Egr/Mef2c Transcription Factors Regulate The

VU Research Portal

Molecular changes during the development of Alzheimer's disease Wirz, K.T.S.

2013

document version Publisher's PDF, also known as Version of record

Link to publication in VU Research Portal

citation for published version (APA) Wirz, K. T. S. (2013). Molecular changes during the development of Alzheimer's disease.

General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.

• Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ?

Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

E-mail address: [email protected]

Download date: 30. Sep. 2021 5 Egr/Mef2c transcription factors regulate the expression of genes potentially involved in the modulation of synaptic activity and plasticity during the early stages of Alzheimer’s disease

Kerstin TS Wirz 1, Ronald E van Kesteren 2, Anke HW Essing 1, Marion JM Sassen 2, August B Smit 2, Dick F Swaab 3, Joost Verhaagen 1,2 and Koen Bossers 1,3

manuscript in preparation

1 Laboratory for Neuroregeneration, Netherlands Institute for Neuroscience, An Institute of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, The Netherlands. 2 Center for Neurogenomics and Cognitive Research, Neuroscience Campus Amsterdam, VU University, Amsterdam, The Netherlands 3 Laboratory for Neuropsychiatric Disorders, Netherlands Institute for Neuroscience, An Institute of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, The Netherlands. Abstract

Early in the pathogenesis of Alzheimer’s disease (AD), at Braak stage II, we have recently discovered in the human prefrontal cortex an increased expression of synaptic genes as well as a decreased expression in inflammation and proliferation genes. Here we employed a log-linear modeling-based method of 3D contingency tables (LLM3D) to investigate the interaction between these regulated genes, transcription factor binding sites and gene ontology (GO) categories. This analysis identified a significant enrichment for binding sites of all members of the early growth response family (EGR1 to 4) and for myocyte enhancer factor 2C (MEF2C) in the promoters of a set of genes involved in synaptic activity and plasticity that were upregulated during early presymptomatic stages of AD. The expression patterns of all 4 EGR transcription factors and MEF2C correlated with the expression of these synaptic activity and plasticity genes over the Braak stages. Following this in silico analysis, we tested whether EGR/MEF2C transcription factors are directly involved in the increased expression of synaptic activity and plasticity genes seen in early stages of AD and in Aβ-induced toxicity. We overexpressed Egr1 to 4 and Mef2c transcription factors in mouse primary cortical neurons and measured the effect on synaptic activity and plasticity gene expression with real-time RT-qPCR. Lentivirus-based overexpression of Egr1, 2 and 4 individually induced the expression of 16% to 29% of the genes tested, while combinatorial expression of Egrs and Mef2c, specifically the combinations Egr1/4, Egr2/3, Egr1/3/4 and Mef2c/Egr1/2/3, induced between 39% and 48% of the target genes regulated in early AD. Furthermore, we found that overexpression of APP-CT100 (the β-secretase product of APP and precursor to Aβ) reduced neurite length and the number of synaptic contacts per neuron. Overexpression of Egr1, Egr2, Egr4 and Mef2c increased Aβ-induced cell death in primary cortical neurons. We conclude that Egr/Mef2c transcription factors can indeed increase the expression of synaptic activity and plasticity genes that are altered in early stages of AD and can modulate Aβ-mediated toxicity. These data contribute to a mechanistic understanding of how changes in synapse function and Aβ neuropathology are mediated in early stages of AD.

200 Egr/Mef2c regulate gene expression in Alzheimer's disease

Introduction

Alzheimer’s disease (AD) is the most prevalent neurodegenerative disorder and accounts for the vast majority of age-related dementias. In addition to the two classical hallmarks of AD (senile plaques and neurofibrillary tangles), neuronal atrophy and synapse loss are major and early neuropathological features of the disease (Heinonen et al., 1995; Koffie et al., 2011; Masliah et al., 1994) and are thought to significantly contribute to the cognitive decline in AD (reviewed in Arendt, 2009). In the last years substantial evidence has emerged that increased levels of soluble amyloid β (Aβ) inhibit synaptic transmission and plasticity (reviewed in (Koffie et al., 2011; LaFerla et al., 2007). For example, infusion of Aβ oligomers impairs cognitive function (Cleary et al., 2005), and acute neuronal overproduction of Aβ blocks synaptic long-term plasticity and reduces synaptic contacts (Kessels et al., 2010; Wei et al., 2010). Interestingly the production of Aβ itself is affected by synaptic activity. Increased synaptic activity directly promotes the production and secretion of Aβ and the activity-dependent modulation of Aβ might acts as a negative feedback that prevents neuronal hyperexcitation (Cirrito et al., 2005; Kamenetz et al., 2003). In the last decade, a substantial number of studies reported evidence for neuronal hyperactivity in brains of patients with mild-cognitive impairment, a prodromal state of AD (Celone et al., 2006; Dickerson et al., 2005, 2004; Dubelaar et al., 2006; Hämäläinen et al., 2007; Kircher et al., 2007), indicating that neuronal hyperactivity is a very early event in AD. Moreover, in several mouse models of AD that express mutated forms of the human amyloid precursor protein gene which leads to elevated Aβ levels, epileptic activity has been reported (Brown et al., 2011; Busche et al., 2008; Minkeviciene et al., 2009; Palop et al., 2007), indicating that Aβ can induce processes that lead to neuronal hyperactivity. These data combined support the notion that increased Aβ levels are either causally or consequentially linked to network hyperactivity in AD brains. We recently conducted a genome-wide gene expression experiment using microarrays in which we studied the transcriptional alterations in the human 5 post-mortem prefrontal cortex during the development and progression of AD (Bossers et al., 2010) as defined by the Braak stages for neurofibrillary tangles (Braak and Braak, 1991). We observed two large groups of genes whose expression levels either initially decreased or increased in the earliest, non-symptomatic stages of AD (Braak stages 0-II), and then sharply rose or declined during later symptomatic stages, respectively (DOWNUP and UPDOWN gene clusters described in detail in Bossers et al., 2010). The initial change in transcription was paralleled by an increase in intraneuronal Aβ levels, which disappeared when the

201 first senile plaques appeared. Importantly, the UPDOWN gene expression cluster was significantly enriched for genes involved in synaptic activity and plasticity (e.g. the exocytosis-related genes SNAP25, CPLX1, VAMP7, SYT1, SYT3, SYT4, NAPB and SV2C and the activity dependent plasticity gene early growth response 1 (EGR1; also known as Zif268, NGFI-A, Krox-24, TIS8, ETR103, Krox-1, or Zenk)). These changes in gene expression may be the results of the neuronal hyperactivity. Alternatively, these changes in gene expression may contribute to the molecular basis for the occurrence of neuronal hyperactivity during the earliest preclinical stages of AD. Yet, the functional implications of the increased expression of genes encoding proteins involved in synaptic activity and plasticity for the development of AD remain unclear. An increase in the expression of genes involved in synaptic activity and plasticity may represent an endogenous compensatory mechanism that initially counteracts the detrimental effects of increased Aβ levels on synapse function, and the beneficial effects of this compensation may be lost in later stages of AD when cognitive decline becomes apparent. It is also possible that an increase in synaptic activity and plasticity precedes the dysregulation of Aβ and is responsible for a pathological buildup of Aβ, thereby causing synaptic dysfunction and cognitive decline. The concerted early changes in the expression of genes encoding proteins involved in synaptic plasticity and activity (Bossers et al., 2010) suggests the existence of underlying regulatory mechanisms that direct the expression of these genes during the earliest stages of AD. Here we performed a transcription factor binding site (TFBS) overrepresentation analysis using a recently developed log-linear modeling-based method (LLM3D; Geeven et al., 2011) and demonstrated that binding sites of the transcription factors of the EGR family [EGR1, EGR2 (also known as Krox-20, AT591, CMT1D, CMT4E, NGF1-B, Zfp-25), EGR3 (also called Pilot), and EGR4 (also called NGF1-C, pAT133)] and myocyte enhancer factor-2 c (MEF2C) were overrepresented in the aforementioned synaptic activity and plasticity genes upregulated at early Braak stages. Similar to their predicted target genes, these transcription factors also showed a trend towards upregulation in early Braak stage II and a significant down-regulation during the progression of AD. Based on these observations we hypothesized that EGR transcription factors and MEF2C are key regulators of the synaptic activity and plasticity genes increased in the human prefrontal cortex during the development and progression of AD, and that their expression is causally involved in AD progression. To test this hypothesis, Egr1 to 4 and Mef2c and combinations thereof were overexpressed in primary cortical neurons and the effect on the expression of the individual members of the cluster of synaptic activity and plasticity genes was examined. Furthermore, we investigated whether Egr1 to 4 and Mef2c overexpression alters the response of primary cortical neurons to the neurotoxic effects of Aβ in vitro.

202 Egr/Mef2c regulate gene expression in Alzheimer's disease

Methods

Transcription factor binding site analysis The generation of the gene expression data in the human prefrontal cortex during the development and progression of AD has been described previously (Bossers et al., 2010). For the TFBS analysis, all Unigene symbols from the normalized microarray data were mapped to their entrezgene IDs using biomaRt (version 2.4.0). All unique entrezgene IDs for the UPDOWN (clusters 6 & 23, Bossers et al., 2010) and DOWNUP (clusters 12 & 24, Bossers et al., 2010) clusters were extracted, as well as for the entire dataset (the “background”). The association between gene expression patterns, GO annotations and TFBSs was performed using the LLM3D algorithm (version 1.0) (Geeven et al., 2011). Briefly, the LLM3D algorithm on the UPDOWN and DOWNUP clusters was performed with species set to “human”, transcription factor predictions set to “preserved” and the “background” entrez IDs were used as reference. From the resulting set of TFBS-GO interactions per cluster, only the 5% most significant TFBS-GO interactions were selected for further analysis.

Primary cortical neuron cultures For primary cortical neuron cultures, cortices from E18 C57BL/6 mice were dissected in Hanks Balanced Salt Solution (Sigma-Aldrich Chemie B.V. Zwijndrecht, Netherlands) with 0.01 M Hepes (Invitrogen, Life Technologies Europe BV, Bleiswijk, Netherlands; Hanks-Hepes), meninges were removed and cortices were incubated for 20 min at 37 ºC in 0.25% trypsin (Gibco, Life Technologies Europe BV)/ Hanks-Hepes. Cells were washed in Hanks-Hepes and dissociated in DMEM (Invitrogen) supplemented with 10% fetal calf serum (FCS), 1% PenStrep (Gibco) and 1% non-essential amino acids (Sigma). Settled debris was removed and cells were centrifuged for 5 min at 800 rpm. Cells were then resuspended in Neurobasal (Gibco) supplemented with 0.018 M Hepes, 0.5 mM Glutamax (Gibco), 0.1% PenStrep, 2% B-27 (Gibco) and 0.625 μg/ml Fungizone (Gibco) (Neurobasal complete). Cells were plated at densities of 15,000 cells/well or 150,000 cells/well on 96 or 12 wells plates, respectively; all coated with 20μg/ml 5 poly-D-lysine (Sigma)/5% horse serum (Gibco). Cells were kept in culture under standard culturing conditions (5% CO2, 37 ˚C) for 15-16 days and 40% medium was refreshed with Neurobasal complete once a week. The cultures were strongly enriched with neurons and contained only few glial cells.

Plasmids I.M.A.G.E. full length cDNA clones for human Egr1 (IRATp970D09107D), mouse Egr2 (IRAKp961H136Q), rat Egr3 (IRCLp5011D0718D) and the RIKEN mouse

203 FANTOM clone for Egr4 (C630048N04) were purchased from Source BioScience (Berlin, Germany). The plasmids containing constitutively active mouse Mef2c and APP-CT100 were kind gifts from Dr. Eric N. Olson (University of Texas Southwestern) and Dr. Helmut Kessels (Netherlands Institute for Neuroscience), respectively. A lentiviral plasmid containing enhanced green fluorescent protein (eGFP) was used as control (Mason et al., 2010).

