DOCSLIB.ORG

Transformation Activation to Oncogenic Growth Critical for The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transformation Activation to Oncogenic Growth Critical for The Sustained Expression of the Novel EBV-Induced Zinc Finger Gene, ZNFEB, Is Critical for the Transition of B Lymphocyte Activation to Oncogenic Growth This information is current as Transformation of September 25, 2021. Cathryn E. Tune, Marc Pilon, Yuriko Saiki and H.-Michael Dosch J Immunol 2002; 168:680-688; ; doi: 10.4049/jimmunol.168.2.680 Downloaded from http://www.jimmunol.org/content/168/2/680 References This article cites 63 articles, 26 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/168/2/680.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 25, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Sustained Expression of the Novel EBV-Induced Zinc Finger Gene, ZNFEB, Is Critical for the Transition of B Lymphocyte Activation to Oncogenic Growth Transformation1 Cathryn E. Tune, Marc Pilon, Yuriko Saiki, and H.-Michael Dosch2 EBV is a human tumor virus that infects and establishes latency in the majority of humans worldwide. In vitro, EBV growth transforms primary B lymphocytes into lymphoblastoid cell lines with high efficiency. We have used cDNA subtraction cloning to identify cellular target genes required for growth transformation and identified a new C2H2 (Kru¨ppel-type) zinc finger gene, ZNFEB, that is trans-activated early following EBV infection. In this study, we characterize ZNFEB, including its intronless locus, and human and mouse protein variants. The gene is transiently expressed during normal lymphocyte activation, and its expression is sustained in EBV-positive but not EBV-negative B cell lines. There is limited expression in nonhemopoietic tissues. Its critical Downloaded from role in the growth transformation of B lineage cells is indicated by the abrogation of transformation with antisense strategies. ZNFEB maps to chromosome 18q12, a region with mutations in numerous, predominantly hemopoietic malignancies. The Journal of Immunology, 2002, 168: 680–688. complex series of cellular programs controls entry and and how they diverge toward oncogenic growth transformation. To exit from cell cycling in activated lymphocytes. Disrup- this end, subtractive hybridization has been employed to delineate http://www.jimmunol.org/ tions of critical checkpoints in these processes through genes induced in primary B lymphocytes (8) or EBV-negative A Ϫ 3 genomic accidents in cell cycle control loci represent a key onco- (EBV ) Burkitt’s lymphoma (BL) cell lines freshly infected with genic event. In this study, we have used EBV as a model to analyze EBV. Several novel cellular genes associated with EBV-dependent the transition of lymphocyte activation to growth transformation growth transformation have been identified using this approach and identify a new zinc finger gene, ZNFEB, as a critical, cellular (9–12). target molecule exploited by the virus for the induction of B cell We used cDNA subtraction cloning in the discovery of ZNFEB. growth transformation. It is a new element in B lymphocyte activation responses that EBV EBV, the human herpesvirus 4, infects the majority of humans brings under viral control. Zinc finger proteins are usually DNA- and establishes latency in a small subset of the B lymphocyte com- binding transcription control proteins, and many function in cel- by guest on September 25, 2021 partment (1). In vitro, the virus activates B cells, triggering a clas- lular development and differentiation pathways. Members of this sical, calcium-dependent activation cascade that is prerequisite for, large protein family assume critical roles in cell cycle control, and but by itself insufficient for, subsequent growth transformation (2). their abnormal expression has been associated with the oncogenic Long-term growth transformation of the cells is associated with the transformation of host cells in which the protein resides. We be- coordinate expression of a selected repertoire of EBV-encoded lieve that ZNFEB may serve a similar function in the EBV-driven genes, collectively