Journal of Cell Science Lnbre n kmnv,20;Mrio ta. 1998). +TIPs al., other et most Morrison of 2006; with plus-end Akhmanova, the interact track and and to (Lansbergen able microtubules being growing (+TIPs) determined proteins tracking be 2012). to Wittmann, and remains Gierke 2009; reorganised how al., et but subsequently (Bellett centrosome the are from originate they microtubules arrays the apico-basal that the show of cells (MDCKII) kidney canine Darby deesjntos(aaloe l,18;Blete l,2009; al., both on et based Evidence 2007). Bellett situ al., in et 1989; Moss 2002; al., al., et et the Mogensen microtubules (Bacallao at apico-basal with junctions associated anchored sites adherens the non-centrosomal longer apical, of at no anchored the become minus-ends array to The apico-basal many leading centrosome. microtubules an of these of extend of formation plus-ends reorganisation typical the dramatic and trigger polarisation a is and centrosome minus- contact Cell-to-cell the cortex. microtubule cell centrosome the at towards the anchored located Here are ends cells. centrally epithelial the undifferentiated of a focused those array microtubule during radial as on A evident such ear. inner particularly cells and intestine is epithelial kidney, of this tissue polarisation and differentiation, apico-basal function for and critical formation is reorganisation Microtubule Introduction influences dramatically microtubule thus initial association, EB2 for lattice differentiation. words: of microtubule important epithelial Key expression and ACF7 evidently spatiotemporal deployment and is ACF7 The EB1 EB2 and formation. facilitates EB1 elevated. bundle organisation, downregulation was and microtubule its co-alignment EB2 Importantly, whereas filament where formin. polarisation, microtubule-actin with absent ACF7 inhibition epithelial were and by during EB1 rescued siRNA which reorganisation with be elongation. bundles, microtubules could not dynamic that epithelial microtubule is less phenotype apico-basal and straight, a EB1 of filaments, formation although formation actin bundle Interestingly, the with situ induced reorganisation, co-alignment formation. apico-basal cells and bundle microtubule prevented epithelial association microtubule and prevented undifferentiated lattice knockdown in stability for differentiation its EB2 microtubule apico-basal of reorganisation, essential promoted of depletion of microtubule that stages is stages not for later but early that promotes at essential EB2, during downregulation of downregulation process EB2 knockdown expression that its and that a siRNA differentiation, whereas time epithelial EB2 first apico-basal instability, during the formation. reorganisation for dynamic microtubule bundle establish initial for we microtubule crucial Here, is differentiation. influence EB1, epithelial proteins apico-basal during (EB) reorganisation end-binding Microtubule Summary 10.1242/jcs.129759 doi: 4000–4014 126, ß Science Cell of Journal 2013 May 31 Accepted ( correspondence for *Author 2 1 Goldspink A. Deborah apico-basal differentiation in epithelial central reorganisation a microtubule is of EB2 regulator protein end-binding microtubule The 4000 lzbt .Lund K. Elizabeth owc eia col nvriyo atAgi,NrihRsac ak owc,N47J UK 7TJ, NR4 UK Norwich, 7TJ, Park, NR4 Research Norwich, Norwich Park, Anglia, Research East Norwich of Anglia, University East School, of Medical University Norwich Sciences, Biological of School 03 ulse yTeCmayo ilgssLtd Biologists of Company The by Published 2013. B sotnrfre oa h atrcnrle fplus-end of controller master the as to referred often is EB1 ne a n netnlcyteihla iservae ietcreain ewe o ee fE2epeso n h rsneof presence the and expression EB2 of level low a between correlations direct revealed tissue epithelial crypt intestinal and ear inner ne a pteilclsand cells epithelial ear inner B,E1 C7 ptei,Mcouue,Ccla netnlcyt ci filaments Actin crypt, Intestinal Cochlea, Microtubules, Epithelia, ACF7, EB1, EB2, [email protected] 1 en .Powell P. Penny , 1 oahnR Gadsby R. Jonathan , nvitro in ) 2 utrso Madin- of cultures alThomas Paul , 1 em Bellett Gemma , 1 n et .Mogensen M. Mette and asegnadAhaoa 06 ue l,20) B may 2005; EBs of al., 2008). al., et et interactions Komarova Wu 2003; 2006; al., Akhmanova, regulate kinetochores and et filaments, Lansbergen (Kodama they actin CLIPs organelles cortex, cell and (CLIP-associated Hence, the coli), with spectraplakin microtubules CLASPs (MACF1). cross-linking polyposis microtubule-actin ACF7 proteins), the and (adenomatous +TIPs proteins) linker other most APC with (cytoplasmic lesser C-terminus a the to plus- but via including the EB3, interact and to EB1 EB2, contribute 2011). extent to al., et likely (Buey also localisation end are 2012). and al., lattice C-terminus et microtubule charged Maurer the negatively GTP– 2011; microtubules the al., for between of et forces affinity end Maurer Repulsive high growing 2008; al., the a et at to (Dimitrov prominent N- due is evidence their is which recent via recognition tubulin, and microtubules tip al., domain that bind et (CH) suggest and homology Vaart dimers calponin function der form EB2’s terminal van EBs about Li known 2000; cells. 2009; is Bierer, in little al., and relatively et However, Tirnauer catastrophe (Komarova 2009). 2011; al., suppressing not microtubule al., et does and influence et apparently are Su EB3 growth EB2 and 2003; genes, promoting whereas EB1 Su, (MAPRE) 2001). by and Qi, dynamics separate (Bu and cells by Su 1995; mammalian encoded in EB1, EB3, members expressed family and three and EB2 conserved, evolutionary is EB1 1 enfrKeynton Jennifer , 1, * 1 ejmnJ Tyrrell J. Benjamin , eerhArticle Research 1 , in Journal of Cell Science yokltn hybt euaeadaergltdby regulated are actin and and and assembly filament microtubule actin regulate the control and both of dynamics microtubule regulators They Rho key The cytoskeleton. cross-talk. are cytoskeletal involve to GTPases likely also is bundles structures. their other with regulating interact by to ability reorganisation and dynamics microtubule influence thus enrpre uigmsl ifrnito hl B levels 1985). that EB1 suggests This while al., 2007). has Merdes, differentiation and expression et (Straube muscle constant EB2 remained during parallel (Tassin in reported non-centrosomal downregulation myotubes been marked into a differentiated myoblasts Intriguingly, in of array transforming bundles network radial microtubule the 2011; the of al., reorganisation 2010). et al., major et Kadir a Takesono 2004; 2003; al., al., et et Scaife 2002; Gao al., 2012; et al., Krendel et al., et Cheng (Chang fibres stress 2008; reducing as well stability as microtubule formation induces bundle RhoA/ and hand, microtubules. other from the GEF-H1 on inhibition, effector ROCK Rho the of release to due microtubules for destabilises and Nocodazole, RhoA/ROCK activates example, by depolymerisation Microtubule organisation. kltlmsl,lk ifrnito feihla el involves cells epithelial of differentiation like muscle, Skeletal apico-basal of generation and reorganisation Microtubule B sakyrgltro irtbl eraiain4001 reorganisation microtubule of regulator key a is EB2 ihSIH nE2dpee el ece h oto phenotype. Results control the rescues cells EB2-depleted in SMIFH2 with in and Furthermore, formation. co-alignment bundle filament microtubule-actin f and differentiation recruitment ACF7 of ap stages elongat for latter epithelial important and is formation stag EB1 early whereas during expre EB1, not reorganisation but EB2, that apico-bas report during reorganisation omto uigeihla differentiation. bundle epithelial apico-basal and during the reorganisation microtubule formation microtubule on in for investigation EB2 our prerequisite of focused role a therefore We be formation. may bundle EB2 of downregulation asrsligi ihycnlet(atal oaie)epithelial polarised) (partially confluent for highly grown in were resulting cells days 9 (mIMCD-3) kidney medullary inner Mouse at stages cells later most apico-basal in of downregulated but stages differentiation early epithelial during expressed is EB2 eew sals o h is ti first the for establish we Here arw n nagmnsi nes tdy n 12. and 7 days 20 at bars: insets) Scale in microtubules enlargements and and but EB1 (arrows 3, with day co-localising at ACF7 tubulin ACF7 cortical or dispersed green) showing mAb, blue) (mouse (YL1/2, EB1 either and all. (red) in prominent is expression ( red) whereas pAb, EB2 cells, (rabbit high-expression low-expression EB1 of by patch surrounded a cells showing (blue) 7 day at filter 7). (day cells confluent in ( expression subconfluent low but in 3) EB2 (day of cells expression high relatively reveal for immunolabelled eihrlacmlto tdy7 ( 7. day and at 3 day accumulation at peripheral plus-ends red) green/invert) (YL1/2, microtubule pAb, at (rabbit comets EB1 tubulin distinct total show and images detyrosinated ( and (C). (B), in 9 levels and 7 5, 3, and EB2 EB1, showing blots ofun prilyplrsd tdy9 ( 9. day highly at to polarised) 3 (partially day confluent of at stages subconfluent different from at differentiation cells of images cells contrast mIMCD-3 most differentiation. in epithelial downregulated apico-basal during is EB2 1. Fig. G F ofclotclscin fplrsdclsgonon grown cells polarised of sections optical Confocal ) ofclscin fclsimnlble o ACF-7 for immunolabelled cells of sections Confocal ) D m A;10 (A); m ieil loecnemicroscope fluorescence Widefield ) clttsE1ltieassociation, lattice EB1 acilitates leihla ifrnito.We differentiation. epithelial al iiino h omnF2domain FH2 formin the of hibition o.E2dwrglto during downregulation EB2 ion. earl o B nmicrotubule in EB2 for role a me so pteildifferentiation epithelial of es a so sciia o microtubule for critical is ssion tbln(e)adE2(blue/invert) EB2 and (red) -tubulin c-aa irtbl bundle microtubule ico-basal m DG.M,microtubule. Mt, (D–G). m b atnpoenlvl tdays at levels protein -actin E Cells ) B , C Western ) ( A Phase- ) Journal of Cell Science ugsigta B elto eut nsrihe microtubules straighter in results in depletion EB2 thus evident cells that siRNA were scramble suggesting and events control to crossover compared EB2-depleted fewer Significantly squares. ubro irtbl rsoe vnswti 10 within events crossover microtubule of number 2). (supplementary 1, division cell Movies EB2- complete material large to relatively able the were even cells that depleted within S2A,B,C). showed Fig. imaging cells material time-lapse (supplementary Live siRNA period analyses scramble hour differences 96 and significant cells Ki-67 no and EB2-depleted siRNA revealed assays 1984) scramble between proliferation al., EB2 Cell than et 2E). cells (Gerdes larger following (Fig. staining area ARPE-19 times cell cells 3.7 on EB2-depleted based average epithelial in shown). on observed not HCT116 were were (data scramble and results knockdown and Similar TC7 (untreated) 2C,D,E). U2OS, (Fig. control cells with to bundled siRNA phenotype often compared distinct and straighter a microtubules containing material produced cells supplementary larger depletion 2B; significantly EB2 (Fig. lines double S1C). hours) after cell 48 Fig. hours and 96 other (a–d) at (0 sequences EB2 for transfection of siRNA knockdown Four reported complete 2009). in al., previously resulted et (Komarova as microtubules 2A) along plus-ends (Fig. patches at in ARPE- localisation 2009). these and al., EB2 et showed as (Bellett cells deviations detected 19 easily and (ARPE-19) are organisation in pattern cells microtubule this siRNA from affects radial epithelial classic using downregulation a pigment contain depleted EB2 retinal was whether human EB2 determine organisation to microtubule order In straight, microtubules of less-dynamic formation and induces bundled resolution. EB2 Z of of depletion the siRNA lack of to due organisation defined be precise not the could apico- microtubules However, assemble to microtubules. appeared had and basal cells filters differentiated on expressing grown EB2 when Fig. the elongated low EB2 material and with a high supplementary co-localised cells Both and 1F; S1B). polarised (Fig. EB1 Z suggesting microtubules to EB2-expressing of distribution apico-basal views similar in expression a lateral that showed and EB2 revealed cross-sections stacks Fig. optical cells of material Confocal polarised supplementary 1B,E,F). S1A). 