Lentivirus (LV) production and infection of primary neurons Egr1, Egr2, Egr3, Egr4, and Mef2c were cloned into lentiviral plasmids (pRRL-MCS+) containing an IRES-GFP using the Gateway cloning technology (Invitrogen). In short, coding DNA sequences for Egr3, Egr4 and Mef2c were amplified from the above- described plasmids using Phusion DNA Polymerase (ThermoFisher Scientific, Landsmeer, Netherlands) and primers containing Gateway attB recombination sites (see table 1 for primer sequences). The PCR products were recombined into the pDONR221 entry vector by a Gateway BP-recombination reaction (Invitrogen). The above-described clones for Egr1 and Egr2 already contained attB sites and were directly relocated into the entry vector. All five donor vectors were sequence verified and then subjected to the Gateway LR reaction to insert the gene sequences into the lentiviral plasmid. The APP-CT100 sequence was fused to mCherry with a P2A linker according to the method described in by Szymczak-Workman (2012). This construct was cloned into a lentiviral backbone using Spe1 and Xho1 restriction sites created by overhang PCR with Phusion DNA polymerase. Production of lentiviral particles and real-time quantitative polymerase chain reaction (qPCR) based titer evaluation was performed as described (Kutner et al., 2009; Logan et al., 2004; Naldini et al., 1996a, 1996b). In short, Hek 293T cells in 15 cm dishes were transfected with 7.88 µg envelope (pMD2.G), 14.63 µg packaging (pCMV-dR8.74) and 22.5 µg lentiviral plasmid DNA using polyethylenimine (ratio 1:3). Two days after transfection, virus in the supernatant was concentrated by ul- tracentrifugation, resuspended in PBS and stored at -80˚C. For titering, Hek 293T cells were plated on 24-wells plates and infected with a series of lentiviral dilutions. 2 days after infection, DNA was collected with the Dneasy Blood & Tissue Kit (Qiagen, Hilden, Germany) and underwent SYBR-green (Applied Biosystems, Life Technologies Europe BV) based qPCR for WPRE and GAPDH at standard settings (see below). Titers (TU/ml) were calculated based on manual titers for a GFP containing control lentivirus (LV-GFP). Primary neuronal cultures were infected with lentivirus encoding Egr1 (LV-Egr1), Egr2 (LV-Egr2), Egr3 (LV-Egr3), Egr4 (LV-Egr4), Mef2c (LV-Mef2c) or APP-CT100 (LV-CT100) on day 8 in culture, when they had well-developed neuronal networks, at a multiplicity of infection (MOI) of 20. Control infections

204 Egr/Mef2c regulate gene expression in Alzheimer's disease

were performed with LV-GFP and an LV plasmid which did neither contain a CMV promotor nor GFP (empty LV). On day 14 in culture, cells from 12 wells plates were collected in 500 µl TRIsure (Bioline, London, U.K) for subsequent RNA isolation and qPCR. Cells from 96 wells plates were subjected to amyloid-β (Aβ) treatment (see below) and immunohistochemical stainings.

RNA isolation RNA from primary neurons was isolated using an adapted TRIsure isolation protocol. Briefly, cells in TRIsure were mixed with 100 μl chloroform, vortexed, and centrifuged at 12,000 x g for 15 minutes at 4 ˚C. The aqueous phase was collected, mixed with 1 μl glycogen and subsequently 250 μl isopropanol and incubated overnight at -20 ˚C. Samples were then centrifuged at 13,600 rpm for 30 min at 4 ˚C. The RNA pellet was washed in 70% ethanol, air-dried, dissolved in RNase-free water and stored at -80 ˚C. RNA purity and yields were determined by a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA synthesis and qPCR For each primary neuron sample 6 μl total RNA was reverse transcribed using an adapted version of the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) protocol. In short, RNA was incubated with 1 μl Wipeout buffer for 2 min at 42 °C. For each sample, 2 μl 5x RT buffer, 0.5 μl RT primer mix, 0.25 μl Quantitect reverse transcriptase and 0.25 μl water were added, samples were flash spun and incubated for 30 min at 42 °C. After denaturation for 3 min at 95 °C, samples were diluted 1:11. cDNA was stored at -20 °C. Primers were designed using Primer3 (http://frodo.wi.mit.edu) (Rozen and Skaletsky, 2000) or taken from the RTPrimerDB database (http://www.rtprimerdb. org) (Lefever et al., 2009). Primer sequences are listed in table 1. For each primer pair, dissociation curves were generated to assess specificity. Only single products and no primer dimers were detected. qPCR reactions from primary neuron samples contained 1 μl 2 µM primer solution, 5 μl SYBR Green Master mix (Applied Biosystems) and 2 μl cDNA in a 10 μl reaction volume. The reaction was run at default settings (95 ºC, 15 s; 60 ºC, 1 min; 40 cycles) on the ABI Prism 7300 5 sequence detection system (Applied Biosystems). Primary neuron samples were normalized to the geometric mean of the housekeeping genes Hprt, Gapdh and β-actin. Expression values determined by qPCR were normalized to the control conditions (uninfected neurons, GFP or empty LV infected neurons), log2-transformed and clustered using the default clustering algorithm of the heatmap function in R (R Core Team, 2012). The patient cDNA included in the present study has been described previously (Bossers et al., 2010). qPCR was also performed as described before. Based on

205 - - - reverse CATCTGCTGGAAGGTGGACA CACTGGAGCAGAATGAGGAA GCCTGATTAGACCCCTGGTA TAGACATGTTTGCGGCATC CTCCCTGGAGGTTCACTCAT AACAACACCAGCCACCACTA CATGTCATGGTTGACGAACA AATGGCTTCCTTCACCATTC TAGGTGTCCAGGGGTAAAGC CCACTGCAGCTCCAAATAAA CTCCAGCTTAGGGTAGTTGTCCAT CAGGACCAGAGGCTGAAGAC CCCAAGTAGGTCACGGTCTT CTCAAAGCCCAGCTCAAGAA CCTCCCGTCTTCATGATTTT AGGCCAGCTATGACCCTCTA GGCATGGACTGTGGTCATGA ATGTAATCCAGCAGGTCAGCAA GAAACAGTCCATCCAACGTG AACCCTTCCTCCCTTCTGTT TTCTCTGGGCTTGGTCTTCT GGAAGATCCAGGTTTCTCCA AGGTCACATCAACCAGGTCA GAAATAGGCTCTTCCGTTCG CTGTACAGGGGAGGAGAAGG TCGTCCTTGTAATCGTCTGC GCGCTAATATTTGGCTCCTC TGTCGGGACAGTGAGAAGAG AGGTGAATGGGGAAGAGATG CTCATCGTAGGAGCCAGACA CATCTGTTTATTGGTATCATTATTAAGCCA CCACCATAGCATTGGTGAAG TATCAGAAACCAGGCAGCAC TCCTGCCATCGTACTCTCTG TGCTTGGTGGGGTATGAGTA GCCACCAGATGACCACTATG CCCCCAAAAAGAAGTCCCAA GTTCGTCCACAGGAAAGGAT TGTACAGCTGCCGCACACA GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAcccac cgtactcgtcaattc GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAttaca gcgcggcgaaggaga GGGGACCACTTTGTACAAGAAAGCTGGGTTCTActagc ccccaaccgccggcc - - - forward GCTCCTCCTGAGCGCAAG ATTGGCCTCACCCTCTACAC AAGGGCTAAAGCTGGGAGAT GGATGAGGACCAGAAGGTT CCTCACCAGGATCAAGGTTT CATTAGTCTGCTGGCCTCAA GGACCAGCAGATTTCCATTT TGGAGTCAACTTGCAAAAGC TTCCAGAGTCCCATCTTTCC CCAAGGAGGAAACCTTTGAA T GTCCCCGCTGCAGATCTC CAGGAGTGACGAAAGGAAGC CTTATTCGGGCTCTTTCCAG CTCCACCTGAGCGACTTCTC GGGTACCAGTTTCCTCCTGA CGAGCCTGCACTTCTTGTAG TGCACCACCAACTGCTTAGC ATGGGAGGCCATCACATTGT TCTTATTGCTCCCCGAGTCT AGGCTCCCTGAAGAAACTCA GTTCCCTGACTTCTGGGGTA AAGGACCTTGTCCCACTGTC GCCTGTTTGTGCTTCACAGT CTGATCAGCAAGGGACAGAA GGAGTCTCGAGGCTGAAATC TGAGAAAGAAGGGCCTCAAT AACAAGCCTGCCTACGAGAT ATGAGCTGACCATCAACGAG TGTGGAGACCTGTGAAGAGC GGAGCAGGACCACTTCTCTC TTAGAAGCCAAGTCCTGTTCTTATTTC TTGCAAAGTGCTTCAGATCC CAGCAAGAGGCTGATTTTGA CCAAAGAGAGCAGTCCCTTC CAGCATGAAGAAGACCGAAA CTCTGTCAGCTTCCCAATGA AAAAAACCACCAATCCCATCC GGTTCTTCCCTCATTGGAGA CACCGGAGAGCCCTGGATA GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCA TGgggagaaaaaagattcagat GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCA TGctccacctgagcgacttctc GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCA TGgagccatgtgcggcgtggag species mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse human mouse rat mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse rat Primer sequences. Table 1 Table gene qPCR primers Actb Arc Atp5g1 Bdnf Cav1 Cd151 Chml Cltc Cplx1 Crh EGR1 Egr2 Egr3 Egr4 Fzd9 Gabrd Gapdh Hprt Icam5 Kcna1 Kcnf1 Kcnv1 Kctd15 Kctd4 Lin7b Mef2 Mgp Nab2 Nptx2 Pacsin1 Psen2 Rasgrf1 Rdh5 Slc12a5 Slc38a2 Snap25 Sox2 Syt1 Tgfb1 Gateway primers with attB overhangs Mef2c Egr4 Egr3

206 Egr/Mef2c regulate gene expression in Alzheimer's disease - - - reverse CATCTGCTGGAAGGTGGACA CACTGGAGCAGAATGAGGAA GCCTGATTAGACCCCTGGTA TAGACATGTTTGCGGCATC CTCCCTGGAGGTTCACTCAT AACAACACCAGCCACCACTA CATGTCATGGTTGACGAACA AATGGCTTCCTTCACCATTC TAGGTGTCCAGGGGTAAAGC CCACTGCAGCTCCAAATAAA CTCCAGCTTAGGGTAGTTGTCCAT CAGGACCAGAGGCTGAAGAC CCCAAGTAGGTCACGGTCTT CTCAAAGCCCAGCTCAAGAA CCTCCCGTCTTCATGATTTT AGGCCAGCTATGACCCTCTA GGCATGGACTGTGGTCATGA ATGTAATCCAGCAGGTCAGCAA GAAACAGTCCATCCAACGTG AACCCTTCCTCCCTTCTGTT TTCTCTGGGCTTGGTCTTCT GGAAGATCCAGGTTTCTCCA AGGTCACATCAACCAGGTCA GAAATAGGCTCTTCCGTTCG CTGTACAGGGGAGGAGAAGG TCGTCCTTGTAATCGTCTGC GCGCTAATATTTGGCTCCTC TGTCGGGACAGTGAGAAGAG AGGTGAATGGGGAAGAGATG CTCATCGTAGGAGCCAGACA CATCTGTTTATTGGTATCATTATTAAGCCA CCACCATAGCATTGGTGAAG TATCAGAAACCAGGCAGCAC TCCTGCCATCGTACTCTCTG TGCTTGGTGGGGTATGAGTA GCCACCAGATGACCACTATG CCCCCAAAAAGAAGTCCCAA GTTCGTCCACAGGAAAGGAT TGTACAGCTGCCGCACACA GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAcccac cgtactcgtcaattc GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAttaca gcgcggcgaaggaga GGGGACCACTTTGTACAAGAAAGCTGGGTTCTActagc ccccaaccgccggcc - - -

