DOT1L-Mediated Murine Neuronal Differentiation Associates with H3k79me2 Accumulation and Preserves SOX2-Enhancer Accessibility
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Transcriptomic Analysis of Pluripotent Stem Cells: Insights Into Health and Disease Jia-Chi Yeo1,2 and Huck-Hui Ng1,2,3,4,5,*
Yeo and Ng Genome Medicine 2011, 3:68 http://genomemedicine.com/content/3/10/68 REVIEW Transcriptomic analysis of pluripotent stem cells: insights into health and disease Jia-Chi Yeo1,2 and Huck-Hui Ng1,2,3,4,5,* Abstract types, termed ‘pluripotency’, allows researchers to study early mammalian development in an artificial setting and Embryonic stem cells (ESCs) and induced pluripotent offers opportunities for regenerative medicine, whereby stem cells (iPSCs) hold tremendous clinical potential ESCs could generate clinically relevant cell types for because of their ability to self-renew, and to tissue repair. However, this same malleability of ESCs dierentiate into all cell types of the body. This unique also renders it a challenge to obtain in vitro differentiation capacity of ESCs and iPSCs to form all cell lineages of ESCs to specific cell types at high efficacy. erefore, is termed pluripotency. While ESCs and iPSCs are harnessing the full potential of ESCs requires an in-depth pluripotent and remarkably similar in appearance, understanding of the factors and mechanisms regulating whether iPSCs truly resemble ESCs at the molecular ESC pluripotency and cell lineage decisions. level is still being debated. Further research is therefore Early studies on ESCs led to the discovery of the core needed to resolve this issue before iPSCs may be safely pluripotency factors Oct4, Sox2 and Nanog [1], and, applied in humans for cell therapy or regenerative increasingly, the use of genome-level screening assays has medicine. Nevertheless, the use of iPSCs as an in vitro revealed new insights by uncovering additional trans- human genetic disease model has been useful in cription factors, transcriptional cofactors and chromatin studying the molecular pathology of complex genetic remodeling complexes involved in the maintenance of diseases, as well as facilitating genetic or drug screens. -
2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins ............................................................................................................. -
Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients. -
The Histone Methyltransferase DOT1L Prevents Antigen-Independent
bioRxiv preprint doi: https://doi.org/10.1101/826255; this version posted November 18, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The histone methyltransferase DOT1L prevents antigen-independent differentiation and safeguards epigenetic identity of CD8+ T cells Eliza Mari Kwesi-Maliepaard1*, Muhammad Assad Aslam2,3*, Mir Farshid Alemdehy2*, Teun van den Brand4, Chelsea McLean1, Hanneke Vlaming1, Tibor van Welsem1, Tessy Korthout1, Cesare Lancini1, Sjoerd Hendriks1, Tomasz Ahrends5, Dieke van Dinther6, Joke M.M. den Haan6, Jannie Borst5, Elzo de Wit4, Fred van Leeuwen1,7,#, and Heinz Jacobs2,# 1Division of Gene Regulation, Netherlands Cancer Institute, 1066CX Amsterdam, The Netherlands 2Division of Tumor Biology & Immunology, Netherlands Cancer Institute, 1066CX Amsterdam, The Netherlands 3Institute of Molecular Biology and Biotechnology, Bahauddin Zakariya University, 60800 Multan, Pakistan 4Division of Gene Regulation, Netherlands Cancer Institute, 1066CX Amsterdam, and Oncode Institute, The Netherlands 5Division of Tumor Biology & Immunology, Netherlands Cancer Institute, 1066CX Amsterdam, and Oncode Institute, The Netherlands 6Department of Molecular Cell Biology and Immunology, Amsterdam UMC, Location VUmc, 1081HV Amsterdam, The Netherlands 7Department of Medical Biology, Amsterdam UMC, location AMC, UvA, 1105 AZ Amsterdam, The Netherlands * These authors contributed equally to this work. # Equal contribution and corresponding authors [email protected]; [email protected] Lead contact: Fred van Leeuwen 1 bioRxiv preprint doi: https://doi.org/10.1101/826255; this version posted November 18, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Gene Expression Profile in Different Age Groups and Its Association With
cells Article Gene Expression Profile in Different Age Groups and Its Association with Cognitive Function in Healthy Malay Adults in Malaysia Nur Fathiah Abdul Sani 1 , Ahmad Imran Zaydi Amir Hamzah 1, Zulzikry Hafiz Abu Bakar 1 , Yasmin Anum Mohd Yusof 2, Suzana Makpol 1 , Wan Zurinah Wan Ngah 1 and Hanafi Ahmad Damanhuri 1,* 1 Department of Biochemistry, Faculty of Medicine, Universiti Kebangsaan Malaysia Medical Center, Jalan Yaacob Latif, Cheras, Kuala Lumpur 56000, Malaysia; [email protected] (N.F.A.S.); [email protected] (A.I.Z.A.H.); zulzikryhafi[email protected] (Z.H.A.B.); [email protected] (S.M.); [email protected] (W.Z.W.N.) 2 Faculty of Medicine and Defence Health, National Defence University of Malaysia, Kem Sungai Besi, Kuala Lumpur 57000, Malaysia; [email protected] * Correspondence: hanafi[email protected] Abstract: