Activated Protein C Ameliorates Renal Ischemia- Reperfusion Injury by Restricting Y-Box Binding Protein-1 Ubiquitination

BASIC RESEARCH www.jasn.org

† ‡ Wei Dong,* Hongjie Wang,* Khurrum Shahzad,* Fabian Bock,* Moh’d Mohanad Al-Dabet,* Satish Ranjan,* Juliane Wolter,* Shrey Kohli,* Juliane Hoffmann,* Vishnu Mukund Dhople,§ | | Cheng Zhu, Jonathan A. Lindquist, Charles T. Esmon,¶ Elisabeth Gröne,** Herman-Josef | †† Gröne,** Thati Madhusudhan,* Peter R. Mertens, Dirk Schlüter, and Berend Isermann*

*Institute of Clinical Chemistry and Pathobiochemistry, Medical Faculty, |Department of Nephrology and Hypertension, Diabetes and Endocrinology, and ††Institute of Microbiology, Medical Faculty, Otto-von-Guericke University Magdeburg, Magdeburg, Germany; †Department of Cardiology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China; ‡Department of Molecular Genetics, University of Health Sciences, Khayaban-e-Jamia Punjab, Lahore, Pakistan; §Department of Functional Genomics, Interfaculty Institute for Genetics and Functional Genomics, University Medicine Greifswald, Greifswald, Germany; ¶Coagulation Biology Laboratory, Oklahoma Medical Research Foundation, University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma; and **Department of Cellular and Molecular Pathology, German Cancer Research Center, Heidelberg, Germany

ABSTRACT Ischemia-reperfusion injury (IRI) is the leading cause of ARF. A pathophysiologic role of the coagulation system in renal IRI has been established, but the functional relevance of thrombomodulin (TM)-dependent activated protein C (aPC) generation and the intracellular targets of aPC remain undeﬁned. Here, we investigated the role of TM-dependent aPC generation and therapeutic aPC application in a murine renal IRI model and in an in vitro hypoxia and reoxygenation (HR) model using proximal tubular cells. In renal IRI, endogenous aPC levels were reduced. Genetic or therapeutic reconstitution of aPC efﬁciently ameliorated renal IRI independently of its anticoagulant properties. In tubular cells, cytoprotective aPC signaling was mediated through protease activated receptor-1- and endothelial protein C receptor-dependent regulation of the cold-shock protein Y-box binding protein-1 (YB-1). The mature 50 kD form of YB-1 was required for the nephro- and cytoprotective effects of aPC in vivo and in vitro, respectively. Reduction of mature YB-1 and K48-linked ubiquitination of YB-1 was prevented by aPC after renal IRI or tubular HR injury. aPC preserved the interaction of YB-1 with the deubiquitinating enzyme otubain-1 and maintained expression of otubain-1, which was required to reduce K48-linked YB-1 ubiquitination and to stabilize the 50 kD form of YB-1 after renal IRI and tubular HR injury. These data link the cyto- and nephroprotective effects of aPC with the ubiquitin-proteasome system and identify YB-1 as a novel intracellular target of aPC. These insights may provide new impetus for translational efforts aiming to restrict renal IRI.

J Am Soc Nephrol 26: 2789–2799, 2015. doi: 10.1681/ASN.2014080846

Ischemia-reperfusion injury (IRI) is the leading cause Received August 31, 2014. Accepted January 6, 2015. ofARF.TheconsequencesofrenalIRIcanbedramatic, W.D., H.W., K.S., P.R.M., D.S., and B.I. contributed equally to this resulting in a marked decline of renal function and work. high mortality rates. A number of candidate mech- Published online ahead of print. Publication date available at anisms involved in renal IRI have been identiﬁed in www.jasn.org. preclinical studies, including mechanisms such as Correspondence: Dr. Berend Isermann, Institute of Clinical protein ubiquitination, endothelial dysfunction, or Chemistry and Pathobiochemistry, Otto-von-Guericke-University coagulation activation.1–5 Whether and how these Magdeburg, Leipziger Str. 44, 39120 Magdeburg, Germany. Email: intra- and extracellular signaling mechanisms may [email protected] or [email protected] interact in renal IRI remains unknown. Copyright © 2015 by the American Society of Nephrology

J Am Soc Nephrol 26: 2789–2799, 2015 ISSN : 1046-6673/2611-2789 2789 BASIC RESEARCH www.jasn.org

Tissue factor-dependent coagulationandthrombinactivation system and YB-1. First, we established that renal IRI impairs in aggravate tubular injury through protease activated receptor-1 vivo PC activation (Figure 1A), reflecting impairment of the (PAR1)–dependent signaling.5 Unlike thrombin, the anticoagulant endogenous TM-PC system in this model. To evaluate the serine protease activated protein C (aPC) is nephroprotective, mechanistic relevance of altered endogenous PC activation, we ameliorating chronic6,7 and acute8,9 renal injury. The opposing ef- used genetically modified mice with impaired TM-dependent fects of thrombin and aPC are largely controlled by thrombomodulin PC activation (TMPro/Pro mice), resulting in low blood levels of (TM).10 TM is a type 1 transmembrane receptor which binds aPC, or mice expressing a hyperactivatable PC mutant, resulting thrombin, directing its activity toward protein C (PC) activation, in high blood levels of aPC (APChigh mice).6,24 Although no dif- therefore providing a functional switch between the serine proteases ferences were observed in sham-operated mice, BUN, creatinine, thrombin and aPC.10 In preclinical studies, therapeutic application tubular injury, and expression of the kidney injury marker of recombinant soluble TM ameliorates IRI in rats.11,12 However, kidney-injury-molecule 1 (KIM1) were significantly induced whether TM-dependent PC activation and signaling through aPC’s inwild-type(WT)miceandfurtherincreasedinTMPro/Pro IRI pivotal receptors PAR1 and endothelial protein C receptor (EPCR) mice (Figure 1, B–G, Supplemental Figure 1A). Of note, these are required for TM-dependent nephroprotection after IRI remains markers were markedly reduced in APChigh IRI mice in compar- unknown.13,14 In addition, although aPC mediated cytoprotection ison with WT IRI mice (Figure 1, B–G). The expression of YB-1 after hepatic IRI has been demonstrated,15 the role of aPC in renal was likewise significantly altered in mice with IRI. YB-1 levels de- IRI or aPC’s intracellular targets in IRI remains unknown. clined in WT IRI and to an even larger extent in TMPro/Pro IRI One potential intracellular target of coagulation proteases in mice, but they were preserved in APChigh mice (Figure 1, F and H). renal IRI is the cold-shock protein Y-box binding protein-1 (YB-1) To determine the therapeutic potential of aPC and the because (1) YB-1 activity is regulated by thrombin, (2) YB-1 is relevance of aPC’s anticoagulant function, we next treated regulated in cardiac IRI, and (3) YB-1 has an established role in mice with exogenous aPC (Supplemental Figure 1B). A subgroup renal diseases other than IRI.16–19 YB-1 is a highly conserved of mice received aPC preincubated with an antibody HAPC1573, protein involved in the regulation of inflammatory processes, which specifically inhibits aPC’s anticoagulant, but not its cyto- including sterile inflammation in renal diseases.19 YB-1 conveys protective effects.25 Both aPC and the aPC-HAPC1573 complex multiple functions through its interaction with DNA, mRNA, and were equally protective in the IRI model (Supplemental Figure 1, proteins.20,21 The diverse functions of YB-1 are in part regulated by its subcellular localization and post-translational modifications, including ubiquitination.20,21 Subcellular localization of YB-1 is furthermore regulated by the coagulation protease thrombin, which induces a partial degradation of YB-1 and nuclear translocation of the N-terminal YB- 1fragmentinendothelialcells.22,23 However, it remains unknown which receptors mediate these effects and whether other coagulation proteases regulate YB-1. Furthermore, the mechanisms through which coagulation proteases modulate partial YB-1 degradation (e.g., relevance of the proteasome or ubiquitination) remain unknown. We speculated that TM, coagulation proteases, and their receptors control renal IRI injury by modulating YB-1 function and that the partial degradation of YB-1 is controlled by the ubiquitin-proteasome system. Hence, we evaluated the effect of TM-dependent aPC generation on YB-1 in Figure 1. Protection from renal IRI by TM-dependent PC activation is associated with renal IRI in this study. sustained YB-1 expression. (A) Plasma levels of aPC are reduced in WT mice after renal IRI (black bars) compared with control (sham, open bars) mice. BUN (B) and creatinine (Crea) (C) in control (Sham) (open bars) and experimental (IRI) (black bars) WT, TMPro/Pro,andAPChigh mice. RESULTS Exemplary images of H&E-stained kidney section from WT, TMPro/Pro,andAPChigh mice without(Sham)orwithIRI(D)andabargraphsummarizing results of pathologic scores (E). Activated PC Maintains Renal YB-1 TM-dependent PC activation modulates KIM1 and YB-1 expression during renal IRI in vivo; Levels during IRI representative immunoblots (F) and bar graphs summarizing results [(G) and (H)]. Mean6SD Renal IRI was induced in mice to evaluate a values of at least six mice per group [(A)–(C), (E), (G), and (H)]; size bar: 20 mm(D);*P,0.05; possible interaction between the TM-PC **P,0.01 [(A): t test;(B),(C),(E),(G),and(H):ANOVA].H&E,hematoxylinandeosin.

