Bcl2l12 Contributes to Th2-Biased Inflammation in the Intestinal Mucosa by Regulating CD4+ T Cell Activities

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Bcl2L12 Contributes to Th2-Biased Inflammation in the Intestinal Mucosa by Regulating CD4+ T Cell Activities This information is current as Mao-Gang Li, Xiao-Yu Liu, Zhi-Qiang Liu, Jing-Yi Hong, of September 30, 2021. Jiang-Qi Liu, Cai-Jie Zhou, Tian-Yong Hu, Xiao-Jun Xiao, Pi-Xin Ran, Peng-Yuan Zheng, Zhi-Gang Liu and Ping-Chang Yang J Immunol published online 8 June 2018 http://www.jimmunol.org/content/early/2018/06/07/jimmun Downloaded from ol.1800139 Supplementary http://www.jimmunol.org/content/suppl/2018/06/07/jimmunol.180013 Material 9.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 30, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/203/6/1675.full.pdf /content/205/5/1473.full.pdf The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2018 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published June 8, 2018, doi:10.4049/jimmunol.1800139 The Journal of Immunology Bcl2L12 Contributes to Th2-Biased Inflammation in the Intestinal Mucosa by Regulating CD4+ T Cell Activities Mao-Gang Li,* Xiao-Yu Liu,* Zhi-Qiang Liu,*,†,‡ Jing-Yi Hong,* Jiang-Qi Liu,*,†,‡ Cai-Jie Zhou,x Tian-Yong Hu,*,† Xiao-Jun Xiao,* Pi-Xin Ran,{ Peng-Yuan Zheng,‖ Zhi-Gang Liu,* and Ping-Chang Yang* The Th2-biased inflammation and immune deregulation play a critical role in the pathogenesis of ulcerative colitis (UC). Recent studies indicate that the Bcl2-like protein 12 (Bcl2L12) is associated with immune deregulation of UC. This study aims to investigate the role of Bcl2L12 in the induction of aberrant Th2-biased inflammation. In this study, peripheral blood samples were collected from patients with inflammatory bowel disease. The Th2 cell activities were analyzed by flow cytometry, real-time quantitative RT- PCR, and Western blotting. Mice with Bcl2L12-knockout CD4+ T cells were used in the experiments. The results showed that the expression of Bcl2L12 was detected in peripheral CD4+ T cells, which was significantly higher in UC patients than in healthy Downloaded from subjects. A positive correlation between the expression of Bcl2L12 and Th2 cytokines was detected in CD4+ T cells from UC patients. Naive CD4+ T cells with Bcl2L12 overexpression were prone to differentiate into Th2 cells. Mice with Bcl2L12 deficiency failed to induce the Th2-biased inflammation in the intestine. Bcl2L12 bound GATA3 to form a complex to enhance the binding between GATA3 and the Il4 promoter to enhance the expression of IL-4 in CD4+ T cells. CD4+ T cells with Bcl2L12 overexpression were resistant to apoptosis. In conclusion, the Bcl2L12 is a critical factor in the induction of aberrant Th2 polarization by upregulating Th2 responses and downregulating Th2 cell apoptosis. Bcl2L12 may be a novel therapeutic target in the management http://www.jimmunol.org/ of the disorders with Th2-biased inflammation. The Journal of Immunology, 2018, 201: 000–000. nflammatory bowel disease (IBD) is a chronic inflammatory have been recognized in IBD patients. Published data show that disease in the intestine, including ulcerative colitis (UC) and both Th1 and Th2 responses play roles in the inflammation of I Crohn disease (CD), which are two subtypes. The patho- IBD. Profound infiltration of Th1 or Th2 cells can be found in the genesis of IBD is not fully understood (1). The skewed immune IBD intestinal mucosa (4). These Th1 or Th2 cells are highly responses to commensal microbes (2) or food components (3) activated, producing high amounts of Th1, Th2, or Th17 cytokines (5). Yet, factors initiating the skewed immune cell differentiation by guest on September 30, 2021 and cytokine overproduction in the intestinal tissue of IBD pa- *Research Center of Allergy and Immunology, Shenzhen University School of Med- tients are not fully understood. icine, Shenzhen 518055, China; †Longgang ENT Hospital, Shenzhen ENT Institute, It is accepted that the dominant Th1 or Th17 response is involved Shenzhen 518116, China; ‡Brain-Body Institute, McMaster University, Hamilton, Ontario L8N 4A6, Canada; xLonggang Chinese Traditional Medical Hospital and in the pathogenesis of CD (6, 7). Dendritic cells in the intestinal Beijing University of Chinese Medicine Shenzhen Hospital, Shenzhen 518116, mucosa express TLR. Upon recognizing microbial stimuli by China; {State Key Laboratory of Respiratory Disease, Guangzhou Medical Univer- ‖ TLR, dendritic cells express IL-12 to initiate the Th1 response by sity, Guangzhou 510120, China; and Department of Gastroenterology, The Fifth + Affiliated Hospital of Zhengzhou University, Zhengzhou 470000, China enhancing the expression of IFN-g in CD4 T cells. Both Th1 and Received for publication January 31, 2018. Accepted for publication May 9, 2018. Th2 responses are associated with the immune phenotypes of UC. This work was supported by the Innovation of Science and Technology Commission of The skewed Th2-dominant immune response is an important Shenzhen Municipality (Grants JCYJ20150403091931195, JCYJ20160422101725667, factor in the pathogenesis of UC. A portion of UC patients is CXZZ20140902151802864, and JCYJ20160429091935720) and the National Natural sensitized to food allergens. Treatment with specific allergen im- Science Foundation of China (Grants 81503623, 31400856, 31570932, 81571790, and 81501573). munotherapy attenuated the inflammation of UC (8, 9). Yet, how M.