The mechanism of cognitive aging at the molecular level is complex and not well under- stood. Growing evidence suggests that cognitive differences might also be caused by ethnicity. Thus, this study aims to determine the gene expression changes associated with age-related cognitive decline among Malay adults in Malaysia. A cross-sectional study was conducted on 160 healthy Malay subjects, aged between 28 and 79, and recruited around Selangor and Klang Valley, Malaysia. Citation: Abdul Sani, N.F.; Amir Gene expression analysis was performed using a HumanHT-12v4.0 Expression BeadChip microarray Hamzah, A.I.Z.; Abu Bakar, Z.H.; kit. The top 20 differentially expressed genes at p < 0.05 and fold change (FC) = 1.2 showed that Mohd Yusof, Y.A.; Makpol, S.; Wan PAFAH1B3, HIST1H1E, KCNA3, TM7SF2, RGS1, and TGFBRAP1 were regulated with increased Ngah, W.Z.; Damanhuri, H.A. -
Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007). -
Accompanies CD8 T Cell Effector Function Global DNA Methylation
Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M. -
Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002) -
POU Domain Family Values: Flexibility, Partnerships, and Developmental Codes
Downloaded from genesdev.cshlp.org on October 1, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW POU domain family values: flexibility, partnerships, and developmental codes Aimee K. Ryan and Michael G. Rosenfeld 1 Howard Hughes Medical Institute, Department and School of Medicine, University of California at San Diego, La Jolla, Califiornia 92093-0648 USA Transcription factors serve critical roles in the progres- primary focus of this review. Crystallization of the Oct-1 sive development of general body plan, organ commit- and Pit-1 POU domains on DNA and in vitro studies ment, and finally, specific cell types. It has been the hope examining the specificity of POU domain cofactor inter- of most developmental biologists that comparison of the actions suggest that the flexibility with which the POU biological roles of a series of individual members within domain recognizes DNA-binding sites is a critical com- a family will permit at least some predictive generaliza- ponent of its ability to regulate gene expression. The tions regarding the developmental events that are likely implications of these data with respect to the mecha- to be regulated by a particular class of transcription fac- nisms utilized by the POU domain family of transcrip- tors. Here, we present an overview of the developmental tion factors to control developmental events will also be functions of the family of transcription factors charac- discussed. terized by the POU DNA-binding motif afforded by re- cent in vivo studies. Conformation of the POU domain on DNA The POU domain family of transcription factors was defined following the observation that the products of High-affinity site-specific DNA binding by POU domain three mammalian genes, Pit-l, Oct-l, and Oct-2 and the transcription factors requires both the POU-specific do- protein encoded by the Caenorhabditis elegans gene main and the POU homeodomain (Sturm and Herr 1988; unc-86 shared a region of homology, known as the POU Ingraham et al. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Effects of Downregulating GLIS1 Transcript On
Journal of Reproduction and Development, Vol. 61, No 5, 2015 —Original Article— Effects of downregulating GLIS1 transcript on preimplantation development and gene expression of bovine embryos Kazuki TAKAHASHI1), Nobuyuki SAKURAI2), Natsuko EMURA1), Tsutomu HASHIZUME1, 2) and Ken SAWAI1, 2) 1)Faculty of Agriculture, Iwate University, Iwate 020-8550, Japan 2)The United Graduate School of Agricultural Sciences, Iwate University, Iwate 020-8550, Japan Abstract. Krüppel-like protein Gli-similar 1 (GLIS1) is known as a direct reprogramming factor for the generation of induced pluripotent stem cells. The objective of this study was to investigate the role of GLIS1 in the preimplantation development of bovine embryos. GLIS1 transcripts in in vitro-matured oocytes and 1-cell to 4-cell stage embryos were detected, but they were either absent or at trace levels at the 8-cell to blastocyst stages. We attempted GLIS1 downregulation of bovine early embryos by RNA interference and evaluated developmental competency and gene transcripts, which are involved in zygotic gene activation (ZGA) in GLIS1-downregulated embryos. Injection of specific siRNA resulted in a distinct decrease inGLIS1 transcript in bovine embryos at the 4-cell stage. Although the bovine embryos injected with GLIS1-siRNA could develop to the 16-cell stage, these embryos had difficulty in developing beyond the 32-cell stage. Gene transcripts of PDHA1 and HSPA8, which are transcribed after ZGA, showed lower level in GLIS1 downregulated embryos. It is possible that GLIS1- downregulated embryos fail to initiate ZGA. Our results indicated that GLIS1 is an important factor for the preimplantation development of bovine embryos. Key words: Bovine embryo, Early development, Gene expression, GLIS1, RNA interference (J.