2790 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2789–2799, 2015 www.jasn.org BASIC RESEARCH

C–G), and both maintained YB-1 levels (Supplemental Figure 1, challenged by hypoxia and reoxygenation (HR). Pretreatment F–H). Taken together, impaired TM-dependent PC activation is of these cells with aPC reduced KIM1 expression at all time causally linked to renal IRI, but can be compensated by restoring points after reoxygenation in comparison with PBS-treated con- aPC levels. The nephroprotective effect of aPC in IRI is indepen- trol cells (Figure 2, C–F, Supplemental Figure 2, C–F). In agree- dent of its anticoagulant function and is associated with sustained ment with the opposite expression pattern of KIM1 and YB-1 in YB-1 expression. vivo, YB-1 levels declined after HR, but this effect was significantly ameliorated after pretreatment with aPC (Figure 2, C–F). Activated PC Maintains YB-1 Levels in Tubular Cells Therefore, aPC preserves YB-1 protein levels during tubular after Hypoxia Reoxygenation hypoxia-reoxygenation injury in a cell-autonomous fashion. YB-1 is predominately expressed in tubular cells (Figure 2A). After IRI, tubular YB-1 expression is diminished in WT and Protective Effect of aPC in Renal IRI Depends on YB-1 TMPro/Pro but not in APChigh mice (Supplemental Figure 2A). To determine the functional relevance of YB-1 for aPC Interestingly, a severe reduction of renal YB-1 expression is mediated nephroprotection in renal IRI we used heterozygous 2 likewise observed in human renal biopsies after acute renal YB-1 mice (YB-1+/ ; homozygous YB-1 deficiency is embryonic- injury (Figure 2B, Supplemental Figure 2B). To evaluate lethal), which express 50% of YB-1 compared with WTmice.28,29 whether aPC cell autonomously maintains YB-1 expression BUN, creatinine, histopathologic changes, and KIM1 expression 2 in tubular cells, we analyzed differentiated BUMPT cells (a were all increased in YB-1+/ compared with WT mice under- conditionally immortalized mouse proximal tubular cell going IRI (Figure 3, A–F). Although treatment with aPC im- line26,27) or primary renal proximal tubular epithelial cells proved these renal injury indices in WT IRI mice, aPC failed to 2 provide renal protection in YB-1+/ IRI mice (Figure 3, A–F). Likewise, pretreatment of tubular cells with aPC failed to reduce KIM1 expression in YB-1 knockdown cells, whereas aPC efficiently reduced KIM1 expression in control cells transfected with a nonspecific shRNA (Figure 3, G and H, Sup- plemental Figure 3). These data establish that aPC’s cytoprotective effect depends at least partially on YB-1 in renal IRI.

Activated PC Regulates YB-1 Levels via the Ubiquitin Proteasome System To evaluate the mechanism through which aPC maintains YB-1 protein levels we first determined YB-1 protein stability by blocking its resynthesis using cycloheximide (CHX).30 This revealed a time-dependent decay of the mature (50 kD) YB-1 protein, which was diminished by the proteasome inhibitor MG132 (Figure 4, A and B). Figure 2. aPC maintains YB-1 expression in tubular cells after HR. (A) YB-1 is strongly Treatment of CHX-exposed tubular cells expressed in renal tubular cells. Exemplary immunohistochemical YB-1 staining of renal with aPC likewise diminished the YB-1 decay paraffin-embedded tissue sections from healthy WT mice (right), IgG control (left), and (Figure 4, A and B), raising the question as YB-1 antigen detected by HRP-DAB reaction (brown) and hematoxylin counterstain to whether aPC regulates YB-1 stability via (blue); overview (top) and tissue section at higher magnification (bottom); scale bar: ubiquitin-proteasome system. Because 20 mm. (B) Expression of YB-1 (red) in human renal biopsies is reduced after acute renal proteasomal degradation is regulated by injury. Exemplary immunofluorescent staining of renal paraffin-embedded tissue bi- protein ubiquitination, in particular by opsies from patients with AKI graded as mild, moderate, or severe and control tissue K48-linked ubiquitination,31 we next analyzed m sections; scale bar: 20 m. Time-dependent expression of KIM1 and YB-1 in mouse the extent and kinetics of YB-1 ubiquitination tubular cells (BUMPT) [(C) and (D)] and in primary renal proximal tubular epithelial cells in HR-challenged tubular cells without and (rTEC) [(E) and (F)] in vitro at baseline, after 6 hours of hypoxia (H) (1% O for 6 hours), 2 with aPC treatment. Treatment with aPC de- and at various time points (1–12 hours) after reoxygenation (21% O2). Pretreatment with aPC (20 nM) diminishes the increase of KIM1 and the loss of YB-1 expression layedandreducedYB-1ubiquitinationafter compared with PBS-treated control cells; representative immunoblots of whole-cell tubular cell HR injury (Figure 4C). Of note, aPC lysates [(C) and (E)] and line graph [(D) and (F)] summarizing results. Mean6SD value of markedly reduced K48-linked ubiquitination at least three independent experiments [(D) and (F)]; *P,0.05; **P,0.01 (ANOVA). of YB-1 (Figure 4D). To ascertain the effect

J Am Soc Nephrol 26: 2789–2799, 2015 aPC Regulates YB-1 in Renal IRI 2791 BASIC RESEARCH www.jasn.org

because OTUB1 is predominantly expressed in tubular cells (Figure 5A) (human protein atlas: http://www.proteinatlas.org), we fo- cused on this DUB. The interaction of OTUB1 with YB-1 was confirmed by immunoprecipitation (Figure 5B, Supplemental Figure 4, A and B). This interaction was reduced after HR injury, but could be preserved by aPC despite HR injury of tubular cells (Figure 5B). Next, to ascertain whether the TM-PC system regulates OTUB1 in vivo, we determined OTUB1 expression. In control mice (sham group), OTUB1 expression did not differ between WT, TMPro/Pro,and APChigh mice (Figure 5 C and D). However, after renal IRI, OTUB1 expression was reduced in WT IRI mice and TMPro/Pro IRI mice, but it was maintained in APChigh IRI mice(Figure5,CandD,Supplemental Figure 4C). To determine whether the regulation of OTUB1 by aPC has functional relevance for renal IRI, YB-1 expression, Figure 3. Reduced YB-1 expression abolishes the protective effect of aPC in renal IRI. 2 and ubiquitination, we used heterozygous (A)–(F) Renal IRI was induced in WT and heterozygous YB-1 (YB-1+/ ) mice. BUN (A), 2 OTUB1 (OTUB1+/ )(SupplementalFigure5) creatinine (Crea) (B), exemplary images of H&E-stained kidney section (C), bar graph 2 mice. We used OTUB1+/ mice because summarizing results of pathologic scores (D), representative immunoblots of kidney 2/2 lysates (E), and bar graph (F) summarizing results of KIM1 protein levels normalized to homozygous OTUB1 mice are not viable b-actin in control (Sham) (open bars) and experimental mice without (IRI) (black bars) or (D. Schlüter, unpublished data). Renal ex- with aPC pretreatment (IRI+aPC) (striped bars; aPC: 0.5 mg/kg i.p.). Treatment with pression of OTUB1 was reduced to about aPC normalizes BUN, Crea, tissue injury, and KIM1 expression in WT mice, but not in 50% in heterozygous OTUB1 mice (Supple- 2 YB-1+/ mice. (G) and (H) Expression of KIM1 in BUMPT cells stably expressing control mental Figure 5, D and E). Renal injury, as (shRNAc) or YB-1-specific (shRNA YB-1) shRNA after HR. Pretreatment of cells with reflected by serum BUN and creatinine, and aPC (aPC) (20 nM, 30 minutes before hypoxia) normalizes KIM1 expression in controls, histopathologic injury were aggravated in 2 but not in YB-1 knockdown cells exposed to 6 hours of hypoxia (1% O2)followedby6 OTUB1+/ IRI mice compared with WT b hours of reoxygenation (21% O2). Representative immunoblot of KIM1 and -actin in IRI mice. Unlike in WT IRI mice, aPC failed to whole-cell lysates (G) and bar graphs (H) summarizing results. Mean6SD value of at 2 improve renal injury in OTUB1+/ IRI mice least six mice per group [(A), (B), (D), and (F)] or of at least three independent ex- (Figure 5, E–G). Renal protein ubiquitination periments (H); *P,0.05; **P,0.01 (ANOVA). H&E, hematoxylin and eosin. 2 was increased in OTUB1+/ IRI mice compared with WT IRI mice (Figure 5H). Al- of the TM-PC system on ubiquitination in vivo, we analyzed though exogenous aPC treatment normalizes ubiquitination 2 renal tissue extracts from the aforementioned IRI experiments. in WT IRI mice, it failed to do so in OTUB1+/ IRI mice (Figure Ubiquitination was increased in WT IRI mice and increased 5H). Concomitantly, YB-1 levels were markedly reduced in 2 even further in TMPro/Pro IRI mice, whereas no increase was OTUB1+/ IRI mice. Unlike in WT IRI mice, this reduction observed in APChigh IRI mice (Figure 4E). These data establish persisted despite aPC treatment (Figure 5H). These data imply that aPC modulates ubiquitination and suggests that aPC regu- that YB-1, OTUB1, and aPC interact in renal IRI, which may be lates YB-1 protein levels via K48-dependent ubiquitination. mechanistically relevant for the regulation of YB-1 ubiquitination by aPC. Cytoprotective Effect of aPC Is Impaired in Heterozygous OTUB1 Mice Reduction of YB-1 Ubiquitination by aPC Requires To evaluate the mechanism through which aPC reduces YB-1 OTUB1 ubiquitination, we immunoprecipitated YB-1 from tubular cells To determine the mechanistic relevance of OTUB1 for the and identified proteins interacting with YB-1 using LC-MS/MS. aPC-dependent ubiquitination of YB-1, we next conducted in Among 685 proteins immunoprecipitated, we identified 6 DUBs vitro studies. In line with the in vivo results, HR reduced (otubain-1 [OTUB1], OTUD4, UBP4, UBP5, UBP7, UBP10). OTUB1 expression in tubular cells (Figure 6, A and B). Because reduced expression has been previously demonstrated The HR-induced reduction of OTUB1 was prevented by for OTUB1 in a model of renal tubulointerstitial injury32 and aPC (Figure 6, A and B). To determine whether modulation