known as the latency genes. Similar processes growth transformation of B lymphocytes. Interestingly, the occur in vivo during acute infectious mononucleosis (3) and in genomic localization of ZNFEB at 18q12 maps to a region in which healthy virus carriers (4), and they almost certainly play a role in chromosomal aberrations have been found in numerous different the fulminant EBV-positive (EBVϩ) lymphomas of immunocom- malignancies, including many of the B lineage (Mitelman Data- promised patients (5) or susceptible nonhuman primates (6, 7). base of Chromosome Aberrations in Cancer, http://cgap.nci.nih. Thus, the analysis of differentially expressed genes in EBV- gov/Chromosomes/Mitelman), suggesting that ZNFEB is a candi- infected B cells has the dual goal to elucidate cellular signaling date molecule involved in an even broader range of tumors. pathways involved in physiological B cell activation as well as those involved in B cell oncogenesis. It is important to understand which aspects of these two pathways overlap, and at what point Materials and Methods Subtractive hybridization and sequence analysis Except for the use of the Uni-ZAP XR vector (pBluescript phagemid; Strat- Division of Infection, Immunity, Injury, and Repair, The Hospital for Sick Children, agene, La Jolla, CA), the preparation of a subtraction library containing Toronto, Ontario, Canada cDNAs differentially expressed 6 h after EBV infection of normal tonsillar B cells in vitro was done as previously described (8). Briefly, purified Received for publication August 13, 2001. Accepted for publication November 12, 2001. mRNA of infected B cells was depleted of housekeeping transcripts through several cycles of hybridization to 20-fold excess of solid-phase The costs of publication of this article were defrayed in part by the payment of page cDNAs from noninfected B cells of the same tonsil. The remaining tran- charges. This article must therefore be hereby marked advertisement in accordance scripts were cloned and plated at low density, and the inserts of randomly with 18 U.S.C. Section 1734 solely to indicate this fact. 1 This work was supported by the Canadian Institutes for Health Research. C.E.T. is the recipient of a Canadian Institutes for Health Research Doctoral Research Award. 2 Address correspondence and reprint requests to Dr. H.-Michael Dosch, Division of 3 Abbreviations used in this paper: BL, Burkitt’s lymphoma; EBNA, EBV nuclear Infection, Immunity, Injury, and Repair, The Hospital for Sick Children, 555 Uni- Ag; EST, expressed sequence tag; hsp, heat shock protein; LCL, lymphoblastoid cell versity Avenue, Toronto, Ontario, Canada M5G 1X8. E-mail address: hmdosch@ line; LMP1, latent membrane protein 1; ORF, open reading frame; UTR, untranslated sickkids.on.ca region; ZNFEBsv, ZNFEB splice variant. Copyright © 2002 by The American Association of Immunologists 0022-1767/02/$02.00 The Journal of Immunology 681 picked clones were directly amplified by PCR and sequenced on an auto- 2041A, 5Ј-CCAGTGCGGTTTTAATGTAGC-3Ј); ZNFEB splice variant mated DNA sequencer (Amersham Pharmacia Biotech, Mississauga, On- (ZNFEBsv 57, 5Ј-GATTTTTCTGGTGGTCTAGTC-3Ј and 2041A); EBV tario, Canada). nuclear Ag (EBNA)1 (109151, 5Ј-GTAGAAGGCCATTTTTCCAC-3Ј; and 109435A, 5Ј-TTTCTACGTGACTCCTAGCC-3Ј); ␤-glucuronidase EB Cloning and chromosomal localization of ZNF (GUS 1355, 5Ј-GTGATGTGGTCTGTGGCCAA-3Ј; and 1657A, 5Ј-TCT GCTCCATACTCGCTCTG-3Ј); ␤-actin (actin 2445, 5Ј-ACTCTTCCAGC In addition to the initial 257-bp ZNFEB cDNA clone isolated from the CTTCCTTCC-3Ј; and 3011A, 5Ј-TCATAGTCCGCCTAGAAGCA-3Ј). subtraction library, seven overlapping cDNA clones were used to deduce The ZNFEB 67 sequence is present in both ZNFEB and ZNFEBsv. The the complete open reading frame (ORF) of ZNFEB. Two expressed se- ZNFEB 41 primer is specific for sequences that flank the extra exon in quence tags (ESTs) were obtained from the American Type Culture Col- ZNFEBsv, while the ZNFEBsv 57 primer is specific for sequences within lection (Manassas, VA). EST1 (I.M.A.G.E. CloneID 648205) (13) was this extra exon, and thus each will differentiate between splice variants