-G.L., X.-Y.L., Z.-Q.L., J.-Y.H., J.-Q.L., C.-J.Z., T.-Y.H., and X.-J.X. performed the skewed Th2-dominant immune response initiated in the in- experiments, analyzed data, and reviewed the manuscript. P.-C.Y., Z.-G.L., P.-X.R., testine still remains elusive. Published data indicate a Th2- and P.-Y.Z. organized the study and supervised experiments. P.-C.Y. designed the project and wrote the paper. dominant immune response in UC patients (8–12). Based on the available knowledge, how the skewed Th2 response occurs in UC Address correspondence and reprint requests to Dr. Ping-Chang Yang, Dr. Zhi-Gang Liu, or Dr. Peng-Yuan Zheng, Room 509, Building A7, Xili Campus, Shenzhen patients is unclear. University School of Medicine, 1066 Xueyuan Boulevard, Shenzhen 518055, China In recent studies, we observed that the Bcl2-like protein 12 (P.-C.Y. and Z.-G.L.), or Department of Gastroenterology, The Fifth Affiliated Hospital of Zhengzhou University, Zhengzhou 470000, China (P.-Y.Z.). E-mail addresses: (Bcl2L12) was associated with the skewed immune response in [email protected] (P.-C.Y.), [email protected] (Z.-G.L.), or [email protected] patients with UC (12) and allergic rhinitis (13). Bcl2L12 is a (P.-Y.Z.) member of the Bcl2 family belonging to the antiapoptotic mole- The online version of this article contains supplemental material. cules (14). Previous studies showed that Bcl2L12 could neutralize Abbreviations used in this article: AICD, activation-induced cell death; Bcl2L12, p53 to prevent glioma cell apoptosis (15). Based on the above Bcl2-like protein 12; CD, Crohn disease; IBD, inflammatory bowel disease; IP, immunoprecipitation; KO, knockout; LPMC, lamina propria mononuclear cell; information, we hypothesize that Bcl2L12 may be involved in the + MPO, myeloperoxidase; RNAi, RNA interference; RT-qPCR, real-time quantitative skewed Th2 response. In this study, we found that CD4 T cells PCR; shRNA, short hairpin RNA; SPT, skin prick test; UC, ulcerative colitis; WT, expressed Bcl2L12, which was higher in UC patients than in CD wild type. patients and healthy subjects. Bcl2L12 bound the GATA3 pro- Copyright Ó 2018 by The American Association of Immunologists, Inc. 0022-1767/18/$35.00 moter to enhance the binding of GATA3 and the Il4 promoter. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1800139 2 Bcl2L12 CONTRIBUTES TO ABERRANT Th2 RESPONSE Mice with Bcl2L12-knockout (KO) CD4+ T cells failed to induce RT-qPCR + inflammation in the intestine. CD4 T cells with Bcl2L12 over- Cells were collected from relevant experiments. The total RNA was extracted expression were resistant to apoptosis. The results suggest that with the TRIzol reagents. The cDNA was synthesized with a reverse tran- Bcl2L12 may be a potential therapeutic target in the management scription kit following the manufacturer’s instructions. The samples were of Th2-biased inflammation. amplified in a quantitative PCR device with the SYBR Green Master Mix and the primers of IL-4 (59-AACGAGGTCACAGGAGAAGG-39 and 59-TCTG- CAGCTCCATGAGAACA-39), IFN-g (59-TTCTTCAGCAACAGCAAGGC- Materials and Methods 39 and 59-ACTCCTTTTCCGCTTCCTGA-39), and Bcl2L12 (59-TTCCGAG- Reagents TTCTATGCCCTGG-39 and 59-CCAGTTTACGATGCAGAGCC-39). The results were presented as fold change against the housekeeping gene b-actin The short hairpin RNA (shRNA) kit of Bcl2L12, Abs of Bcl2L12, IL-4, (59-GGAAATCGTGCGTGACATCA-39 and 59-GCCACAGGATTCCATA- CD3, and GATA3 were purchased from Santa Cruz Biotech (Santa Cruz, CCCA-39). CA). The fluorochrome-labeled Abs of CD3, CD4, IL-4, IL-5, IL-13, IFN-g, and TNF were purchased from BD Biosciences (Franklin Lakes, Western blotting NJ). The IL-2, ELISA kits of IL-4, IL-5, IL-13, and TNF were purchased from R&D Systems (Minneapolis, MN). The reagents for real-time The total proteins were extracted from the cells collected from relevant ex- quantitative PCR (RT-qPCR), Western blotting, molecular cloning, and periments, fractioned by SDS-PAGE, and transferred onto a PVDF mem- plasmid transfection were purchased from Invitrogen (Carlsbad, CA).
Recommended publications
  • Glioma Oncoprotein Bcl2l12 Inhibits the P53 Tumor Suppressor