2792 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2789–2799, 2015 www.jasn.org BASIC RESEARCH

increased expression of OTUB1 is sufﬁ- cient to maintain YB-1 protein levels in tubular cells, and loss of OTUB1 abolishes the protective effect of aPC in regard to YB-1 expression.

Activated PC Maintains OTUB1 and YB-1 Expression via PAR1 and EPCR in Tubular Cells To identify the receptors through which aPC maintains YB-1 and OTUB1 expression after hypoxia, we first determined the expression of PARs and EPCR in tubular cells. PAR1, PAR2, PAR4, and EPCR, but not PAR3, were readily detectable in BUMPT cells (Figure 7A). To determine Figure 4. aPC suppresses YB-1 ubiquitination. (A) and (B) aPC increases the protein the functional relevance of receptors ex- stability of YB-1. After treatment of BUMPT cells with the protein synthesis inhibitor pressed by tubular cells, we next preincu- CHX (10 mg/ml) YB-1 protein levels markedly decline. Treatment of BUMPT cells with bated tubular cells with receptor blocking the proteasome inhibitor MG132 (10 mM) or aPC (20 nM) stabilizes YB-1 levels when antibodies. Inhibition of PAR1 or EPCR ef- compared with PBS-treated control cells; representative immunoblots (IBs) of YB-1 in ficiently abolished aPC’s effect on OTUB1 whole-cell lysates (A) and line graphs (B) summarizing results. (C) YB-1 is rapidly and YB-1 expression, whereas blocking ubiquitinated after in vitro reoxygenation (top, PBS-treated control). Pretreatment with PAR2 or PAR4 had no effect (Figure 7B). aPC (20 nM, bottom) delays and reduces YB-1 ubiquitination. Immunoprecipitation (IP) In agreement with these blocking studies, of YB-1 from whole-cell lysates and representative images of ubiquitin IBs and YB-1 IB only the aPC-specific PAR1 agonist peptide as input control. (D) HR (6 hours postreoxygenation) induces YB-1 K48–linked ubiquitination maintained OTUB1 and YB-1 expression in BUMPT cells, which is efficiently suppressed by aPC treatment (20 nM). IP of YB-1 from whole-cell lysates and representative images of IBs using an antibody against K48-linked despite HR injury, whereas the thrombin- fi ubiquitin (top, K48-linked ubiquitin IB; bottom, YB-1 IB as input control). (E) After IRI, speci c PAR1 or the other PAR agonist protein ubiquitination is increased in WT mice, and to a larger extent in TMPro/Pro, but not in peptides failed to do so (Figure 7C).33 APChigh mice. Representative IB of ubiquitinated proteins (top) in kidney lysates; b-actin as Therefore, aPC maintains OTUB1 and loading control (bottom). Mean6SD value of at least three independent experiments (B); YB-1 expression in tubular cells exposed *P,0.05; **P,0.01 (ANOVA). to HR injury via PAR1 and EPCR. of OTUB1 expression is sufficient to alter ubiquitination and DISCUSSION expression of YB-1 after HR, we next used loss and gain of function approaches in tubular cells. Overexpression of Within this study we identify a novel mechanism through OTUB1 was sufficient to prevent excess polyubiquitination, which coagulation proteases modulate renal IRI. Specifically, K48-linked YB-1 ubiquitination, and loss of YB-1 expres- the coagulation protease aPC conveys nephroprotection by sion in HR-challenged tubular cells (Figure 6C), demon- sustaining protein stability of YB-1. Several studies strating that high OTUB1 expression is sufficient to reduce demonstrated a role of aPC in modulating mRNA expression ubiquitination, including K48-linked YB-1 ubiquitination, by regulating transcription factor activity, mRNA stability, or and loss of YB-1 in tubular cells. Next, we analyzed tubular through epigenetic mechanisms.7,34,35 Within this study we cells with reduced OTUB1 expression (OTUB1 knockdown establish that aPC additionally modulates protein stability [OTUB1KD]) (Supplemental Figure 6). Loss of OTUB1 did not via the ubiquitin-proteasome system. We show that aPC increase polyubiquitination or K48-linked YB-1 ubiquitination maintains the 50 kD form of full length YB-1 protein by de- and did not reduce YB-1 expression at baseline (Figure 6D). creasing the K48-linked YB-1 ubiquitination through an However, after HR injury, polyubiquitination and K48-linked OTUB1-dependent mechanism. These effects of aPC, the sus- YB-1 ubiquitination were markedly increased, whereas YB-1 tained expression of OTUB1, the diminished YB-1 ubiquitination, expression was reduced in OTUB1KD tubular cells. Impor- and the preservation of the 50 kD form of YB-1 are required tantly, aPC failed to prevent the increased polyubiquitination, for aPC-mediated nephroprotection after renal IRI. This K48-linked ubiquitination, and loss of YB-1 expression in newly identified nephroprotective mechanism, which depends OTUB1KD tubular cells (Figure 6D), demonstrating that the on the functional interaction of aPC, YB-1, and OTUB1, effect of aPC on YB-1 stability, K48-linked YB-1 ubiquitination, may lay ground for new translational approaches to renal and polyubiquitination depends on OTUB1. Taken together, IRI.

J Am Soc Nephrol 26: 2789–2799, 2015 aPC Regulates YB-1 in Renal IRI 2793 BASIC RESEARCH www.jasn.org