as isolated from a human teratocarcinoma cDNA library (Stratagene), and well as genomic DNA. RT-PCR products were electrophoretically sepa- EST2 (ATCC 157317) was isolated from a Jurkat T cell cDNA library. ϩ rated. Where indicated, gels were blotted to Hybond-N membranes Additional clones were identified in a Jurkat T cell cDNA library (Strat- (Amersham Pharmacia Biotech) and hybridized with the following ␥-32P- agene) and a human thymus ␭gt11 cDNA library (gifts of E. Arpaia, The end-labeled reporter probes (23, 24): ZNFEB and ZNFEBsv (ZNFEB 1858, Hospital for Sick Children, Toronto, Ontario, Canada). The chromosomal 5Ј-CCATTGTGGAGAAGACAGTC-3Ј);
Load more

Recommended publications
  • Molecular Clock Is Involved in Predictive Circadian Adjustment of Renal Function
    Molecular clock is involved in predictive circadian adjustment of renal function Annie Mercier Zubera,1,2, Gabriel Centenoa,2, Sylvain Pradervandb, Svetlana Nikolaevaa,c, Lionel Maquelina, Le´ onard Cardinauxa, Olivier Bonnya,d, and Dmitri Firsova,3 aDepartment of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland; bDNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland; cInstitute of Evolutionary Physiology and Biochemistry, 194223 St-Petersburg, Russia; and dService of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland Edited by Maurice B. Burg, National Heart, Lung, and Blood Institute, Bethesda, MD, and approved August 6, 2009 (received for review May 4, 2009) Renal excretion of water and major electrolytes exhibits a significant anticipate upcoming circadian environmental challenges (activity, circadian rhythm. This functional periodicity is believed to result, at feeding, etc). least in part, from circadian changes in secretion/reabsorption capac- The most obvious manifestation of circadian rhythmicity of renal ities of the distal nephron and collecting ducts. Here, we studied the function is a well-marked difference in the volume of urine forma- molecular mechanisms underlying circadian rhythms in the distal tion/excretion between the day and the night. The urinary excretion nephron segments, i.e., distal convoluted tubule (DCT) and connect- ϩ ϩ Ϫ Ϫ 2ϩ 2ϩ of all major solutes (Na ,K ,Cl , urea, PO4 ,Ca ,Mg )also ing tubule (CNT) and the cortical collecting duct (CCD). Temporal follows a circadian oscillating pattern. Although, renal excretion expression analysis performed on microdissected mouse DCT/CNT or rhythms are apparently synchronized with circadian rhythms of CCD revealed a marked circadian rhythmicity in the expression of a activity/feeding, they have been shown to persist over long periods large number of genes crucially involved in various homeostatic of time under experimental conditions in which external factors functions of the kidney.
    [Show full text]
  • The Microtubule-Associated Protein MAPRE2 Is Involved in Perineural Invasion of Pancreatic Cancer Cells
    1111-1116.qxd 8/9/2009 08:18 Ì ™ÂÏ›‰·1111 INTERNATIONAL JOURNAL OF ONCOLOGY 35: 1111-1116, 2009 The microtubule-associated protein MAPRE2 is involved in perineural invasion of pancreatic cancer cells IVANE ABIATARI1*, SONJA GILLEN1*, TIAGO DeOLIVEIRA1, THERESA KLOSE1, KONG BO1, NATHALIA A. GIESE2, HELMUT FRIESS1 and JÖRG KLEEFF1,3 1Department of General Surgery, Technische Universität München, Munich; 2Department of General Surgery, University of Heidelberg, Heidelberg, Germany; 3Center of Cancer Systems Biology, Department of Medicine, Caritas St. Elizabeth's Medical Center, Tufts University School of Medicine, Boston, MA 02135-2997, USA Received May 4, 2009; Accepted July 10, 2009 DOI: 10.3892/ijo_00000426 Abstract. Perineural invasion of tumor cells is a characteristic Defining molecular mechanisms that allow pancreatic cancer feature of human pancreatic cancer. Unrevealing the molecular cells to grow along and into nerves is therefore important for mechanisms that enable cancer cells to invade and grow along the development of novel therapeutic strategies in pancreatic nerves is important for the development of novel therapeutic cancer, a disease whose incidence virtually mirrors its mortality strategies in this