Spherical Nucleic Acid Nanoparticles: Therapeutic Potential
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Glioma Oncoprotein Bcl2l12 Inhibits the P53 Tumor Suppressor
Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Glioma oncoprotein Bcl2L12 inhibits the p53 tumor suppressor Alexander H. Stegh,1,2,7 Cameron Brennan,3 John A. Mahoney,1 Kristin L. Forloney,1 Harry T. Jenq,4 Janina P. Luciano,2 Alexei Protopopov,1 Lynda Chin,1,5 and Ronald A. DePinho1,6,8 1Belfer Institute for Applied Cancer Science, Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA; 2Ken and Ruth Davee Department of Neurology, Robert H. Lurie Comprehensive Cancer Center, The Brain Tumor Institute, Center for Genetic Medicine, Northwestern University, Chicago, Illinois 60611, USA; 3Brain Tumor Center, Department of Neurosurgery, Memorial Sloan-Kettering Cancer Center, New York, New York 10021, USA; 4Division of Health Sciences and Technology, Harvard Medical School and Massachusetts Institute of Technology, Boston, Massachusetts 02114, USA; 5Department of Dermatology, Harvard Medical School, Boston, Massachusetts 02115, USA; 6Department of Medicine and Genetics, Harvard Medical School, Boston, Massachusetts 02115, USA Glioblastoma multiforme (GBM) is a lethal brain tumor characterized by intense apoptosis resistance and extensive necrosis. Bcl2L12 (for Bcl2-like 12) is a cytoplasmic and nuclear protein that is overexpressed in primary GBM and functions to inhibit post-mitochondrial apoptosis signaling. Here, we show that nuclear Bcl2L12 physically and functionally interacts with the p53 tumor suppressor, as evidenced by the capacity of Bcl2L12 to (1) enable bypass of replicative senescence without concomitant loss of p53 or p19Arf, (2) inhibit p53-dependent DNA damage-induced apoptosis, (3) impede the capacity of p53 to bind some of its target gene promoters, and (4) attenuate endogenous p53-directed transcriptomic changes following genotoxic stress. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Overview of DNA Self-Assembling: Progresses in Biomedical Applications
pharmaceutics Review Overview of DNA Self-Assembling: Progresses in Biomedical Applications Andreia F. Jorge 1 and Ramon Eritja 2,* 1 Coimbra Chemistry Centre (CQC), Department of Chemistry, University of Coimbra, Rua Larga, 3004-535 Coimbra, Portugal; [email protected] 2 Institute for Advanced Chemistry of Catalonia (IQAC-CSIC), Networking Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Jordi Girona 18-26, E-08034 Barcelona, Spain * Correspondence: [email protected]; Tel.: +34-934-006-145 Received: 22 November 2018; Accepted: 8 December 2018; Published: 11 December 2018 Abstract: Molecular self-assembling is ubiquitous in nature providing structural and functional machinery for the cells. In recent decades, material science has been inspired by the nature’s assembly principles to create artificially higher-order structures customized with therapeutic and targeting molecules, organic and inorganic fluorescent probes that have opened new perspectives for biomedical applications. Among these novel man-made materials, DNA nanostructures hold great promise for the modular assembly of biocompatible molecules at the nanoscale of multiple shapes and sizes, designed via molecular programming languages. Herein, we summarize the recent advances made in the designing of DNA nanostructures with special emphasis on their application in biomedical research as imaging and diagnostic platforms, drug, gene, and protein vehicles, as well as theranostic agents that are meant to operate in-cell and in-vivo. Keywords: DNA self-assembling; gene delivery; drug delivery; protein delivery; theranostics; nanomedicine 1. Introduction Nowadays, there is an increasing demand for developing predictive, preventive, and non-invasive patient-centered medicines, ideally combining diagnosis and therapeutics in one single device to enabling early diagnosis, precise treatment, and management of a specific disease, with power to leverage the quality of medical care [1]. -
Gene Regulation Using Spherical Nucleic Acids to Treat Skin Disorders