argatroban, likewise protect kidneys from IRI,12 supporting the notion that a TM- mediated switch from thrombin- to aPC- dependent signaling is required, whereas inhibition of thrombin is not sufficient for nephroprotection in renal IRI. The ef- ficacy of soluble TM in renal IRI suggests that the nephroprotective pathway identified within this study may be amendable to therapeutic interventions not only by aPC, but also by soluble TM. Previously, the partial thrombin-induced proteolytical degradation of YB-1 was proposed to be independent of ubiquitination.36 However, studies analyzing proteasome- mediated YB-1 degradation have been conducted in a cell-free system, and we ac- knowledge that evaluation of their findings in cellular systems or in vivo is required.36 Using an in vitro hypoxia-reoxygenation model and the in vivo model of renal IRI, we reveal that YB-1 is ubiquitinated (including K48-linked ubiquitination) and that this is relevant for the regulation of the 50 kD form of YB-1. Polyubiquitination and proteasomal degradation of YB-1 have been previously 37,38 Figure 5. aPC-mediated renal protection and sustained YB-1 expression after IRI demonstrated in HEK 293T cells. There- depends on OTUB1. (A) OTUB1 is predominately expressed in tubular cells; immuno- fore, the adaptor protein F-box protein 33 histochemical detection of OTUB1 in paraffin-embedded tissue sections of WT mouse can bind to YB-1 and integrate it into an kidney (right) and IgG control (left); OTUB1 antigen detected by HRP-DAB reaction SCF E3 ligase complex composed of SKP1, (brown) and hematoxylin counterstain (blue); overview (top) and tissue section at higher CUL1, and ROC1. This E3 ligase complex magnification (bottom); scale bar: 20 mm. (B) The interaction of YB-1 and OTUB1 is im- induces polyubiquitination and proteasomal paired after HR injury in tubular cells. Detection of OTUB1 by immunoblotting after degradation of YB-1.37 In addition, the RING immunoprecipitation of YB-1 (top; YB-1 IB: input control) or of YB-1 after immunopre- finger containing protein retinoblastoma bind- cipitation of OTUB1 (bottom; OTUB1 IB: input control) from whole-cell lysates of control ing protein 6 promotes polyubiquitination (C) mouse tubular cells or tubular cells after in vitro HR without (PBS) or with aPC treat- 38 ment (aPC) (20 nM); representative images of immunoblots. Expression of OTUB1 is and proteasomal destruction of YB-1. How- maintained in APChigh mice after IRI. OTUB1 protein levels in kidney lysates were de- ever, modulation of YB-1 ubiquitination by termined by immunoblotting and normalized to b-actin; representative immunoblots (C) coagulation proteases controls partial and bar graph summarizing results (D). BUN (E), creatinine (Crea) (F), and tissue injury rather than complete proteasomal degrada- (pathologic score) (G) in control (Sham, open bars) and experimental mice without (IRI) tion, suggesting the involvement of a distinct (black bars) or with aPC pretreatment (IRI+aPC) (striped bars; aPC: 0.5 mg/kg i.p.). (H) mechanism. Consistently, we demonstrate Immunoblot of ubiquitinated proteins (top) and YB-1 (middle) and b-actin as loading that aPC modulates YB-1 ubiquitination +/2 control (bottom) in WT and heterozygous OTUB1 (OTUB1 ) mice. Control mice (Sham) and stability in part by regulating its interac- 6 or mice with IRI without (PBS) or with (aPC) (0.5 mg/kg i.p.) treatment. Mean SD value of tion with the deubiquitinating enzyme – , , at least six mice per group [(D) (G)]; *P 0.05; **P 0.01 (ANOVA). OTUB1. OTUB1 can inhibit ubiquitination of target molecules by two distinct mecha- The effect of aPC on YB-1 in renal IRI is independent of its nisms. First, OTUB1 can directly remove ubiquitin chains from anticoagulant function but requires TM and signaling via the target molecules, including TRAF3, TRAF6, or c-IAP1.39,40 Sec- PAR1-EPCR heterodimer.33 Considering the established role ond, OTUB1 can segregate E2-E3 complexes and inhibit the of TM in modulating thrombin and aPC activity and previous transfer of ubiquitin molecules from E2 conjugating enzymes data, which established a detrimental role of thrombin and to E3 ligases independent of its catalytic activity.41–43 Although PAR1 in renal IRI, we conclude that TM provides a functional our immunoprecipitation experiments demonstrate that OTUB1 switch between thrombin- and aPC-dependent signaling in and YB-1 act in close proximity to each other, we currently cannot the context of renal IRI (and current data).5,10 Of note, soluble differentiate which of these two alternative mechanisms in- recombinant TM, but not the direct thrombin inhibitor hibit ubiquitination of YB-1. Interestingly, OTUB1 has been

2794 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2789–2799, 2015 www.jasn.org BASIC RESEARCH

In this study we observed robust expression of YB-1 in tubular cells at baseline, which is contrary to the general perception that YB-1 is a stress-induced gene with low basal expression levels. The high expression of YB-1 within the tubular compartment is consistent with public data (http://www. proteinatlas.org/ENSG00000065978/ tissue/kidney) and previous reports.45–47 Despite its high basal renal expression level heterozygosity for YB-1, resulting in a roughly 50% reduction of YB-1 expression,18,29 it did not result in an obvious renal defect. Therefore, YB-1 heterozygosity is compatible with normal renal function in the absence of additional stimuli. However, the marked phenotype in YB-1 heterozygous mice after renal IRI establishes that a partial reduction of YB-1 is sufficient to aggravate renal injury, emphasizing the potential pathophysiologic role of YB-1 in the kidney. The mechanism through which YB-1 conveys nephroprotection after renal IRI remains tobe shown, but itmaybe relatedto its function in regulating cell-cycle progression. Therefore, YB-1 induces expression of cyclin A and B1,28,29,48 and its expression is increased in regenerating liver49 or in the proliferating compartment of the colorectal Figure 6. Inhibition of YB-1 ubiquitination by aPC depends on OTUB1. (A) and (B) mucosa.50 Renal recovery after IRI is associ- HR (6 hours of hypoxia and 6 hours of reoxygenation; C: normoxic control) decreases OTUB1 levels in BUMPT cells in vitro. Treatment of BUMPT cells with aPC (20 nM) ated with tubular cell proliferation and hence conserves OUTB1 expression despite HR. Representative IBs (A) and bar graph it seems possible, but remains to be shown, summarizing the results (B). (C) Ubiquitination in BUMPT cells stably expressing that YB-1 promotes renal recovery by pro- empty vector (C) or an expression construct for flag tagged OTUB1 (OTUB1+). moting tubular proliferation.51 Alternatively, Overexpression of OUTB1 reduces HR-induced protein ubiquitination (top; ubiquitin IB), YB-1 has been proposed to block translation maintains YB-1 expression (middle; b-actin as loading control), and reduces YB-1 of oxidatively modified RNA by binding and K48–linked ubiquitination (bottom, aK48 IB: IP of YB-1 followed by K48-linked sequestering such RNA species.52 Through ubiquitin IB; YB-1 IB shown as input control). Flag IB reflecting efficient over- the preferential binding to oxidized RNA, fl fi ’ expression of ag-tagged OTUB1. (D) OTUB1 de ciency impairs aPC seffect YB-1 may therefore prevent erroneous pro- on ubiquitination and YB-1 expression. The aPC mediated reduction of protein tein biosynthesis after renal IRI. The identi- ubiquitination (C, top) and YB-1 K48-linked ubiquitination (C, bottom) and the fication of the precise mechanism through sustained YB-1 expression (C, middle, b-actin as loading control) are impaired in stable OTUB1 knockdown tubular cells (shRNA OTUB1) when compared with which YB-1 conveys nephroprotection after control transfected cells (shRNAc). YB-1 K48–linked ubiquitination is determined by IP IRI may identify new therapeutic targets for of YB-1 followed by K48 immunoblotting (aK48 IB); YB-1 IB shown as input control. this frequent renal disease. Mean6SD value of three independent experiments (B); *P,0.05, (ANOVA); represen- Taken together, we identify a new ne- tative IBs of at least three independent experiments [(A), (C), and (D)]. IB, immunoblot; phroprotective pathway, linking the extra- IP, immunoprecipitation. cellular protease aPC with cytoprotective effects of YB-1. Considering the established proposed to preferentially inhibit K48-linked ubiquitination,40,44 relevance of coagulation protease-dependent signaling in var- which may specifically avert proteasomal degradation of target ious tissues and the broad expression of YB-1, we postulate that proteins, such as YB-1, while still allowing other ubiquitination- the identified mechanism may be relevant in other tissues and dependent processes. Future studies are required to decipher disease models. Furthermore, as new and signaling-specificaPC the concise molecular nature of the OTUB1 and YB-1 interac- variants (e.g., 3K3A-aPC, soluble TM, PAR agonists) are being tion and the consequences for YB-1 abundance, localization, and evaluated in clinical and preclinical studies, this pathway may be activity. therapeutically amendable in the future.53,54

J Am Soc Nephrol 26: 2789–2799, 2015 aPC Regulates YB-1 in Renal IRI 2795 BASIC RESEARCH www.jasn.org

renal IRI experiments. In all experiments, littermates were used and randomly assigned to experimental groups. Male mice, 8–10 weeks old, underwent bilateral renal pedicle occlusion (30 minutes) and reperfusion for 24 hours (Sup- plemental Figure 1B, Supplemental Material).55 aPC (0.5 mg/kg body wt, i.p.) was injected 30 minutes before IRI in a subgroup of mice. Control mice underwent sham operation omitting only pedicle clamping. All surgical instruments were obtained from F.S.T (Heidelberg, Germany). Animal experiments were conducted following principles of laboratory animal care and proce- dures approved by the local Animal Care and Use Committee (Regierungspräsidium Sachsen-Anhalt, Germany).

