DOCSLIB.ORG

Egr/Mef2c Transcription Factors Regulate The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Egr/Mef2c Transcription Factors Regulate The VU Research Portal Molecular changes during the development of Alzheimer's disease Wirz, K.T.S. 2013 document version Publisher's PDF, also known as Version of record Link to publication in VU Research Portal citation for published version (APA) Wirz, K. T. S. (2013). Molecular changes during the development of Alzheimer's disease. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. E-mail address: [email protected] Download date: 30. Sep. 2021 5 Egr/Mef2c transcription factors regulate the expression of genes potentially involved in the modulation of synaptic activity and plasticity during the early stages of Alzheimer’s disease Kerstin TS Wirz 1, Ronald E van Kesteren 2, Anke HW Essing 1, Marion JM Sassen 2, August B Smit 2, Dick F Swaab 3, Joost Verhaagen 1,2 and Koen Bossers 1,3 manuscript in preparation 1 Laboratory for Neuroregeneration, Netherlands Institute for Neuroscience, An Institute of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, The Netherlands. 2 Center for Neurogenomics and Cognitive Research, Neuroscience Campus Amsterdam, VU University, Amsterdam, The Netherlands 3 Laboratory for Neuropsychiatric Disorders, Netherlands Institute for Neuroscience, An Institute of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, The Netherlands. Abstract Early in the pathogenesis of Alzheimer’s disease (AD), at Braak stage II, we have recently discovered in the human prefrontal cortex an increased expression of synaptic genes as well as a decreased expression in inflammation and proliferation genes. Here we employed a log-linear modeling-based method of 3D contingency tables (LLM3D) to investigate the interaction between these regulated genes, transcription factor binding sites and gene ontology (GO) categories. This analysis identified a significant enrichment for binding sites of all members of the early growth response family (EGR1 to 4) and for myocyte enhancer factor 2C (MEF2C) in the promoters of a set of genes involved in synaptic activity and plasticity that were upregulated during early presymptomatic stages of AD. The expression patterns of all 4 EGR transcription factors and MEF2C correlated with the expression of these synaptic activity and plasticity genes over the Braak stages. Following this in silico analysis, we tested whether EGR/MEF2C transcription factors are directly involved in the increased expression of synaptic activity and plasticity genes seen in early stages of AD and in Aβ-induced toxicity. We overexpressed Egr1 to 4 and Mef2c transcription factors in mouse primary cortical neurons and measured the effect on synaptic activity and plasticity gene expression with real-time RT-qPCR. Lentivirus-based overexpression of Egr1, 2 and 4 individually induced the expression of 16% to 29% of the genes tested, while combinatorial expression of Egrs and Mef2c, specifically the combinations Egr1/4, Egr2/3, Egr1/3/4 and Mef2c/Egr1/2/3, induced between 39% and 48% of the target genes regulated in early AD. Furthermore, we found that overexpression of APP-CT100 (the β-secretase product of APP and precursor to Aβ) reduced neurite length and the number of synaptic contacts per neuron. Overexpression of Egr1, Egr2, Egr4 and Mef2c increased Aβ-induced cell death in primary cortical neurons. We conclude that Egr/Mef2c transcription factors can indeed increase the expression of synaptic activity and plasticity genes that are altered in early stages of AD and can modulate Aβ-mediated toxicity. These data contribute to a mechanistic understanding of how changes in synapse function and Aβ neuropathology are mediated in early stages of AD. 200 Egr/Mef2c regulate gene expression in Alzheimer's disease Introduction Alzheimer’s disease (AD) is the most prevalent neurodegenerative disorder and accounts for the vast majority of age-related dementias. In addition to the two classical hallmarks of AD (senile plaques and neurofibrillary tangles), neuronal atrophy and synapse loss are major and early neuropathological features of the disease (Heinonen et al., 1995; Koffie et al., 2011; Masliah et al., 1994) and are thought to significantly contribute to the cognitive decline in AD (reviewed in Arendt, 2009). In the last years substantial evidence has emerged that increased levels of soluble amyloid β (Aβ) inhibit synaptic transmission and plasticity (reviewed in (Koffie et al., 2011; LaFerla et al., 2007). For example, infusion of