5 forward GCTCCTCCTGAGCGCAAG ATTGGCCTCACCCTCTACAC AAGGGCTAAAGCTGGGAGAT GGATGAGGACCAGAAGGTT CCTCACCAGGATCAAGGTTT CATTAGTCTGCTGGCCTCAA GGACCAGCAGATTTCCATTT TGGAGTCAACTTGCAAAAGC TTCCAGAGTCCCATCTTTCC CCAAGGAGGAAACCTTTGAA T GTCCCCGCTGCAGATCTC CAGGAGTGACGAAAGGAAGC CTTATTCGGGCTCTTTCCAG CTCCACCTGAGCGACTTCTC GGGTACCAGTTTCCTCCTGA CGAGCCTGCACTTCTTGTAG TGCACCACCAACTGCTTAGC ATGGGAGGCCATCACATTGT TCTTATTGCTCCCCGAGTCT AGGCTCCCTGAAGAAACTCA GTTCCCTGACTTCTGGGGTA AAGGACCTTGTCCCACTGTC GCCTGTTTGTGCTTCACAGT CTGATCAGCAAGGGACAGAA GGAGTCTCGAGGCTGAAATC TGAGAAAGAAGGGCCTCAAT AACAAGCCTGCCTACGAGAT ATGAGCTGACCATCAACGAG TGTGGAGACCTGTGAAGAGC GGAGCAGGACCACTTCTCTC TTAGAAGCCAAGTCCTGTTCTTATTTC TTGCAAAGTGCTTCAGATCC CAGCAAGAGGCTGATTTTGA CCAAAGAGAGCAGTCCCTTC CAGCATGAAGAAGACCGAAA CTCTGTCAGCTTCCCAATGA AAAAAACCACCAATCCCATCC GGTTCTTCCCTCATTGGAGA CACCGGAGAGCCCTGGATA GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCA TGgggagaaaaaagattcagat GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCA TGctccacctgagcgacttctc GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCA TGgagccatgtgcggcgtggag species mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse human mouse rat mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse mouse rat Primer sequences. Table 1 Table gene qPCR primers Actb Arc Atp5g1 Bdnf Cav1 Cd151 Chml Cltc Cplx1 Crh EGR1 Egr2 Egr3 Egr4 Fzd9 Gabrd Gapdh Hprt Icam5 Kcna1 Kcnf1 Kcnv1 Kctd15 Kctd4 Lin7b Mef2 Mgp Nab2 Nptx2 Pacsin1 Psen2 Rasgrf1 Rdh5 Slc12a5 Slc38a2 Snap25 Sox2 Syt1 Tgfb1 Gateway primers with attB overhangs Mef2c Egr4 Egr3

207 Grubbs’ test for outliers one sample from Braak stage I was removed before statistical analysis.

Aβ treatment and cell viability assessment Oligomeric and fibrilar Aβ was prepared from synthetic Aβ42 (Anaspec, Seraing, Belgium) as described (Chafekar et al., 2007). Other Aβ preparations were made by dissolving synthetic Aβ42 directly in DMSO (Aβ-DMSO) or PBS (Aβ-PBS). All Aβ preparations were stored in aliquots at -80 ºC. For Aβ treatment in primary neurons 3 µM Aβ oligomers, fibrils, Aβ-DMSO or Aβ-PBS were added to the cultures at day 13 for 48 h at 37 ºC. Cell viability in primary neurons after Aβ treatment was assessed with a cell titer blue assay according to the manufacturer’s protocol (Promega, Leiden, Netherlands). In short, cells were incubated 1:5 with resazurin solution for 4 h at 37 ºC. Medium was transferred to black 96 wells plates and measured with a Varioskan plate reader at an excitation wave length of 560 nm and emission wavelength at 590 nm. Neurite length and number of synaptic spots were assessed after treatment with 10 µM Aβ-DMSO for 48 h at 37 ºC as described below.

Immunohistochemistry Primary neurons were stained with polyclonal chicken anti-MAP2 (Millipore; AB5543; 1:2500) and monoclonal mouse anti-synaptobrevin 2 (VAMP2; Synaptic- Systems, Göttingen, Germany; 1:2000) to visualize neurites and synapses, respectively. APP-CT100/Aβ protein was visualized in neurons using the monoclonal antibody 4G8 (Signet laboratoria, Dedham, MA, USA; 1:5,000). For Egr1 and Egr2 protein expression, we used monoclonal mouse anti-Egr1 (Abcam; Cambridge, UK; 1:800 for primary neurons; 1:400 in Hek 293T cells) and polyclonal rabbit anti-Egr2 (Covance, Rotterdam, Netherlands; 1:800 for primary neurons; 1:500 in Hek 293T cells). 4% paraformaldehyde (PFA) fixed cells were made permeable with phosphate- buffered saline (PBS)/ 0.5% Triton X-100 for 5 min at room temperature. After a blocking step with PBS/ 0.1% TritonX-100/ 1% BSA for 1 h at room temperature, primary neurons were incubated with the primary antibodies in PBS/ 1%BSA overnight at 4ºC. In Hek 293T cells, blocking was done with PBS/ 0.25% gelatin/ 0.5% Triton X-100/ 2% FCS (for Egr1) or as described for primary neurons (Egr2). Hek 293T cells were incubated with primary antibodies in PBS for 2 h at room temperature. Fluorescently labeled secondary antibodies (Jackson Immuno Research, Newmarket, Suffolk, UK) were used at 1:800 in PBS/ 1% BSA (primary neurons) or PBS (Hek 293T) for 90 min at room temperature. Cell nuclei were visualized with Hoechst (Invitrogen; 1:10,000). Images of Egr1, Egr2, and 4G8 immunoreactivity were taken with an Axiovert 200M microscope (Zeiss, Jena,

208 Egr/Mef2c regulate gene expression in Alzheimer's disease

Germany). Quantifications of Egr1 and Egr2 protein in primary neurons were performed by outlining neuronal cell bodies in photomicrographs and assessing the average fluorescent intensity using Image-Pro Plus version 6.3 (Media Cybernetics, USA). For Egr1 208 neurons and for Egr2 176 neurons were measured per condition.

Assessment of neurite outgrowth and synaptic contacts Neurite outgrowth and synaptic contacts were quantified using a Cellomics ArrayScan HCS Reader and the Cellomics Neuronal Profiling 3.5 bioapplication (Thermo Scientific, Pittsburgh, PA, USA). For analysis, the parameters mean_Neu- riteAvgLength, NeuriteSpotTotalCountPerNeuron, and NeuriteSpotTotalCountPer- NeuriteLength were used. Normalization was performed either to uninfected or LV-Gfp infected neurons. In the case of APP-CT100-mCherry lentivirus-based overexpression, primary neurons were selected based upon mCherry overexpression and compared to mCherry negative cells of the same well.

Results

Transcription factor binding site overrepresentation analysis of genes regulated during the initial stages and progression of AD We previously identified two dominant clusters of highly correlated gene expression changes during the development and progression of AD: i) the UPDOWN cluster – enriched for genes involved in synaptic activity and plasticity, and ii) the DOWNUP cluster – enriched for genes involved in inflammation and proliferation (Figure 1A; Bossers et al., 2010). These concerted alterations in gene expression during the progression of AD suggest the existence of regulatory mechanisms that actively direct transcriptional changes. We, therefore, performed an in silico analysis of the promoter regions of the genes in both the UPDOWN and DOWNUP clusters using the LLM3D algorithm (Geeven et al., 2011). This transcription factor binding site (TFBS) overrepresentation analysis specifically investigates the interaction between computationally predicted TFBS and gene 5 ontology (GO) categories in a given set of regulated genes. The LLM3D analysis revealed a significant interaction between 147 TFBS and 46 GO classes in the above mentioned gene clusters. Figure 1B lists the most significant interactions between the 50 highest-ranking transcription factor binding sites and the 30 highest-ranking GO classes. Our primary research interest concerned the regulation of synaptic activity and plasticity during the development and progression of AD. The LLM3D analysis revealed a significant interaction between all members of the EGR family (EGR1,

209 210 Egr/Mef2c regulate gene expression in Alzheimer's disease

Figure 1 Transcription factor binding site analysis A) Concerted gene expression changes in Alzheimer’s disease. The UPDOWN clusters, which show an upregulation in Braak stage II and a downregulation in later Braak stages, are enriched for synaptic activity and plasticity genes. The DOWNUP clusters, which are enriched for genes involved in inflammation and proliferation, show a downregulation in Braak stage II and an upregulation in later Braak stages (adapted from Bossers at al., 2010). The red line indicates the average expression profile of all group members. B) Analysis of the promoter regions of regulated genes in AD using the log-linear modeling of 3D contingency tables (LLM3D) approach from Geeven et al. (2011) to investigate interactions between transcription factor binding sites and Gene Ontology classes. The heatmap shows the 50 highest ranking transcription factor binding sites and 30 highest ranking GO classes. Note that all EGR family members (EGR1, EGR2, EGR3, NGFIC (=EGR4)) and MEF2C are over-represented in the GO classes neurological system processes and synaptic transmission.

EGR2, EGR3 and EGR4) and the GO classes neurological system processes, synaptic transmission, vesicle mediated transport and inorganic cation transport (Figure 1B). Furthermore, we noticed that the TFBS for MEF2C was significantly associated with the GO classes neurological system processes and synaptic transmission. A recent study showed that MEF2 regulates the transcription of EGR1 to 4 (Flavell et al., 2008). We next investigated which synaptic activity and plasticity genes were potential targets of EGR1 to 4 and MEF2C. Specifically, we selected all genes in the UPDOWN cluster that met the following criteria: 1) their promotor region contained minimally one EGR binding site, and 2) they were annotated with one or more of the following GO categories: neurological system processes, synaptic transmission, vesicle mediated transport or inorganic cation transport (see Table 2). Presenilin 2 (Psen2) was included as target gene since it has an EGR1 binding site (Renbaum et al., 2003) and is, as the catalytic subunit of gamma secretase, an enzyme of special interest in AD. It, however, is not annotated with a synaptic function in the GO database. EGR1, EGR2 and EGR3 are auto- and cross-regulatory transcription factors and were also included in the list of target genes (see Table 2). This selection resulted in a total of 33 genes. 9 target genes had an additional MEF2C binding site. 23 target genes had at least two binding sites for several EGRs. 5 Caveolin 1 (Cav1), corticotropin releasing hormone (Crh) and solute carrier family 38 member 2 (Slc38a2) were predicted to have binding sites for only EGR2. Gamma- aminobutyric acid A receptor delta (Gabrd), potassium channel tetramerisation domain containing 4 (Kctd4), Matrix Gla protein (Mgp), and Ras protein-specific guanine nucleotide-releasing factor 1 (Rasgrf1) had predicted binding sites for EGR3 only, and complexin 1 (Cplx1) had a binding site for only EGR4.

211 Table 2 Genes, regulated during the progression of Alzheimer’s disease (UPDOWN cluster; see Figure 1A), with predicted EGR/MEF2C binding sites and Gene Ontology (GO) annotation neurological system processes, synaptic transmission, vesicle mediated transport or inorganic cation transport.