1F; and levels (Fig. (Fig. confluent population heterogeneous differentiation high of patches epithelial showed few may with a EB2 Interestingly, of vast associated downregulation the low that very be suggesting while revealed EB2 cells expression, of polarised fully expression EB2 and 12) 3–5) confluent high and of (days majority relatively 7 differentiating early (days showed with and cells cells subconfluent co-localising differentiated All peripheral, 1G). in to (Fig. microtubules 3) Interestingly, and (day 1B,D,F). EB1 dispersed cells (Fig. and subconfluent cytoplasmic cells confluent from in polarised changed in also apico-basal fully localisation EB1 and ACF7 and peripheral period, 7) mainly to differentiation (day subconfluent 3) in this (day plus-end cells microtubule during from changed same localisation levels protein the EB1 as Although, tubulin 1C). remained detyrosinated (Fig. in confluence increase reached an cells microtubule by while in indicated increase differentiation was An 1B,D,E). stability epithelial (Fig. that during downregulated showed is expressed 2005) EB2 using stably al., immunolocalisation is et (Komarova EB1 and antibodies blots specific Western highly 1A). (Fig. sheets 4002 irtbl tagteswsaaye ydtriigthe determining by analysed was straightness Microtubule ora fCl cec 2 (17) 126 Science Cell of Journal 6 10 m m u o ncnrlsrml iN,cls(i.3,addt not data and cold 3B, (Fig. with cells 3A). siRNA, (Fig. EB2-depleted, confirmed control/scramble in in was evident not bundles was microtubules but resistant tubulin stability microtubule with treatment, microtubule detyrosinated in In 1990). Increased prominent cells al., et particularly ARPE-19 (Pepperkok stability EB2-depleted microtubule in increase siRNA crossover control/scramble more to 2E,F). had (Fig. organised the cells similarly than microtubules were less The the and significantly events and was 2E,F,G). cells (Fig. cells rescued EB2-depleted the phenotypes of size event average and size crossover cell The both with rescued microtubule successfully associated S2E,F). and human cells lattice microtubule Fig. the EB2-depleted the by in material expressed unaffected (supplementary these mCherry–EB2 is which sequences verify cells generated sequence, to siRNA was siRNA mouse vector order the expression scramble In using EB2 mCherry-tagged and S2D). a Fig. results siRNA squares. material EB2 was the (supplementary numbers between microtubule within in microtubules observed difference significant of by no assessed number However, also could was density the straightness microtubule in in determining increase increase an the to that due be possibility The 2F). (Fig. n eraei irtbl yaisaeeietyassociated evidently depletion. are Fig. dynamics EB2 formation microtubule with material bundle in and decrease supplementary stability a microtubule and 3E; in (Fig. increase An to cells S2G). compared events deviations, in siRNA EB2-depleted minimal pausing in showed profiles scramble dynamics time microtubule in over reduced on changes demonstrating in of increase length effect reduction representation of an terms significant no Graphic a and 3D). had (Fig. cause shrinking depletion did on microtubule but EB2 (based growth that material microtubule Analyses revealed supplementary and 4). 3C,D,E; condition) control (Fig. 3, to cells Movies compared marked siRNA dynamics a revealed scramble microtubule EB2 in GFP–tubulin for of depleted reduction cells imaging ARPE-19 time-lapse expressing live Furthermore, shown). iN el hl ece el hwdartr ocontrol to return a scramble showed a 4C). to cells (Fig. the levels revealed compared rescued intensity along fluorescence while EB2-depleted plus-ends) intensity cells in fluorescence the siRNA lattice EB1 from in microtubule increase away significant (but microtubules eiidb loecneitniymaueet.The 2 measurements. random intensity were from phenotypes fluorescence rescue signal and by fluorescence depletion cells EB2 EB2-depleted be verified in Both could mCherry–EB2 lattice 4B). localisation of (Fig. plus-end microtubule expression (data by EB1 cells the rescued epithelial Predominant following HCT116 of shown). observed and TC7 also not length U2OS, was in the association depletion 4A). EB2 lattice along plus- (Fig. EB1 the 4A). also at observed (Fig. localisation only was not but deployment associating plus-end EB1 ends EB1 with in cells EB1 EB2-depleted change in marked distribution classic a its However, the in cells siRNA change scramble showed ARPE-19 and a in control investigated Both but cells. therefore EB2-siRNA-treated was expression localisation EB1 EB1 1). (Fig. of in change level no showed the cells mIMCD-3 in differentiation Epithelial the along association EB1 lattice to microtubule leads EB2 of depletion siRNA pteildfeetaini nw ob soitdwt an with associated be to known is differentiation Epithelial . m 0mcouue per microtubules 60 emnsalong segments m Journal of Cell Science ADG;20 (A,D,G); soitdaogmcouue rd.Sesplmnaymtra al 1frsmayo aaadsaitcltsig *** inve testing. (blue, statistical mCherry–EB2 and with data of cell summary mCherry–EB2-expressing for an S1 Table from material regions supplementary Enlarged See (red). microtubules. microtubules curvy along showing associated cell rescued (red) EB2-expressing ahtetet mgsso yia xmlso irtbl raiaini qae eetdfraayi rmcnrlo cabe(irtbl cr (microtubule scramble or control from analysis for selected squares in ( organisation cells. microtubule microtubules) (straight of siRNA-treated examples EB2 typical and show Images treatment. each ubro irtbl rsoe vnsbsdo 5prpea qae (10 squares peripheral 15 on based events crossover microtubule of number vriw ihih tiigdfeecsi elsz ewe cabeadE2sRAtetd(euned el.Clswr ie nparaformaldeh in ( fixed control were in Cells area cell and cells. on EB1 d) based EB2, size (sequence cell showing siRNA-treated treatment EB2 and initial channel) and (red/single for post scramble EB2 labelled hours between were 96 and size shrinkage at cell cell d) in minimise (sequence differences siRNA striking EB2 highlight scramble, overviews control, of lysates cell nutetdcnrlcl elre einarwd hwn B bu)a h lsed n ln h irtbl ( microtubule the along and size. plus-ends cell the increased at and microtubules (blue) bundled EB2 and showing straight arrowed) to region leads (enlarged cells cell ARPE-19 control in EB2 untreated of an depletion siRNA 2. Fig. aantson.Frhroe nciaino h h effector Rho and the S3A of a inactivation Fig. to Furthermore, material but shown). (supplementary remained not microtubules, EB1 the data and along than with extent associate bundles associated lesser did rarely Taxol-induced EB3 very in cytoplasmic. EB2 lattice However, (Shannon microtubule 2005). become reported to al., previously EB1 as et caused microtubules cells along ARPE-19 associated in formation bundle and eas on htTxlidcdmcouuestabilisation microtubule induced Taxol that found also We m C;2 (C); m m AGelreet) t microtubule. Mt, enlargements). (A,G m a tbln(lesnl hne)soigicesdcl ie tagtrda irtblswt oebnln arw.( (arrow). bundling some with microtubules radial straight size, cell increased showing channel) (blue/single -tubulin n 5 1) cabe( scramble 311), a tbln(re) ( (green). -tubulin G B-iN-eltdcl ihsrih n ude irtbls( microtubules bundled and straight with cell EB2-siRNA-depleted ) n 5 1) B-iN-rae sqec d, (sequence EB2-siRNA-treated 311), D ieil loecneiae fcnrl cabeadE2sRAtetdclslble for labelled cells EB2-siRNA-treated and scramble control, of images fluorescence Widefield ) B sakyrgltro irtbl eraiain4003 reorganisation microtubule of regulator key a is EB2 6 10 m )i iecls aaaeae ( averaged data cells, five in m) ugssta B soitswt h atc fstable of lattice the with This associates S3B). to EB1 Fig. compared microtubules. association material that lattice (supplementary suggests a EB1 to controls led also in untreated but 2004) increase al., for et Gao significant noted previously 2007; as al., is et protrusions (Darenfed cell reported which microtubule-rich bundling of microtubule cells, formation in and ARPE-19 resulted stability, in microtubule inducing Y27632 with ROCK n 5 1)admhryE2rsud( rescued mCherry–EB2 and 311) 6 ... rmtreidpneteprmnsfor experiments independent three from s.e.m.) a tbln e)ltie ( lattice. red) -tubulin, b atnepeso ees ( levels. expression -actin P , ( A a .0,** 0.001, tbln le ett nmCherry– an to next blue) -tubulin, ieil loecneiae of images fluorescence Widefield ) P , n 5 .1 cl as 10 bars: Scale 0.01. 5 el.( cells. 