Aβ oligomers impairs cognitive function (Cleary et al., 2005), and acute neuronal overproduction of Aβ blocks synaptic long-term plasticity and reduces synaptic contacts (Kessels et al., 2010; Wei et al., 2010). Interestingly the production of Aβ itself is affected by synaptic activity. Increased synaptic activity directly promotes the production and secretion of Aβ and the activity-dependent modulation of Aβ might acts as a negative feedback that prevents neuronal hyperexcitation (Cirrito et al., 2005; Kamenetz et al., 2003). In the last decade, a substantial number of studies reported evidence for neuronal hyperactivity in brains of patients with mild-cognitive impairment, a prodromal state of AD (Celone et al., 2006; Dickerson et al., 2005, 2004; Dubelaar et al., 2006; Hämäläinen et al., 2007; Kircher et al., 2007), indicating that neuronal hyperactivity is a very early event in AD. Moreover, in several mouse models of AD that express mutated forms of the human amyloid precursor protein gene which leads to elevated Aβ levels, epileptic activity has been reported (Brown et al., 2011; Busche et al., 2008; Minkeviciene et al., 2009; Palop et al., 2007), indicating that Aβ can induce processes that lead to neuronal hyperactivity. These data combined support the notion that increased Aβ levels are either causally or consequentially linked to network hyperactivity in AD brains. We recently conducted a genome-wide gene expression experiment using microarrays in which we studied the transcriptional alterations in the human 5 post-mortem prefrontal cortex during the development and progression of AD (Bossers et al., 2010) as defined by the Braak stages for neurofibrillary tangles (Braak and Braak, 1991). We observed two large groups of genes whose expression levels either initially decreased or increased in the earliest, non-symptomatic stages of AD (Braak stages 0-II), and then sharply rose or declined during later symptomatic stages, respectively (DOWNUP and UPDOWN gene clusters described in detail in Bossers et al., 2010). The initial change in transcription was paralleled by an increase in intraneuronal Aβ levels, which disappeared when the 201 first senile plaques appeared. Importantly, the UPDOWN gene expression cluster was significantly enriched for genes involved in synaptic activity and plasticity (e.g. the exocytosis-related genes SNAP25, CPLX1, VAMP7, SYT1, SYT3, SYT4, NAPB and SV2C and the activity dependent plasticity gene early growth response 1 (EGR1; also known as Zif268, NGFI-A, Krox-24, TIS8, ETR103, Krox-1, or Zenk)). These changes in gene expression may be the results of the neuronal hyperactivity. Alternatively, these changes in gene expression may contribute to the molecular basis for the occurrence of neuronal hyperactivity during the earliest preclinical stages of AD. Yet, the functional implications of the increased expression of genes encoding proteins involved in synaptic activity and plasticity for the development of AD remain unclear. An increase in the expression of genes involved in synaptic activity and plasticity may represent an endogenous compensatory mechanism that initially counteracts the detrimental effects of increased Aβ levels on synapse function, and the beneficial effects of this compensation may be lost in later stages of AD when cognitive decline becomes apparent. It is also possible that an increase in synaptic activity and plasticity precedes the dysregulation of Aβ and is responsible for a pathological buildup of Aβ, thereby causing synaptic dysfunction and cognitive decline. The concerted early changes in the expression of genes encoding proteins involved in synaptic plasticity and activity (Bossers et al., 2010) suggests the existence of underlying regulatory mechanisms that direct the expression of these genes during the earliest stages of AD. Here we performed a transcription factor binding site (TFBS) overrepresentation analysis using a recently developed log-linear modeling-based method (LLM3D; Geeven et al., 2011) and demonstrated that binding sites of the transcription factors of the EGR family [EGR1, EGR2 (also known as Krox-20, AT591, CMT1D, CMT4E, NGF1-B, Zfp-25), EGR3 (also called Pilot), and EGR4 (also called NGF1-C, pAT133)] and myocyte enhancer factor-2 c (MEF2C) were overrepresented in the aforementioned synaptic activity and plasticity genes upregulated at early Braak stages.
Load more

Recommended publications
  • Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
    The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP).