Binding site Overexpression Gene Description EGR1 EGR2 EGR3 EGR4 MEF2C # of sites Neuron ARC activity-regulated cytoskeleton-associated protein x x x 3 x ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) x x x x 4 x BDNF brain-derived neurotrophic factor x x 2 x CAV1 caveolin 1, caveolae protein, 22kDa x 1 x CD151 CD151 molecule (Raph blood group) x x 2 x CHD7 chromodomain helicase DNA binding protein 7 x 1 CHML choroideremia-like (Rab escort protein 2) x x x x 4 x CLTC clathrin, heavy chain (Hc) x x x x 4 x CPLX1 complexin 1 x 1 x CRB2 crumbs homolog 2 (Drosophila) x 1 CRH corticotropin releasing hormone x 1 x EDN1 endothelin 1 x 1 EGR1 early growth response 1 x 1 x EGR2 early growth response 2 x x x 3 x EGR3 early growth response 3 x x x x 4 x ELOVL4 ELOVL fatty acid elongase 4 x 1 FZD9 frizzled homolog 9 (Drosophila) x x x x 4 x GABRD gamma-aminobutyric acid (GABA) A receptor, delta x x 2 x GABRG2 gamma-aminobutyric acid (GABA) A receptor, gamma 2 x 1 HTR2A 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled x 1 ICAM5 intercellular adhesion molecule 5, telencephalin x x 2 x KCNA1 potassium voltage-gated channel, shaker-related subfamily, member 1 x x x 3 x KCNF1 potassium voltage-gated channel, subfamily F, member 1 x x x x 4 x KCNV1 potassium channel, subfamily V, member 1 x x x x x 5 x KCTD15 potassium channel tetramerisation domain containing 15 x x x x x 5 x KCTD4 potassium channel tetramerisation domain containing 4 x 1 x LIN7B lin-7 homolog B (C. elegans) x x x x 4 x LRP4 low density lipoprotein receptor-related protein 4 x 1 MAN2B1 mannosidase, alpha, class 2B, member 1 x 1

212 Egr/Mef2c regulate gene expression in Alzheimer's disease

Table 2 Genes, regulated during the progression of Alzheimer’s disease (UPDOWN cluster; see Figure 1A), with predicted EGR/MEF2C binding sites and Gene Ontology (GO) annotation neurological system processes, synaptic transmission, vesicle mediated transport or inorganic cation transport.

Binding site Overexpression Gene Description EGR1 EGR2 EGR3 EGR4 MEF2C # of sites Neuron ARC activity-regulated cytoskeleton-associated protein x x x 3 x ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) x x x x 4 x BDNF brain-derived neurotrophic factor x x 2 x CAV1 caveolin 1, caveolae protein, 22kDa x 1 x CD151 CD151 molecule (Raph blood group) x x 2 x CHD7 chromodomain helicase DNA binding protein 7 x 1 CHML choroideremia-like (Rab escort protein 2) x x x x 4 x CLTC clathrin, heavy chain (Hc) x x x x 4 x CPLX1 complexin 1 x 1 x CRB2 crumbs homolog 2 (Drosophila) x 1 CRH corticotropin releasing hormone x 1 x EDN1 endothelin 1 x 1 EGR1 early growth response 1 x 1 x EGR2 early growth response 2 x x x 3 x EGR3 early growth response 3 x x x x 4 x ELOVL4 ELOVL fatty acid elongase 4 x 1 FZD9 frizzled homolog 9 (Drosophila) x x x x 4 x GABRD gamma-aminobutyric acid (GABA) A receptor, delta x x 2 x GABRG2 gamma-aminobutyric acid (GABA) A receptor, gamma 2 x 1 HTR2A 5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled x 1 ICAM5 intercellular adhesion molecule 5, telencephalin x x 2 x KCNA1 potassium voltage-gated channel, shaker-related subfamily, member 1 x x x 3 x 5 KCNF1 potassium voltage-gated channel, subfamily F, member 1 x x x x 4 x KCNV1 potassium channel, subfamily V, member 1 x x x x x 5 x KCTD15 potassium channel tetramerisation domain containing 15 x x x x x 5 x KCTD4 potassium channel tetramerisation domain containing 4 x 1 x LIN7B lin-7 homolog B (C. elegans) x x x x 4 x LRP4 low density lipoprotein receptor-related protein 4 x 1 MAN2B1 mannosidase, alpha, class 2B, member 1 x 1

213 Table 2 Continued.

Binding site Overexpression Gene Description EGR1 EGR2 EGR3 EGR4 MEF2C # of sites Neuron MGP matrix Gla protein x 1 x MKKS McKusick-Kaufman syndrome x 1 NPTX2 neuronal pentraxin II x x x x 4 x PACSIN1 protein kinase C and casein kinase substrate in neurons 1 x 1 x PEX7 peroxisomal biogenesis factor 7 x 1 POU3F2 POU class 3 homeobox 2 x 1 RASGRF1 Ras protein-specific guanine nucleotide-releasing factor 1 x 1 x RBP4 retinol binding protein 4, plasma x 1 RDH5 retinol dehydrogenase 5 (11-cis/9-cis) x x 2 x SCN4B sodium channel, voltage-gated, type IV, beta subunit x 1 SLC12A5 solute carrier family 12 (potassium/chloride transporter), member 5 x x x x 4 x SLC17A6 solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), x 1 member 6 SLC38A2 solute carrier family 38, member 2 x 1 x SNAP25 synaptosomal-associated protein, 25kDa x x x x 4 x SOX2 SRY (sex determining region Y)-box 2 x x x 3 x SYT1 synaptotagmin I x x x x x 5 x TGFB1 transforming growth factor, beta 1 x x x 3 x TRIP10 thyroid hormone receptor interactor 10 x 1

NAB2* NGFI-A binding protein 2 x 1 x PSEN2** presenilin 2 x 1 x

* NAB2 serves as positive control. It has been reported that Egr1-3 activate NAB2 expression (Kumbrink et al., 2010, 2005). ** PSEN2 has an Egr1 binding site, but its GO annotation does not include synaptic activity or plasticity function. It is included in this study for its special interest in Alzheimer’s disease. Binding sites for all Egr family members and Mef2c are indicated per gene. Genes with only a Mef2c binding site are listed for completeness, but were not investigated in vitro.

EGR and MEF2C expression in the human prefrontal cortex correlates with the expression of synaptic activity and plasticity genes The occurrence of EGR and MEF2C binding sites in the promoter regions of the co-regulated target genes prompted us to revisit the expression patterns of EGR1 to

214 Egr/Mef2c regulate gene expression in Alzheimer's disease

Table 2 Continued.

NAB2* NGFI-A binding protein 2 x 1 x PSEN2** presenilin 2 x 1 x

* NAB2 serves as positive control. It has been reported that Egr1-3 activate NAB2 expression (Kumbrink et al., 2010, 2005). ** PSEN2 has an Egr1 binding site, but its GO annotation does not include synaptic activity or plasticity 5 function. It is included in this study for its special interest in Alzheimer’s disease. Binding sites for all Egr family members and Mef2c are indicated per gene. Genes with only a Mef2c binding site are listed for completeness, but were not investigated in vitro.

4 in the human microarray data (Bossers et al., 2010). We found that the expression patterns of the EGR transcription factors EGR1 to 3 significantly correlated with the average expression pattern of their predicted target genes (see Table 2) in the UPDOWN cluster (EGR1 r = 0.87, p = 0.01; EGR2 r = 0.94, p = 0.002; EGR3 r = 0.96,

215 p = 0.001; Pearson’s product-moment correlation). EGR4 was expressed but not significantly correlated (r = 0.58, p = 0.17). The expression pattern of MEF2C significantly correlated with the average expression pattern of its predicted target genes with an MEF2C binding site (Table 2) in the UPDOWN cluster (r = 0.94, p = 0.002).

* *

* * r elative expression

Braak stage

Figure 2 EGR mRNA expression in human prefrontal cortex during the progression of Alzheimer’s disease. The expression of EGR1, EGR2, EGR3 and EGR4 is significantly regulated over the Braak stages (ANOVA, p < 0.05). The expression patterns of EGR1, EGR2, and EGR3 show a downregulation between Braak stages II and VI; EGR1 expression is also downregulated between Braak stage II and V. EGR4 expression is downregulated from Braak stage III to V and VI (Bonferroni’s multiple comparison post hoc test p < 0.05). These expression patterns are very similar to the expression patterns of synaptic activity and plasticity genes with EGR binding sites (Figure 1A and listed in Table 2). mRNA expression was measured with qPCR on 49 human prefrontal cortex post-mortem tissue (7 patients per Braak stage; 1 statistical outlier in Braak stage I was removed for all EGRs).

216 Egr/Mef2c regulate gene expression in Alzheimer's disease

To confirm the expression patterns of EGR1 to 4, we performed a qPCR analysis on RNA isolated from the human prefrontal cortex of patients with Braak stages 0 to VI which was also used in the microarray study (Bossers et al., 2010). The expression levels of EGR1, EGR2, EGR3 and EGR4 were significantly regulated over the Braak stages (ANOVA, p < 0.05; Figure 2). Post hoc testing revealed that the expression patterns of EGR1, EGR2, and EGR3 showed a downregulation between Braak stages II and VI (p < 0.05). EGR1 expression was also significantly downregulated from Braak stage II to Braak stage V (p < 0.05). EGR4 expression was downregulated from Braak stage III to Braak stages V and VI (p < 0.05). Again, these expression patterns were very similar to the expression patterns of the synaptic activity and plasticity genes with EGR binding sites (Figure 1A and listed in Table 2). Based on Grubbs’ test for outliers one sample from Braak stage I was removed from analysis for all Egr members.

Overexpression of EGR1 to 4 and MEF2c in primary cortical neurons increases the expression of synaptic activity and plasticity genes To investigate whether Egr1 to 4 and Mef2c overexpression could induce the expression of synaptic activity and plasticity genes, we used embryonic primary cortical neurons that form networks with active synaptic connections in vitro and used lentiviral vectors to overexpress Egr1 to 4 and Mef2c in these neurons. We first verified the mRNA overexpression of Egr1 to 4 and Mef2c. The overexpression ranged from 12.3 to 107.5 fold for Egr1, 30.7 to 478 fold for Egr2, 14.4 to 86.3 fold for Egr3, 5.4 to 35.8 fold for Egr4 and 195 to 1508.8 fold for Mef2c. The great variation of overexpression levels could be explained by different experimental conditions. The combined overexpression of transcription factors resulted in lower levels of overexpression of each individual transcription factor, while conditions in which cells were only infected with a single transcription factor resulted in the highest overexpression levels. Subsequently, we tested whether the lentiviral vectors encoding Egr1 and Egr2 indeed directed the expression of Egr1 and Egr2 protein (Figure 3). Hek 293T cells, which endogenously do not express Egr1 or Egr2, showed clear Egr1 and Egr2 immunoreactivity when transduced with LV-Egr1 and LV-Egr2 (Figure 3A). In contrast, mouse primary cortical neurons already expressed 5 clearly detectable endogenous levels of Egr1 and Egr2. A quantitative analysis of the lentivirus-based overexpression of these two transcription factors demonstrated a significant increase in the immunoreactivity for Egr1 and Egr2 in these cells (Figure 3B; Chi-squared test; p < 0.001). Next, we overexpressed Egr1, Egr2, Egr3, Egr4 and Mef2c transcription factors separately, and all possible combinations, in primary cortical neurons. 6 days after infection, we quantified the expression of 33 predicted Egr and Mef2c target genes (selected as described above; Table 2) using qPCR. A clustering analysis and

217 218 Egr/Mef2c regulate gene expression in Alzheimer's disease

Figure 3 Lentiviral vector-mediated expression of Egr 1 and Egr2 protein expression in 293T HEK cells and in primary cortical neurons. A) Immunohistochemical analysis showed that Egr1 and Egr2 immunoreactivity was increased in lentivirus-infected Hek 293T cells (ii, iv) indicating that the lentiviral vector directed the expression of EGR1 and EGR2 protein. Endogenous immunoreactivity of Egr1 and Egr2 was undetectable in uninfected Hek cells (i, iii). B) Both Egr1 and Egr2 protein were expressed endogenously in primary mouse cortical neurons (i, iii). Lentivirus-based overexpression of Egr1 (ii) or Egr2 (iv) enhanced immunoreactivity levels of the transgenes in these cells. The quantifications show that the number of infected cells that express high levels of Egr1 (v) or Egr2 (vi) is increased compared to the uninfected conditions (Chi-squared test; p < 0.001). Cells are ordered in bins according to their average fluorescence intensity (x-axis). Intensity range per bin is 15. Scale bar: 50 µm.