disease. We have previously identified tran- rate (5). We have previously identified and described in detail scriptional changes in highly nerve invasive pancreatic cancer the transcriptome signature of perineural invasion in pancreatic cells. Here we further analyzed one of the identified de- cancer by generating highly nerve invasive pancreatic cancer regulated genes, MAPRE2, a microtubule-associated protein. cells (6). One of the genes that displayed a significant up- MAPRE2 expression was significantly increased in high versus regulation in pancreatic cancer cells with a high potential for less nerve invasive pancreatic cancer cells, and changes of nerve invasion was MAPRE2.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Supplementary Table 1: List of the 316 Genes Regulated During Hyperglycemic Euinsulinemic Clamp in Skeletal Muscle
    Supplementary Table 1: List of the 316 genes regulated during hyperglycemic euinsulinemic clamp in skeletal muscle. UGCluster Name Symbol Fold Change Cytoband Response to stress Hs.517581 Heme oxygenase (decycling) 1 HMOX1 3.80 22q12 Hs.374950 Metallothionein 1X MT1X 2.20 16q13 Hs.460867 Metallothionein 1B (functional) MT1B 1.70 16q13 Hs.148778 Oxidation resistance 1 OXR1 1.60 8q23 Hs.513626 Metallothionein 1F (functional) MT1F 1.47 16q13 Hs.534330 Metallothionein 2A MT2A 1.45 16q13 Hs.438462 Metallothionein 1H MT1H 1.42 16q13 Hs.523836 Glutathione S-transferase pi GSTP1 -1.74 11q13 Hs.459952 Stannin SNN -1.92 16p13 Immune response, cytokines & related Hs.478275 TNF (ligand) superfamily, member 10 (TRAIL) TNFSF10 1.58 3q26 Hs.278573 CD59 antigen p18-20 (protectin) CD59 1.49 11p13 Hs.534847 Complement component 4B, telomeric C4A 1.47 6p21.3 Hs.535668 Immunoglobulin lambda variable 6-57 IGLV6-57 1.40 22q11.2 Hs.529846 Calcium modulating ligand CAMLG -1.40 5q23 Hs.193516 B-cell CLL/lymphoma 10 BCL10 -1.40 1p22 Hs.840 Indoleamine-pyrrole 2,3 dioxygenase INDO -1.40 8p12-p11 Hs.201083 Mal, T-cell differentiation protein 2 MAL2 -1.44 Hs.522805 CD99 antigen-like 2 CD99L2 -1.45 Xq28 Hs.50002 Chemokine (C-C motif) ligand 19 CCL19 -1.45 9p13 Hs.350268 Interferon regulatory factor 2 binding protein 2 IRF2BP2 -1.47 1q42.3 Hs.567249 Contactin 1 CNTN1 -1.47 12q11-q12 Hs.132807 MHC class I mRNA fragment 3.8-1 3.8-1 -1.48 6p21.3 Hs.416925 Carcinoembryonic antigen-related cell adhesion molecule 19 CEACAM19 -1.49 19q13.31 Hs.89546 Selectin E (endothelial
    [Show full text]
  • Activation of NF-Κb Signaling Promotes Prostate Cancer Progression in the Mouse and Predicts Poor Progression and Death in Pati
    SUPPLEMENTARY DATA: Supplementary Figure 1. NF-B signaling is continuously activated in the prostate of - mouse. In order to determine the NF- '- mouse, we crossed the '- mice with NGL, a NF-B reporter mouse. NGL transgenic mice are engineered to express a GFP/luciferase fusion protein under the control of a promoter containing multiple NF-B consensus binding sites (1). Since the NF-'- NGL mouse is activated in the whole body, the relatively high level of background activation does not allow detection of NF- prostate. Therefore, in order to determine the NF-the '- mouse, we grafted the prostates from 'o the kidney capsule of male nude mice using a tissue rescue technique. NF-B activity was measured at 7 weeks after grafting. The bioluminescence imaging shows NF-B signaling is activated (green) in the kidney, where the grafted prostate from ' use resides (B). In panel (A), the control mouse (grafted with the prostate from NGL mouse) has no bioluminescence, illustrating that in the absence of '-, there is not activation of NF- B. The circles indicate kidney areas. 1 Supplementary Figure 2. NF-B signaling activated in the prostate of Myc/IB bigenic mouse. The prostates from Myc alone (Myc) and bigenic (Myc/IB) mice were harvested at 6 months of age. Activation of NF-B signaling in the prostate was determined by IHC staining of p65-pho antibody. 2 Supplementary Figure 3. Continuous activation of NF-B signaling promotes PCa progression in the Hi-Myc transgenic mouse. The prostates from Myc alone (Myc) and bigeneic (Myc/IB) mice were harvested at 6 months of age.