55) B etr lt of blots Western ) C E Image ) nlssof Analysis ) F ossovers) d to yde Average ) rt) m m Journal of Cell Science eeual odtriewehrti hnei ACF7 in change this whether was We 5C). determine expression (Fig. to analyses mCherry–EB2 unable intensity by fluorescence were by rescue and confirmed cells subsequent siRNA EB2-depleted in control/scramble microtubules in the along in shift alignment be dispersed to significant cells could from The phenotype 5B). distribution (Fig. this ACF7 mCherry–EB2 Again with along 5A). rescued (Fig. in alignment observed cells was distinct EB1 siRNA EB2-depleted with whereas co-localisation scramble some bundle diffuse and and microtubules microtubule was microtubule control cells facilitate the in ARPE-19 and along localisation 12 ACF7 ACF7 binding and formation. recruit 7 EB1 day could that at lattice cortical microtubules suggesting to and 3 1) EB1 day (Fig. at with increased dispersed a co-localising showed from and to data distribution polarisation ACF7 linked epithelial in Our change been 2008). al., al., et has et Kodama Wu the 2000; 2003; and al., in et junctions, (Karakesisoglou especially stability microtubule cell to filaments, EB1, of and actin microtubules vicinity and both bind microtubules to cross-link reported been filaments has to actin ACF7 recruitment with ACF7 co-alignment to and leads microtubules EB2 of depletion siRNA 4004 ora fCl cec 2 (17) 126 Science Cell of Journal niiinwt 262ddntrsl nAF erimn othe to recruitment ACF7 ROCK in Similarly, result as not S3A). microtubules did Y27632 Fig. along with material align inhibition remained to (supplementary appear ACF7 did not EB1 filaments, did actin and interdigitating cytoplasmic contain not actin filaments do 5E). and (Fig. filaments microtubules bundles actin actin microtubule single to within parallel evident microscope of aligned were filaments seen electron be bundles the also could In with microtubule 5D,E). with (Fig. interdigitating cells EB2-depleted in bundles both evident using co- was filament Furthermore, alignment microtubule-actin 5D). microscopy electron (Fig. oriented and cortex bundles confocal and the filaments to actin in in perpendicular reduction increase a and revealed fibres apparent cells stress EB2-depleted actin while was cortical fibres and mainly stress reorganisation and showing cells linkage actin siRNA facilitate control/scramble Indeed, with cross thus ACF7 formation. could co-alignment, EB1, bundle in via filament or increase with microtubule-actin EB1 directly association pool. ACF7 either existing an and microtubules, lattice the microtubule of the with redistribution along a binding merely associated or expression was localisation oee,i ao nue ude nAP-9cls which cells, ARPE-19 in bundles induced Taxol in However, 5 o umr fdt n ttsia testing. statistical and *** data of summary S1 for cells, Table material EB2-depleted supplementary and See scramble respectively. for 4 and Movies material 3 supplementary from microtubules C the in of selected profiles Dynamic microtubules) (E) (66 cells. siRNA EB2 and (61 scramble microtubules) or microtubules), (61 shrinking control growing, in either pausing as seconds 3 every cabeadE2dpee ein(e also (see region representative EB2-depleted a and from scramble selected frames Image cells. (C) EB2-depleted and scramble control, ihmn asn vns D nlsso average of ( Analysis (D) events. pausing microtubules many dynamic with less EB2- shows the cell whereas depleted cell, siRNA in scramble shrinkage the and growth dynamic undergoing show microtubules circles) (red plus-ends The microtubule 3,4). Movies material supplementary loecnemcocp.Attlo 0peripheral 30 (12.5 widefield of regions a total using A minutes microscope. 3 fluorescence for seconds 3 every GFP– expressing stably cells cells. ( EB2-depleted in microtubules resistant ( microtubules tubulin. ( detyrosinated showing cells treated dynamic less microtubules. and stable more cells have ARPE-19 EB2-siRNA-depleted 3. Fig. n C–E B m 5 odtetdclssoigttlls of loss total showing cells Cold-treated ) C.M,microtubule. Mt, (C). m P cells 5 , oto,srml n EB2-siRNA-treated and scramble Control, ) .0,** 0.001, 6 6 ... irtbl vnsscored events microtubule s.e.m.) a 12.5 ( tbln nsrml iN but siRNA scramble in -tubulin) A P cabeadEB2-siRNA- and Scramble ) , m .1 cl as 10 bars: Scale 0.01. )wr nlsdfrom analysed were m) a tblnimaged -tubulin m (A,B), m n 5 5 Journal of Cell Science iNsfrE2adE1rsle nkokono both of microtubule knockdown cells in double-depleted in in differences evident resulted were discernable organisation or No EB1 straightness 6A). and (Fig. EB2 is proteins association for lattice siRNAs EB1 phenotype. if depletion EB2 phenotype the expected control to be central the would double depletion rescue by Double cells EB1. to and ARPE-19 EB2 in of investigated actin depletion with further co-alignment was and microtubule filaments recruitment of ACF7 terms in and EB1 organisation associated lattice of the compensation importance rescue EB3 The not reveals does but EB1 phenotype and control EB2 to of depletion recruitment Double ACF7 co- that filaments. filament seems actin requires microtubule-actin it microtubules facilitate Furthermore, and that alignment. sufficient ACF7 not suggests is recruit This association cell shown). lattice to EB1 not and (supplementary within data stability filaments and microtubule except S3B,C,D actin Fig. filaments, contained material also actin that of radial projections co-alignment preferential and to lead microtubules it did nor lattice microtubule iutnosdul rnfcin( n 8hus with hours) 48 and (0 transfection double Simultaneous B sakyrgltro irtbl eraiain4005 reorganisation microtubule of regulator key a is EB2 h irtbl atc n ananteE2dpee phenotype. EB2-depleted the maintain and lattice microtubule the 6E,F). this in (Fig. and analyses evident cells intensity was fluorescence EB2-depleted by ACF7 for microtubules verified found was in of as increase length cells double-depleted the an along Furthermore, association 6D). intensity (Fig. fluorescence EB2/ by in measurements verified association was double not cells lattice control, double-depleted data microtubule EB1 and cells unlike EB3 6C (Fig. is Increased in EB3 shown). This of plus-ends distribution showed 6C). which cytoplasmic (Fig. the cells, dispersed ARPE-19 EB1 EB2-siRNA-treated at and and scramble EB2 as for well depleted as microtubules 6B). (Fig. cells siRNA compared scramble double-depleted to in events crossover fewer revealed as significantly which cells analysis event siRNA crossover EB2/ microtubule scramble by in to confirmed straighter compared appeared cells double-depleted microtubules EB2-depletedEB1 The in 6A,E). found (Fig. evident also were cells as bundles cells Microtubule and double-depleted 5A). EB2/EB1 6A,C,E Fig. in Fig. and 4A (compare Fig. cells 2D; depleted Fig. only EB2 to compared hssget htE3cncmest o B,ascaealong associate EB1, for compensate can EB3 that suggests This the of length the along associated EB3 Interestingly, 10 *** testing. of statistical summary and for data S1 Table material See supplementary cells. rescued EB2- and scramble, siRNA-treated control, in intensity fluorescence hw itntE1(net oeswt iteo no or little with comets (invert) cell EB1 scramble distinct of shows region peripheral and Enlarged blue/inverts) (red). mAb, (mouse EB1 for cells. ( ARPE-19 microtubule EB2-siRNA-depleted the in with lattice associates EB1 4. Fig. microtubule. ( ( average restoration cell. comet rescued plus-end the and in cell depleted microtubules the Invert along in cell. localisation depleted EB1 a show to images next cell mCherry– rescued an EB2 EB1 showing for green/invert) labelled mAb, and (mouse fixation before hours 24 mCherry–EB2 (red) with transfected transiently cells the ( along lattice. and (red) plus-end microtubule at shows invert) cell (blue, EB2-depleted EB1 of region Enlarged tail. A cabeadE2sRAtetdclslabelled cells EB2-siRNA-treated and Scramble ) m AB;5 (A,B); m n 5 5microtubules 25 m elreet) Mt, (enlargements). m C aaaayi showing analysis Data ) B EB2-siRNA-depleted ) 6 P ... EB1 s.e.m.) , .0.Saebars: Scale 0.001. a -tubulin Journal of Cell Science ofclscin eeldalc faiobsleogto in elongation apico-basal of optical 7A). (Fig. lack of a proteins reconstructions revealed both three-dimensional sections of confocal of knockdown views in Lateral resulted 10– cells producing colonic TC7 polarise human readily they differentiating as microtubule in 12 cells in EB1 (TC7) separately EB1 and epithelial and EB2 depleted bundle formation EB2 bundle were of apico-basal promotes and role To and reorganisation. reorganisation the expression binding enable investigate to ensure EB2 to population further lattice required microtubule be dynamic low may a expression EB1 EB2 that Therefore formation. stability, show microtubule findings elongation epithelial Our and formation inhibits bundle either microtubule of depletion whereas initial epithelial differentiation, prevents microtubule apico-basal EB1 during not in reorganisation but microtubule EB2 EB1/EB3 of depletion of siRNA role 2009). al., the et (Komarova formation determine bundle not and to straightness thus could used and lethal is be EBs of depletion triple Unfortunately, 4006 B rE2sRAtil ramns(,4 n 6hus of hours) 96 and 48 (0, treatments triple siRNA EB2 or EB1 m alclswe rw oconfluence. to grown when cells tall m ora fCl cec 2 (17) 126 Science Cell of Journal hra B sipratfraiobslmcouuebundle microtubule apico-basal for important is constriction EB1 cell and whereas reorganisation microtubule initial which for critical treatment depletion, subconfluent of EB2 scramble typical for areas 7C,D). surface case (Fig. to large cells the with cells not compared cell in some resulted was caused area depletion this EB1 constriction while in However, 7B,C,D). both height (Fig. increase cell Furthermore, in decrease 7C). significant and (Fig. caused depletion apico-basally EB2 and EB1 oriented bundles not peripheral the peripheral were However, some sections. and medial cells in siRNA microtubule microtubules scramble basal of that and the to apical organisation of Instead, similar cross-sections showed optical cells. cells knockdown, EB1-depleted EB2 EB2-depleted epithelial Unlike undifferentiated 7C). in (Fig. of cells typical lost were apico-basal was networks microtubule and cross-sections This medial networks in 7C). microtubule rings (Fig. basal peripheral by epithelial and evidenced as scramble polarised bundles apical of typical with regions showed organisation basal and cells medial siRNA cross- apical, optical Single through 7B). (Fig. sections cells EB2-depleted and EB1- both hs idnssgetta B u o B xrsinis expression EB1 not but EB2 that suggest findings These 10 aaadsaitcltsig *** testing. statistical of and summary data for S1 Table material bundles. supplementary microtubule See within as filaments well actin as single co-aligned, bundles filament arrowheads) actin (red and arrowheads) (blue showing microtubule cell EB2-siRNA-depleted from micrograph ( interdigitation. and and co-alignment cortex filament the microtubule-actin to actin perpendicular radial oriented show filaments cells Enlarged EB2-depleted cells. of depleted regions in prominent is co- alignment filament microtubule–actin whereas scramble cells, and siRNA control little in and microtubules fibres, with stress alignment and actin peripheral mainly and red/invert) actin (phalloidin, for stained cells EB2-siRNA-treated rae n ece el.