Preparation of aPC The aPC used in this study was generated as previously described with slight modifica- Figure 7. aPC regulates OTUB1 and YB-1 expression in tubular cells via PAR1 and tion.56,57 See the Supplemental Material for fur- EPCR. (A) PAR1, PAR2, PAR4, and EPCR are expressed in BUMPT cells. Representative ther details. images showing expression of PARs and EPCR in BUMPT cells and mouse kidney. (Kid, positive control; semi-quantitative RT-PCR, top, and immunoblot [IB] bottom). OTUB1 In vivo and YB-1 levels in HR-stressed BUMPT cells incubated with PAR (P1-P4) or EPCR (EP) aPC Capture Assay The in vivo aPC activation and capture assay blocking antibodies (Ab) before aPC treatment (B) or treated with PAR-agonist pep- 6 tides (P1-P4 AP) (C). Blocking PAR1 or EPCR, but not PAR2 or PAR4, abolishes aPC’s were conducted as previously described. See effect in regard to OTUB1 and YB-1 expression. Activation of PAR1 by the aPC-specific the Supplemental Material for further details. agonist peptide (P1AP1: NPNDKYEPFWEDEEKNESGL), but not by the thrombin-specific agonist peptide (P1AP2: TFLLR) prevents the HR-induced loss of OTUB1 and YB1. Determination of Serum BUN and Representative immunoblots showing OTUB1 [(B) and (C) top] and YB-1 [(B) and Creatinine (C), bottom] expression in whole-cell lysates and bar graph summarizing results. Serum BUN and creatinine were analyzed using Mean6SD value of at least three independent experiments [(B) and (C)]; *P,0.05; commercially available assays. See the Supple- , **P 0.01 (ANOVA). mental Material for further details.

CONCISE METHODS Histology and Immunohistochemistry Tubular injury was determined using a histologic score obtained from Animal Model for Renal IRI hematoxylin and eosin stained images. Expression of YB-1 and 2 APChigh,TMPro/Pro, and YB-1+/ mice have been previously de- OTUB1 was determined by immunohistochemistry following estab- scribed.6,18,24 To obtain OTUB1-deficient mice, we generated lished protocols.6,58 See the Supplemental Material for further details. C57BL/6N-derived Art B6/3.6 embryonic stem cells with a condi- tional OTUB1 allele by flanking exons 2 and 3 with loxP sites (Sup- Cell Culture and in vitro Model HR plemental Figure 5). The selection markers neomycin and puromycin BUMPT cells were cultured according to an established protocol.26 were removed from correctly targeted clones by flp-mediated recom- Mouse primary renal proximal tubular epithelial cells were isolated bination, generating OTUB1loxP/wt mice in which exon 2 and 3 of and cultured according to established protocols.59,60 For in vitro HR OTUB1 were flanked by loxP-sites. OTUB1loxP/wt mice were crossed injury, confluent cells were serum-deprived overnight and then 2 with C57BL/6 Rosa 26-Cre+/ mice to delete exons 2 and 3, resulting maintained in HBSS (Life Technologies, Darmstadt, Germany) in a in out-of-frame translation and germline inactivation of OTUB1. hypoxic atmosphere containing 1% O2, 94% N2, and 5% CO2 for 6 Offsprings were crossed with WT C57BL/6 mice to generate Cre- hours. For reoxygenation, cells were returned to complete medium loxP/wt +/2 negative OTUB1 mice (designated as OTUB1 mice), which and 21% O2. Control cells were serum-starved and maintained in were maintained by breeding with C57BL/6 WT mice. Homozygous HBSS for 6 hours, but they were continuously exposed to 21% O2. 2 2 OTUB1 / mice were embryonic lethal and will be published indepen- Efficient hypoxic stress was ascertained by determining HIF-1a ex- dently.Micewerebackcrossedontothe C57BL/6 background for at least pression (Supplemental Figure 2, E and F). Cells were harvested at four generations. OTUB1+/+ littermates were used for direct comparison. various time points after reoxygenation for RNA and protein isola- 2 APChigh mice, TMPro/Pro mice, and YB-1+/ were backcrossed tion. For further details, including pretreatment regimens, see the onto the C57BL/6 background for at least eight generations before Supplemental Material.

2796 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2789–2799, 2015 www.jasn.org BASIC RESEARCH

Immunoblotting and Immunoprecipitation endothelial cells by targeting TRAF6 for deubiquitination. Circ Res 112: Immunoblotting and immunoprecipitation were conducted as pre- 1583–1591, 2013 – viously described.6,25 See the Supplemental Material for further details. 2. Eltzschig HK, Eckle T: Ischemia and reperfusion from mechanism to translation. Nat Med 17: 1391–1401, 2011 3. Liu S, Soong Y, Seshan SV, Szeto HH: Novel cardiolipin therapeutic RT-PCR protects endothelial mitochondria during renal ischemia and mitigates RT-PCR and quantitative RT-PCR were conducted essentially as microvascular rarefaction, inflammation, and fibrosis. Am J Physiol previously described.6,25,61 For further information see the Supple- Renal Physiol 306: F970–F980, 2014 mental Material. 4. Lu CY, Winterberg PD, Chen J, Hartono JR: Acute kidney injury: A conspiracy of toll-like receptor 4 on endothelia, leukocytes, and tu- bules. Pediatr Nephrol 27: 1847–1854, 2012 Generation of Knockdown Cell Lines 5. Sevastos J, Kennedy SE, Davis DR, Sam M, Peake PW, Charlesworth JA, For in vitro transfection, undifferentiated BUMPT cells were seeded Mackman N, Erlich JH: Tissue factor deficiency and PAR-1 deficiency in six well plates and transfected with YB-1, OTUB1, or control are protective against renal ischemia reperfusion injury. Blood 109: – shRNA plasmids (pLKO.1-puro based TRC clones) according to the 577 583, 2007 6. Isermann B, Vinnikov IA, Madhusudhan T, Herzog S, Kashif M, Blautzik manufacturer’s instructions (Thermo Fisher Scientific, Waltham, J, Corat MA, Zeier M, Blessing E, Oh J, Gerlitz B, Berg DT, Grinnell BW, m m MA). For transfection, 4 g of shRNA plasmid DNA and 6 l Chavakis T, Esmon CT, Weiler H, Bierhaus A, Nawroth PP: Activated of Turbofect were added to each well in a final volume of 1.5 ml protein C protects against diabetic nephropathy by inhibiting endo- Opti-MEM. After 6 hours, the medium was replaced by fresh culture thelial and podocyte apoptosis. Nat Med 13: 1349–1358, 2007 medium. Stably transfected cell lines were selected in the presence of 7. Bock F, Shahzad K, Wang H, Stoyanov S, Wolter J, Dong W, Pelicci PG, Kashif M, Ranjan S, Schmidt S, Ritzel R, Schwenger V, Reymann KG, 1 mg/ml puromycin. After 7–10 days of selection, cells were subcloned by Esmon CT, Madhusudhan T, Nawroth PP, Isermann B: Activated protein seeding individual clones into 96 well plates. Approximately 30 clones C ameliorates diabetic nephropathy by epigenetically inhibiting the each were isolated and analyzed by quantitative RT-PCR. Clones with redox enzyme p66Shc. Proc Natl Acad Sci U S A 110: 648–653, 2013 low expression of target genes were selected for further experiments. 8. Gupta A, Gerlitz B, Richardson MA, Bull C, Berg DT, Syed S, Galbreath EJ, Swanson BA, Jones BE, Grinnell BW: Distinct functions of activated protein C differentially attenuate acute kidney injury. J Am Soc Nephrol Statistical Analyses 20: 267–277, 2009 6 The data are expressed as mean SD. Statistical analyses were per- 9. Gupta A, Williams MD, Macias WL, Molitoris BA, Grinnell BW: Activated formed with the unpaired t test and ANOVA, as appropriate. Posthoc protein C and acute kidney injury: Selective targeting of PAR-1. Curr comparisons of ANOVA were corrected with the method of Tukey. Drug Targets 10: 1212–1226, 2009 – statistiXL (www.statistixl.com) and Prism 5 (www.graphpad.com) 10. Weiler H, Isermann BH: Thrombomodulin. J Thromb Haemost 1: 1515 1524, 2003 software were used for statistical analyses. Statistical significance 11. Sharfuddin AA, Sandoval RM, Berg DT, McDougal GE, Campos SB, , was accepted at values of P 0.05. Phillips CL, Jones BE, Gupta A, Grinnell BW, Molitoris BA: Soluble thrombomodulin protects ischemic kidneys. J Am Soc Nephrol 20: 524–534, 2009 12.OzakiT,AnasC,MaruyamaS,YamamotoT,YasudaK,MoritaY,ItoY, ACKNOWLEDGMENTS Gotoh M, Yuzawa Y, Matsuo S: Intrarenal administration of recombinant human soluble thrombomodulin ameliorates ischaemic acute renal – We thank John H. Schwartz (Boston University School of Medicine, failure. Nephrol Dial Transplant 23: 110 119, 2008. 13. Conway EM, Van de Wouwer M, Pollefeyt S, Jurk K, Van Aken H, De Boston) for providing immortalized mouse proximal tubular cell line. Vriese A, Weitz JI, Weiler H, Hellings PW, Schaeffer P, Herbert JM, We thank Kathrin Deneser, Julia Judin, Juliane Friedrich, René Rudat, Collen D, Theilmeier G: The lectin-like domain of thrombomodulin and Rumiya Makarova for excellent technical support. confers protection from neutrophil-mediated tissue damage by sup- Supported by grants from the Deutsche Forschungsgemeinschaft pressing adhesion molecule expression via nuclear factor kappaB and – (IS 67/2-4 to B.I., TH 1789/1-1 to T.M., Me1365/9-1 to P.R.M., SFB mitogen-activated protein kinase pathways. JExpMed196: 565 577, 2002 854 and TP01 to P.R.M., TP05 to D.S., TP26 to B.I.), the European 14. Van de Wouwer M, Collen D, Conway EM: Thrombomodulin-protein C- Foundation for the Study of Diabetes (to B.I.), the Stiftung für EPCR system: Integrated to regulate coagulation and inflammation. Pathobiochemie und Molekulare Diagnostik (to F.B. and T.M.), and a Arterioscler Thromb Vasc Biol 24: 1374–1383, 2004 travel grant from Boehringer Ingelheim (to F.B.). 15. Park SW, Chen SW, Kim M, D’Agati VD, Lee HT: Human activated protein C attenuates both hepatic and renal injury caused by hepatic ischemia and reperfusion injury in mice. Kidney Int 76: 739–750, 2009 16. Raffetseder U, Wernert N, Ostendorf T, van Roeyen C, Rauen T, DISCLOSURES Behrens P, Floege J, Mertens PR: Mesangial cell expression of proto- None. oncogene Ets-1 during progression of mesangioproliferative glomer- ulonephritis. Kidney Int 66: 622–632, 2004 17. Raffetseder U, Liehn EA, Weber C, Mertens PR: Role of cold shock Y- box protein-1 in inflammation, atherosclerosis and organ transplant REFERENCES rejection. Eur J Cell Biol 91: 567–575, 2012 18. Raffetseder U, Rauen T, Boor P, Ostendorf T, Hanssen L, Floege J, En- 1. Luong A, Fragiadaki M, Smith J, Boyle J, Lutz J, Dean JL, Harten S, Nia A, Djudjaj S, Frye BC, Mertens PR: Extracellular YB-1 blockade in Ashcroft M, Walmsley SR, Haskard DO, Maxwell PH, Walczak H, Pusey experimental nephritis upregulates Notch-3 receptor expression and C, Evans PC: Cezanne regulates inflammatory responses to hypoxia in signaling. Nephron Exp Nephrol 118: e100–e108, 2011

