and outer lobules. The peripheral localization of symbiont- alkaline phosphatase, and visualized with the coloring specific hybrids was previously reported with the substrates of 5-bromo-4-chloro-3-indolyl phosphate and vestimentiferan worm Riftia piscesae (Cary et al., 1993). In nitro blue tetrazolium (Hötke et al., 1990). For reference, the HE-stained section, several morphotypes (globules, other serial cross-sections were stainedby the standard ovoids, rods and threads; Naganuma et al., 1996) were ob- double-staining method with a dye mixture of hematoxylin served, while the positive hybridization was restricted to and eosin (HE, Fig. 2; Dealtry and Rickwood, 1992). globules and ovoids (Fig. 2). TW-1R hybrid was detected in slightly ovoid particles, while TW-2R hybrid was localized in association with the smaller globules (4 to 5 µm). Sepa- rate localization of hybrids to different morphotypes sug-

Intracellular ε-Proteobacteria in a Vestimentiferan Tubeworm 195 gests that the TW-1 and TW-2 were from different bacterial DeLong, E. F. (1992). Archaea in coastal marine environments. species though they were closely related to each other. Proc. Natl. Acad. Sci. USA, 89, 5685Ð5689. Distel, D. L., D. J. Lane, G. J. Olsen, S. J. Giovannoni, B. Pace, N. 3.3 ε-Proteobacteria and tubeworms R. Pace, D. A. Stahl and H. Felbeck (1988): Sulfur-oxidizing Other than those from vestimentiferan worms, ε- bacterial endosymbionts: analysis of phylogeny and specificity by 16S rRNA sequences. J. Bacteriol., 170, 2506Ð2510. Proteobacterial 16S rDNAs have recently been reported to Distel, D. L., H. K.-W. Lee and C. M. Cavanaugh (1995): Intra- predominate among the epibiotic microflora associated with cellular coexistence of methano- and thioautotrophic bacteria rocks and animals at hydrothermal vents (Haddad et al., 1995; in a hydrothermal vent mussel. Proc. Natl. Acad. Sci. USA, 92, Moyer et al., 1995; Polz and Cavanaugh, 1995), including a 9598Ð9602. tube-dwelling vent polychaete. Vent polychaetes are phy- Dubilier, N., O. Giere, D. L. Distel and C. M. Cavanaugh (1995): logenetically close to and often share an ecological niche Characterization of chemoautotrophic bacterial symbionts in with vestimentiferan worms. Thus, it does not seem surprising a gutless marine worm (Oligochaeta, Annelida) by phyloge- that ε-Proteobacteria were in intracellular association with netic 16S rDNA sequence analysis and in situ hybridization. a vestimentiferan worm, even though the association of ε- Appl. Environ. Microbiol., 61, 2346Ð2350. Proteobacteria and vent polychaetes was epibiotic, not Felbeck, H. and J. J. Childress (1988): Riftia pachyptila: a highly necessarily endosymbiotic (Haddad et al., 1995). integrated symbiosis. Oceanol. Acta, 8, 131Ð138. Fisher, C. R. (1990). Chemoautotrophic and methanotrophic Vestimentiferan worms are known to bear sulfur-oxi- γ symbioses in marine invertebrates. Aquat. Sci., 2, 399Ð436. dizing endosymbionts that are presumed to belong to - Haddad, A., F. Camacho, P. Durand and S. C. Cary (1995): ε Proteobacteria (Distel et al., 1988). Sulfur-oxidation by - Phylogenetic characterization of the epibiotic bacteria associ- Proteobacteria is known for free-living Thiovulum sp. ated with the hydrothermal vent polychaete Alvinella (Wirsen and Jannasch, 1978). Some other ε-Proteobacterial pompejana. Appl. Environ. Microbiol., 61, 1679Ð1687. species were reported to be capable of reducing sulfate and Heiles, H. B. J., E. Genersch, C. Kessler, R. Neumann and H. J. sulfur, i.e. sulfide production (Vandamme et al., 1991; Rainey Eggers (1988): In situ hybridization with digoxigenin-labeled et al., 1993). Intracellular association of ε-Proteobacterial 16S DNA of human papilloma viruses (HPV 16/18) in HeLa and rDNAs with vestimentiferan trophosome suggests that ε- SiHa cells. BioTechniques, 6, 978Ð981. Proteobacteria are involved in multiple metabolic pathways Hötke, H.