( cells. rescued EB2-siRNA- and siRNA, treated scramble control, in intensity ( ( the cell. of in rescued loss association showing microtubule fixation (green/invert) before ACF7 hours 24 mCherry– (red) with EB2 transfected transiently cells depleted hglgtdi nagdiae) ( images). enlarged cells in EB2-depleted (highlighted in purple) EB1 mAb, with (mouse the co-localises along and associated lattice is microtubule in but dispersed cells is siRNA ACF7 scramble red). (YL1/2, tubulin (green/invert) and ACF7 for labelled cells siRNA-treated co-alignment. microtubule-actin filament and EB1 co- with to and localisation leads microtubules cells along ARPE-19 localisation in ACF7 depletion EB2 5. Fig. n 5 m 5microtubules 25 ABD;2.5 (A,B,D); m C aaaayi hwn average showing analysis Data ) E rnmsinelectron Transmission ) m 6 elreet) 0n (E). nm 50 (enlargements); m ... C7fluorescence ACF7 s.e.m.) ( A D cabeadEB2- and Scramble ) a oto,srml and scramble Control, ) tbln(le showing (blue) -tubulin P , .0.Saebars: Scale 0.001. B EB2-siRNA- ) Journal of Cell Science omn nmcouuesrihns,c-lgmn ihactin with of co-alignment role The straightness, 2007). al., microtubule et 2001; Ryu Yang in 2012; 2012; al., al., al., and et formins et et Oakes Thurston (Bartolini 2013; Ishizaki 2009; al., al., et 2005; filaments et Kovac al., 2004; actin al., et et with Kobielak Gasteier of co-alignment 2010; domains stability as Gundersen, microtubule FH1/FH2 induce well to the shown as with of been mDia have expression by formins associated several assembled addition, and In filaments Rac1 by formins. The cells activated dorsal/radial are EB2-depleted formins. that the resemble lamellipodia the in 5D) effectors, evident (Fig. bundles downstream actin Rho their the perpendicular of and involvement suggest GTPases EB2 downregulation following or filaments actin knockdown and microtubules and of reorganisation co-alignment filament actin stability, microtubule Increased the rescues phenotype cells control EB2-depleted in inhibition Formin of not lack can for it formation. compensate reorganisation bundle microtubule to apico-basal of results for able stages be the early may during Furthermore, EB1 EB3 while elongation. that epithelial suggest and formation B sakyrgltro irtbl eraiain4007 reorganisation microtubule of regulator key a is EB2 utemr,asgiiatrdcini C7fluorescence ACF7 in 8B,D). reduction (Fig. significant cells fluorescence (+DMSO) a siRNA lattice scramble while Furthermore, SMIFH2-treated to cells plus-end in compared (+DMSO) EB1 EB2-depleted not decrease EB1 to with significant compared EB2-depleted a Predominant restored showing 8A,C). intensities was (Fig. siRNA scramble localisation to cells EB2- compared to not the (+DMSO) but compared cells, at EB2-depleted (+DMSO) significant curled depleted SMIFH2-treated a often revealed in events microtubules crossover increase of The analysis in and 8A). increase periphery (Fig. an actin ACF7 and fibres radial cortex in the cytoplasmic stress to reduction less-organised perpendicular a and oriented caused filaments SMIFH2 plus-end in 8). and (Fig. EB1 localisation filaments resulted actin predominant with showed co-alignment cells lacked that actin microtubules ARPE-19 both affects EB2-depleted microtubules. and which with interactions 2009), domain formin al., and FH2 et assembly the filament (Rizvi SMIFH2 inhibits inhibitor specifically treated formin were the cells EB2-depleted with EB2-depleted investigated. in therefore association was lattice cells ACF7 and EB1 and filaments omnihbto ih10 with inhibition Formin ACE;2.5 (A,C,E); umr fdt n ttsia testing. statistical * and for data S1 of Table summary material supplementary See EB2-siRNA-treated cells. and EB1- in and lattice scramble microtubule the along intensity microtubules C7lclsto ln h irtbl lattice. ( microtubule the along localisation ACF7 highlights regions Enlarged (purple/invert). showing atc nsrml n B-adEB2-siRNA- ( and cells. EB1- treated and scramble in microtubule lattice along intensity fluorescence EB3 igecanl oaiaint irtbl plus- microtubule to localisation (red, channel) EB3 single showing region Enlarged invert). cell showing EB2-siRNA-depleted scramble and a EB1- in cell. (mAb) siRNA EB1 and (KT36) EB3 treatment. ( each for experiments ( independent averaged data with (10 cells squares peripheral based 15 events on crossover microtubule of number hwn vrg ( ( average lattice. showing the along and ends irtbl udig(ro) ( (arrow). and bundling proteins microtubule both channel), of blue knockdown mAb showing (mouse EB1 and channel) eltetdwt ohE1adE2siRNA, EB2 and EB1 for both labelled with showing treated shown) cell not a cells scramble to set levels compensation. ( EB3 control reveals the but in rescue phenotype EB1 not and does EB2 cells of APRE-19 depletion Double 6. Fig. F C A P aaaayi hwn vrg ( average showing analysis Data ) netdiae fmcouue ( microtubules of images Inverted ) ieil loecneiae (exposure images fluorescence Widefield ) , .5 *** 0.05, m a a MF2fr4 iue in minutes 40 for SMIFH2 M tbln(re)adE3(T6 red, (KT36, EB3 and (green) -tubulin tbln(re,ivr)adACF7 and invert) (green, -tubulin a m 6 tbln(re) B (red EB2 (green), -tubulin P E (enlargements). m , B-adE2dpee cell EB2-depleted and EB1- ) ... C7fluorescence ACF7 s.e.m.) .0.Saebr:10 bars: Scale 0.001. n 5 5microtubules 25 6 D 6 ... rmthree from s.e.m.) aaanalysis Data ) 10 B Average ) m )i five in m) n a 5 6 -tubulin), m 25 m s.e.m.) Journal of Cell Science B xrsinadtepeec fdsic apico-basal sensory of rows distinct organised of highly organ of contains The ear inner cells. presence the epithelial in the polarised to Corti in important and bundles co- is microtubule expression it and However, EB2 recruitment filaments. ACF7 actin determine bundle binding, with microtubule lattice alignment promotes EB1 knockdown formation, or downregulation distinct The of presence bundles the microtubule and apico-basal correlation expression direct EB2 a low reveal between epithelia intestinal and ear Inner cells. epithelial in phenotype EB2-depleted the localisation. ACF7 cytoplasmic and plus-end restoring EB1 and predominant filaments actin crossover with microtubule co-alignment decreasing increasing events, by control/ phenotype the siRNA rescue to scramble seemed not thus Formin cells EB2-depleted 8B,E). while of (Fig. inhibition cells cells (+DMSO) (+DMSO) siRNA scramble EB2-depleted to compared to compared EB2- SMIFH2-treated depleted in evident was microtubules along intensity 4008 h aasgetta omnatvto sivle ncreating in involved is activation formin that suggest data The nvitro in ora fCl cec 2 (17) 126 Science Cell of Journal nvivo in utrdeihla eldt ugs htEB2 that suggest data cell epithelial cultured hte hr sacreainbtenlwlevel low between correlation a is there whether B gi hwdadsic atr ihhg eeso EB2 of while levels region high cell stem with for basal the pattern Immunolabelling within located distinct the 2009). cells in a transit- up Clevers, expression showed to and migrate rise again Flier and give EB2 der differentiate crypt (van the divide, of crypt that base cells. cells the epithelial at amplifying differentiating located cells and and Stem proliferating turnover rapid both undergoes but contains differentiated terminally the not along is 9Avi). associate (Fig. cells to supporting supporting the found the in also in expression was bundles of microtubule EB1 in level EB2 9Aiv,v). low of (Fig. very expression cells but high expression with cells EB2 Corti hair of of all organ pattern al., the distinct et in A al., evident (Bane 1992). et was Slepecky al., iii) are 2002; et al., 9Ai, cells Tucker et (Fig. Mogensen 1995; hair 1990; cytoplasm By al., the the et Furness in in 2002; 9Ai,ii,vii,viii). microtubules free (Fig. the and of filaments dynamic majority the actin bundles contrast, microtubule interdigitating apico-basal stable with the contain are only cells types but cell supporting differentiated Both sound terminally 9A). and (Fig. (transmit polarised cells) apico-basally hair cells the to supporting vibrations induced and (mechanoreceptors) hair nieteinrerclsteeihlu fteitsia crypt intestinal the of epithelium the cells ear inner the Unlike *** aaadsaitcltsig ** testing. statistical of and summary data for S1 Table material See supplementary experiments. separate three from rae (height treated area (height, treated etosso ag elaesadlc fcellular of lack and areas All cell section. large each show in sections line) dotted (red highlighted for stained cells siRNA a EB1 representative and of EB2 section) scramble, of diagrams, level (see represents regions line basal and medial apical, ( cells. EB1-depleted and EB2-depleted labelled scale) for (to EB2- cells scramble, EB1-siRNA-treated of and reconstructions 3D of views EB1 EB2, and showing mAb) cells, (mouse hours) 96 hours, hours, control, 48 (0 from EB1-siRNA-treated hours and 144 EB2- at scramble, taken extracts of blots reorganisation. not but affects elongation depletion EB1 whereas elongation, prevents apico-basal cells and TC7 reorganisation in microtubule depletion EB2 7. Fig. oe ein ncnrl(egt area (height (height, scramble control 143 in in regions area boxed and height cell of terms and ( cells EB1-depleted cells. EB2-depleted in in (arrow) these bundles of mis-oriented lack total there a cells; is scramble in the microtubules of apico-basal cross-sections representing (arrow) microtubule rings peripheral distinct Medial show cells. sections EB1-depleted and siRNA with scramble compared cells EB2-depleted in constriction C tbln n elfo ahcniinis condition each from cell One -tubulin. ofclotclcosscin through cross-sections optical Confocal ) a P tblnsoigardcini elhih in height cell in reduction a showing -tubulin , D .0.Saebr 10 bar: Scale 0.001. nlsso pteildfeetainin differentiation epithelial of Analysis ) n 5 n ,area 9, 5 b atnepeso.( expression. -actin ,area 8, n 5 )adEB2-siRNA- and 4) n 5 n )cls aapooled Data cells. 