J Am Soc Nephrol 26: 2789–2799, 2015 aPC Regulates YB-1 in Renal IRI 2797 BASIC RESEARCH www.jasn.org

19. Hanssen L, Alidousty C, Djudjaj S, Frye BC, Rauen T, Boor P, Mertens protein induced during programmed cell death. FEBS Lett 580: 3921– PR, van Roeyen CR, Tacke F, Heymann F, Tittel AP, Koch A, Floege J, 3930, 2006 Ostendorf T, Raffetseder U: YB-1 is an early and central mediator of 38. Chibi M, Meyer M, Skepu A, G Rees DJ, Moolman-Smook JC, Pugh DJ: bacterial and sterile inflammation in vivo. JImmunol191: 2604–2613, RBBP6 interacts with multifunctional protein YB-1 through its RING 2013 finger domain, leading to ubiquitination and proteosomal degradation 20. Eliseeva IA, Kim ER, Guryanov SG, Ovchinnikov LP, Lyabin DN: Y-box- of YB-1. JMolBiol384: 908–916, 2008 binding protein 1 (YB-1) and its functions. Biochemistry (Mosc) 76: 39. Lawson EA, Miller KK, Bredella MA, Phan C, Misra M, Meenaghan E, 1402–1433, 2011 Rosenblum L, Donoho D, Gupta R, Klibanski A: Hormone predictors of 21. Lindquist JA, Brandt S, Bernhardt A, Zhu C, Mertens PR: The role of cold abnormal bone microarchitecture in women with anorexia nervosa. shock domain proteins in inflammatory diseases. J Mol Med (Berl) 92: Bone 46: 458–463, 2010 207–216, 2014 40. Goncharov T, Niessen K, de Almagro MC, Izrael-Tomasevic A, 22. Stenina OI, Poptic EJ, DiCorleto PE: Thrombin activates a Y box- Fedorova AV, Varfolomeev E, Arnott D, Deshayes K, Kirkpatrick DS, binding protein (DNA-binding protein B) in endothelial cells. JClin Vucic D: OTUB1 modulates c-IAP1 stability to regulate signalling Invest 106: 579–587, 2000 pathways. EMBO J 32: 1103–1114, 2013 23. Stenina OI, Shaneyfelt KM, DiCorleto PE: Thrombin induces the release 41. Juang YC, Landry MC, Sanches M, Vittal V, Leung CC, Ceccarelli DF, of the Y-box protein dbpB from mRNA: A mechanism of transcriptional Mateo AR, Pruneda JN, Mao DY, Szilard RK, Orlicky S, Munro M, Brzovic activation. Proc Natl Acad Sci U S A 98: 7277–7282, 2001 PS, Klevit RE, Sicheri F, Durocher D: OTUB1 co-opts Lys48-linked 24. Weiler-Guettler H, Christie PD, Beeler DL, Healy AM, Hancock WW, ubiquitin recognition to suppress E2 enzyme function. Mol Cell 45: Rayburn H, Edelberg JM, Rosenberg RD: A targeted point mutation in 384–397, 2012 thrombomodulin generates viable mice with a prethrombotic state. J 42. Sato Y, Yamagata A, Goto-Ito S, Kubota K, Miyamoto R, Nakada S, Clin Invest 101: 1983–1991, 1998 Fukai S: Molecular basis of Lys-63-linked polyubiquitination inhibition 25. Madhusudhan T, Wang H, Straub BK, Gröne E, Zhou Q, Shahzad K, by the interaction between human deubiquitinating enzyme OTUB1 Müller-Krebs S, Schwenger V, Gerlitz B, Grinnell BW, GriffinJH,Reiser and ubiquitin-conjugating enzyme UBC13. J Biol Chem 287: 25860– J, Gröne HJ, Esmon CT, Nawroth PP, Isermann B: Cytoprotective sig- 25868, 2012 naling by activated protein C requires protease-activated receptor-3 in 43. Wiener R, Zhang X, Wang T, Wolberger C: The mechanism of OTUB1- podocytes. Blood 119: 874–883, 2012 mediated inhibition of ubiquitination. Nature 483: 618–622, 26. Sinha D, Wang Z, Price VR, Schwartz JH, Lieberthal W: Chemical anoxia 2012 of tubular cells induces activation of c-Src and its translocation to the 44. Edelmann MJ, Iphöfer A, Akutsu M, Altun M, di Gleria K, Kramer HB, zonula adherens. Am J Physiol Renal Physiol 284: F488–F497, 2003 Fiebiger E, Dhe-Paganon S, Kessler BM: Structural basis and specificity 27. Takacs-Jarrett M, Sweeney WE, Avner ED, Cotton CU: Morphological of human otubain 1-mediated deubiquitination. Biochem J 418: 379– and functional characterization of a conditionally immortalized col- 390, 2009 lecting tubule cell line. Am J Physiol 275: F802–F811, 1998 45. Ito K, Tsutsumi K, Kuzumaki T, Gomez PF, Otsu K, Ishikawa K: A novel 28. Uchiumi T, Fotovati A, Sasaguri T, Shibahara K, Shimada T, Fukuda T, growth-inducible gene that encodes a protein with a conserved cold- Nakamura T, Izumi H, Tsuzuki T, Kuwano M, Kohno K: YB-1 is important shock domain. Nucleic Acids Res 22: 2036–2041, 1994 for an early stage embryonic development: Neural tube formation and 46. Mastrangelo MA, Kleene KC: Developmental expression of Y-box cell proliferation. J Biol Chem 281: 40440–40449, 2006 protein 1 mRNA and alternatively spliced Y-box protein 3 mRNAs in 29. Lu ZH, Books JT, Ley TJ: YB-1 is important for late-stage embryonic spermatogenic cells in mice. Mol Hum Reprod 6: 779–788, 2000 development, optimal cellular stress responses, and the prevention of 47. van Roeyen CR, Eitner F, Martinkus S, Thieltges SR, Ostendorf T, premature senescence. Mol Cell Biol 25: 4625–4637, 2005 Bokemeyer D, Lüscher B, Lüscher-Firzlaff JM, Floege J, Mertens 30. Klinge S, Voigts-Hoffmann F, Leibundgut M, Arpagaus S, Ban N: Crystal PR: Y-box protein 1 mediates PDGF-B effects in mesangioproli- structure of the eukaryotic 60S ribosomal subunit in complex with ini- ferative glomerular disease. J Am Soc Nephrol 16: 2985–2996, tiation factor 6. Science 334: 941–948, 2011 2005 31. Pickart CM, Fushman D: Polyubiquitin chains: Polymeric protein sig- 48. Jurchott K, Bergmann S, Stein U, Walther W, Janz M, Manni I, Piaggio nals. Curr Opin Chem Biol 8: 610–616, 2004 G, Fietze E, Dietel M, Royer HD: YB-1 as a cell cycle-regulated tran- 32. Petrova DT, Brehmer F, Schultze FC, Asif AR, Gross O, Oellerich M, scription factor facilitating cyclin A and cyclin B1 gene expression. JBiol Brandhorst G: Differential kidney proteome profiling in a murine model Chem 278: 27988–27996, 2003 of renal fi brosis under treatment with mycophenolate mofetil. Patho- 49. Ladomery M, Sommerville J: A role for Y-box proteins in cell pro- biology 78: 162–170, 2011. liferation. Bioessays 17: 9–11, 1995. 33. Mosnier LO, Sinha RK, Burnier L, Bouwens EA, GriffinJH:Biased 50. Shibao K, Takano H, Nakayama Y, Okazaki K, Nagata N, Izumi H, agonism of protease-activated receptor 1 by activated protein C caused Uchiumi T, Kuwano M, Kohno K, Itoh H: Enhanced coexpression of YB-1 by noncanonical cleavage at Arg46. Blood 120: 5237–5246, 2012 and DNA topoisomerase II alpha genes in human colorectal carcino- 34. Joyce DE, Grinnell BW: Recombinant human activated protein C at- mas. Int J Cancer 83: 732–737, 1999. tenuates the inflammatory response in endothelium and monocytes by 51. Canaud G, Bonventre JV: Cell cycle arrest and the evolution of chronic modulating nuclear factor-kappaB. Crit Care Med 30[Suppl]: S288– kidney disease from acute kidney injury [published online ahead of S293, 2002 print July 12, 2014]. Nephrol Dial Transplant 35. Brueckmann M, Marx A, Weiler HM, Liebe V, Lang S, Kaden JJ, Zieger 52. Hayakawa H, Uchiumi T, Fukuda T, Ashizuka M, Kohno K, Kuwano M, W, Borggrefe M, Huhle G, Konstantin Haase K: Stabilization of mono- Sekiguchi M: Binding capacity of human YB-1 protein for RNA con- cyte chemoattractant protein-1-mRNA by activated protein C. Thromb taining 8-oxoguanine. Biochemistry 41: 12739–12744, 2002 Haemost 89: 149–160, 2003 53. Lyden P, Levy H, Weymer S, Pryor K, Kramer W, GriffinJH,DavisTP, 36. Sorokin AV, Selyutina AA, Skabkin MA, Guryanov SG, Nazimov IV, Zlokovic B: Phase 1 safety, tolerability and pharmacokinetics of Richard C, Th’ng J, Yau J, Sorensen PH, Ovchinnikov LP, Evdokimova V: 3K3A-APC in healthy adult volunteers. Curr Pharm Des 19: 7479– Proteasome-mediated cleavage of the Y-box-binding protein 1 is 7485, 2013 linked to DNA-damage stress response. EMBO J 24: 3602–3612, 2005 54. Wang L, Jiang R, Sun XL: Recombinant thrombomodulin of different 37. Lutz M, Wempe F, Bahr I, Zopf D, von Melchner H: Proteasomal deg- domains for pharmaceutical, biomedical, and cell transplantation ap- radation of the multifunctional regulator YB-1 is mediated by an F-Box plications. Med Res Rev 34: 479–502, 2014