    [Show full text]
  • And Represses TNF Gene Expression Activating Transcription Factor-2
    Histone Deacetylase 3, a Class I Histone Deacetylase, Suppresses MAPK11-Mediated Activating Transcription Factor-2 Activation and Represses TNF Gene Expression This information is current as of September 25, 2021. Ulrich Mahlknecht, Jutta Will, Audrey Varin, Dieter Hoelzer and Georges Herbein J Immunol 2004; 173:3979-3990; ; doi: 10.4049/jimmunol.173.6.3979 http://www.jimmunol.org/content/173/6/3979 Downloaded from References This article cites 45 articles, 31 of which you can access for free at: http://www.jimmunol.org/content/173/6/3979.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2004 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Histone Deacetylase 3, a Class I Histone Deacetylase, Suppresses MAPK11-Mediated Activating Transcription Factor-2 Activation and Represses TNF Gene Expression1 Ulrich Mahlknecht,2* Jutta Will,* Audrey Varin,† Dieter Hoelzer,* and Georges Herbein2† During inflammatory events, the induction of immediate-early genes, such as TNF-␣, is regulated by signaling cascades including the JAK/STAT, NF-␬B, and the p38 MAPK pathways, which result in phosphorylation-dependent activation of transcription factors.
    [Show full text]
  • Targeting Endothelial Kruppel-Like Factor 2 (KLF2) in Arteriovenous
    Targeting Endothelial Krüppel-like Factor 2 (KLF2) in Arteriovenous Fistula Maturation Failure A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY (Ph.D.) in the Biomedical Engineering Program Department of Biomedical Engineering College of Engineering and Applied Science 2018 by Keith Louis Saum B.S., Wright State University, 2012 Dissertation Committee: Albert Phillip Owens III, Ph.D. (Committee Chair) Begona Campos-Naciff, Ph.D Christy Holland, Ph.D. Daria Narmoneva, Ph.D. Prabir Roy-Chaudhury, M.D., Ph.D Charuhas Thakar, M.D. Abstract The arteriovenous fistula (AVF) is the preferred form of vascular access for hemodialysis. However, 25-60% of AVFs fail to mature to a state suitable for clinical use, resulting in significant morbidity, mortality, and cost for end-stage renal disease (ESRD) patients. AVF maturation failure is recognized to result from changes in local hemodynamics following fistula creation which lead to venous stenosis and thrombosis. In particular, abnormal wall shear stress (WSS) is thought to be a key stimulus which alters endothelial function and promotes AVF failure. In recent years, the transcription factor Krüppel-like factor-2 (KLF2) has emerged as a key regulator of endothelial function, and reduced KLF2 expression has been shown to correlate with disturbed WSS and AVF failure. Given KLF2’s importance in regulating endothelial function, the objective of this dissertation was to investigate how KLF2 expression is regulated by the hemodynamic and uremic stimuli within AVFs and determine if loss of endothelial KLF2 is responsible for impaired endothelial function.
    [Show full text]
  • Global Mef2 Target Gene Analysis in Skeletal and Cardiac Muscle
    GLOBAL MEF2 TARGET GENE ANALYSIS IN SKELETAL AND CARDIAC MUSCLE STEPHANIE ELIZABETH WALES A DISSERTATION SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY GRADUATE PROGRAM IN BIOLOGY YORK UNIVERSITY TORONTO, ONTARIO FEBRUARY 2016 © Stephanie Wales 2016 ABSTRACT A loss of muscle mass or function occurs in many genetic and acquired pathologies such as heart disease, sarcopenia and cachexia which are predominantly found among the rapidly increasing elderly population. Developing effective treatments relies on understanding the genetic networks that control these disease pathways. Transcription factors occupy an essential position as regulators of gene expression. Myocyte enhancer factor 2 (MEF2) is an important transcription factor in striated muscle development in the embryo, skeletal muscle maintenance in the adult and cardiomyocyte survival and hypertrophy in the progression to heart failure. We sought to identify common MEF2 target genes in these two types of striated muscles using chromatin immunoprecipitation and next generation sequencing (ChIP-seq) and transcriptome profiling (RNA-seq). Using a cell culture model of skeletal muscle (C2C12) and primary cardiomyocytes we found 294 common MEF2A binding sites within both cell types. Individually MEF2A was recruited to approximately 2700 and 1600 DNA sequences in skeletal and cardiac muscle, respectively. Two genes were chosen for further study: DUSP6 and Hspb7. DUSP6, an ERK1/2 specific phosphatase, was negatively regulated by MEF2 in a p38MAPK dependent manner in striated muscle. Furthermore siRNA mediated gene silencing showed that MEF2D in particular was responsible for repressing DUSP6 during C2C12 myoblast differentiation. Using a p38 pharmacological inhibitor (SB 203580) we observed that MEF2D must be phosphorylated by p38 to repress DUSP6.