    Glioma Oncoprotein Bcl2l12 Inhibits the P53 Tumor Suppressor

    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Glioma oncoprotein Bcl2L12 inhibits the p53 tumor suppressor Alexander H. Stegh,1,2,7 Cameron Brennan,3 John A. Mahoney,1 Kristin L. Forloney,1 Harry T. Jenq,4 Janina P. Luciano,2 Alexei Protopopov,1 Lynda Chin,1,5 and Ronald A. DePinho1,6,8 1Belfer Institute for Applied Cancer Science, Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA; 2Ken and Ruth Davee Department of Neurology, Robert H. Lurie Comprehensive Cancer Center, The Brain Tumor Institute, Center for Genetic Medicine, Northwestern University, Chicago, Illinois 60611, USA; 3Brain Tumor Center, Department of Neurosurgery, Memorial Sloan-Kettering Cancer Center, New York, New York 10021, USA; 4Division of Health Sciences and Technology, Harvard Medical School and Massachusetts Institute of Technology, Boston, Massachusetts 02114, USA; 5Department of Dermatology, Harvard Medical School, Boston, Massachusetts 02115, USA; 6Department of Medicine and Genetics, Harvard Medical School, Boston, Massachusetts 02115, USA Glioblastoma multiforme (GBM) is a lethal brain tumor characterized by intense apoptosis resistance and extensive necrosis. Bcl2L12 (for Bcl2-like 12) is a cytoplasmic and nuclear protein that is overexpressed in primary GBM and functions to inhibit post-mitochondrial apoptosis signaling. Here, we show that nuclear Bcl2L12 physically and functionally interacts with the p53 tumor suppressor, as evidenced by the capacity of Bcl2L12 to (1) enable bypass of replicative senescence without concomitant loss of p53 or p19Arf, (2) inhibit p53-dependent DNA damage-induced apoptosis, (3) impede the capacity of p53 to bind some of its target gene promoters, and (4) attenuate endogenous p53-directed transcriptomic changes following genotoxic stress.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Supplementary Materials