2798 Journal of the American Society of Nephrology J Am Soc Nephrol 26: 2789–2799, 2015 www.jasn.org BASIC RESEARCH

55. Wei Q, Dong Z: Mouse model of ischemic acute kidney injury: Tech- 60. Breggia AC, Himmelfarb J: Primary mouse renal tubular epithelial cells nical notes and tricks. Am J Physiol Renal Physiol 303: F1487–F1494, have variable injury tolerance to ischemic and chemical mediators of 2012 oxidative stress. Oxid Med Cell Longev 1: 33–38, 2008 56. Esmon CT, Esmon NL, Le Bonniec BF, Johnson AE: Protein C activation. 61. Kashif M, Hellwig A, Hashemolhosseini S, Kumar V, Bock F, Wang H, Methods Enzymol 222: 359–385, 1993 Shahzad K, Ranjan S, Wolter J, Madhusudhan T, Bierhaus A, Nawroth P, 57. Taylor FB Jr, Chang A, Esmon CT, D’Angelo A, Vigano-D’Angelo S, Isermann B: Nuclear factor erythroid-derived 2 (Nfe2) regulates JunD Blick KE: Protein C prevents the coagulopathic and lethal effects of DNA-binding activity via acetylation: A novel mechanism regulating Escherichia coli infusion in the baboon. J Clin Invest 79: 918–925, 1987 trophoblast differentiation. JBiolChem287: 5400–5411, 2012 58. Wang H, Vinnikov I, Shahzad K, Bock F, Ranjan S, Wolter J, Kashif M, Oh J, Bierhaus A, Nawroth P, Kirschﬁnk M, Conway EM, Madhusudhan T, Isermann B: The lectin-like domain of thrombomodulin ameliorates diabetic glomerulopathy via complement inhibition. Thromb Haemost See related editorial, “A Friend in Need: Activated Protein C Stabilizes YB-1 – 108: 1141 1153, 2012 during Renal Ischemia Reperfusion Injury,” on pages 2605–2607. 59. Sheridan AM, Schwartz JH, Kroshian VM, Tercyak AM, Laraia J, Masino S, Lieberthal W: Renal mouse proximal tubular cells are more susceptible This article contains supplemental material online at http://jasn.asnjournals. than MDCK cells to chemical anoxia. Am J Physiol 265: F342–F350, 1993 org/lookup/suppl/doi:10.1681/ASN.2014080846/-/DCSupplemental.

J Am Soc Nephrol 26: 2789–2799, 2015 aPC Regulates YB-1 in Renal IRI 2799 1 Supplements 2 3 The protease aPC ameliorates renal I/R-injury by restricting YB-1 ubiquitination 4 5 Running title: aPC regulates YB-1 in renal IRI 6 7 Wei Dong1*, Hongjie Wang1,2*, Khurrum Shahzad1,3*, Fabian Bock1, Moh'd Mohanad Al- 8 Dabet1, Satish Ranjan1, Juliane Wolter1, Shrey Kohli1, Juliane Hoffmann1, Vishnu Mukund 9 Dhople4, Cheng Zhu5, Jonathan A. Lindquist5, Charles T. Esmon6, Elisabeth Gröne7, 10 Herman-Josef Gröne7, Thati Madhusudhan1, Peter R. Mertens5*, Dirk Schlüter8*, Berend 11 Isermann1* 12 13 *these authors contributed equally to the manuscript.

14 1 Institute of Clinical Chemistry and Pathobiochemistry, Medical Faculty, Otto-von-Guericke 15 University Magdeburg, Magdeburg, Germany. 16 2 Department of Cardiology, Tongji Hospital, Tongji Medical College, Huazhong University of 17 Science and Technology, 430030 Wuhan, China. 18 3 University of Health Sciences, Khayaban-e-Jamia Punjab, Lahore, Pakistan. 19 4 Department of Functional Genomics, Interfaculty Institute for Genetics and Functional 20 Genomics, University Medicine Greifswald, Germany. 21 5 Department of Nephrology and Hypertension, Diabetes and Endocrinology, Otto-von- 22 Guericke University, Magdeburg, Germany. 23 6 Coagulation Biology Laboratory, Oklahoma Medical Research Foundation, University of 24 Oklahoma Health Sciences Center, Oklahoma City, OK, USA. 25 7 Department of Cellular and Molecular Pathology, German Cancer Research Center, 69120 26 Heidelberg, Germany. 27 8 Institute of Microbiology, Medical Faculty, Otto-von-Guericke University Magdeburg, 28 Magdeburg, Germany. 29

31 Content

32 Supplementary materials and methods page 1 33 Supplementary Tables page 9 34 References page 10 35 Supplementary Figures page 11