heatmap presentation of target gene expression under all conditions (Figure 4A) revealed the following general patterns: Egr3, Mef2c and Egr3/Mef2c did not alter target gene expression and clustered together with the control groups (untreated cells, cells infected with LV-GFP or cells transduced with an empty lentiviral vector). In most other conditions, a set of 9 genes was strongly upregulated. These genes were: Mgp, neuronal pentraxin II (Nptx2), Crh, retinol dehydrogenase 5 (11-cis/9-cis) (Rdh5), the positive control Nab2, activity-regulated cytoskeleton-associated protein (Arc), transforming growth factor, beta 1 (Tgfb1), Gabrd and brain-derived neurotrophic factor (Bdnf). For these genes, the expression was increased with more than 2x standard deviation (SD) of all controls in 9 to 28 experimental conditions. The broad upregulation of Nptx2 upon Egr overexpression was in line with its predicted binding sites for all Egrs. Two of the other strongly regulated genes, Mgp and Crh, were predicted to be only regulated by either Egr3 or Egr2, respectively. In both cases we found, however, that the actual regulation was much broader. Mgp was not regulated by Egr3, as predicted, but was strongly regulated by all other transcription factors. Crh was not only regulated by Egr2, as predicted, but also by Egr1 and Mef2c even though Crh was not a predicted target gene for Egr1 or Mef2c in the LLMD3 analysis. Mef2c alone and all combinations with Mef2c strongly increased the expression of Crh. Combinations of Egr transcription factors without Mef2c had a weaker or no effect 5 on Crh overexpression. Furthermore, Gabrd, which was predicted to be only regulated by Egr3 and Mef2c, was not regulated by these two transcription factors alone, but by Egr1 and Egr2 and many other transcription factor combinations. In line with the predicted binding sites, Arc was regulated by Egr2 and Egr4 and combinations of transcription factors, but not by Egr1 alone. A second set of 7 genes was moderately upregulated. Between 1 and 12 combinations of the Egr transcription factors increased the expression of target genes in this cluster by more than 2x SD of all controls. Combinations with Mef2c,

219 A

−4 −2 0 2 4 # of genes >2x SD increased control 0 empty 0 Egr3 0 Mef2 1 gfp 0 Mef2.Egr3 1 Egr134 1 2 Egr234 8 Egr34 7 Egr123 6 Egr13 1 0 Mef2.Egr24 9 Mef2.Egr123 1 5 Egr12 1 0 Egr2 9 Egr1 8 Mef2.Egr234 6 Mef2.Egr1234 7 Mef2.Egr4 5 Mef2.Egr34 8 Egr4 5 Egr124 9 Mef2.Egr1 6 Egr1234 9 Egr24 1 0 Egr14 1 2 Egr23 1 4 Mef2.Egr23 6 Mef2.Egr13 1 0 Mef2.Egr14 9 Mef2.Egr134 1 1 Mef2.Egr124 9 Mef2.Egr2 9 Mef2.Egr12 1 1 Mgp Nptx2 Crh Fzd9 Rdh5 Nab2 Arc Tgfb1 Gabrd Bdnf Syt1 Kcnf1 Kctd4 S o Psen2 Snap25 Lin7b C a Cd151 Kctd15 P Slc12a5 Kc n Icam5 Kcna1 Atp5g1 Chml Cplx1 Slc38a2 Cltc Rasgrf1 acsin1 x2 v1 v1

28 26 24 0 22 26 26 9 1 7 1 7 1 2 6 2 7 7 1 2 3 6 0 1 2 1 2 2 1 2 0 1 0 0 # of conditions in which gene is >2x SD increased B Eg r2 Eg r3 Eg r4 Eg r1 Eg r3 Eg r4 Eg r1 Eg r2 Eg r4 Eg r1 Eg r2 Eg r3

Figure 4 The effects of Egr1 to 4 and Mef2c expression on genes found altered in Alzheimer’s disease. The effects of lentivirus-based overexpression of Egr1, Egr2, Egr3, Egr4 and Mef2c transcription factors separately, and all possible combinations thereof, in synapse forming primary cortical neurons on target gene expression was determined by qPCR. A) Most conditions, except for control and Egr3, Mef2c and Egr3/Mef2c, induced upregulation of the expression of several Egr/Mef2c target genes from the LLM3D analysis (Mgp, Nptx2, Crh Rdh5, Nab2, Arc, Tgfb1, Gabrd, Bdnf and to a lesser degree Syt1, Kcnf1, Kctd4, Sox2, Psen2, Snap25, Lin7b). Note that combinations of Egr1/4, Egr2/3, Egr1/3/4, and Mef2c/Egr1/2/3 increased the expression of at least 12 target genes with more than 2xSD of all controls.

220 Egr/Mef2c regulate gene expression in Alzheimer's disease

Overexpression of Egrs/Mef2c reduced Fzd9 expression. The heat map shows log2- transformed mRNA expression values. B) LV-overexpression of Egr1 to 4 strongly upregulated the expression of the respective Egr and were, therefore, not included in the heatmap analysis. Egr1 and 2 also cross-regulated other Egr family members: Egr1 upregulated Egr2 and Egr2 downregulated Egr3 by more than 1.5xSD of all controls. Control samples were untreated cells, cells infected with LV-GFP and an empty lentiviral vector. All expression values are depicted relative to the mean of the controls. Each data point represents the mean of at least 3 biological replicates. SD: standard deviation. however, did increase these target genes to a much lesser extent or not at all. This cluster consisted of synaptotagmin (Syt1), potassium voltage-gated channel, subfamily F, member 1 (Kcnf1), Kctd4, SRY (sex determining region Y)-box 2 (Sox2), Psen2, synaptosomal-associated protein, 25kDa (Snap25), and lin-7 homolog B (C. elegans) (Lin7b). Kctd4 was not regulated by Egr3 alone as predicted, but only by transcription factor combinations including Egr3. Overexpression of almost all combinations of Egrs/Mef2c reduced frizzled homolog 9 (Drosophila) (Fzd9) expression. 6 target genes (Rasgrf1, clathrin, heavy chain [Cltc], Slc38a2, Cplx1, choroideremia-like (Rab escort protein 2) [Chml], ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9) [Atp5g1]) showed no regulation upon Egr/Mef2c overexpression in any experimental condition. Another group of 8 target genes (potassium voltage-gated channel, shaker-related subfamily, member 1 [Kcna1], intercellular adhesion molecule 5, telencephalin [Icam5], potassium channel, subfamily V, member 1 [Kcnv1], solute carrier family 12 (potassium/ chloride transporter), member 5 [Slc12a5], protein kinase C and casein kinase substrate in neurons 1 [Pacsin1], Kctd15, CD151 molecule (Raph blood group) [Cd151], Cav1) showed only very mild upregulation. Interestingly, certain combinations of transcription factors had a particularly strong influence on the target genes. Combinations of Egr1/4, Egr2/3, Egr1/3/4 and Mef2c/Egr1/2/3 increased the expression of 12 to 15 target genes with at least 2x SD of all controls and thus highly induced the expression of more than 38% of the target genes (Figure 4A). The individual transcription factors Egr1, 2 and 4 only induced the expression of 5 to 9 target genes by more than 2x SD of all controls. Importantly, we excluded Egr1, Egr2 and Egr3 as target genes in the heatmap analysis as their strong overexpression, induced by the transduction with the LV 5 vectors for a specific factor, distorted the representation of the regulation of the other target genes. Overexpression of Egr1 and Egr2 also caused mild expression changes of other Egr family members (Figure 4B). Egr1 induced a 2.8-fold upregulation of Egr2 (> 2x SD of all controls), while Egr2 overexpression reduced Egr3 expression by 2.4-fold (> 1.5x SD of all controls).

Overexpression of Egr1, Egr2, Egr4 and Mef2c induces Aβ neurotoxicity Neurite outgrowth and the formation of synaptic contacts are important measures

221 to study whether neurons and synaptic contact are functionally and structurally compromised in AD. We, therefore, investigated the effect of Egr1 to 4 and Mef2c overexpression on these two cellular features (Figure 5A,B) in primary neuronal cultures stained for MAP2 and VAMP2 to visualize neurites and presynaptic contacts, respectively (Figure 5C). We found, that overexpression of Egr1, Egr2, Egr3, Egr4, Mef2c or combinations of Egr1 to 4 and Mef2c did not have an effect on neurite outgrowth or synapse formation in primary cortical neurons (ANOVA and Bonferroni’s multiple comparison post-hoc test, p > 0.05). Next, we investigated whether Egr1 to 4 and/or Mef2c overexpression can modulate Aβ toxicity in primary neurons. We first studied the effect of extracellularly applied Aβ on the viability of primary cortical neurons with and without Egr1 to 4 or Mef2c overexpression (Figure 6A). 3 µM extracellular Aβ42 in different preparations (diluted in DMSO or PBS, fibrils or oligomers) did not influence cell viability in primary neurons. The overexpression of Egr1 to 4 or Mef2c did not influence cell viability either. However, overexpression of Egr1, Egr2, Egr4 and Mef2c in combination with Aβ diluted in DMSO or PBS significantly decreased cell viability when compared to uninfected neurons treated with the same Aβ preparations (ANOVA and Bonferroni’s multiple comparison post-hoc test, p < 0.05), except for the combinations Egr1 overexpression with Aβ-PBS and Egr2 overexpression with Aβ-DMSO. Preparations of Aβ oligomers or fibrils in combination with Egr1 overexpression did not significantly decrease cell viability compared to uninfected cells. Egr3 overexpression had no effect on Aβ toxicity. We then applied Aβ42 (10 µM) to the primary neuronal cultures and determined neurite length and number of synaptic contacts in neurons with or without Egr1, Egr2 or Egr1/2 overexpression (Figure 6 B and C, respectively). Aβ42 treatment did neither alter neurite outgrowth nor the number of synaptic contacts in primary neurons irrespective of Egr overexpression. As Egr transcription factors might be important mediators of Aβ toxicity, we also investigated whether Egr1 expression is regulated by the application of extracellular Aβ42 (3 µM, different preparations). However, we did not find any significant expression changes of Egr1 that were caused by Aβ42 in primary neurons (Figure 6D). As documented in the previous experiments (Figure 6), extracellularly applied Aβ42 did not cause changes in cell viability, neurite length and number of synaptic contacts in uninfected primary neurons. Previous studies, however, have reported prominent toxic effects of Aβ on primary neurons (Killick et al., 2012; Nguyen et al., 2012). We therefore, decided to investigate whether an increased production of intracellular Aβ shows toxic effects in primary cortical neurons making use of APP-CT100 overexpression. As γ-secretase is active in cultured primary neurons (Dovey et al., 2001) and APP-CT100 is, therefore, cleaved to Aβ (Querfurth and

222 Egr/Mef2c regulate gene expression in Alzheimer's disease

Figure 5 Effects of Egr1 to 4 and/or Mef2c overexpression on neurite outgrowth and synaptic contacts in primary cortical neurons. Overexpression of Egr1 to 4 or combinations of Egr1 to 4 did not have an effect on A) neurite outgrowth or B) synapse formation in primary cortical neurons. Each data point represents 3 biological replicates. All data are normalized to Gfp-infected neurons. C) Neurites were visualized with MAP2 staining (green); synaptic contacts were visualized with VAMP2 staining (red). Neurites and synaptic contacts were automatically measured using algorithms from the Cellomics ArrayScan VTI system.

223 224 Egr/Mef2c regulate gene expression in Alzheimer's disease

Figure 6 The effects of extracellular Aβ on cell viability and Egr1 expression. A) In primary neurons (untreated or infected with empty lentivirus), extracellular Aβ (3 µM, different preparations) did not influence cell viability. Egr1, Egr2, Egr4 and Mef2c overexpression increased Aβ toxicity measured with a cell titer blue assay (ANOVA and Bonferroni’s multiple comparison post-hoc test, p < 0.05). Egr3 overexpression had no effect on Aβ toxicity. B) Neurite outgrowth and C) number of synaptic contacts were not changed when 10 µM Aβ (dissolved in DMSO) were extracellularly applied for 48 h. D) Extracellular Aβ (3 µM, different preparations) did not alter Egr1 mRNA expression levels. Error bars: standard deviation.