    Supplementary Materials

    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
  • Inhibition of Mitochondrial Complex II in Neuronal Cells Triggers Unique

    Inhibition of Mitochondrial Complex II in Neuronal Cells Triggers Unique

    www.nature.com/scientificreports OPEN Inhibition of mitochondrial complex II in neuronal cells triggers unique pathways culminating in autophagy with implications for neurodegeneration Sathyanarayanan Ranganayaki1, Neema Jamshidi2, Mohamad Aiyaz3, Santhosh‑Kumar Rashmi4, Narayanappa Gayathri4, Pulleri Kandi Harsha5, Balasundaram Padmanabhan6 & Muchukunte Mukunda Srinivas Bharath7* Mitochondrial dysfunction and neurodegeneration underlie movement disorders such as Parkinson’s disease, Huntington’s disease and Manganism among others. As a corollary, inhibition of mitochondrial complex I (CI) and complex II (CII) by toxins 1‑methyl‑4‑phenylpyridinium (MPP+) and 3‑nitropropionic acid (3‑NPA) respectively, induced degenerative changes noted in such neurodegenerative diseases. We aimed to unravel the down‑stream pathways associated with CII inhibition and compared with CI inhibition and the Manganese (Mn) neurotoxicity. Genome‑wide transcriptomics of N27 neuronal cells exposed to 3‑NPA, compared with MPP+ and Mn revealed varied transcriptomic profle. Along with mitochondrial and synaptic pathways, Autophagy was the predominant pathway diferentially regulated in the 3‑NPA model with implications for neuronal survival. This pathway was unique to 3‑NPA, as substantiated by in silico modelling of the three toxins. Morphological and biochemical validation of autophagy markers in the cell model of 3‑NPA revealed incomplete autophagy mediated by mechanistic Target of Rapamycin Complex 2 (mTORC2) pathway. Interestingly, Brain Derived Neurotrophic Factor
  • Atlas Journal

    Atlas Journal

    Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 13, Number 7, July 2009 Previous Issue / Next Issue Genes ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1) (9q34.1) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 757-766. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ABL.html BCL2L12 (BCL2-like 12 (proline-rich)) (19q13.3). Christos Kontos, Hellinida Thomadaki, Andreas Scorilas. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 767-771. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCL2L12ID773ch19q13.html BCR (Breakpoint cluster region) (22q11.2) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 772-779. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCR.html ENAH (enabled homolog (Drosophila)) (1q42.12). Paola Nisticò, Francesca Di Modugno. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 780-785. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ENAHID44148ch1q42.html FGFR2 (fibroblast growth factor receptor 2) (10q26.13). Masaru Katoh. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 786-799. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/FGFR2ID40570ch10q26.html MAPK6 (mitogen-activated protein kinase 6) (15q21.2). Sylvain Meloche. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 800-804.
  • BCL2L12 (NM 138639) Human Tagged ORF Clone Product Data