pharmaceuticals Review Gene Regulation Using Spherical Nucleic Acids to Treat Skin Disorders Thomas R. Holmes and Amy S. Paller * Department of Dermatology, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-312-695-3721 Received: 19 September 2020; Accepted: 30 October 2020; Published: 2 November 2020 Abstract: Spherical nucleic acids (SNAs) are nanostructures consisting of nucleic acids in a spherical configuration, often around a nanoparticle core. SNAs are advantageous as gene-regulating agents compared to conventional gene therapy owing to their low toxicity, enhanced stability, uptake by virtually any cell, and ability to penetrate the epidermal barrier. In this review we: (i) describe the production, structure and properties of SNAs; (ii) detail the mechanism of SNA uptake in keratinocytes, regulated by scavenger receptors; and (iii) report how SNAs have been topically applied and intralesionally injected for skin disorders. Specialized SNAs called nanoflares can be topically applied for gene-based diagnosis (scar vs. normal tissue). Topical SNAs directed against TNFα and interleukin-17A receptor reversed psoriasis-like disease in mouse models and have been tested in Phase 1 human trials. Furthermore, SNAs targeting ganglioside GM3 synthase accelerate wound healing in diabetic mouse models. Most recently, SNAs targeting toll-like receptor 9 are being used in Phase 2 human trials via intratumoral injection to induce immune responses in Merkel cell and cutaneous squamous cell carcinoma. Overall, SNAs are a valuable tool in bench-top and clinical research, and their advantageous properties, including penetration into the epidermis after topical delivery, provide new opportunities for targeted therapies. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
Inhibition of Mitochondrial Complex II in Neuronal Cells Triggers Unique
www.nature.com/scientificreports OPEN Inhibition of mitochondrial complex II in neuronal cells triggers unique pathways culminating in autophagy with implications for neurodegeneration Sathyanarayanan Ranganayaki1, Neema Jamshidi2, Mohamad Aiyaz3, Santhosh‑Kumar Rashmi4, Narayanappa Gayathri4, Pulleri Kandi Harsha5, Balasundaram Padmanabhan6 & Muchukunte Mukunda Srinivas Bharath7* Mitochondrial dysfunction and neurodegeneration underlie movement disorders such as Parkinson’s disease, Huntington’s disease and Manganism among others. As a corollary, inhibition of mitochondrial complex I (CI) and complex II (CII) by toxins 1‑methyl‑4‑phenylpyridinium (MPP+) and 3‑nitropropionic acid (3‑NPA) respectively, induced degenerative changes noted in such neurodegenerative diseases. We aimed to unravel the down‑stream pathways associated with CII inhibition and compared with CI inhibition and the Manganese (Mn) neurotoxicity. Genome‑wide transcriptomics of N27 neuronal cells exposed to 3‑NPA, compared with MPP+ and Mn revealed varied transcriptomic profle. Along with mitochondrial and synaptic pathways, Autophagy was the predominant pathway diferentially regulated in the 3‑NPA model with implications for neuronal survival. This pathway was unique to 3‑NPA, as substantiated by in silico modelling of the three toxins. Morphological and biochemical validation of autophagy markers in the cell model of 3‑NPA revealed incomplete autophagy mediated by mechanistic Target of Rapamycin Complex 2 (mTORC2) pathway. Interestingly, Brain Derived Neurotrophic Factor -
Atlas Journal
Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 13, Number 7, July 2009 Previous Issue / Next Issue Genes ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1) (9q34.1) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 757-766. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ABL.html BCL2L12 (BCL2-like 12 (proline-rich)) (19q13.3). Christos Kontos, Hellinida Thomadaki, Andreas Scorilas. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 767-771. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCL2L12ID773ch19q13.html BCR (Breakpoint cluster region) (22q11.2) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 772-779. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCR.html ENAH (enabled homolog (Drosophila)) (1q42.12). Paola Nisticò, Francesca Di Modugno. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 780-785. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ENAHID44148ch1q42.html FGFR2 (fibroblast growth factor receptor 2) (10q26.13). Masaru Katoh. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 786-799. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/FGFR2ID40570ch10q26.html MAPK6 (mitogen-activated protein kinase 6) (15q21.2). Sylvain Meloche. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 800-804. -