LaFerla, 2010), APP-CT100 overexpression in neurons mimics the situation in neurons with increased intracellular protein levels of Aβ as we observed it in Braak stage II in human post-mortem tissue (Bossers et al., 2010). In vitro, neurons that expressed APP-CT100-mCherry also showed strong Aβ immunoreactivity (Figure 7A); yet, the cell viability of APP-CT100 overexpressing neurons did not change (Figure 7B). We found that APP-CT100 overexpressing neurons had significantly shorter neurites and less synaptic contacts per neuron compared to control neurons of the same well without APP-CT100 overexpression (Student’s paired t-test, p < 0.05; Figure C and D, respectively). However, the number of synaptic contacts per unit length of neurite was increased in APP-CT100 overexpressing neurons (Student’s paired t-test, p < 0.05; Figure 7E). As for extracellular Aβ, the overexpression of APP-CT100 did not alter Egr1 mRNA expression levels either (Figure F). These results are important for future experiments investigating the interaction between Egr transcription factors and APP-CT100.

225 Figure 7 APP-CT100 overexpression effects on cell viability, neurite length, synaptic contacts and Egr1 expression in primary neurons. A) APP-CT100 protein overexpression. Cells expressing APP-CT100-mCherry (red) also stained intensely with the 4G8 antibody against Aβ (green). B) APP-CT100 overexpression did not influence cell viability measured with a cell titer blue assay. C) Neurite outgrowth and D) the total number of synaptic contacts per neuron were significantly lower in cells expressing APP-CT100-mCherry compared to cells of the same well that were APP-CT100- mCherry negative (paired t-test, p < 0.05). E) The number of synaptic contacts per unit length of neurite was increased when APP-CT100 was overexpressed (paired t-test, p < 0.05). F) APP-CT100 overexpression did not alter Egr1 mRNA expression levels. Error bars: standard deviation.

226 Egr/Mef2c regulate gene expression in Alzheimer's disease

Discussion

In this study we used LLM3D to predict key transcriptional regulators of a set of genes, which are upregulated during the early stages of AD and encode proteins involved in synaptic plasticity and activity. LLM3D revealed that computationally predicted DNA-binding sites for EGR1 to 4 and MEF2C are overrepresented in the promoter regions of these genes. Overexpression of Egr1, 2 and 4 individually in cultured embryonic primary cortical neurons induced the expression of 16% to 29% of the genes that are also upregulated in the human prefrontal cortex during the initial stages of AD, while combinatorial expression of Egrs and Mef2c, especially the combinations Egr1/4, Egr2/3, Egr1/3/4 and Mef2c/Egr1/2/3, induced between 39% and 48% of the target genes regulated in early AD. Finally, preliminary results suggest that overexpression of Erg1, 2, 4 and Mef2c renders neurons sensitive to the neurotoxic effects of Aβ. These observations might form the basis for further studies on the role of Egrs and Mef2c in the pathogenesis of AD.

EGR1 to 4 and MEF2C as modulators of synaptic activity and plasticity during the development and progression of AD We show here that overexpression of Egr and Mef2c transcription factors resulted in the simultaneous upregulation of the expression of many biocomputationally predicted target genes with various roles in synaptic function (Mgp, Nptx2, Crh, Rdh5, Arc, Tgfb1, Gabrd, Bdnf and to a lesser extent Syt1, Kcnf1, Kctd4, Sox2, Psen2, Snap25, and Lin7b). The regulation of these genes by Egr/Mef2c might be the molecular basis for Egr/Mef2c induced plasticity. Even though Egr1, Egr2, Egr3, Egr4 and Mef2c are known to be important for neural development (Flavell et al., 2008; Funalot et al., 2012; Ludwig et al., 2011; Nakamura et al., 2012; O’Donovan et al., 1999; Paciorkowski et al., 2013; Shiga et al., 2012; Zhang et al., 2012), synaptic plasticity, learning and memory (Akhtar et al., 2012; Bozon et al., 2003; Cole et al., 1989; Hall et al., 2001; Li et al., 2007; O’Donovan et al., 1999; Renaudineau et al., 2009; Thomas et al., 2002; Toscano et al., 2006; Williams et al., 1995) little is known about the underlying molecular mechanisms by which these transcription factors affect plasticity. The observations presented in this study are a first step towards a 5 mechanistic understanding on how Egr and Mef2c transcription factors might contribute to changes of plasticity occurring in AD. It should be noted that the presence of predicted binding sites did not always directly correlate with the induction (or lack thereof) of EGR1 to 4 and MEF2C target genes in our in vitro model system. There are several factors that may explain these apparent discrepancies. Importantly, we should acknowledge the high false positive prediction rates inherent to biocomputational analyses including LLMD3. The in vitro experimental conditions (cultured embryonic cortical neurons) also do

227 only very incompletely resemble the in vivo situation in the human brain and, therefore, some genes might not show the predicted upregulation while others are regulated in culture and in the human brain. The absence of target gene expression may indicate that additional transcription factors that interact with the synaptic activity and plasticity genes (see LLMD3 analysis in Figure 1B) are needed to direct the upregulation of these genes. The induction of a target gene without a binding site for the overexpressed transcription factor may suggest that the regulation occurs indirectly or via uncharacterized binding sites. Perhaps most important, the mechanisms underlying the expression and activity of EGR family members are very complex. Firstly, all EGRs bind to and activate transcription from the same consensus motif TGCG[T/g][G/A]GG[C/a/t]G[G/T] (lowercase denotes less frequently observed bases, (Swirnoff and Milbrandt, 1995). EGR1 also binds sequences that are divergent from this consensus. EGR1-3 bind with similar affinities to the consensus sequence, but EGR4 has a 3-fold lower affinity. The magnitude of target gene expression may thus also depend on the amount of LV-mediated expression of EGR1 to 4 compared to native EGR1 to 4 levels (Figure 4B). Also, these data suggest that EGRs can compete for binding to the same binding site in a particular target gene, making it difficult to computationally predict the exact effects of combinatorial expression of multiple EGR members on target gene expression. Secondly, several EGRs bind to their own promotors and/or those of other EGR family members and influence their expression (see Table 2 and Figure 4B). Thirdly, EGR1-3 all induce the expression of NAB2, which in turn physically interacts with EGR proteins and thereby negatively modulates their activity. The level of NAB2 induction, however, differs between EGRs: EGR1 and 3 strongly induce NAB2, EGR2 mildy induces NAB2 and combinatiorial expression of EGR1-3 leads to the strongest increase in NAB2 expression (Kumbrink et al., 2010). Most of the regulated target genes, namely Nptx2, Mgp, Crh, Fzd9, Rdh5, Gabrd, Syt1, Kcnf1, Kctd4, Sox2, Psen2, Snap25, and Lin7b, have not been described to have a connection with Egr transcription factors before. Nptx2 was highly upregulated by overexpression of most combinations of Egrs and Mef2c (1.4 to 9.5-fold). Nptx2 is upregulated in Parkinson’s disease where it is expressed in Lewy bodies and plays a key role in synaptic plasticity and dopaminergic nerve cell death via the regulation of AMPA receptors (Moran et al., 2008, 2006; O’Brien et al., 2002, 1999). Our data suggest that Egr/Mef2c regulated expression of Nptx2 might also play an important role in AD. Early neuronal hyperactivity in Braak stage II (Palop and Mucke, 2009) might contribute to increased Nptx2 expression as Nptx2 expression has been shown to be upregulated in response to seizures, i.e. abnormal excessive neuronal activity (Tsui et al., 1996). In a positive feedback mechanism high Nptx2 levels might then further increase neuronal hyperactivity by the induction of excitatory synapses (O’Brien et al., 2002, 1999).

228 Egr/Mef2c regulate gene expression in Alzheimer's disease

The expression of the extracellular matrix gene Mgp was consistently strongly upregulated (4.2 to 20.4-fold) by Egr1, Egr2 and Egr4 and all combinations including at least one of the aforementioned Egr transcription factors. The upregulation was strongest for the combinations of Egr2/3 and Egr2/4. Mgp has a function in regulating extracellular matrix calcification. A mutant form of Mgp causes Keutel syndrome, a disease with calcifications of soft tissues, which lead to compromises in cerebral blood flow and mental retardation (Hur et al., 2005; Munroe et al., 1999). Increased expression of Mgp in Braak stage II may thus result in dysregulated calcium homeostasis and changes in the extracellular matrix in early AD which can directly influence synaptic transmission and cognitive function (Chakroborty et al., 2012a, 2012b; Gogolla et al., 2009; Pizzorusso et al., 2002). Crh expression was most clearly upregulated by Mef2c overexpression and combinations of Mef2c and Egrs (up to 20.6-fold upregulated). Egr transcription factors alone did have a much weaker effect on Crh expression. A marked reduction in Crh has been observed in association with AD (Whitehouse et al., 1987). Crh is released in response to stress and accelerates neuropathology and cognitive decline in mouse models for AD (Dong et al., 2012; Kang et al., 2007; Rissman et al., 2007). Our data suggest that an increase of Crh in early stages of AD (Bossers et al., 2010) might be mediated by Mef2c/Egrs. Importantly, both Mgp and Crh were strongly upregulated by Egrs and Mef2c, which were not predicted to bind to their promotor regions. These unexpected regulations are most likely due to indirect effects as discussed above. Arc is an immediate-early gene and probably the gene most clearly associated with neuronal plasticity, long-term potentiation and memory consolidation (reviewed in Bramham et al., 2010, 2008). It has been reported earlier that Egr1 increases the expression of Arc in the hippocampus of mice (Penke et al., 2011). Arc is downregulated together with Egr1 expression in late stages of AD pathology (Dickey et al., 2003) and Arc expression patterns are disrupted near plaques in APP transgenic mice (Rudinskiy et al., 2012). Our results support the view that Arc expression changes in AD are mediated by Egr transcription factors. Here we show that Egr transcription factors induced the expression of the 5 neurotrophin Bdnf. Other studies demonstrated that Bdnf regulates the expression of Egr1, although both down- (Glorioso et al., 2006) and upregulation (Szekeres et al., 2010) have been reported. Moreover, Bdnf down regulates the expression of Egr2 (Glorioso et al., 2006) and robustly induces Egr4 expression (Ludwig et al., 2011). Additionally, we report here that Mef2c mildly induced Bdnf expression in mouse primary cortical neurons. In line with this finding, Mef2c knockdown has been shown to impair Bdnf expression upon neuronal depolarization (Lyons et al., 2012) indicating that Mef2c is necessary for Bdnf expression. Yet Bdnf has also been

229 shown to activate Mef2c expression (Cavanaugh et al., 2001). Taken together these observations suggest mutual feedback mechanisms between Egr transcription factors, Mef2c and Bdnf. Bdnf also induces the expression of the synaptic vesicle protein Snap25 (Takei et al., 1997). It is thus possible that the induction of Snap25 following Egr overexpression, as we observed here, is an indirect effect mediated by Bdnf. In line with our results, it is long known that Egr1 and Tgfb1 induce the expression of one another (Chen et al., 2006; Liu et al., 1996). Importantly, our results show that only overexpression conditions including Egr1 show a clear upregulation of Tgfb1. This indicates that Tgfb1 is specifically upregulated by Egr1, and not other Egr family members even though it has predicted binding sites for Egr1, Egr2 and Egr4. As described above Egrs and Mef2c are involved in memory formation. In later stages of AD, EGR and MEF2C expression is decreased and this may result in a decreased expression of genes with synaptic function and consequently cognitive decline. This view is supported by an earlier finding that aged APP+PS1 transgenic mice which show cognitive deficits have reduced Egr1 mRNA expression in brain regions with amyloid deposition (Dickey et al., 2003). Fzd9 was the only target gene consistently downregulated with Egr/Mef2c overexpression. In sporadic AD, however, we observed an upregulation of Fzd9 in Braak stage II (Bossers et al., 2010). The observations presented here indicate that the upregulation of Fzd9 in human tissue seems to be directed by means other than Egrs and Mef2c, may it be other transcription factors or (the absence of) microRNAs. Alternatively, differences in the in vitro and in vivo situation could account for these discrepancies. Egr and Mef2c overexpression did not alter neurite length or the number of synaptic contacts in cultured primary neurons. The embryonic cortical neurons used here are very plastic and express relatively high endogenous levels of Egr and Mef2c. It is, therefore, conceivable that the endogenous levels of these transcription factors already yield the maximum effect on neurite outgrowth and synapse formation.