    BCL2L12 (NM 138639) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC221347 BCL2L12 (NM_138639) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: BCL2L12 (NM_138639) Human Tagged ORF Clone Tag: Myc-DDK Symbol: BCL2L12 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC221347 representing NM_138639 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGACGGCCCGCTGGGCTGTTCCCGCCCCTATGCCCTTTTTTGGGTTTCCGGCCAGAGGCATGCTGGG AGCGTCACATGCAAATTGAGCGTGCACCCAGCGTTCCGCCCTTTCTACGCTGGGCCGGTTATCGACCCGG CCCAGTGCGCAGGCGCGGGAAAGTTGAACTAATAAAGTTTGTACGAGTTCAGTGGAGGAGACCGCAAGTT GAGTGGAGGAGGCGGCGGTGGGGCCCCGGACCAGGTGCCTCCATGGCAGGCTCTGAAGAGCTGGGGCTCC GGGAAGACACGCTGAGGGTCCTAGCTGCCTTCCTTAGGCGTGGTGAGGCTGCCGGGTCTCCTGTTCCAAC TCCACCTAGAAGCCCTGCCCAAGAAGAGCCAACAGACTTCCTGAGCCGCCTTCGAAGATGTCTTCCCTGC TCCCTGGGGCGAGGAGCAGCCCCCTCTGAGTCCCCTCGGCCTTGCTCTCTGCCCATCCGCCCCTGCTATG GTTTAGAGCCTGGCCCAGCTACTCCAGACTTCTATGCTTTGGTGGCCCAGCGGCTGGAACAGCTGGTCCA AGAGCAGCTGAAATCTCCGCCCAGCCCAGAATTACAGGGTCCCCCATCGACAGAGAAGGAAGCCATACTG CGGAGGCTGGTGGCCCTGCTGGAGGAGGAGGCAGAAGTCATTAACCAGAAGCTGGCCTCGGACCCCGCCC TGCGCAGCAAGCTGGTCCGCCTGTCCTCCGACTCTTTCGCCCGCCTGGTGGAGCTGTTCTGTAGCCGGGA TGACAGCTCTCGCCCAAGCCGAGCATGCCCCGGGCCCCCGCCTCCTTCCCCGGAGCCCCTGGCCCGCCTG GCCCTAGCCATGGAGCTGAGCCGGCGCGTGGCCGGGCTGGGGGGCACCCTGGCCGGACTCAGCGTGGAGC
  • Expression of BCL2L12, a New Member of Apoptosis-Related Genes

    Expression of BCL2L12, a New Member of Apoptosis-Related Genes

    © 2003 Schattauer GmbH, Stuttgart 1 Cellular Proteolysis and Oncology Expression of BCL2L12, a new member of apoptosis-related genes, in breast tumors Maroulio Talieri1, Eleftherios P.Diamandis2, Nikos Katsaros3, Dimitrios Gourgiotis4, Andreas Scorilas3 1 “G. Papanicolaou” Research Center of Oncology “Saint Savas” Hospital Athens, Greece 2 Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, and Department of Laboratory Medicine and Pathobiology, University of Toronto, Ontario, Canada 3 National Center for Scientific Research “Demokritos”, IPC, Athens Greece 4 Research Laboratories, Second Department of Pediatrics, School of Medicine, University of Athens, Athens, Greece Summary Apoptosis, a normal physiological form of cell death, is critical- BCL2L12 gene is constitutively expressed in many tissues, sug- ly involved in the regulation of cellular homeostasis. If the deli- gesting that the encoded protein serves an important function cate balance between cell death and cell proliferation is altered in different cell types. In the present study, the expression of by a defect in the normal regulation of apoptosis signaling, a cell BCL2L12 gene was analyzed by reverse transcription-PCR population is able to survive and accumulate, thereby favoring (PT-PCR) in 70 breast cancer tissues. Our results indicate that the acquisition of further genetic alterations and promoting BCL2L12 positive breast tumors are mainly of lower stage (I/II) tumorigenesis. Dysregulation of programmed cell death mech- or grade (I/II) (p=0.02 or p=0.04 respectively). Cox regression anisms plays an important role in the pathogenesis and progres- analysis revealed that BCL2L12 expression is positively related sion of breast cancer, as well as in the responses of tumors to to disease-free (DFS) and overall survival (OS) at both univari- therapeutic intervention.
  • Bcl2l12 Inhibits Post-Mitochondrial Apoptosis Signaling in Glioblastoma