6) m 5 P m. , ) EB1-siRNA- 6), 0.01, m ( A m n B Western ) 6 5 Lateral ) 143 3), m m Journal of Cell Science yai eaiu fmcouue sesnilfrtheir for essential Our is differentiation. epithelial microtubules apico-basal during of reorganisation behaviour Dynamic Discussion microtubules. dynamic both with cells in in prominent is expression apparent (intestinal EB2 proliferating The thus tissue. and epithelial polarised ear) crypt) is (inner differentiated microtubules terminally apico-basal distinct evident S4). the Fig. transit- within was material cells supplementary in the EB1 9Bii,iv; sides (Fig. basal in while region and basal baso-lateral cells bundles the along differentiated microtubule mainly localised and ACF7 apico-basal and amplifying EB1 the Both 10Aii). expression Fig. EB2 along 9Bi,ii; where region (Fig. this low above bundles was cells microtubule the in apico-basal distinct evident umbrella-like were distinct centrosome form an apical However, not an 10Ai). displayed on (Fig. did region focused they and microtubules this with Instead, curly organisation above 9Biv). were (Fig. cells region bundles cells basal the in the microtubules in apico-basal within the evident Interestingly, 9Bi,iii). was (Fig. expression low orlto ewe B oneuainadtepeec of presence the and downregulation EB2 between correlation A nsitu in aaas niae that indicated also data B sakyrgltro irtbl eraiain4009 reorganisation microtubule of regulator key a is EB2 odidcddplmrsto n iecl mgn fGFP– resulted of depletion imaging EB2 cell microtubule where cells live from ARPE-19 and data tubulin-expressing our depolymerisation inhibited by supported induced is cold This due microtubules. likely differentiation dynamic most less is apico-basal to microtubule reorganisation also microtubule thus of most of Lack and elongation. during constriction major in cell depletion apical stages downregulated EB2 reorganisation, cells. and is epithelial early it polarised and constriction whereas confluent epithelial cell–cell occur when apical in reorganisation differentiation of EB2 stages contacts, early of during expressed role studies central dynamics the microtubule differentiation. and confirmed rescue further depletion, siRNA iaet.Smlrrslswr bandfo both from obtained and were differentiation results epithelial actin and Similar microtubules the of well filaments. co-alignment as stability, and formation, recruitment bundle ACF7 and microtubule lattice as EB2 of the increased along dynamics. stages EB1 of to association microtubule early leads maintain during downregulation to expression helps EB2 differentiation that suggest findings nlsso pteildfeetainrvae htE2is EB2 that revealed differentiation epithelial of Analyses cl as 10 bars: Scale (enlargements). *** testing. statistical and data summary of for S1 Table material supplementary See cells. formin-inhibited EB2-siRNA-depleted and (+DMSO) (+DMSO), siRNA scramble EB2 in (E) ACF7 and (D) of EB1 intensities fluorescence lattice microtubule +MO n omnihbtd(10 formin-inhibited and (+DMSO) phenotype. ( control the EB2-depleted rescues in cells inhibition Formin 8. Fig. ( (10 siRNA EB2- formin-inhibited and (+DMSO)-depleted EB2-siRNA treated, for (+DMSO) experiments scramble independent three from cells (10 formin-inhibited and (+DMSO) depleted co- filament ( microtubule–actin alignment. of lack a with cells in EB2-siRNA-depleted phenotype SMIFH2-treated scramble the to highlight reversion regions Enlarged EB2- cells. SMIFH2-treated depleted in evident cortex are the (arrow) to perpendicular actin oriented radial filaments and microtubules straight Lack invert). of red, (phalloidin, actin and invert) for stained cells EB2-depleted ARPE-19 minutes) 40 for SMIFH2 n1 eihrlsurs(10 squares peripheral 15 based on events crossover microtubule of number ako B irtbl atc association lattice microtubule EB1 a of and lack ACF7 dispersed curving, extensive microtubule show cells Formin- EB2-depleted invert). inhibited mAb, (mouse EB1 (invert) and ACF7 invert), (YL1/2 for microtubules labelled cells ARPE-19 depleted fE1sann) ( staining). regions EB1 enlarged of (see cells scramble to similar A D cabe(DS) EB2-depleted (+DMSO), Scramble ) , E m vrg ( Average ) nsitu in MF2fr4 iue)EB2- minutes) 40 for SMIFH2 M m B MF2fr4 iue)cells. minutes) 40 for SMIFH2 M cabe(DS) EB2- (+DMSO), Scramble ) pteiltsu analyses. tissue epithelial m AB;5 (A,B); m n 5 C 5microtubules 25 vrg ( Average ) a m 6 tbln(blue, -tubulin m 10 n 5 m P 3, )i five in m) , nvitro in m 6 6 0.001. M s.e.m.) s.e.m.) Journal of Cell Science Avvi ) 0n (Aviii). nm 50 B); (Aiv–vii; pclatmoi otclcnrcintu eutn nls cell less for in resulting required and Decreased thus contraction mis-localisation signalling microtubules. cortical to actomyosin Rho/ROCK/myosinII dynamic apical lead of less also inactivation may and (Aii, dynamics nm 100 stable bars: microtubule Scale more areas. cortical to in restricted mainly sing green, channel) (YL1/2 single microtubules (red, curvy express EB1 showing green cells cells with (YL1/2, epithelial epithelial organisation microtubules crypt crypt umbrella-like apico-basal Basal Basal and (iv) along (iii) bundles red), channel) bundles. straight (YL1/2, single microtubule microtubules of (red, curvy apico-basal lack EB1 along along EB2 with localisation showing expression EB1 channel) EB2 ( highlights single arrow). low (arrow) (red showing region evident i) Enlarged cross-links ( in and channel). microtubule ( microtubule (arrow EB1 apico-basal between region showing for showing filaments cells labelled Transit-amplifying actin cells an pillar crypt (ii) with of of pillar (OH) wherea view cell region of hair Lateral cells, apical pillar region (Bi) outer of a OH crypts. view apical through (IH), intestinal and Lateral cross-section of hair (vi) IH a view expression. inner in of EB2 Lateral of part expression in (vii) showing rows low channel) microtubules. are with (green/single cells apico-basal Corti EB2 ( supporting the of whereas high apico-basa cells along cells, Organ showing the supporting in OH of (D)] of all the an view in Deiters part in of (red) Apical and showing region low microtubules (iv) cell (OP) arrow) is bundling. pillar pillar (red EB2 of inner outer body of lack an centrosomal/basal (IP), expression and in apical pillar microtubules region the [inner Furne of apical of cells on sites arrow) the micrograph supporting (based non-centrosomal of (black Electron microtubules at micrograph fascicle (iii) anchored cytoplasmic Electron a (arrow). filaments, free (ii) actin sites showing mainly disti interdigitating (ii,iii). non-centrosomal contains of with images at cell microtubules presence TEM anchored IH of the in microtubules The bundle and covered apico-basal black. expression areas an in EB2 the contains sites low indicate cell anchoring between IP correlation non-centrosomal the a and whereas reveal red 1990), epithelia in (crypt) filaments intestinal actin and blue, Corti) of (organ bundles. microtubule ear apico-basal inner Isolated 9. Fig. 4010 ora fCl cec 2 (17) 126 Science Cell of Journal ( A sltdP os ra fCri (i Corti. of Organ mouse P4 Isolated ) a tbln e) v aea iwsoigO n uprigclswt B gen olclsn with co-localising (green) EB2 with cells supporting and OH showing view Lateral (v) red). -tubulin, a tbln(e,snl hne)adE2(re,snl hne)soighg B xrsini aa cells. basal in expression EB2 high showing channel) single (green, EB2 and channel) single (red, -tubulin ) ceai igaso ne ar(H n ne ilr(P el ihmcouue in microtubules with cells (IP) pillar inner and (IH) hair inner of diagrams Schematic iservae tiigcreainbtenlwE2expression EB2 low between correlation striking a revealed tissue Doe, and (Siegrist cells 2007). EB2-depleted in observed as constriction nlssof Analyses nsitu in ne a n netnlcytepithelial crypt intestinal and ear inner a tbln ude.(ii E image TEM (viii) bundles. -tubulin) B sltdautmuesmall mouse adult Isolated ) n B (green, EB2 ing oe regions Boxed . i) 5 iii); e arcell hair ner echannel), le abtpAb) rabbit udeof bundle l single , the s se al., et ss m m nct d Journal of Cell Science pteildfeetain oee,adsic hf rma This stability. microtubule from evident in increase was shift an association with coincided distinct lattice this microtubule and a to plus-end However, mainly differentiation. and epithelial cells upregulation pillar gene cochlear 2012). in (MAPRE2) al., et formation EB2 (Szarama bundle in to microtubule signalling FGF-Receptor3 linked reduced from apico-basal of Factor) been function them Growth by of has loss prevent supported (Fibroblast prevent where is FGF development did This cochlear not on in bundles. it data straight EB2 recent did but distinct of into forming organising cells expression from high microtubules epithelial Interestingly, bundles. polarised lack and such expression EB2 high of that and bundles filaments microtubule actin apico-basal with co-aligned distinct of presence the and microtubule. Mt, bundle. the apico-basal and stable co-alignment a and of filament binding formation microtubule–actin lattice to EB1 lead ACF7. cross-linkage and guide ACF7 EB1 cables by actin facilitated and downwards centrosome, microtubules the from release microtubule mediates bundle facilitates ( EB2 differentiation of of downregulation stages The elongation. and assembly Activatio cable actin 2009). al., et p (Bellett a receptors junction, adherens the at th captured along cell associated the EB2 towards with elongates of periphery microtubule stages nucleated early centrosome the The during differentiation. population microtubule dynamic a maintains ( bundles (blue) microtubule (ii) apico-basal fashion (blue) umbrella-like microtubules an curvy expression in unbundled EB2 organised with of cell basis High-EB2-expressing the (i) on levels. organisation microtubule of bundle diagrams microtubule Schematic apico-basal and expression (A) EB2 formation. for Models 10. Fig. B oe o pc-aa irtbl udefrain B xrsin(+EB2) expression EB2 formation. bundle microtubule apico-basal for Model ) h xrsinlvlo B eandcntn during constant remained EB1 of level expression The B xrsinlvladapico-b and level expression EB2 oesmdae y+Isadcortical and +TIPs by mediated rocess atc.Temcouuepu-n is plus-end microtubule The lattice. e oaindwt ci iaet (red). filaments actin with co-aligned fjnto-soitdfri initiates formin junction-associated of n o-B-xrsigcl ihdistinct with cell Low-EB2-expressing omto.Cria-nhrddynein Cortical-anchored formation. slmcouueorganisation. microtubule asal 2 B)a latter at EB2) B sakyrgltro irtbl eraiain4011 reorganisation microtubule of regulator key a is EB2 neetnl,AF n B aebe ugse oguide to suggested leading depletion been ACF7 with have Most filaments actin microtubules. EB1 along along stabilise and microtubules bind to ACF7 to MAP a reported interestingly, as been acting previously the showed microtubules, and have cells ACF7 Shot bundles. crypt homologue apico-basal the epithelial along differentiated ACF7 and microtubules 2011). al., GTP– et of (Nakata patches lattice al., that with the GTP– microtubules et along GFP–EB1 axonal tubulin in of (Dimitrov on co-localisation increase studies binding shown by an have lattice supported form is EB1 This stable 2008). facilitate this and could lattice GTP–tubulin for microtubule tubulin affinity Interestingly, the EB1s within stabilisation. in identified with may further been this have to and patches binding lead lattice 2004; observed EB1 turn that al., also suggesting facilitate et was microtubules may Wen association stabilised stabilisation 2008; Y27632 lattice and al., EB1 Taxol et 2009). along al., Wang al., increase et 2008; et Sandblad al., thus Zhang 2008; et al., and Vitre et to 2006; Georges suggested interactions (des been stability protofilament has microtubule binding lateral lattice myotubes EB1 differentiated enforce and in cells EB1 reported Sertoli depletion. been and siRNA has EB2 association following lattice evident particularly was 04.Hr eso htfri niiinwt MF2i EB2 in SMIFH2 with al., inhibition et formin Wen that 2001; show al., we et Here mDia Palazzo 2004). and 2010; Rho of mDia Gundersen, downstream to and function binds (Bartolini to EB1 (Bartolini suggested 2012). been microtubules al., has and et stabilise Thurston to 2010; known Gundersen, also and are and phenotype domain and control co-alignment cells. EB2-depleted the filament in microtubule–actin ACF7 rescued microtubule-associated of in loss which co- inhibition formin inducing on (Kodama cells, data filament our ACF7 by supported by EB2-depleted