The effects of Egr1 to 4 and Mef2c on Aβ-induced synaptotoxicity In post-mortem human brain tissue intraneuronal Aβ levels are increased in the earliest, presymptomatic stages of AD (Braak stage II, Bossers et al., 2010). This increase occurs at the same time when the expression of EGR1 to 4 and MEF2C transcription factors is increased. The data presented in this study suggest that EGR1 to 4 and MEF2C are key transcriptional regulators of a cohort of genes that regulate synaptic activity early in AD. These transcription factors might be part of an endogenous compensatory mechanism that initially counteracts the detrimental

230 Egr/Mef2c regulate gene expression in Alzheimer's disease

effects of increased Aβ levels on synaptic transmission and plasticity (Cleary et al., 2005; Kessels et al., 2010; Koffie et al., 2011; LaFerla et al., 2007; Wei et al., 2010), i.e. they may help to protect against the synaptotoxic effects of increased intraneuronal Aβ by increasing synaptic activity and plasticity. Alternatively, the increase of EGR and MEF2C levels might cause an increase of synaptic activity and plasticity which contributes to neuronal hyperactivity that occurs in early stages of AD (Palop and Mucke, 2009) and may later later stimulate a pathological buildup of synaptotoxic Aβ (Cirrito et al., 2005; Kamenetz et al., 2003). This might imply that enhanced expression of EGRs and MEF2C is a process that promotes the initiation of the disease. Due to the observed connections between Egr/Mef2c transcription factors, synaptic function and Aβ levels we hypothesized that the overexpression of Egr and Mef2c transcription factors might directly influence Aβ induced neuronal toxicity. Indeed, in primary neurons that overexpressed Egr1, Egr2, Egr4 and Mef2c Aβ induced a moderate degree of cell death. Contrary to other reports (Killick et al., 2012) Aβ alone did not reduce the viability of primary neurons. Increased Aβ toxicity upon Egr or Mef2c overexpression suggests that these transcription factors might provide a vulnerable state for Aβ mediated toxicity in rodent primary neurons. We could not show that extracellular Aβ induced the expression of Egr1 as reported by Killick et al. (2012). Intracellular APP-CT100 overexpression, which consequently leads to increased intracellular Aβ levels, did also not increase Egr1 expression. Considering the hypothesis that the high expression of synaptic genes reflects hyperactivity and may cause Aβ release, it would be interesting to investigate whether endogenous Aβ production is increased upon Egr and Mef2c overexpression. Previous studies have shown that the overexpression of APP-CT100 in hippocampal slices reduces synaptic plasticity, the number of dendritic spines and causes synaptic depression (Hsieh et al., 2006; Kamenetz et al., 2003; Wei et al., 2010). Here we show that APP-CT100 overexpression caused a reduction of the length of neurites measured by MAP2 staining and thereby a reduction in the number of presynaptic contacts (measured by VAMP2 staining) per neuron. Yet, 5 the number of presynaptic contacts per unit length of neurite was increased. This may indicate that the formation of more synaptic contacts on the remaining neurites is a compensatory response to the synaptotoxic effects of APP-CT100 overexpression.

Conclusions Taken together, we here provide evidence for the involvement of Egr and Mef2c transcription factors in early AD. We show that they regulate synaptic activity and

231 plasticity genes that are upregulated in early stages of the disease (Braak II). Moreover, Egr transcription factors make neurons more vulnerable to the toxic effects of Aβ in culture. These data contribute to a mechanistic understanding on how changes in synapse functions and Aβ neuropathology might be mediated in early stages of AD. A number of combinations of transcription factor combinations (Egr1/4, Egr2/3, Egr1/3/4 and Mef2c/Egr1/2/3) deserve special attention in future experiments as they strongly increase the expression of the highest number of synaptic activity and plasticity genes that are also altered in AD. These results form the basis for future experiments to directly investigate the effects of Egr transcription factors in combination with Aβ application or APP-CT100 overexpression on synaptic plasticity in brain slices and in vivo.

232 Egr/Mef2c regulate gene expression in Alzheimer's disease

References

Akhtar MW, Kim M-S, Adachi M, Morris MJ, Qi X, Richardson JA, et al. In vivo analysis of MEF2 transcription factors in synapse regulation and neuronal survival. PLoS ONE 2012; 7: e34863. Arendt T. Synaptic degeneration in Alzheimer’s disease. Acta Neuropathol. 2009; 118: 167–179. Bossers K, Wirz KTS, Meerhoff GF, Essing AHW, van Dongen JW, Houba P, et al. Concerted changes in transcripts in the prefrontal cortex precede neuropathology in Alzheimer’s disease. Brain 2010; 133: 3699–723. Bozon B, Davis S, Laroche S. A requirement for the immediate early gene zif268 in reconsolidation of recognition memory after retrieval. Neuron 2003; 40: 695–701. Braak H, Braak E. Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 1991; 82: 239―259. Bramham CR, Alme MN, Bittins M, Kuipers SD, Nair RR, Pai B, et al. The Arc of synaptic memory. Exp Brain Res 2010; 200: 125–140. Bramham CR, Worley PF, Moore MJ, Guzowski JF. The immediate early gene arc/arg3.1: regulation, mechanisms, and function. J. Neurosci. 2008; 28: 11760–11767. Brown JT, Chin J, Leiser SC, Pangalos MN, Randall AD. Altered intrinsic neuronal excitability and reduced Na+ currents in a mouse model of Alzheimer’s disease. Neurobiol. Aging 2011; 32: 2109.e1–14. Busche MA, Eichhoff G, Adelsberger H, Abramowski D, Wiederhold K-H, Haass C, et al. Clusters of hyperactive neurons near amyloid plaques in a mouse model of Alzheimer’s disease. Science 2008; 321: 1686–1689. Cavanaugh JE, Ham J, Hetman M, Poser S, Yan C, Xia Z. Differential Regulation of Mitogen-Activated Protein Kinases ERK1/2 and ERK5 by Neurotrophins, Neuronal Activity, and cAMP in Neurons. J. Neurosci. 2001; 21: 434–443. Celone KA, Calhoun VD, Dickerson BC, Atri A, Chua EF, Miller SL, et al. Alterations in memory networks in mild cognitive impairment and Alzheimer’s disease: an independent component analysis. J. Neurosci. 2006; 26: 10222–10231. Chafekar SM, Hoozemans JJM, Zwart R, Baas F, Scheper W. Abeta 1-42 induces mild endoplasmic reticulum stress in an aggregation state-dependent manner. Antioxid. Redox Signal. 2007; 9: 2245–2254. Chakroborty S, Briggs C, Miller MB, Goussakov I, Schneider C, Kim J, et al. Stabilizing ER Ca2+ channel function as an early preventative strategy for Alzheimer’s disease. PLoS ONE 2012; 7: e52056. Chakroborty S, Kim J, Schneider C, Jacobson C, Molgó J, Stutzmann GE. Early presynaptic and postsynaptic calcium signaling abnormalities mask underlying synaptic depression in presymptomatic Alzheimer’s disease mice. J. Neurosci. 2012; 32: 8341–8353. Chen S-J, Ning H, Ishida W, Sodin-Semrl S, Takagawa S, Mori Y, et al. The early-immediate gene EGR-1 is induced by transforming growth factor-beta and mediates stimulation of collagen gene expression. J. Biol. Chem. 2006; 281: 21183–21197. Cirrito JR, Yamada KA, Finn MB, Sloviter RS, Bales KR, May PC, et al. Synaptic activity regulates interstitial fluid amyloid-beta levels in vivo. Neuron 2005; 48: 913–922. Cleary JP, Walsh DM, Hofmeister JJ, Shankar GM, Kuskowski MA, Selkoe DJ, et al. Natural oligomers of the 5 amyloid-beta protein specifically disrupt cognitive function. Nat.Neurosci. 2005; 8: 79–84. Cole AJ, Saffen DW, Baraban JM, Worley PF. Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation. Nature 1989; 340: 474–476. Dickerson BC, Salat DH, Bates JF, Atiya M, Killiany RJ, Greve DN, et al. Medial temporal lobe function and structure in mild cognitive impairment. Ann. Neurol. 2004; 56: 27–35. Dickerson BC, Salat DH, Greve DN, Chua EF, Rand-Giovannetti E, Rentz DM, et al. Increased hippocampal activation in mild cognitive impairment compared to normal aging and AD. Neurology 2005; 65: 404–411. Dickey CA, Loring JF, Montgomery J, Gordon MN, Eastman PS, Morgan D. Selectively reduced expression of synaptic plasticity-related genes in amyloid precursor protein + presenilin-1 transgenic mice. J. Neurosci 2003; 23: 5219–5226.

233 Dong H, Murphy KM, Meng L, Montalvo-Ortiz J, Zeng Z, Kolber BJ, et al. Corticotrophin releasing factor accelerates neuropathology and cognitive decline in a mouse model of Alzheimer’s disease. J. Alzheimers Dis. 2012; 28: 579–592. Dovey HF, John V, Anderson JP, Chen LZ, De Saint Andrieu P, Fang LY, et al. Functional gamma-secretase inhibitors reduce beta-amyloid peptide levels in brain. Journal of Neurochemistry 2001; 76: 173–181. Dubelaar EJ, Mufson EJ, ter Meulen WG, Van Heerikhuize JJ, Verwer RW, Swaab DF. Increased metabolic activity in nucleus basalis of Meynert neurons in elderly individuals with mild cognitive impairment as indicated by the size of the Golgi apparatus. J.Neuropathol.Exp.Neurol. 2006; 65: 257–266. Flavell SW, Kim T-K, Gray JM, Harmin DA, Hemberg M, Hong EJ, et al. Genome-wide analysis of MEF2 transcriptional program reveals synaptic target genes and neuronal activity-dependent polyadenyl- ation site selection. Neuron 2008; 60: 1022–1038. Funalot B, Topilko P, Arroyo MAR, Sefiani A, Hedley-Whyte ET, Yoldi ME, et al. Homozygous deletion of an EGR2 enhancer in congenital amyelinating neuropathy. Ann. Neurol. 2012; 71: 719–723. Geeven G, Macgillavry HD, Eggers R, Sassen MM, Verhaagen J, Smit AB, et al. LLM3D: a log-linear modeling-based method to predict functional gene regulatory interactions from genome-wide expression data. Nucleic Acids Res. 2011; 39: 5313–5327. Glorioso C, Sabatini M, Unger T, Hashimoto T, Monteggia LM, Lewis DA, et al. Specificity and timing of neocortical transcriptome changes in response to BDNF gene ablation during embryogenesis or adulthood. Mol. Psychiatry 2006; 11: 633–648. Gogolla N, Caroni P, Lüthi A, Herry C. Perineuronal nets protect fear memories from erasure. Science 2009; 325: 1258–1261. Hall J, Thomas KL, Everitt BJ. Cellular imaging of zif268 expression in the hippocampus and amygdala during contextual and cued fear memory retrieval: selective activation of hippocampal CA1 neurons during the recall of contextual memories. J. Neurosci. 2001; 21: 2186–2193. Hämäläinen A, Pihlajamäki M, Tanila H, Hänninen T, Niskanen E, Tervo S, et al. Increased fMRI responses during encoding in mild cognitive impairment. Neurobiol. Aging 2007; 28: 1889–1903. Heinonen O, Soininen H, Sorvari H, Kosunen O, Paljärvi L, Koivisto E, et al. Loss of synaptophysin-like immunoreactivity in the hippocampal formation is an early phenomenon in Alzheimer’s disease. Neuroscience 1995; 64: 375–384. Hsieh H, Boehm J, Sato C, Iwatsubo T, Tomita T, Sisodia S, et al. AMPAR removal underlies Abeta-induced synaptic depression and dendritic spine loss. Neuron 2006; 52: 831–843. Hur DJ, Raymond GV, Kahler SG, Riegert-Johnson DL, Cohen BA, Boyadjiev SA. A novel MGP mutation in a consanguineous family: review of the clinical and molecular characteristics of Keutel syndrome. Am. J. Med. Genet. A 2005; 135: 36–40. Kamenetz F, Tomita T, Hsieh H, Seabrook G, Borchelt D, Iwatsubo T, et al. APP processing and synaptic function. Neuron 2003; 37: 925–937. Kang JE, Cirrito JR, Dong H, Csernansky JG, Holtzman DM. Acute stress increases interstitial fluid amyloid-beta via corticotropin-releasing factor and neuronal activity. Proc.Natl.Acad.Sci.U.S.A 2007; 104: 10673–10678. Kessels HW, Nguyen LN, Nabavi S, Malinow R. The prion protein as a receptor for amyloid-beta. Nature 2010; 466: E3–4; discussion E4–5. Killick R, Ribe EM, Al-Shawi R, Malik B, Hooper C, Fernandes C, et al. Clusterin regulates β-amyloid toxicity via Dickkopf-1-driven induction of the wnt-PCP-JNK pathway. Mol. Psychiatry 2012 Kircher TT, Weis S, Freymann K, Erb M, Jessen F, Grodd W, et al. Hippocampal activation in patients with mild cognitive impairment is necessary for successful memory encoding. J. Neurol. Neurosurg. Psychiatr. 2007; 78: 812–818. Koffie RM, Hyman BT, Spires-Jones TL. Alzheimer’s disease: synapses gone cold. Mol Neurodegener 2011; 6: 63. Kumbrink J, Kirsch KH, Johnson JP. EGR1, EGR2, and EGR3 activate the expression of their coregulator NAB2 establishing a negative feedback loop in cells of neuroectodermal and epithelial origin. J. Cell. Biochem. 2010; 111: 207–217.