    Bcl2l12 Inhibits Post-Mitochondrial Apoptosis Signaling in Glioblastoma

    Bcl2L12 inhibits post-mitochondrial apoptosis signaling in glioblastoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Stegh, A. H., H. Kim, R. M. Bachoo, K. L. Forloney, J. Zhang, H. Schulze, K. Park, et al. 2007. “Bcl2L12 Inhibits Post-Mitochondrial Apoptosis Signaling in Glioblastoma.” Genes & Development 21 (1): 98–111. https://doi.org/10.1101/gad.1480007. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41483449 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Bcl2L12 inhibits post-mitochondrial apoptosis signaling in glioblastoma Alexander H. Stegh,1 Hyunggee Kim,1,9 Robert M. Bachoo,1,2 Kristin L. Forloney,1 Jean Zhang,1,3 Harald Schulze,1 Kevin Park,4 Gregory J. Hannon,5 Junying Yuan,6 David N. Louis,4 Ronald A. DePinho,1,3,7,11 and Lynda Chin1,3,8,10 1Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA; 2Center for Neuro-Oncology and Department of Neurology, Brigham and Women’s Hospital, Boston, Massachusetts 02115, USA; 3Center for Applied Cancer Science and the Belfer Foundation Institute for Innovative Cancer Science, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA; 4Department of Pathology, Cancer Center and Neurosurgical Service, Massachusetts General Hospital
  • Gene Section Mini Review

    Gene Section Mini Review

    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Mini Review BCL2L12 (BCL2-like 12 (proline-rich)) Christos Kontos, Hellinida Thomadaki, Andreas Scorilas Department of Biochemistry and Molecular Biology, Faculty of Biology, University of Athens. 157 01, Panepistimiopolis, Athens, Greece (CK, HT, AS) Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/BCL2L12ID773ch19q13.html DOI: 10.4267/2042/44508 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology protein, and five consensus PXXP tetrapeptide Identity sequences. Other names: BPR; MGC120313; MGC120314; BCL2L12 protein also includes various putative MGC120315 posttranslational modification sites. There are HGNC (Hugo): BCL2L12 numerous potential sites for O-glycosylation. Furthermore, several possible sites of phosphorylation Location: 19q13.3 have been identified for cAMP-dependent protein Local order: Telomere to centromere. kinase, protein kinase C, and casein kinase 2. In addition, several N-myristoylation sites have been DNA/RNA predicted. The BCL2L12 protein was found to have proline-rich sites. One PPPP site as well as five PP Description amino acid sites are present in this protein. Eight Spanning 8.8 kb of genomic DNA, the BCL2L12 gene putative PXXP motifs were also identified. Proline-rich consists of 6 introns and 7 exons. motifs are characterized by the presence of the Transcription consensus PXXP tetrapeptide, found in all proline-rich proteins identified to date. It is known that SH3 The BCL2L12 gene has three splice variants with domains recognize proline-rich sequences and that all differences in exon 3.
  • Spherical Nucleic Acid Nanoparticles: Therapeutic Potential

    Spherical Nucleic Acid Nanoparticles: Therapeutic Potential

    BioDrugs https://doi.org/10.1007/s40259-018-0290-5 LEADING ARTICLE Spherical Nucleic Acid Nanoparticles: Therapeutic Potential Chintan H. Kapadia1 · Jilian R. Melamed1 · Emily S. Day1,2,3 © Springer International Publishing AG, part of Springer Nature 2018 Abstract Spherical nucleic acids (SNAs) are highly oriented, well organized, polyvalent structures of nucleic acids conjugated to hollow or solid core nanoparticles. Because they can transfect many tissue and cell types without toxicity, induce minimum immune response, and penetrate various biological barriers (such as the skin, blood–brain barrier, and blood–tumor barrier), they have become versatile tools for the delivery of nucleic acids, drugs, and proteins for various therapeutic purposes. This article describes the unique structures and properties of SNAs and discusses how these properties enable their application in gene regulation, immunomodulation, and drug and protein delivery. It also summarizes current eforts towards clinical translation of SNAs and provides an expert opinion on remaining challenges to be addressed in the path forward to the clinic. Key Points genes includes antisense oligonucleotides (ASOs), small interfering RNAs (siRNAs), and microRNAs (miRNAs) Spherical nucleic acids (SNAs) are revolutionizing the [4]. Many of these have been investigated in clinical trials felds of diagnostics, gene regulation, immunotherapy, for the treatment of diseases including cancer, neurological and drug and protein delivery. disease, infectious disease, and spinal muscular atrophy, and six nucleic acid-based therapies have been approved by the This article discusses how the unique structure and US Food and Drug Administration (FDA) for clinical use properties of SNAs enable them to maximize their efect [5]. However, translation and clinical success of nucleic acid in various medical applications.
  • Osteoarthritis Prevention Using BCL2