BCL2L12 (NM 138639) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC221347 BCL2L12 (NM_138639) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: BCL2L12 (NM_138639) Human Tagged ORF Clone Tag: Myc-DDK Symbol: BCL2L12 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC221347 representing NM_138639 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGACGGCCCGCTGGGCTGTTCCCGCCCCTATGCCCTTTTTTGGGTTTCCGGCCAGAGGCATGCTGGG AGCGTCACATGCAAATTGAGCGTGCACCCAGCGTTCCGCCCTTTCTACGCTGGGCCGGTTATCGACCCGG CCCAGTGCGCAGGCGCGGGAAAGTTGAACTAATAAAGTTTGTACGAGTTCAGTGGAGGAGACCGCAAGTT GAGTGGAGGAGGCGGCGGTGGGGCCCCGGACCAGGTGCCTCCATGGCAGGCTCTGAAGAGCTGGGGCTCC GGGAAGACACGCTGAGGGTCCTAGCTGCCTTCCTTAGGCGTGGTGAGGCTGCCGGGTCTCCTGTTCCAAC TCCACCTAGAAGCCCTGCCCAAGAAGAGCCAACAGACTTCCTGAGCCGCCTTCGAAGATGTCTTCCCTGC TCCCTGGGGCGAGGAGCAGCCCCCTCTGAGTCCCCTCGGCCTTGCTCTCTGCCCATCCGCCCCTGCTATG GTTTAGAGCCTGGCCCAGCTACTCCAGACTTCTATGCTTTGGTGGCCCAGCGGCTGGAACAGCTGGTCCA AGAGCAGCTGAAATCTCCGCCCAGCCCAGAATTACAGGGTCCCCCATCGACAGAGAAGGAAGCCATACTG CGGAGGCTGGTGGCCCTGCTGGAGGAGGAGGCAGAAGTCATTAACCAGAAGCTGGCCTCGGACCCCGCCC TGCGCAGCAAGCTGGTCCGCCTGTCCTCCGACTCTTTCGCCCGCCTGGTGGAGCTGTTCTGTAGCCGGGA TGACAGCTCTCGCCCAAGCCGAGCATGCCCCGGGCCCCCGCCTCCTTCCCCGGAGCCCCTGGCCCGCCTG GCCCTAGCCATGGAGCTGAGCCGGCGCGTGGCCGGGCTGGGGGGCACCCTGGCCGGACTCAGCGTGGAGC -
Expression of BCL2L12, a New Member of Apoptosis-Related Genes
© 2003 Schattauer GmbH, Stuttgart 1 Cellular Proteolysis and Oncology Expression of BCL2L12, a new member of apoptosis-related genes, in breast tumors Maroulio Talieri1, Eleftherios P.Diamandis2, Nikos Katsaros3, Dimitrios Gourgiotis4, Andreas Scorilas3 1 “G. Papanicolaou” Research Center of Oncology “Saint Savas” Hospital Athens, Greece 2 Department of Pathology and Laboratory Medicine, Mount Sinai Hospital, and Department of Laboratory Medicine and Pathobiology, University of Toronto, Ontario, Canada 3 National Center for Scientific Research “Demokritos”, IPC, Athens Greece 4 Research Laboratories, Second Department of Pediatrics, School of Medicine, University of Athens, Athens, Greece Summary Apoptosis, a normal physiological form of cell death, is critical- BCL2L12 gene is constitutively expressed in many tissues, sug- ly involved in the regulation of cellular homeostasis. If the deli- gesting that the encoded protein serves an important function cate balance between cell death and cell proliferation is altered in different cell types. In the present study, the expression of by a defect in the normal regulation of apoptosis signaling, a cell BCL2L12 gene was analyzed by reverse transcription-PCR population is able to survive and accumulate, thereby favoring (PT-PCR) in 70 breast cancer tissues. Our results indicate that the acquisition of further genetic alterations and promoting BCL2L12 positive breast tumors are mainly of lower stage (I/II) tumorigenesis. Dysregulation of programmed cell death mech- or grade (I/II) (p=0.02 or p=0.04 respectively). Cox regression anisms plays an important role in the pathogenesis and progres- analysis revealed that BCL2L12 expression is positively related sion of breast cancer, as well as in the responses of tumors to to disease-free (DFS) and overall survival (OS) at both univari- therapeutic intervention. -
Advances in Oligonucleotide Drug Delivery