microtubule–actin is facilitated This 2003). likely al., initiate most et process and a of nucleation alignment, localised trigger bundles could cells formin actin epithelial located In junction polarising prominent. of activation become apico-basal cortex and perpendicular the thus confluent from towards and emanating shifted assembly bundles be filament actin may actin bundles induced or Alternatively, formin cables formin 2007). and actin al., networks Ryu linear et actin 2012; activated nucleated Yang al., Arp2/3 2002; between et al., balance Oakes et the 2013; Tsuji 2009; al., al., et et lead (Kovac can activation pathway mDia Rac1 assembled the to of are activation that Interestingly, actin mDia2. lamellipodia by dorsal/ with perpendicular induced associated Rac1 The filaments resemble radial cells activation. EB2-depleted the formin in bundles with downregulation EB2 associated that suggest is may GTPases. data Rho inhibition the formin of Our activation spatiotemporal the by determined EB2 needed by are this. triggered investigations resolve ACF7 future to in redeployment but upregulation downregulation observed ACF7 an or the to depletion ACF7 influence linked that is possible filaments showed ACF7 also of actin is filaments It that deployment. actin that projections suggesting and cell localisation Only to did microtubules length. sufficient microtubules their EB1 stabilised contained along not Y27632 However, ACF7 is and contain 2008). Taxol not lattice al., as microtubule et ACF7 Wu recruit the 2003; along al., al., association et et (Alves-Silva Kodama microtubules 2012; disorganised and unbundled to B elto lorsle nAF soito ln the along association ACF7 in resulted also depletion EB2 ipaosfrisbn irtblsdrcl i hi FH2 their via directly microtubules bind formins Diaphanous partly is filaments actin and microtubules between Cross-talk Drosophila Journal of Cell Science el ie eemitie t37 at maintained were lines treatment Cells drug and culture Cell Methods and Materials dependent 10B). is (Fig. process EB2 this of to downregulation that microtubules the and generation on the bundles cross-linking in apico-basal and resulting stable bundles guiding of actin in linear lattice association nucleated role lattice formin ACF7 dual ACF7 and and a EB1 EB1 play that and propose We filaments recruitment. microtubule and actin stabilisation with initial microtubule co-alignment assembly, for Rho/ROCK/ formin filament favours actin of and mediated downregulation activation constriction EB2 Subsequent and apical apical reorganisation. effectors formation, for Rho junction myosinII cell–cell of for localisation microtubule important dynamic a expression maintains population EB2 differentiation of levels. stages bundle expression early at EB2 apico-basal on dependent in formation role EB1’s can for it lattice compensate formation. microtubule did the fully EB1 along not associate of can that lack double EB3 suggesting However, formation our although EB1. bundle by microtubule and shown apico-basal EB2 as inhibit of EB3 studies constriction by compensation depletion cell to and due reorganisation possibly not microtubule did differentiation initial epithelial and prevent during (Bu depletion idea microtubule EB1 this induce 2001). supports dynamic not Su, does, does EB1 a EB2 for while of bundles, maintain crypt, overexpression microtubule that the thus fact The of and population. region and formation binding cell lattice interaction, bundle stem formin EB1 prevent the as may microtubules, example, in of length evident the along particularly apico- binding and for differentiation. expression epithelial critical EB2 and formation evidently bundle is microtubule basal differentiation EB1 epithelial facilitate during thus may forces repulsive microtubule binding. the lattice reduced within and repulsive GTP–tubulin lattice the A increased favourable. been reduces more of whether association microtubules determine lattice combination has EB1 al., to or makes thus future et EB1 surface and the forces (Buey to C- in plus-end microtubule binding interesting the the be formin at the will between binding binding. It EB1 and charges 2011). favour lattice formin-induced negative EB1 to suggested that to of EB1 due or terminus facilitates forces lattice to order Repulsive microtubule stabilisation in formin the with microtubule interact along to need This bind may association. EB1 lattice that EB1 decreased suggests in resulted cells depleted 4012 4hus omnihbto a efre nAP-9clsadclswere cells and cells ARPE-19 treatment. in each performed 10 for was either 10 with inhibition with treated Formin treated by hours. cells were 24 ARPE-19 the cells in incubated induced were 19 was cells stability ARPE-19 2 Microtubule with analysis minutes. treatment treatment 90 cold for For ice days. on 12 for day other . gm tetmcnad10uism eiiln IC- n C cells and TC7 L-glutamine and mIMCD-3 1% penicillin. FBS, units/ml 0.4 10% 100 on grown Caco-2), containing and were streptomycin line (Invitrogen) were mg/ml cell cells DMEM 0.1 cancer) adenocarcinoma colorectal in (human colorectal HCT-116 cultured human and medullary 2% Osteosarcoma) of (human Hepes, (inner 10% U2OS (sub-clone mM with mIMCD-3 supplemented 5 TC7 (Invitrogen) containing L-glutamine and FBS. mM DMEM/F12 2.5 in epithelial) and cultured bicarbonate pigment sodium were cells retinal duct) (human collecting cells 19 osiuaeeihla oaiain o ifrnito nlssmMD3cells mIMCD-3 analysis 0.24 differentiation at For seeded polarisation. were epithelial stimulate to eeorfnig ugs oe o pc-aa bundle apico-basal for model a suggest findings our Here EB1 and EB2 of expression spatial and temporal precise The ora fCl cec 2 (17) 126 Science Cell of Journal m fSIH Sga o 0mnts MOcnrlwsused was control DMSO a minutes, 40 for (Sigma) SMIFH2 of M m fTxl(im)fr1 or.FrRC niiinARPE- inhibition ROCK For hours. 12 for (Sigma) Taxol of M m 6 oeplcroaecl utr net Nn)fr57days 5–7 for (Nunc) inserts culture cell polycarbonate pore m 10 4 el n6wl ltsadwr ie n ye every lysed and fixed were and plates 6-well in cells ˚ Cin5%CO m Mor30 2 n asgdtiewel.ARPE- weekly. twice passaged and m fY73 Tci)for (Tocris) Y27632 of M Qae) n iae sn 4DALgs Aesa isine)into Biosciences) experiments. rescue (Amersham and overexpression Ligase for 2 according cells deliver used DNA to was protocol (Polyplus) T4 manufacturer’s jetPRIME to transfection using transient For ligated pmCherry-C1. and (Qiagen), lcrl %TioX0,1m MF 10 10% EDTA, PMSF, mM 1 mM NaCl, mM 1 50 TritonX100, Hepes, mM 1% (50 buffer lysis Glycerol, in lysed were Isolated Cells immunoblotting 1993). and al., PAGE SDS et as Whitehead fractioned was 2010; cold colon al., in and fixed et were intestine fractions (Belshaw Small 2000). described al., previously 1:800. et at Secondary (Mogensen used antibodies were described 1:200. (Jackson) secondary at 647 used cross-absorbed at and were highly 488 used (Invitrogen) Dylight staining 647 to tissue was or conjugated isolated 568, (Invitrogen) For 488, AlexaFluor 1:1000. phalloidin 488 to staining actin conjugated AlexaFluor For antibodies against 1:1000. antibodies to at and (Abcam) 1:200 conjugated at YL1/2 used clone k52 were tubulin clone (Abcam) EB2 tyrosinated KT36 against clone antibodies (BD tubulin EB3 monoclonal EB1 and Rat against (Abcam) detyrosinated 1:500. antibodies at monoclonal used against Mouse were 1:2000. biosciences) ACF7 antibodies at Abcam) against 1:100, (ab50188 EB1 antibodies and at Abcam) polyclonal used (ab48389 previously Rabbit were as 2009). performed Microsystems) Sigma), were al., cells et (HPA013713 cultured (Bellett of described immunolabelling and Fixation isolation tissue and Immunolabelling otaeadpoesduigVlct Ipoiin n htso (Adobe) LSM 37 at Photoshop stage Zeiss heated and a using on (Improvision) maintained were taken cells Volocity microscopy were live using For LSM510 Images (Adobe) software. processed Zeiss a Photoshop microscope. and using and imaged confocal software were (Zeiss) scanning tissues Axiovision isolated META and using al. cells processed et Polarised monochrome widefield a software. and a Bellett using on taken camera were in imaged Images were CCD microscope. described cells 200M immunolabelled Axiovert previously and Zeiss Fixed upright as 2009). al., performed et (Bellett was microscopy microscopy Electron electron and confocal Widefield, The (Clontech). vector pmCherry-C1 the and by frame into PCR restricted in cloning Fidelity was designed High for were insert Expand sites NM_001162942 using restriction on cells based with mIMCD-3 Primers from (Roche). cloned System was cDNA transfection EB2 cDNA and generation mCherry–EB2 0.1 at seeded were measured cells were ARPE-19 cells analysis rescued and proliferation 55 hours cell and 0 For cells CAGCAGGTGC- EB2-depleted at blindly. and siRNA) scramble each control, of 310 (a) nM (27 siRNA of siRNA nM hours. 54 48 ARPE-19 with mRNA, EB2 treated EB2 were and EB1 cells EB2 of CTCGATAACC- depletion (d) sequences; simultaneous AACGCAGGTCATACAGCTTAA, For siRNA CAAGAGACTAT. EB2 (b) GACCTTATTAATAGGAGCATA, target (c) siRNA siRNA Human indicated EB2 ACCAATTGCATCCCAGCTAAA. siRNA at AGCTAAARCAA, sequence was protocol target (Qiagen) EB2 sequence manufacturer’s EB1 delivered siRNA was Human scramble per siRNA Allstar used. All controls as siRNA. negative of For (Invitrogen) (Qiagen) nM timepoints. siRNA 72 of Oligofectamine with nM treated 27 by were with cells treated were TC7 cells whereas U2OS and HCT-116 ARPE-19, transfection RNAi el eegoni i-elpae n hs otatiae eecpue using captured were images contrast phase and plates a six-well in grown were cells o ute 2husbfr fixation/lysis. before hours 42 further a for os oolnlatbde gis B n F a686Acm eeused were Abcam) (ab65856 RFP and EB1 against antibodies antibodies monoclonal polyclonal Mouse Rabbit PBS-T. in indicated against as diluted antibodies primary for eesrpe Ceio)adatbd nuainaddtcinwsrepeated. was detection and incubation membranes antibody reprobing, and For secondary (Chemicon) 1:10,000. with stripped at incubated were then used and (Sigma) washed K52 was antibodies clone membrane HRP-conjugated EB2 The against 1:200. antibodies at polyclonal used Rat were respectively. 1:1000 and 1:500 at %CO 5% ouainwsmaue 4husad4 or ae.Fraiobslarray At apico-basal hours. 