    Osteoarthritis Prevention Using BCL2

    Design Brief Osteoarthritis prevention using BCL2 Baishali Chaudhuri, Jeffrey Conners, Eva McKone, Nadia Shah, Abhay Yajurvedi BioBuilderClub, Andover High School, Andover, Massachusetts, USA Reviewed on 2 May 2020; Accepted on 22 June 2020; Published on 26 October 2020 Osteoarthritis (OA) is a chronic, progressive illness that affects millions worldwide, primarily those aged 45 and above. Commonly known as “wear and tear” arthritis, it is caused by the degradation of cartilage in the joints. There is no cure for the disease, but there are methods to manage pain and symptoms. There are many challenges to curing osteoarthritis, especially in the development of Disease Modifying Osteoarthritis Drugs (or DMOADs). Most of these issues come from patient testing and the limita- tions of conventional technology used in trials. Here, we propose a solution for treat- ing osteoarthritis by using a gene called BCL2. BCL2 is responsible for blocking the apoptosis of specific cells. We believe that we could utilize BCL2 to prevent the death of chondrocytes—cells responsible for producing and maintaining cartilage—and inhibit caspase activity, including Caspase-1. Caspase-1 is responsible for the maturation of IL-1β, which is widely known for degenerating cartilage. Therefore, the overproduc- tion of IL-1β stimulates osteoarthritis. Saccharomyces cerevisiae will be transformed with the BCL2 gene, and we will then test it for purity using PCR. Afterwards, we will test its response to IL-1β. Finally, our solution will be made into an injection that can be applied to the joint. If our solution works as intended, then it would slow down the progression of osteoarthritis and hopefully restore the patient’s quality of life.
  • BH3-Only Proteins and Their Roles in Programmed Cell Death

    BH3-Only Proteins and Their Roles in Programmed Cell Death

    Oncogene (2009) 27, S128–S136 & 2009 Macmillan Publishers Limited All rights reserved 0950-9232/09 $32.00 www.nature.com/onc REVIEW BH3-only proteins and their roles in programmed cell death M Giam1,2, DCS Huang1 and P Bouillet1 1The Walter and Eliza Hall Institute of Medical Research, Melbourne, Australia and 2Department of Medical Biology, The University of Melbourne, Melbourne, Australia The Bcl-2 family of proteins controls the mitochondrial space is required for the activation of the initiator pathway to apoptosis. It consists of pro-survival and pro- caspase-9 by the apoptotic protease-activating factor-1. apoptotic members, and their interactions decide whether Proteins of the Bcl-2 family control the integrity of the apoptogenic factor confined to the mitochondrial inter- mitochondrial membrane in healthy cells, and its membrane space can leak to the cytosol. Despite the permeabilization in response to apoptotic stimuli (Cory intense efforts to understand the molecular mechanisms and Adams, 2002). that lead to the permeabilization of the mitochondrial membrane, this particular issue remains a matter of The Bcl-2 family intense controversy. It is well accepted that pro-apoptotic Bax and Bak are directly responsible for the damage to All members of the Bcl-2 family share a close homology the mitochondria, but pro-survival family members pre- in up to four characteristic regions termed the BH (Bcl-2 vent them from doing so. It is also accepted that stress homology) domains (BH1–4) (Figure 1). They have signals activate selected Bcl-2 homology (BH)3-only either a pro-survival or a pro-apoptotic function.