    [Show full text]
  • The Kinesin Spindle Protein Inhibitor Filanesib Enhances the Activity of Pomalidomide and Dexamethasone in Multiple Myeloma
    Plasma Cell Disorders SUPPLEMENTARY APPENDIX The kinesin spindle protein inhibitor filanesib enhances the activity of pomalidomide and dexamethasone in multiple myeloma Susana Hernández-García, 1 Laura San-Segundo, 1 Lorena González-Méndez, 1 Luis A. Corchete, 1 Irena Misiewicz- Krzeminska, 1,2 Montserrat Martín-Sánchez, 1 Ana-Alicia López-Iglesias, 1 Esperanza Macarena Algarín, 1 Pedro Mogollón, 1 Andrea Díaz-Tejedor, 1 Teresa Paíno, 1 Brian Tunquist, 3 María-Victoria Mateos, 1 Norma C Gutiérrez, 1 Elena Díaz- Rodriguez, 1 Mercedes Garayoa 1* and Enrique M Ocio 1* 1Centro Investigación del Cáncer-IBMCC (CSIC-USAL) and Hospital Universitario-IBSAL, Salamanca, Spain; 2National Medicines Insti - tute, Warsaw, Poland and 3Array BioPharma, Boulder, Colorado, USA *MG and EMO contributed equally to this work ©2017 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2017.168666 Received: March 13, 2017. Accepted: August 29, 2017. Pre-published: August 31, 2017. Correspondence: [email protected] MATERIAL AND METHODS Reagents and drugs. Filanesib (F) was provided by Array BioPharma Inc. (Boulder, CO, USA). Thalidomide (T), lenalidomide (L) and pomalidomide (P) were purchased from Selleckchem (Houston, TX, USA), dexamethasone (D) from Sigma-Aldrich (St Louis, MO, USA) and bortezomib from LC Laboratories (Woburn, MA, USA). Generic chemicals were acquired from Sigma Chemical Co., Roche Biochemicals (Mannheim, Germany), Merck & Co., Inc. (Darmstadt, Germany). MM cell lines, patient samples and cultures. Origin, authentication and in vitro growth conditions of human MM cell lines have already been characterized (17, 18). The study of drug activity in the presence of IL-6, IGF-1 or in co-culture with primary bone marrow mesenchymal stromal cells (BMSCs) or the human mesenchymal stromal cell line (hMSC–TERT) was performed as described previously (19, 20).
    [Show full text]
  • The Microtubule End-Binding Protein EB2 Is a Central Regulator Of
    4000 Research Article The microtubule end-binding protein EB2 is a central regulator of microtubule reorganisation in apico-basal epithelial differentiation Deborah A. Goldspink1, Jonathan R. Gadsby1, Gemma Bellett1, Jennifer Keynton1, Benjamin J. Tyrrell1, Elizabeth K. Lund1, Penny P. Powell2, Paul Thomas1 and Mette M. Mogensen1,* 1School of Biological Sciences, University of East Anglia, Norwich Research Park, Norwich, NR4 7TJ, UK 2Norwich Medical School, University of East Anglia, Norwich Research Park, Norwich, NR4 7TJ, UK *Author for correspondence ([email protected]) Accepted 31 May 2013 Journal of Cell Science 126, 4000–4014 ß 2013. Published by The Company of Biologists Ltd doi: 10.1242/jcs.129759 Summary Microtubule end-binding (EB) proteins influence microtubule dynamic instability, a process that is essential for microtubule reorganisation during apico-basal epithelial differentiation. Here, we establish for the first time that expression of EB2, but not that of EB1, is crucial for initial microtubule reorganisation during apico-basal epithelial differentiation, and that EB2 downregulation promotes bundle formation. EB2 siRNA knockdown during early stages of apico-basal differentiation prevented microtubule reorganisation, whereas its downregulation at later stages promoted microtubule stability and bundle formation. Interestingly, although EB1 is not essential for microtubule reorganisation, its knockdown prevented apico-basal bundle formation and epithelial elongation. siRNA depletion of EB2 in undifferentiated epithelial cells induced the formation of straight, less dynamic microtubules with EB1 and ACF7 lattice association and co-alignment with actin filaments, a phenotype that could be rescued by inhibition with formin. Importantly, in situ inner ear and intestinal crypt epithelial tissue revealed direct correlations between a low level of EB2 expression and the presence of apico-basal microtubule bundles, which were absent where EB2 was elevated.