-J., R. Seibl, J. Burg, K. Mühlegger and C. Kessler regarding sulfur oxidation and/or reduction. This multiple (1990). Nonradioactive labeling and detection of nucleic acids: II. Optimization of the digoxigenin system. Biol. Chem. metabolism may support the intracellular microbial pro- Hopper-Seyler, 371, 929Ð938. duction, as shown for a pogonophoran tubeworm and a vent Maidak, B. L., N. Larsen, M. J. McCaughey, R. Overbeek, G. J. mussel (Schmaljohann et al., 1990; Distel et al., 1995). Olse, K. Fogel, J. Blandy and C. R. Woese (1994): The ribosomal database project. Nucleic Acids Res., 22, 3485Ð3487. Acknowledgements Masuzawa, T., N. Handa, H. Kitagawa and M. Kusakabe (1992): We are obliged to the operation teams of the DSV Sulfate reduction using methane in sediments beneath a bathyal Shinkai 2000 and the ROV Dolphin 3K, and the crew of the “cold seep” giant clam community off Hatsushima Island, RV Natsushima, for their assistance and expertise. We thank Sagami Bay, Japan. Earth Planet. Sci. Lett., 110, 39Ð50. M. Yoshida for kindly collecting the tubeworm samples, Moyer, C. L., F. C. Dobbs and D. M. Karl (1995): Phylogenetic and two anonymous referees for helpful comments on the diversity of the bacterial community from a microbial mat at manuscript. This work was partly supported by a Grant-in- an active, hydrothermal vent system, Loihi Seamount, Hawaii. Appl. Environ. Microbiol., 61, 1555Ð1562. Aid from the Ministry of Education, Science, and Culture of Naganuma, T., J. Naka, Y. Okayama, A. Minami and K. Horikoshi Japan (No. 07556140). (1996): Multiformity of the microbial population in a vestimentiferan tubeworm. J. Mar. Biotechnol., 4 (in press). References Polz, M. F. and C. M. Cavanaugh (1995): Dominance of one Cary, S. C., W. Warren, E. Anderson and S. J. Giovannoni (1993): bacterial phylotype at a Mid-Atlantic Ridge hydrothermal Identification and localization of bacterial endosymbionts in vent site. Proc. Natl. Acad. Sci. USA, 92, 7232Ð7236. hydrothermal vent taxa with symbiont-specific polymerase Rainey, F. A., R. Toalster and E. Stackerbrandt (1993): Desulfurella chain reaction amplification and in situ hybridization tech- acetivorans, a thermophilic, acetate-oxidizing and sulfur-re- niques. Molec. Mar. Biol. Biotechnol., 2, 51Ð62. ducing organisms, represents a distinct lineage within the Cavanaugh, C. M., S. L. Gardiner, M. L. Jones, H. W. Jannasch Proteobacteria. Syst. Appl. Microbiol., 16, 373Ð379. and J. B. Waterbury (1981): Prokaryotic cells in the hydro- Saitou, N. and M. Nei (1987): The neighbor-joining method: a thermal vent tube worm, Riftia pachyptila: possible chemo- new method for reconstructing phylogenetic trees. Mol. Biol. autotrophic symbionts. Science, 213, 340Ð342. Evol., 4, 406Ð425. de Burgh, M. E., S. K. Juniper and C. L. Singla (1989): Bacterial Schmaljohann, R., E. Faber, M. J. Whiticar and P. R. Dando symbionts in Northeast Pacific vestimentifera: a TEM study. (1990): Co-existence of methane- and sulphur-based endo- Mar. Biol., 101, 97Ð105. symbioses between bacteria and invertebrates at a site in the Dealtry, G. B. and D. Rickwood (eds.) (1992): Cell Biology Labfax. Skagerrak. Mar. Ecol. Prog. Ser., 61, 119Ð124. BIOS Scientific Publishers, Oxford, 254 pp.

196 T. Naganuma et al. Stahl, D. A., D. J. Lane, G. J. Olsen and N. R. Pace (1984): netic descriptions and proposal of Arcobacter gen. nov. Int. J. Analysis of hydrothermal vent-associated symbionts by ri- Syst. Bacteriol., 41, 88Ð103. bosomal RNA sequences. Science, 224, 409Ð411. Wirsen, C. O. and H. W. Jannasch (1978): Physiological and Vandamme, P., E. Falsen, R. Rossau, B. Hoste, P. Segers, R. morphological observations on Thiovulum sp. J. Bacteriol., Tytgat and J. De Ley (1991): Revision of Campylobacter, 136, 765Ð774. Helicobacter, and Wolinella Taxonomy: emendation of ge- Woese, C. R. (1987): Bacterial evolution. Microbiol. Rev., 51, 221Ð271.

Intracellular ε-Proteobacteria in a Vestimentiferan Tubeworm 197