    [Show full text]
  • Early Growth Response 1 Acts As a Tumor Suppressor in Vivo and in Vitro Via Regulation of P53
    Research Article Early Growth Response 1 Acts as a Tumor Suppressor In vivo and In vitro via Regulation of p53 Anja Krones-Herzig,1 Shalu Mittal,1 Kelly Yule,1 Hongyan Liang,2 Chris English,1 Rafael Urcis,1 Tarun Soni,1 Eileen D. Adamson,2 and Dan Mercola1,3 1Sidney Kimmel Cancer Center, San Diego, California and 2The Burnham Institute; 3Cancer Center, University of California at San Diego, La Jolla, California Abstract human tumor cell lines express little or no Egr1 in contrast to their normal counterparts (9–12). Furthermore, Egr1 is decreased or The early growth response 1 (Egr1) gene is a transcription factor that acts as both a tumor suppressor and a tumor undetectable in small cell lung tumors, human breast tumors promoter. Egr1-null mouse embryo fibroblasts bypass repli- (11, 13), and human gliomas (12). Reexpression of Egr1 in human tumor cells inhibits transformation. The mechanism of suppression cative senescence and exhibit a loss of DNA damage response h and an apparent immortal growth, suggesting loss of p53 involves the direct induction of TGF- 1 leading to an autocrine- functions. Stringent expression analysis revealed 266 tran- mediated suppression of transformation (8), increased fibronectin, scripts with >2-fold differential expression in Egr1-null mouse and plasminogen activator inhibitor (9). Egr1 also has been embryo fibroblasts, including 143 known genes. Of the 143 implicated in the regulation of p53 in human melanoma cells genes, program-assisted searching revealed 66 informative leading to apoptosis (14–16), and the proapoptotic tumor genes linked to Egr1. All 66 genes could be placed on a single suppressor gene PTEN also is directly regulated by Egr1 (17).
    [Show full text]
  • The Transcription Factor Egr1 Is a Direct Regulator of Multiple Tumor
    Cancer Gene Therapy (2006) 13, 115–124 r 2006 Nature Publishing Group All rights reserved 0929-1903/06 $30.00 www.nature.com/cgt REVIEW The transcription factor Egr1 is a direct regulator of multiple tumor suppressors including TGFb1, PTEN, p53, and fibronectin V Baron1, ED Adamson2, A Calogero3, G Ragona3 and D Mercola1,4,5 1Sidney Kimmel Cancer Center, San Diego, CA, USA; 2The Burnham Institute, La Jolla, CA, USA; 3The University of Rome, Rome, Italy; 4The Rebecca and John Moores Cancer Center, University of California at San Diego, La Jolla, CA, USA and 5The Department of Pathology, University of California at Irvine, Irvine, CA, USA Recent studies are reviewed indicating that the transcription factor early growth response-1 (Egr1) is a direct regulator of multiple tumor suppressors including TGFb1, PTEN, p53, and fibronectin. The downstream pathways of these factors display multiple nodes of interaction with each other, suggesting the existence of a functional network of suppressor factors that serve to maintain normal growth regulation and resist the emergence of transformed variants. Paradoxically, Egr1 is oncogenic in prostate cancer. In the majority of these cancers, PTEN or p53 is inactive. It is suggested that these defects in the suppressor network allow for the unopposed induction of TGFb1 and fibronectin, which favor transformation and survival of prostate tumor epithelial cells, and explain the role of Egr1 in prostate cancer. Egr1 is a novel and logical target for intervention by gene therapy methods, and targeting methods are discussed. Cancer Gene Therapy (2006) 13, 115–124. doi:10.1038/sj.cgt.7700896; published online 2 September 2005 Keywords: suppressor network; anoikis; systems biology; prostate cancer; tumor progression Introduction products.
    [Show full text]
  • A Dissertation Entitled the Androgen Receptor
    A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen.