    [Show full text]
  • Supplementary Table 1: Genes Located on Chromosome 18P11-18Q23, an Area Significantly Linked to TMPRSS2-ERG Fusion
    Supplementary Table 1: Genes located on Chromosome 18p11-18q23, an area significantly linked to TMPRSS2-ERG fusion Symbol Cytoband Description LOC260334 18p11 HSA18p11 beta-tubulin 4Q pseudogene IL9RP4 18p11.3 interleukin 9 receptor pseudogene 4 LOC100132166 18p11.32 hypothetical LOC100132166 similar to Rho-associated protein kinase 1 (Rho- associated, coiled-coil-containing protein kinase 1) (p160 LOC727758 18p11.32 ROCK-1) (p160ROCK) (NY-REN-35 antigen) ubiquitin specific peptidase 14 (tRNA-guanine USP14 18p11.32 transglycosylase) THOC1 18p11.32 THO complex 1 COLEC12 18pter-p11.3 collectin sub-family member 12 CETN1 18p11.32 centrin, EF-hand protein, 1 CLUL1 18p11.32 clusterin-like 1 (retinal) C18orf56 18p11.32 chromosome 18 open reading frame 56 TYMS 18p11.32 thymidylate synthetase ENOSF1 18p11.32 enolase superfamily member 1 YES1 18p11.31-p11.21 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 LOC645053 18p11.32 similar to BolA-like protein 2 isoform a similar to 26S proteasome non-ATPase regulatory LOC441806 18p11.32 subunit 8 (26S proteasome regulatory subunit S14) (p31) ADCYAP1 18p11 adenylate cyclase activating polypeptide 1 (pituitary) LOC100130247 18p11.32 similar to cytochrome c oxidase subunit VIc LOC100129774 18p11.32 hypothetical LOC100129774 LOC100128360 18p11.32 hypothetical LOC100128360 METTL4 18p11.32 methyltransferase like 4 LOC100128926 18p11.32 hypothetical LOC100128926 NDC80 homolog, kinetochore complex component (S. NDC80 18p11.32 cerevisiae) LOC100130608 18p11.32 hypothetical LOC100130608 structural maintenance
    [Show full text]
  • EB2 (MAPRE2) (NM 014268) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC200259 EB2 (MAPRE2) (NM_014268) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: EB2 (MAPRE2) (NM_014268) Human Tagged ORF Clone Tag: Myc-DDK Symbol: MAPRE2 Synonyms: CSCSC2; EB1; EB2; RP1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC200259 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCTGGGCCGACCCAAACCCTGTCCCCAAATGGCGAGAACAACAACGACATCATCCAGGATAATAACG GGACCATCATTCCTTTCCGGAAGCACACAGTGCGCGGGGAGCGTTCCTACAGTTGGGGAATGGCGGTCAA TGTGTATTCTACCTCGATAACCCAAGAGACTATGAGCAGACATGACATCATTGCATGGGTTAATGACATA GTATCTTTAAACTACACAAAAGTGGAACAGCTTTGTTCAGGAGCGGCCTATTGCCAATTCATGGACATGC TCTTCCCTGGCTGCATTAGTTTGAAGAAAGTAAAATTTCAAGCAAAGCTGGAACATGAATATATTCACAA TTTTAAACTTCTGCAAGCATCATTTAAGCGAATGAACGTTGATAAGGTAATTCCAGTGGAGAAGCTAGTG AAAGGACGTTTCCAGGACAACCTGGATTTTATTCAATGGTTTAAGAAATTCTATGATGCTAACTACGATG GGAAGGAGTATGATCCTGTAGAGGCACGACAAGGGCAAGATGCAATTCCTCCTCCTGACCCTGGTGAACA GATCTTCAACCTGCCAAAAAAGTCTCACCATGCAAACTCCCCCACAGCAGGTGCAGCTAAATCAAGTCCA GCAGCTAAACCAGGATCCACACCTTCTCGACCCTCATCAGCCAAAAGGGCTTCTTCCAGTGGCTCAGCAT CCAAATCCGATAAAGATTTAGAAACGCAGGTCATACAGCTTAATGAACAGGTACATTCATTAAAACTTGC CCTTGAAGGCGTGGAAAAGGAAAGGGATTTCTACTTTGGGAAGTTGAGAGAGATCGAGCTACTCTGCCAA GAACACGGGCAGGAAAATGATGACCTCGTGCAGAGACTAATGGACATCCTGTATGCTTCAGAAGAACACG
    [Show full text]
  • Identification of Endogenous Adenomatous Polyposis Coli Interaction Partners and Β-Catenin−Independent Targets by Proteomics