REVIEWS Advances in oligonucleotide drug delivery Thomas C. Roberts 1,2 ✉ , Robert Langer 3 and Matthew J. A. Wood 1,2 ✉ Abstract | Oligonucleotides can be used to modulate gene expression via a range of processes including RNAi, target degradation by RNase H-mediated cleavage, splicing modulation, non-coding RNA inhibition, gene activation and programmed gene editing. As such, these molecules have potential therapeutic applications for myriad indications, with several oligonucleotide drugs recently gaining approval. However, despite recent technological advances, achieving efficient oligonucleotide delivery, particularly to extrahepatic tissues, remains a major translational limitation. Here, we provide an overview of oligonucleotide-based drug platforms, focusing on key approaches — including chemical modification, bioconjugation and the use of nanocarriers — which aim to address the delivery challenge. Oligonucleotides are nucleic acid polymers with the In addition to their ability to recognize specific tar- potential to treat or manage a wide range of diseases. get sequences via complementary base pairing, nucleic Although the majority of oligonucleotide therapeutics acids can also interact with proteins through the for- have focused on gene silencing, other strategies are being mation of three-dimensional secondary structures — a pursued, including splice modulation and gene activa- property that is also being exploited therapeutically. For tion, expanding the range of possible targets beyond example, nucleic acid aptamers are structured -
Bcl2l12 Inhibits Post-Mitochondrial Apoptosis Signaling in Glioblastoma
Bcl2L12 inhibits post-mitochondrial apoptosis signaling in glioblastoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Stegh, A. H., H. Kim, R. M. Bachoo, K. L. Forloney, J. Zhang, H. Schulze, K. Park, et al. 2007. “Bcl2L12 Inhibits Post-Mitochondrial Apoptosis Signaling in Glioblastoma.” Genes & Development 21 (1): 98–111. https://doi.org/10.1101/gad.1480007. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41483449 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Bcl2L12 inhibits post-mitochondrial apoptosis signaling in glioblastoma Alexander H. Stegh,1 Hyunggee Kim,1,9 Robert M. Bachoo,1,2 Kristin L. Forloney,1 Jean Zhang,1,3 Harald Schulze,1 Kevin Park,4 Gregory J. Hannon,5 Junying Yuan,6 David N. Louis,4 Ronald A. DePinho,1,3,7,11 and Lynda Chin1,3,8,10 1Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA; 2Center for Neuro-Oncology and Department of Neurology, Brigham and Women’s Hospital, Boston, Massachusetts 02115, USA; 3Center for Applied Cancer Science and the Belfer Foundation Institute for Innovative Cancer Science, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA; 4Department of Pathology, Cancer Center and Neurosurgical Service, Massachusetts General Hospital -
Gene Section Mini Review
Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL AT INIST-CNRS Gene Section Mini Review BCL2L12 (BCL2-like 12 (proline-rich)) Christos Kontos, Hellinida Thomadaki, Andreas Scorilas Department of Biochemistry and Molecular Biology, Faculty of Biology, University of Athens. 157 01, Panepistimiopolis, Athens, Greece (CK, HT, AS) Published in Atlas Database: August 2008 Online updated version : http://AtlasGeneticsOncology.org/Genes/BCL2L12ID773ch19q13.html DOI: 10.4267/2042/44508 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2009 Atlas of Genetics and Cytogenetics in Oncology and Haematology protein, and five consensus PXXP tetrapeptide Identity sequences. Other names: BPR; MGC120313; MGC120314; BCL2L12 protein also includes various putative MGC120315 posttranslational modification sites. There are HGNC (Hugo): BCL2L12 numerous potential sites for O-glycosylation. Furthermore, several possible sites of phosphorylation Location: 19q13.3 have been identified for cAMP-dependent protein Local order: Telomere to centromere. kinase, protein kinase C, and casein kinase 2. In addition, several N-myristoylation sites have been DNA/RNA predicted. The BCL2L12 protein was found to have proline-rich sites. One PPPP site as well as five PP Description amino acid sites are present in this protein. Eight Spanning 8.8 kb of genomic DNA, the BCL2L12 gene putative PXXP motifs were also identified. Proline-rich consists of 6 introns and 7 exons. motifs are characterized by the presence of the Transcription consensus PXXP tetrapeptide, found in all proline-rich proteins identified to date. It is known that SH3 The BCL2L12 gene has three splice variants with domains recognize proline-rich sequences and that all differences in exon 3.