    [Show full text]
  • Cortical Foxp2 Supports Behavioral Flexibility and Developmental Dopamine D1 Receptor Expression
    bioRxiv preprint doi: https://doi.org/10.1101/624973; this version posted May 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Cortical Foxp2 supports behavioral flexibility and developmental dopamine D1 receptor expression Marissa Co, Stephanie L. Hickey, Ashwinikumar Kulkarni, Matthew Harper, Genevieve Konopka* Department of Neuroscience, University of Texas Southwestern Medical Center, Dallas, TX, USA *Correspondence: [email protected] Contact information Genevieve Konopka, Ph.D. Department of Neuroscience, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., ND4.300, Dallas, TX 75390-9111 TEL: 214-648-5135, FAX: 214-648-1801, Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/624973; this version posted May 2, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract FoxP2 encodes a forkhead box transcription factor required for the development of neural circuits underlying language, vocalization, and motor-skill learning. Human genetic studies have associated FOXP2 variation with neurodevelopmental disorders (NDDs), and within the cortex, it is coexpressed and interacts with other NDD-associated transcription factors. Cortical Foxp2 is required in mice for proper social interactions, but its role in other NDD-relevant behaviors and molecular pathways is unknown.
    [Show full text]
  • Egr1 (NM 007913) Mouse Tagged ORF Clone – MG227136 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG227136 Egr1 (NM_007913) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Egr1 (NM_007913) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Egr1 Synonyms: A530045N19Rik; egr; Egr-1; ETR103; Krox-1; Krox-24; Krox24; NGF1-A; NGFI-A; NGFIA; TIS8; Zenk; Zfp-6 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Egr1 (NM_007913) Mouse Tagged ORF Clone – MG227136 ORF Nucleotide >MG227136 representing NM_007913 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) GACGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGGCGCGCCC ATGGCAGCGGCCAAGGCCGAGATGCAATTGATGTCTCCGCTGCAGATCTCTGACCCGTTCGGCTCCTTTC CTCACTCACCCACCATGGACAACTACCCCAAACTGGAGGAGATGATGCTGCTGAGCAACGGGGCTCCCCA GTTCCTCGGTGCTGCCGGAACCCCAGAGGGCAGCGGCGGTAATAGCAGCAGCAGCACCAGCAGCGGGGGC GGTGGTGGGGGCGGCAGCAACAGCGGCAGCAGCGCCTTCAATCCTCAAGGGGAGCCGAGCGAACAACCCT ATGAGCACCTGACCACAGAGTCCTTTTCTGACATCGCTCTGAATAATGAGAAGGCGATGGTGGAGACGAG TTATCCCAGCCAAACGACTCGGTTGCCTCCCATCACCTATACTGGCCGCTTCTCCCTGGAGCCCGCACCC AACAGTGGCAACACTTTGTGGCCTGAACCCCTTTTCAGCCTAGTCAGTGGCCTCGTGAGCATGACCAATC CTCCGACCTCTTCATCCTCGGCGCCTTCTCCAGCTGCTTCATCGTCTTCCTCTGCCTCCCAGAGCCCGCC
    [Show full text]
  • Foxp2 Loss of Function Increases Striatal Direct Pathway Inhibition Via Increased GABA Release
    Brain Structure and Function https://doi.org/10.1007/s00429-018-1746-6 ORIGINAL ARTICLE Foxp2 loss of function increases striatal direct pathway inhibition via increased GABA release Jon‑Ruben van Rhijn1,2,3 · Simon E. Fisher3,4 · Sonja C. Vernes2,4 · Nael Nadif Kasri1,5 Received: 8 March 2018 / Accepted: 31 August 2018 © The Author(s) 2018 Abstract Heterozygous mutations of the Forkhead-box protein 2 (FOXP2) gene in humans cause childhood apraxia of speech. Loss of Foxp2 in mice is known to affect striatal development and impair motor skills. However, it is unknown if striatal excitatory/ inhibitory balance is affected during development and if the imbalance persists into adulthood. We investigated the effect of reduced Foxp2 expression, via a loss-of-function mutation, on striatal medium spiny neurons (MSNs). Our data show that heterozygous loss of Foxp2 decreases excitatory (AMPA receptor-mediated) and increases inhibitory (GABA receptor-medi- ated) currents in D1 dopamine receptor positive MSNs of juvenile and adult mice. Furthermore, reduced Foxp2 expression increases GAD67 expression, leading to both increased presynaptic content and release of GABA. Finally, pharmacological blockade of inhibitory activity in vivo partially rescues motor skill learning deficits in heterozygous Foxp2 mice. Our results suggest a novel role for Foxp2 in the regulation of striatal direct pathway activity through managing inhibitory drive. Keywords Foxp2 · Excitatory-inhibitory balance · Neurodevelopment · D1R-MSN · Striatum Introduction Balanced neuronal activity between cortex, striatum and Sonja C. Vernes and Nael Nadif Kasri contributed equally to this thalamus is essential for the generation of voluntary move- work. ments (Shepherd 2013). Imbalanced activity within the stria- tum is known to disrupt complex motor behaviors, such as Electronic supplementary material The online version of this the production of spoken language (Peach 2004; Square- article (https ://doi.org/10.1007/s0042 9-018-1746-6) contains supplementary material, which is available to authorized users.