96 For and 0.3 hours later. at 48 seeded hours, cell hours were 0 and 48 at cells hours) siRNA hours and 48 with 102 treated and hours were (0 24 cells TC7 treatment analysis, measured siRNA each was before population 6) plate, (multiwall well eernuigSSPG.Poen eetaserdot nitrocellulose onto milk transferred 0.5% containing were 4 [PBS at PBS-T overnight Proteins Tween20] in 0.05% PAGE. blocked and samples (oxoid) was and powder SDS which (Pierce) assay (BioRad), using BCA membrane a run using determined were was concentration proteins 6 ra fcriioainadimnlbligwspromda previously as performed was immunolabelling and isolation corti of Organ o RE1 elsz nlss el eegont ofuneadteae of area the and confluence to grown were cells analysis; size cell ARPE-19 For 0ojcieeey1 iue o 4hu eid einn t7 or after hours 72 at beginning period, hour 24 a for minutes 10 every objective 20 2 b o nlsso eldvso,srml n B-iN-rae ARPE-19 EB2-siRNA-treated and scramble division, cell of analysis For . atnwr sda 1:10,000, at used were -actin b atn(b27Acm t120adatbde against antibodies and 1:200 at Abcam) (ab8227 -actin Xho a tbln(b54 ba)adK-7(Leica Ki-67 and Abcam) (ab15246 -tubulin 2 and I 20 ˚ ehnlfr1 iue n tie sabove. as stained and minutes 10 for methanol C 6 10 Hin a 6 m tblnaddtrsntdtblna 1:500. at tubulin detyrosinated and -tubulin II(oh) uiidb e extraction gel by purified (Roche), dIII so Cer–B DAit ARPE-19 into cDNA mCherry–EB2 of gs nocvrlp n2-elpae n left and plates 24-well in coverslips onto m /lartnn t4 at aprotinin) g/ml ˚ .Temmrn a probed was membrane The C. ˚ .Equal C. 6 10 ˚ with C 6 per Journal of Cell Science esrdi II niiulfae eeanttdi db htso,and CS6 Photoshop, production. illustrator Adobe figure Adobe in final (Microprojects). for annotated Time-lapse used were using was manually movies frames was into frame Individual each assembled FIJI. in the and length in inverted Microtubule smoothed, measured adjusted. filter, mask contrast unsharp and the brightness with treated were areas briefly, 12.5 eemitie npeo e reDE/1 Ivtoe)medium a set at (Invitrogen) captured glass-bottomed using were cm Images 3 DMEM/F12 treatment. (Invitrogen), levels a siRNA in after L-glutamine free (Invitrogen), hours exposure mM 96 bicarbonate (MatTek), 2.5 sodium red dish 2% (Invitrogen), Petri and Hepes FBS phenol mM 10% 5 in with supplemented GFP– maintained and expressing scramble stably untreated, were dynamics, cells microtubule ARPE-19 of EB2-siRNA-treated analysis For treatment. siRNA le-iv,J,Sa J., Alves-Silva, References at http://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.129759/-/DC1 online available material B.J.T.). Supplementary to support (Studentship J.R.G. BBSRC to the supports and and (Studentship (studentship J.K.); Appeal D.A.G.; (AS) BigC and and the Society D.A.G.); M.M.M. Anatomical to the support to P.P.P.]; BB/J009040/1 Biological to G.B.; and BBS/B/00689 and Biotechnology BB/D012201\1 M.M.M. the numbers to [grant by (BBSRC) Council supported Research Sciences was project This with Funding assistance the isolation edited and read and crypt authors All directed manuscript. and data, manuscript. the expertise wrote analysed and work M.M.M. project analyses. the provided construct and imaging in microscope P.T. training provided E.K.L. respectively. and and P.P.P. with experiments. assisted expertise preparations of B.J.T. performance and figure the J.K. and with manuscript. design the assisted designed and writing J.R.G. with experiments and D.A.G. and and performed D.A.G. conceived G.B. data. and M.M.M. analysed J.R.G. and D.A.G., G.B. experiments. J.R.G., D.A.G., contributions Author and manuscript. discussions helpful the for on discussions Hyams comments helpful Jeremy Wright for and Paul Prescott Gavrilovic and Alan Jelena advice thank and also for Selina We Mayer assistance. Uli Microscopy, IT diagrams, for Electron with culture, with help tissue for with help Catto help for for Perkins Evans-Gowing James Richard thank to wish authors The Acknowledgements S1. unpaired Table material two-tailed supplementary in a found be can using significance analysed was assess To in ( unpaired treatment). events experiment per crossover microtubule microtubules each of 60+ number 10 of average cortical (total the straightness cells microtubule five from averaged boxed from averaged and measured was Cell TC7 cells. differentiating ARPE-19 (143 in of regions siRNA size EB2 of and analysis height area cell for significance statistical unpaired two-tailed A analysis Statistical irtbl)wr crda rwho hikg.Frec irtbl the microtubule a each Using calculated. For was pausing shrinkage. and unpaired or shrinking growing, two-tailed growth spent same time as of the percentage scored movements (from were where images microtubule) frames, exposure using between set determined unpaired was two-tailed from significance statistical a (Andor), measured AndorIQ microtubule using was the experiment) along channel) ACF7 2 and along tubulin EB1 intensity of average analysis unpaired lattice, intensity two-tailed fluorescence a using For determined test. was significance statistical and treatment pcrpaispooemcouuemdae xnlgot yfntoigas functioning by al. growth et A. axonal R. Kammerer, C., microtubule-mediated Ballestrem, J., promote K. Venken, Spectraplakins J., H. Bellen, H., T. 6 12.5 t ts.Frcl rlfrto sesetcl rwhadK-7expression Ki-67 and growth cell assessment proliferation cell For -test. m m ra eeslce n rcse nFJ IaeJ software; J) (Image FIJI in processed and selected were areas m m m 6 m 6 10 nhzSrao . evn . li,M,Pri,J,Millard, J., Parkin, M., Klein, R., Beaven, N., ´nchez-Soriano, 143 n m 5 oe eecutdi iecls(he oe e el for cell) per boxes (three cells five in counted were boxes m t )adsgiiac a eemnduigatotailed two a using determined was significance and 3) ts ttsia infcnewsdtrie rmdata from determined was significance statistical -test m t ts.Mcouuednmc eeaaye sn length using analysed were dynamics Microtubule -test. ) utpergoswr hnfrhraeae o each for averaged further then were regions Multiple m). t ts ihWlhscreto a sdt determine to used was correction Welch’s with -test 6 3ojcieeey3scnsfr3minutes. 3 for seconds 3 every objective 63 m etoso 5rno irtbls(using microtubules random 25 of sections m § 6 0.5 t m ts.Smaiso aaand data of Summaries -test. wdho loecneof fluorescence of (width m a tbln(Clontech) -tubulin B sakyrgltro irtbl eraiain4013 reorganisation microtubule of regulator key a is EB2 (2012). t - uns,D . ake,C .adSegr .S. P. Steyger, and M. C. Hackney, Pou N., I., D. Cantaloube, Furness, S., Moutel, M., Quesnoit, Amos, A., and A. Dimitrov, R. Cross, M., Osei, R., D. Drummond, M., Katsuki, A., Georges, des aefd . aaadn . hn,T,Hih .H,Fune,A .and E. A. Fournier, H., S. Hsieh, T., Zhang, B., Dayanandan, H., Darenfed, hn,I . sn,B . a,K . hn,A . hn .W,T,K . Lai, F., K. To, W., A. Chan, K., A. Ching, P., K. Lai, C., B. Tsang, M. K., G. I. Bokoch, Cheng, and F. Z. Chang, J., Birkenfeld, P., Nalbant, C., Y. Chang, rne,M,Zne .T n ooh .M. G. Bokoch, and T. F. Zenke, M., Krendel, uy .M,Mhn . ele . azhei . ismr .H,Mne,A., Menzel, H., J. Missimer, T., Walzthoeni, K., Leslie, R., Mohan, M., R. Buey, oa,B,To .L,Ma L., J. Teo, B., Kovac, E. Fuchs, and A. Vaezi, E., Wong, I., Karakesisoglou, A., Kodama, E. Fuchs, and A. H. Pasolli, D. A., Kobielak, C. Nobes, and P. Martin, L., Tahtamouni, W., J. Astin, S., Kadir, T. Wittmann, and S. H. Stein, Gierke, and U. Schwab, H., H. Wacker, H., Baisch, H., Lemke, J., Gerdes, u .adS,L K. L. Su, and W. Bu, oaoa . eGot .O,Gioiv . ovi,S . utau .L., E. Munteanu, M., S. Gouveia, and I., Grigoriev, G. O., G. C. Borisy, Groot, De F., Y., Grosveld, Komarova, N., Galjart, G., Lansbergen, Y., Komarova, E. Fuchs, and Y. Yang, I., Karakesisoglou, Narumiya, and T. Kato, T., Furuyashiki, M., Okamoto, Y., Morishima, T., Ishizaki, Fackler, and S. Benichou, R., Madrid, W., Muranyi, S., Schroeder, E., J. Gasteier, u .adS,L K. L. Su, and W. Bu, B. N. Slepecky, and J. Bateman, H., Xiang, H., T. MacRae, C., B. Bane, a,S . i .Y,Ce,J,Pn . at,S,Trsia . at,K,Miyawaki, K., Saito, T., Terashita, S., Saito, L., Pan, J., Chen, Y., C. Li, Y., S. Gao, esa,N . a,N,Tp,H . any .R,Lws .P,Wlim,M R., M. Williams, P., M. Lewis, R., J. Dainty, S., H. Tapp, N., Pal, J., N. Belshaw, G. G. Gundersen, and F. Bartolini, Simons, and H. E. Stelzer, E., Karsenti, C., Dotti, C., Antony, R., Bacallao, elt,G,Cre,J . eno,J,Glsik . ae,C,Ms,D .and K. D. Moss, C., James, D., Goldspink, J., Keynton, M., J. Carter, G., Bellett, ennsi irtbl rescues. microtubule in remnants F. lattice. microtubule A. L. oi.Cytoskeleton Motil. A. C. Mandato, rmtscl oiiyvaatvto fRo signalling. RhoA of activation via motility N. cell Wong, promotes and B. P. E-1mdae rs-akbtenmcouue n h ci cytoskeleton. actin the and microtubules Biol. Cell between cross-talk mediates GEF-H1 E-1culsncdzl-nue irtbl iasml ocl contractility cell to disassembly RhoA. microtubule via tips nocodazole-induced microtubule couples discriminating GEF-H1 for al. domain et C-terminal its I. lattice. of Smal, the role from I., the Grigoriev, and K., structure Bargsten, S., Bjelic, otatl oslsrs iesrequires fibers cells. stress spreading dorsal contractile aiyproteins. family coe,J . onpa . uy .M,Hoera,C . Dogterom, C., C. Hoogenraad, M., R. Buey, growth. S., al. et Honnappa, M. M., J. Schober, microtubules. growing A. Akhmanova, dynamics. microtubule of integrator essential cables. actin linear of polymerization and junctions adherens junctions. cellular at networks microtubule and actin contact during switch polarity front-rear locomotion. the of for inhibition required is remodelling Microtubule mDia1. effector S. remodeling. epithelial 762. 3D during dynamics protrusion coordinate by defined antigen Ki-67. nuclear antibody human monoclonal proliferation-associated cell the a of analysis cycle Cell elongation. cell mediate T. O. aiyproteins. family euae irtbl-ae rcs omto fclue ooye—niiinof al. podocytes—inhibition elongation. et cultured process promoted of K. ROCK formation process Mominoki, microtubule-based K., regulates Shigemoto, K., ooi rpsrva gn n acrrltdfeddfcsi h morphologically the in defects field cancer-related and mucosa. aging normal T. reveal I. crypts Johnson, colonic and K. E. Lund, sensory auditory gerbil the of modifications. cells post-translational tubulin supporting Res. with in correlation stability epithelium: cold Microtubule epithelium. polarized a of formation the K. irtblsi oherhi cells. hair cochlear in microtubules ucin sivle nteasml faiobslary nplrsdepithelial polarised in arrays apico-basal of assembly the in cells. involved is junctions M. M. Mogensen, Acta Biophys. interacting (tip +TIPs EB1-dependent proteins). and proteins microtubule-associated structural 20) eeto fGPtblncnomto nvv eel oefrGTP for role a reveals vivo in conformation GTP-tubulin of Detection (2008). 20) oriaino irtblsadteatnctseeo yteRho the by cytoskeleton actin the and microtubules of Coordination (2001). 18) h uclua raiaino ai-ab aiekde el during cells kidney canine Madin-Darby of organization subcellular The (1989). 307 elMtl Cytoskeleton Motil. Cell 20) a3 h cioacaoye ob ooo fE1 hne the changes EB1, of homolog pombe Schizosaccharomyces the Mal3, (2008). 20) HD oriae ci iaetadmcouueainetto alignment microtubule and filament actin coordinates FHOD1 (2005). .Cl Biol. Cell J. 57-67. , .Neurosci. J. 4 20) amla n idn rtiscnrlpritn microtubule persistent control proteins binding end Mammalian (2009). o.Bo.Cell Biol. Mol. 294-301. , 1803 .Cl Sci. Cell J. .Bo.Chem. Biol. J. a.Cl Biol. Cell Nat. Oncogene Carcinogenesis o.Bo.Cell Biol. Mol. 20) oeua hrceiaino h fet fY-27632. of effects the of characterization Molecular (2007). 