234 Egr/Mef2c regulate gene expression in Alzheimer's disease

Kutner RH, Zhang X-Y, Reiser J. Production, concentration and titration of pseudotyped HIV-1-based lentiviral vectors. Nat Protoc 2009; 4: 495–505. LaFerla FM, Green KN, Oddo S. Intracellular amyloid-beta in Alzheimer’s disease. Nat.Rev.Neurosci. 2007; 8: 499–509. Lefever S, Vandesompele J, Speleman F, Pattyn F. RTPrimerDB: the portal for real-time PCR primers and probes. Nucleic Acids Res. 2009; 37: D942–945. Li L, Yun SH, Keblesh J, Trommer BL, Xiong H, Radulovic J, et al. Egr3, a synaptic activity regulated transcription factor that is essential for learning and memory. Mol. Cell. Neurosci. 2007; 35: 76–88. Liu C, Adamson E, Mercola D. Transcription factor EGR-1 suppresses the growth and transformation of human HT-1080 fibrosarcoma cells by induction of transforming growth factor beta 1. Proc. Natl. Acad. Sci. U.S.A. 1996; 93: 11831–11836. Logan AC, Nightingale SJ, Haas DL, Cho GJ, Pepper KA, Kohn DB. Factors influencing the titer and infectivity of lentiviral vectors. Hum. Gene Ther. 2004; 15: 976–988. Ludwig A, Uvarov P, Soni S, Thomas-Crusells J, Airaksinen MS, Rivera C. Early growth response 4 mediates BDNF induction of potassium chloride cotransporter 2 transcription. J. Neurosci. 2011; 31: 644–649. Lyons MR, Schwarz CM, West AE. Members of the myocyte enhancer factor 2 transcription factor family differentially regulate Bdnf transcription in response to neuronal depolarization. J. Neurosci. 2012; 32: 12780–12785. Masliah E, Mallory M, Hansen L, DeTeresa R, Alford M, Terry R. Synaptic and neuritic alterations during the progression of Alzheimer’s disease. Neurosci. Lett. 1994; 174: 67–72. Mason MRJ, Ehlert EME, Eggers R, Pool CW, Hermening S, Huseinovic A, et al. Comparison of AAV serotypes for gene delivery to dorsal root ganglion neurons. Mol. Ther. 2010; 18: 715–724. Minkeviciene R, Rheims S, Dobszay MB, Zilberter M, Hartikainen J, Fulop L, et al. Amyloid beta-induced neuronal hyperexcitability triggers progressive epilepsy. J.Neurosci. 2009; 29: 3453–3462. Moran LB, Duke DC, Deprez M, Dexter DT, Pearce RK, Graeber MB. Whole genome expression profiling of the medial and lateral substantia nigra in Parkinson’s disease. Neurogenetics. 2006; 7: 1–11. Moran LB, Hickey L, Michael GJ, Derkacs M, Christian LM, Kalaitzakis ME, et al. Neuronal pentraxin II is highly upregulated in Parkinson’s disease and a novel component of Lewy bodies. Acta Neuropathol. 2008; 115: 471–478. Munroe PB, Olgunturk RO, Fryns JP, Van Maldergem L, Ziereisen F, Yuksel B, et al. Mutations in the gene encoding the human matrix Gla protein cause Keutel syndrome. Nat. Genet. 1999; 21: 142–144. Nakamura T, Hashiguchi A, Suzuki S, Uozumi K, Tokunaga S, Takashima H. Vincristine exacerbates asymptomatic Charcot-Marie-tooth disease with a novel EGR2 mutation. Neurogenetics 2012; 13: 77–82. Naldini L, Blömer U, Gage FH, Trono D, Verma IM. Efficient transfer, integration, and sustained long-term expression of the transgene in adult rat brains injected with a lentiviral vector. Proc. Natl. Acad. Sci. U.S.A. 1996; 93: 11382–11388. Naldini L, Blömer U, Gallay P, Ory D, Mulligan R, Gage FH, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996; 272: 263–267. Nguyen L, Wright S, Lee M, Ren Z, Sauer J-M, Hoffman W, et al. Quantifying amyloid beta (Aβ)-mediated 5 changes in neuronal morphology in primary cultures: implications for phenotypic screening. J Biomol Screen 2012; 17: 835–842. O’Brien R, Xu D, Mi R, Tang X, Hopf C, Worley P. Synaptically targeted narp plays an essential role in the aggregation of AMPA receptors at excitatory synapses in cultured spinal neurons. J. Neurosci. 2002; 22: 4487–4498. O’Brien RJ, Xu D, Petralia RS, Steward O, Huganir RL, Worley P. Synaptic clustering of AMPA receptors by the extracellular immediate-early gene product Narp. Neuron 1999; 23: 309–323. O’Donovan KJ, Tourtellotte WG, Millbrandt J, Baraban JM. The EGR family of transcription-regulatory factors: progress at the interface of molecular and systems neuroscience. Trends Neurosci. 1999; 22: 167–173.

235 Paciorkowski AR, Traylor RN, Rosenfeld JA, Hoover JM, Harris CJ, Winter S, et al. MEF2C Haploinsuffi- ciency features consistent hyperkinesis, variable epilepsy, and has a role in dorsal and ventral neuronal developmental pathways. Neurogenetics 2013; 14: 99-111. Palop JJ, Chin J, Roberson ED, Wang J, Thwin MT, Bien-Ly N, et al. Aberrant excitatory neuronal activity and compensatory remodeling of inhibitory hippocampal circuits in mouse models of Alzheimer’s disease. Neuron 2007; 55: 697–711. Palop JJ, Mucke L. Epilepsy and cognitive impairments in Alzheimer disease. Arch. Neurol. 2009; 66: 435–440. Penke Z, Chagneau C, Laroche S. Contribution of Egr1/zif268 to Activity-Dependent Arc/Arg3.1 Transcription in the Dentate Gyrus and Area CA1 of the Hippocampus. Front Behav Neurosci 2011; 5: 48. Pizzorusso T, Medini P, Berardi N, Chierzi S, Fawcett JW, Maffei L. Reactivation of ocular dominance plasticity in the adult visual cortex. Science 2002; 298: 1248–1251. Querfurth HW, LaFerla FM. Alzheimer’s disease. N. Engl. J. Med. 2010; 362: 329–344. R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing. Vienna, Austria. 2012 Available from: http://www.R-project.org/ Renaudineau S, Poucet B, Laroche S, Davis S, Save E. Impaired long-term stability of CA1 place cell representation in mice lacking the transcription factor zif268/egr1. Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 11771–11775. Renbaum P, Beeri R, Gabai E, Amiel M, Gal M, Ehrengruber MU, et al. Egr-1 upregulates the Alzheimer’s disease presenilin-2 gene in neuronal cells. Gene 2003; 318: 113–124. Rissman RA, Lee K-F, Vale W, Sawchenko PE. Corticotropin-releasing factor receptors differentially regulate stress-induced tau phosphorylation. J. Neurosci. 2007; 27: 6552–6562. Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editor(s). Bioinformatics Methods and Protocols: Methods in Molecular Biology. Totowa, NJ: Humana Press; 2000. p. 365–386. Rudinskiy N, Hawkes JM, Betensky RA, Eguchi M, Yamaguchi S, Spires-Jones TL, et al. Orchestrated experience-driven Arc responses are disrupted in a mouse model of Alzheimer’s disease. Nat. Neurosci. 2012; 15: 1422–1429. Shiga K, Noto Y, Mizuta I, Hashiguchi A, Takashima H, Nakagawa M. A novel EGR2 mutation within a family with a mild demyelinating form of Charcot-Marie-Tooth disease. J. Peripher. Nerv. Syst. 2012; 17: 206–209. Swirnoff AH, Milbrandt J. DNA-binding specificity of NGFI-A and related zinc finger transcription factors. Mol. Cell. Biol. 1995; 15: 2275–2287. Szekeres M, Nádasy GL, Turu G, Süpeki K, Szidonya L, Buday L, et al. Angiotensin II-induced expression of brain-derived neurotrophic factor in human and rat adrenocortical cells. Endocrinology 2010; 151: 1695–1703. Szymczak-Workman AL, Vignali KM, Vignali DAA. Design and construction of 2A peptide-linked multicistronic vectors. Cold Spring Harb Protoc 2012; 2012: 199–204. Takei N, Sasaoka K, Inoue K, Takahashi M, Endo Y, Hatanaka H. Brain-derived neurotrophic factor increases the stimulation-evoked release of glutamate and the levels of exocytosis-associated proteins in cultured cortical neurons from embryonic rats. J. Neurochem. 1997; 68: 370–375. Thomas KL, Hall J, Everitt BJ. Cellular imaging with zif268 expression in the rat nucleus accumbens and frontal cortex further dissociates the neural pathways activated following the retrieval of contextual and cued fear memory. Eur. J. Neurosci. 2002; 16: 1789–1796. Toscano CD, McGlothan JL, Guilarte TR. Experience-dependent regulation of zif268 gene expression and spatial learning. Exp. Neurol. 2006; 200: 209–215. Tsui CC, Copeland NG, Gilbert DJ, Jenkins NA, Barnes C, Worley PF. Narp, a novel member of the pentraxin family, promotes neurite outgrowth and is dynamically regulated by neuronal activity. J. Neurosci. 1996; 16: 2463–2478. Wei W, Nguyen LN, Kessels HW, Hagiwara H, Sisodia S, Malinow R. Amyloid beta from axons and dendrites reduces local spine number and plasticity. Nat. Neurosci. 2010; 13: 190–196.

236 Egr/Mef2c regulate gene expression in Alzheimer's disease

Whitehouse PJ, Vale WW, Zweig RM, Singer HS, Mayeux R, Kuhar MJ, et al. Reductions in corticotropin releasing factor-like immunoreactivity in cerebral cortex in Alzheimer’s disease, Parkinson’s disease, and progressive supranuclear palsy. Neurology 1987; 37: 905–909. Williams J, Dragunow M, Lawlor P, Mason S, Abraham WC, Leah J, et al. Krox20 may play a key role in the stabilization of long-term potentiation. Brain Res. Mol. Brain Res. 1995; 28: 87–93. Zhang R, Lu S, Meng L, Min Z, Tian J, Valenzuela RK, et al. Genetic evidence for the association between the early growth response 3 (EGR3) gene and schizophrenia. PLoS ONE 2012; 7: e30237.

237