    [Show full text]
  • Transcription Factor MEF2C Influences Neural Stem/Progenitor Cell Differentiation and Maturation in Vivo
    Transcription factor MEF2C influences neural stem/progenitor cell differentiation and maturation in vivo Hao Li*†, Jonathan C. Radford*†, Michael J. Ragusa‡, Katherine L. Shea‡, Scott R. McKercher*, Jeffrey D. Zaremba*, Walid Soussou*, Zhiguo Nie*, Yeon-Joo Kang*, Nobuki Nakanishi*, Shu-ichi Okamoto*, Amanda J. Roberts§, John J. Schwarz‡, and Stuart A. Lipton*§¶ *Center for Neuroscience, Aging, and Stem Cell Research, Burnham Institute for Medical Research, La Jolla, CA 92037; ‡Center for Cardiovascular Sciences, Albany Medical Center, Albany, NY 12208; and §Molecular and Integrative Neurosciences Department, The Scripps Research Institute, La Jolla, CA 92037 Edited by Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, TX, and approved May 3, 2008 (received for review March 21, 2008) Emerging evidence suggests that myocyte enhancer factor 2 (MEF2) (7). Therefore, to investigate the role of MEF2C in brain develop- transcription factors act as effectors of neurogenesis in the brain, with ment, we conditionally knocked out Mef2c in neural stem/ MEF2C the predominant isoform in developing cerebrocortex. Here, progenitor cells by E9.5 by using a nestin-driven Cre [see supporting we show that conditional knockout of Mef2c in nestin-expressing information (SI) Materials and Methods) (11). Heterozygous neural stem/progenitor cells (NSCs) impaired neuronal differentiation n-Creϩ/Mef2cloxp/ϩ mice were indistinguishable from wild type in vivo, resulting in aberrant compaction and smaller somal size. NSC (WT) and served as littermate controls. Evidence for Cre-mediated proliferation and survival were not affected. Conditional null mice recombination included PCR, immunofluorescence, and immuno- surviving to adulthood manifested more immature electrophysiolog- blotting. Normally, MEF2 activity (Fig.
    [Show full text]
  • A Mef2 Gene That Generates a Muscle-Specific Isoform Via Alternative Mrna Splicing JAMES F
    MOLECULAR AND CELLULAR BIOLOGY, Mar. 1994, p. 1647-1656 Vol. 14, No. 3 0270-7306/94/$04.00 + 0 Copyright C) 1994, American Society for Microbiology A Mef2 Gene That Generates a Muscle-Specific Isoform via Alternative mRNA Splicing JAMES F. MARTIN,' JOSEPH M. MIANO,' CAROLYN M. HUSTAD,2 NEAL G. COPELAND,2 NANCY A. JENKINS,2 AND ERIC N. OLSON'* Department of Biochemistry and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030,1 and Mammalian Genetics Laboratory, ABL-Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 217022 Received 21 July 1993/Returned for modification 30 September 1993/Accepted 2 December 1993 Members of the myocyte-specific enhancer-binding factor 2 (MEF2) family of transcription factors bind a conserved A/T-rich sequence in the control regions of numerous muscle-specific genes. Mammalian MEF2 proteins have been shown previously to be encoded by three genes, MeQt, xMeJ2, and Me.2c, each of which gives rise to multiple alternatively spliced transcripts. We describe the cloning of a new member of the MEF2 family from mice, termed MEF2D, which shares extensive homology with other MEF2 proteins but is the product of a separate gene. MEF2D binds to and activates transcription through the MEF2 site and forms heterodimers with other members of the MEF2 family. Deletion mutations show that the carboxyl terminus of MEF2D is required for efficient transactivation. MEF2D transcripts are widely expressed, but alternative splicing of MEF2D transcripts gives rise to a muscle-specific isoform which is induced during myoblast differentiation.
    [Show full text]