20) B n B oto LPdsoito rmteed of ends the from dissociation CLIP control EB3 and EB1 (2005). 20) irtbl lsedadmnsedcpuea adherens at capture minus-end and plus-end Microtubule (2009). 164-173. , a.Src.Ml Biol. Mol. Struct. Nat. 64 20) hrceiaino ucinldmiso ua EB1 human of domains functional of Characterization (2003). 184 21) E-1oe-xrsini eaoellrcarcinoma hepatocellular in over-expression GEF-H1 (2012). 20) euaino irtbl sebyb ua EB1 human by assembly microtubule of Regulation (2001). 97-109. , 32 o.Bo.Cell Biol. Mol. ¨kela x.Cl Res. Cell Exp. 691-706. , 9143-9158. , .Cl Sci. Cell J. 19 20 126 ,T .adVleis T. Vallenius, and P. T. ¨, 2147-2153. , 3185-3192. , 21) B-erie irtbl TPcomplexes +TIP microtubule EB1-recruited (2012). 66 278 263-273. , 3 22 31 .Immunol. J. 8-14. , 893-908. , 21) atrso N ehlto nindividual in methylation DNA of Patterns (2010). Science 2912-2923. , 1158-1163. , 49721-49731. , .Eeto irs.Tech. Microsc. Electron J. 124 eho.Ep Nephrol. Exp. Nephron. 21) omn n microtubules. and Formins (2010). 16 306 20) amla omn1priiae in participates formin-1 Mammalian (2004). .Cl Biol. Cell J. 2642-2653. , 5334-5345. , 20) neiemlpai htintegrates that plakin epidermal An (2000). 322 a 15 192-202. , atnn1adRc nmgaigand migrating in Rac1 and -actinin-1 133 1102-1108. , 1353-1356. , Cell 20) h-OKsga pathway signal Rho-ROCK (2004). 20) uloieecag factor exchange Nucleotide (2002). 1710-1715. , 115 .Cl Biol. Cell J. 109 343-354. , 2817-2832. , 21) sebyo non- of Assembly (2013). .Pathol. J. 21) nihsit EB1 into Insights (2011). 19) raiainof Organization (1990). a.Cl Biol. Cell Nat. 97 15 s .adPerez, and C. ¨s, ur Biol. Curr. e49-e61. , 261-279. , 149 20) C7 an ACF7: (2003). 228 195-208. , 575–585. , elTissue Cell 6 Biochim. 22 21-30. , (2008). (2011). (1984). (2002). 753- , Nat. Cell Journal of Cell Science adld . uc,K . itan . rs,H,Bunr .adHoenger, and D. Brunner, H., Gross, P., Tittmann, E., K. M. Busch, A. L., Pendergast, Sandblad, and R. Li, A., Echarri, R., J. Ryu, os .K,Blet . atr .M,Loi,M,Kytn . rsot .R,Lane, R., A. Prescott, J., Keynton, M., Liovic, M., J. Carter, G., Bellett, K., D. Moss, iv,S . ed,E . u,J,Fie,Z,Sa,C . adl .L,Kozmin, L., M. Gardel, T., C. Skau, Z., Feiger, J., Cui, M., E. Neidt, A., S. Rizvi, G. G. Gundersen, Bre and R., S. Pepperkok, A. Alberts, A., T. Cook, F., A. Palazzo, L. M. Gardel, and J. Stricker, Y., N. Beckham, W., Hirokawa, P. Oakes, and F. Perez, Y., Okada, S., Niwa, T., Nakata, Slepecky,N.B.,Henderson,C.G.andSaha,S. orsn .E,Wrlwrh .N,Aka,J . aka,A .and F. A. Markham, M., J. Askham, N., Na B. and Wardleworth, R. E., A. E. Prescott, Morrison, B., J. Mackie, B., Bornens, J. and Tucker, V. M., Bouckson-Castaing, M. M., Mogensen, Piel, A., Malik, M., M. Mogensen, hno,K . amn .C,BnMre . inur .S n amn .D. E. Salmon, and S. J. Tirnauer, C., Moree, Ben C., J. Canman, B., K. Shannon, Q. C. Doe, and E. S. Siegrist, arr .P,Funo,F . onr . ors .A n ury T. Surrey, and A. C. Moores, G., Bohner, J., F. Fourniol, P., S. Maurer, T. Surrey, and A. Hoenger, J., Cope, P., Bieling, P., S. Maurer, cie .M,Jb .adLndn .Y. W. Langdon, and D. Job, M., R. Scaife, i . ii . aaae . aeo . uiaa . abci .and K. Kaibuchi, I., Sugiyama, M., Kakeno, T., Watanabe, T., Miki, W., Li, A. Akhmanova, and G. Lansbergen, 4014 tblzstemcouueltieseam. lattice microtubule the stabilizes A. complexes. Abi/Diaphanous by adhesion oeueihbtro omnmdae ci assembly. R. actin D. formin-mediated of Kovar, inhibitor molecule and A. S. 3012. microtubules. stable of orientation and Biol. formation Rho-regulated mediates template. fiber stress a without maturation adhesion Biol. focal for sufficient not polarized but underlies microtubules GTP-tubulin-rich to motor transport. kinesin-1 vesicle a of binding microtubules. M. along M. bi-directionally Mogensen, moves and B. E. tblzdi ofun pteilclsbtnti fibroblasts. in not but cells epithelial confluent in stabilized cycle. cell the throughout cytoskeleton microtubule the Oncogene with associated is suppressor, M. D. microtubule of Meredith, arrays cells. parallel epithelial establishing polarized in highly involved in is bundles and ends plus microtubule S. I. ninein. of role the sites: M. oiiain ftblnsgetta yai irtblsaepeeti sensory in present are in microtubules dynamic furrow that suggest cytokinetic tubulin of the modifications position can microtubules cells. mammalian Taxol-stabilized (2005). Dev. eonz uloiedpnetsrcua a tgoigmcouueends. microtubule growing at end- cap structural by 149 nucleotide-dependent recognized a recognize structure end microtubule (EBs). growing proteins the binding mimic microtubules nuto fnuielk xesosi I T irbat yihbto fROCK of inhibition by fibroblasts 3T3 NIH in Cbl. and extensions neurite-like of induction rspiacells. Drosophila G. Goshima, activities. 371-382. , 20) irtbl iu-n nhrg tcnrsmladnon-centrosomal and centrosomal at anchorage minus-end Microtubule (2000). 20) h cioacaoye ob B ooo a3 id and binds Mal3p homolog EB1 pombe Schizosaccharomyces The (2006). 21 3 196 20) h dnmtu oyoi oipoenuabgosylclzsto localizes unambiguously protein coli polyposis adenomatous The (2002). 723-729. , 483-496. , 363-374. , o.Bo.Cell Biol. Mol. Traffic ora fCl cec 2 (17) 126 Science Cell of Journal 17 3471-3477. , 21) B rmtsmcouuednmc yrcutn etnin Sentin recruiting by dynamics microtubule promotes EB1 (2011). ,M . aos,J n ri,T E. T. Kreis, and J. Davoust, H., M. ´, .Cl Biol. Cell J. .Cl Biol. Cell J. 7 o ilCell Biol Mol 499-507. , 19) B,apoenwihitrcswt h P tumour APC the with interacts which protein a EB1, (1998). rc al cd c.USA Sci. Acad. Natl. Proc. .Cl Sci. Cell J. 14 4605-4617. , 20) irtbl-nue otclcl polarity. cell cortical Microtubule-induced (2007). 20) dniiainadcaatrzto fasmall a of characterization and Identification (2009). 193 194 20) ieni eesdfo h etooeand centrosome the from released is Ninein (2007). 16 973-983. , 245-255. , 4423-4436. , 113 20) irtbl lsed u fcellular of hub a end: plus Microtubule (2006). Cell 3013-3023. , o.Cl.Biol. Cell. Mol. .Cl Sci. Cell J. .Cl Biol. Cell J. 127 20) ai microtubule-dependent Rapid (2003). 1415-1424. , 108 20) euaino cell-cell of Regulation (2009). hm Biol. Chem. 120 3988-3993. , 157 19) Post-translational (1995). 21) eso srequired is Tension (2012). 29 3064-3074. , 19) irtblsare Microtubules (1990). 1735-1748. , .Cl Biol. Cell J. 1041-1048. , 21) GTPgammaS (2011). 21) Preferential (2011). 16 1158-1168. , 20) mDia (2001). 21) EBs (2012). 111 a.Cell Nat. 3003- , .Cell J. ¨thke, Genes Cell a e ar,B,Ahaoa .adSrue A. Straube, and A. Akhmanova, B., Vaart, der van a e le,L .adCees H. Clevers, and Russell, G. and L. M. M. Flier, Mogensen, der P., van G. Richardson, C., C. Paton, B., J. Tucker, sj,T,Ihzk,T,Oaoo . iahd,C,Kmr,K,Frysii T., Furuyashiki, K., Kimura, C., Higashida, M., Okamoto, T., Ishizaki, T., Tsuji, E. B. Bierer, W. and J. S. Copeland, J. and Tirnauer, M. J. Lee, S., Shaikh, A., W. M. Kulacz, F., Bornens, S. and Thurston, B. Maro, M., A. Tassin, J. A. Ridley, and R. Garg, B., Wojciak-Stothard, J., S. Heasman, A., Takesono, Kelley, I., G. Frolenkov, N., Gavara, S., R. Petralia, R., Stepanyan, B., K. Szarama, u .K,Brel . il .E,Gui,J,Bet . ithr,R,Tet J., Trent, R., Wiltshire, R., Brent, J., Gyuris, E., D. Hill, M., Burrell, K., L. Y. Su, Qi, and K. L. Su, A. Merdes, and A. Straube, htha,R . aEdn .E,Nbe .D,Aaits .adJt .S. P. Jat, and P. Ataliotis, D., M. Noble, E., P. VanEeden, H., R. Whitehead, M., Chen, J., E. Morris, N., Cabrera-Poch, J., Schmoranzer, H., C. Eng, Y., Wen, hn,T,Za,K . hrdn . et,A,Gnesn .G n Ralston, and G. G. Gundersen, A., Mehta, J., Sheridan, J., K. Zaal, T., Zhang, T. Svitkina, and G. Scita, S., Kojima, S., Gerboth, L., Czech, C., Yang, E. Fuchs, and A. Kodama, X., Wu, X. Zhu, and Q. Huang, J., Cao, Q., Chre Zhang, C., F., Garnier, Wang, C., Heichette, M., F. Coquelle, B., Vitre, ifrnito nteitsia epithelium. intestinal cochlea. the mouse in the differentiation of cell pillar inner the in material J. I. yai instability. dynamic naoiei h-eedn a ciaini ws T fibroblasts. 3T3 Swiss in activation al. Rac 157 et H. Rho-dependent Hirai, in T., Nakamoto, antagonize B., R. Birge, Y., Arakawa, cells. T in ONE signaling Rho/ROCK through polarity migratory regulate Microtubules organ developing the in properties Corti. mechanical of surface cell S. and R. formation Chadwick, microtubule and W. M. elplrt,adcrmsm stability. chromosome and proteins. polarity, formin cell of feature general a is acetylation ONE microtubule PLoS induce to ability The vitro. in myogenesis during centers W. K. Res. Kinzler, Cancer and B. Vogelstein, fusion. and elongation myoblast for required is and cortex Dat tblz irtblsdwsra fRoadpooecl migration. cell promote and Rho G. of G. Biol. downstream Gundersen, Cell microtubules and stabilize S. to A. mDia Alberts, J., B. Wallar, el n tbemcouue r rsn nspotn el ftemammalian proteins. the of cells supporting in present are microtubules cochlea. stable and cells ifrnito,eogto n fusion. and elongation differentiation, cells. E. motile in formation filopodia and lamellipodia in Biol. mDia2 formin of roles and mice. colon transgenic both 587-591. H-2Kb-tsA58 from adult lines of cell intestine epithelial small immortalized conditionally of Establishment seminiferous testicular in plasticity cell Sertoli in tubules. involved is EB1 protein end-binding Biol. Cell yaisadmgainadhsAPs activity. ATPase has and migration and dynamics I. 20) B euae irtbl yaisadtblnsetcouei vitro. in closure sheet tubulin and dynamics microtubule regulates EB1 (2008). 20) irtbl lsedbnigpoenE1i eesr o ucecell muscle for necessary is EB1 protein binding plus-end Microtubule (2009). 819-830. , 19) elsraeascae etooa ae fmicrotubule-organizing of layer centrosomal surface-associated cell A (1992). 5 5 e317. , e8774. , x.Cl Res. Cell Exp. er Res. Hear. Bioarchitecture Genomics 6 10 820-830. , 7 415-421. , 55 e48041. , 2972-2977. , 71 91 ice.Sc Trans. Soc. Biochem. 20) hrceiaino ua AR ee n their and genes MAPRE human of Characterization (2001). 142-149. , 136-147. , 314 2 214-219. , 213-226. , 20) B euae irtbl yaisa h cell the at dynamics microtubule regulates EB3 (2007). 21) irbatgot atrrcpo regulates 3 receptor factor growth Fibroblast (2012). 20) B rtisrglt irtbl dynamics, microtubule regulate proteins EB1 (2000). 20) C7rgltsctseea-oa adhesion cytoskeletal-focal regulates ACF7 (2008). .Cl Biol. Cell J. 19) P id otenvlpoenEB1. protein novel the to binds APC (1995). .Cl Sci. Cell J. .Cl Biol. Cell J. 37 nu e.Physiol. Rev. Annu. 20) tmcls efrnwl and self-renewal, cells, Stem (2009). 18) aeo microtubule-organizing of Fate (1985). 1007-1013. , 100 122 20) euaino microtubule of Regulation (2009). Cell 35-46. , 149 1401-1409. , rc al cd c.USA Sci. Acad. Natl. Proc. 20) B n P idto bind APC and EB1 (2004). .Cl Sci. Cell J. 20) h irtbl plus microtubule The (2008). 135 761-766. , ur Biol. Curr. 20) OKadmDia1 and ROCK (2002). 137-148. , te,D n Arnal, and D. ´tien, 71 241-260. , 102 17 215-226. , 20) Novel (2007). 1318-1325. , .Cl Biol. Cell J. (2012). (1993). (2010). PLoS PLoS Nat. Nat. 90 ,