    Published OnlineFirst June 3, 2019; DOI: 10.1158/1541-7786.MCR-18-1154 Cancer Genes and Networks Molecular Cancer Research Identification of Endogenous Adenomatous Polyposis Coli Interaction Partners and b-Catenin– Independent Targets by Proteomics Olesja Popow1,2,3,Joao~ A. Paulo2, Michael H. Tatham4, Melanie S. Volk3, Alejandro Rojas-Fernandez5, Nicolas Loyer3, Ian P. Newton3, Jens Januschke3, Kevin M. Haigis1,6, and Inke Nathke€ 3 Abstract Adenomatous Polyposis Coli (APC) is the most frequently tion between endogenous MINK1 and APC and further mutated gene in colorectal cancer. APC negatively regulates confirmed the negative, and b-catenin–independent, regu- the Wnt signaling pathway by promoting the degradation of lation of MINK1 by APC. Increased Mink1/Msn levels were b-catenin, but the extent to which APC exerts Wnt/b-cate- also observed in mouse intestinal tissue and Drosophila nin–independent tumor-suppressive activity is unclear. To follicular cells expressing mutant Apc/APC when compared identify interaction partners and b-catenin–independent with wild-type tissue/cells. Collectively, our results highlight targets of endogenous, full-length APC, we applied label- the extent and importance of Wnt-independent APC func- free and multiplexed tandem mass tag-based mass spec- tions in epithelial biology and disease. trometry. Affinity enrichment-mass spectrometry identified more than 150 previously unidentified APC interaction Implications: The tumor-suppressive function of APC, the partners. Moreover, our global proteomic analysis revealed most frequently mutated gene in colorectal cancer, is mainly that roughly half of the protein expression changes that attributed to its role in b-catenin/Wnt signaling. Our study occur in response to APC loss are independent of b-catenin.
    [Show full text]
  • EB2 (MAPRE2) Mouse Monoclonal Antibody [Clone ID: OTI5F3] – TA502961 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA502961 EB2 (MAPRE2) Mouse Monoclonal Antibody [Clone ID: OTI5F3] Product data: Product Type: Primary Antibodies Clone Name: OTI5F3 Applications: FC, IF, IHC, WB Recommended Dilution: WB 1:2000, IHC 1:150, IF 1:100, FLOW 1:100 Reactivity: Human Host: Mouse Isotype: IgG2a Clonality: Monoclonal Immunogen: Full length human recombinant protein of human MAPRE2 (NP_055083) produced in HEK293T cell. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 36.9 kDa Gene Name: microtubule associated protein RP/EB family member 2 Database Link: NP_055083 Entrez Gene 10982 Human Q15555 Background: The protein encoded by this gene shares significant homology to the adenomatous polyposis coli (APC) protein-binding EB1 gene family. This protein is a microtubule-associated protein that is necessary for spindle symmetry during mitosis. It is thought to play a role in the tumorigenesis of colorectal cancers and the proliferative control of normal cells. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 EB2 (MAPRE2) Mouse Monoclonal Antibody [Clone ID: OTI5F3] – TA502961 Synonyms: EB1; EB2; RP1 Protein Families: Druggable Genome Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY MAPRE2 ([RC200259], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]