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M i 1 Supplementary materials and methods 2 3 Materials 4 The following antibodies were used in the current study: rabbit polyclonal antibody to β-actin, 5 rabbit polyclonal antibody to YB-1, rabbit polyclonal antibody to OTUB1, mouse monoclonal 6 antibody to ubiquitin, rabbit polyclonal antibody to K48-linkage specific polyubiquitin and 7 rabbit isotype IgG (Cell Signaling Technology, Frankfurt, Germany); rat monoclonal antibody 8 to EPCR (Sigma-Aldrich, Taufkirchen, Germany); rabbit polyclonal antibody to megalin, 9 rabbit polyclonal antibody to HIF-1α, mouse monoclonal antibody to PAR1, mouse 10 monoclonal antibody to PAR2, rabbit polyclonal antibody to PAR3 and goat polyclonal 11 antibody to PAR4 (Santacruz, Heidelberg, Germany); rabbit polyclonal antibody to KIM1, 12 (Abcam, Cambridge, UK). The following HRP conjugated secondary antibodies were used: 13 goat anti-rabbit IgG-HRP, rabbit anti-mouse IgG-HRP, rabbit anti-rat IgG-HRP, rabbit anti- 14 goat IgG-HRP (Abcam, Cambridge, UK). 15 Other reagents used in the current study were: human plasma thrombin, MG132, DMEM, 16 benzamidine and Bradford reagent, ANTI-FLAG® M2 Affinity Gel, antibiotic/antimycotic 17 solution (10,000 units/ml penicillin, 0.1 mg/ml streptomycin, and 0.25 μg/ml amphotericin B; 18 A5955), APO transferrin, hydrocortisone, amphotericin B (Sigma-Aldrich, Taufkirchen, 19 Germany); trypsin-EDTA, fetal bovine serum, heat inactivated horse serum, 20 insulin/transferrin/selenium, DMEM/F12, PBS, HBSS, TRIZOL, Superscript III Reverse 21 Transcriptase Kit, soybean trypsin inhibitor (Life Technologies, Darmstadt, Germany); 22 interferon γ (Cell Sciences, Canton, MA); protease inhibitor cocktail (Roche diagnostics 23 GmbH, Mannheim, Germany); BCA reagent, shRNA vectors for YB-1 and OTUB1, 24 transfection reagent Turbofect (Thermo Fisher Scientific, Waltham, MA, USA); OTUB1 ORF 25 overexpression construct (OriGene, Rockville, MD, USA); ZipTip C18, PVDF membrane and 26 immobilion enhanced chemiluminescence reagent (Millipore GmbH, Germany); 27 cycloheximide (New England Biolabs, Frankfurt, Germany); ketamine (Pfizer, Karlsruhe, 28 Germany); xylazine (Bayer, Leverkusen, Germany); mouse PAR agonists and control 29 peptides (Bachem, Weil am Rhein, Germany); mouse PAR1 agonist peptide (P1 AP2) 30 (GenScript, Aachen, Germany); DAB substrate Kit for peroxidase (Vector Laboratories, CA, 31 USA); Trypsin, GoTag PCR kit (Promega, Mannheim, Germany); protein A/G-agarose beads 32 (Santacruz, Heidelberg, Germany); human protein C (CEPROTIN®) and Prothromplex 33 NF600 (Baxter, Vienna, Austria); SPECTROZYME® PCa (LOXO, Heidelberg, Germany); 34 collagenase (Worthington Biochemical Corp., Lakewood, N.J.); recombinant human 35 epidermal growth factor (R&D Systems, Minneapolis, MN). 36

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 1 1 Renal ischemia reperfusion injury model 2 All mice were anesthetized with sodium ketamine (100 mg/kg body weight, i.p.) and xylazine 3 (10 mg/kg body weight, i.p.). In preliminary experiments we determined that equal dosing 4 was required and sufficient in the different genotypes. Mice were routinely observed during 5 the post-operative recovery phase and no differences in the recovery time between the 6 different genotypes were noticed. 7 Body temperature was maintained by placing the mice on a 37°C thermostatically controlled 8 operating platform. Post-surgery mice were kept in a heated environment during the recovery 9 phase. 10 The surgery procedure did not differ among the groups. Only age-matched mice were used. 11 Body fluid was maintained in all mice by subcutaneous administration of 300 μL 0.9% normal 12 saline pre-operatively. A midline abdominal incision was made and both kidneys were 13 exposed. The main renal arteries and veins were identified using a stereotactic microscope 14 (Olympus, Germany), and great care was taken to identify all vascular branches. All renal 15 arteries and veins were then bilaterally occluded for 30 min with nontraumatic 16 microaneurysm clamps (F.S.T Instruments, Germany). To help maintain thermoregulation 17 during surgery, the intestine was relocated and the abdomen was temporarily closed with few 18 stitches. After 30 min of renal ischemia the abdomen was reopened and the clamps were 19 removed. The kidneys were inspected for at least 1 minute to ensure restoration of blood 20 flow (as indicated by a pink color) and 0.5 ml of pre-warmed (37°C) normal saline was 21 instilled into the abdominal cavity. The abdomen was closed with continuous 4-0 22 polypropylene sutures. All animals received subcutaneous analgesic (buprenorphine 0.1 23 mg/kg) at the end of surgery. Mice were placed in a temperature controlled (~35°C) 24 environment during the recovery phase and regularly inspected. After full recovery animals 25 were returned to their cages with free access to food and water. Sham surgery consisted of 26 an identical procedure without application of the microaneurysm clamps. Animals were 27 sacrificed 24h after renal ischemia reperfusion injury or sham surgery to obtain blood and 28 tissue samples. 29 30 Preparation of activated protein C 31 Activated protein C was generated as previously described with slight modifications.1,2 32 Briefly, prothrombin complex (Prothromplex NF600), containing all vitamin K dependent

33 coagulation factors, was reconstituted with sterile water and supplemented with CaCl2 at a 34 final concentration of 20 mM. The column for purification of protein C was equilibrated at 35 room temperature with 1 liter of washing buffer (0.1 M NaCl, 20 mM Tris, pH 7.5, 5 mM 36 benzamidine HCl, 2 mM Ca2+, 0.02% sodium azide). The reconstituted prothombin complex 37 was gravity eluted on a column filled with Affigel-10 resin covalently linked to a calcium-

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 2 1 dependent monoclonal antibody to PC (HPC4). The column was washed first with two 2 column volumes of washing buffer and then two column volumes with a wash buffer rich in 3 salt (0.5 M NaCl, 20 mM Tris, pH 7.5, 5 mM benzamidine HCl, 2 mM Ca2+, 0.02% sodium 4 azide). Then the benzamidine was washed off the column with a buffer of 0.1 M NaCl, 20 5 mM Tris, pH 7.5, 2 mM Ca2+, 0.02% sodium azide. To elute PC the column was gravity 6 eluted with elution buffer (0.1 M NaCl, 20 mM Tris, pH 7.5, 5 mM EDTA, 0.02% sodium 7 azide, pH 7.5) and 3 ml fractions were collected. The peak fractions were identified by 8 measuring absorbance at 280 nm. The peak fractions were pooled. The recovered PC was 9 activated with human plasma thrombin (5% w/w) and incubated for 3 h at 37°C. To isolate 10 activated protein C (aPC) ion exchange chromatography with FPLC (ÄKTAFPLC®, GE 11 Healthcare Life Sciences) was used. First, thrombin was removed with a cation exchange 12 column MonoS (GE Healthcare Life Sciences). Then a MonoQ anion exchange column (GE 13 Healthcare Life Sciences) was equilibrated with 10% of a 20 mM Tris, pH 7.5, 1 M NaCl 14 buffer. After applying the solution that contains aPC a 10-100% gradient of a 20 mM Tris, pH 15 7.5, 1 M NaCl buffer was run through the column to elute aPC at a flow of 1-2 ml/min under 16 continuous monitoring of OD and conductivity. APC eluted at ~36 mS/cm by conductivity or 17 at 40% of the buffer. Fractions of 0.5 ml were collected during the peak and pooled. 18 Proteolytic activity of purified aPC was ascertained with the chromogenic substrate 19 SPECTROZYME® PCa. 20 21 In vivo aPC capture assay 22 Mice were anesthetized (sodium ketamine, 100 mg/kg body weight, i.p., and xylazine 10 23 mg/kg body weight, i.p.) and injected via the tail vein with human PC (20 µg in a final volume 24 of 100 µl 1xPBS) or 1xPBS (100 µl) per mouse. After 10 min blood samples were collected 25 from the vena cava into 0.38% sodium citrate and 50 mM benzamidine HCl (final 26 concentrations). Human aPC was captured from these plasma samples using an antibody 27 highly specific for human aPC (HAPC 1555), and the activity of the captured human protein 28 C was determined using the chromogenic substrate SPECTROZYME® PCa as previously 29 described.3 30 31 Determination of serum BUN and creatinine 32 Mice were anesthetized 24h after reperfusion with sodium ketamine (100 mg/kg body weight, 33 i.p.) and xylazine (10 mg/kg body weight, i.p.) and sacrificed. Blood samples were obtained 34 from the abdominal vena cava and collected into tubes pre-filled with sodium citrate (final 35 concentration 0.38%). Plasma was obtained by centrifugation at 2000g for 10 min. Renal 36 dysfunction was evaluated by measuring serum levels of blood urea nitrogen (BUN) and 37 creatinine according to the manufacturer’s instructions. Serum BUN was measured using a

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 3 1 kinetic test kit with urease (Roche Diagnostics, Cobas c501 module) and creatinine was 2 determined by an enzymatic based kit (Roche Diagnostics, Cobas c501 module) in the 3 Institute of Clinical Chemistry and Pathobiochemistry, medical faculty, Otto-von-Guericke 4 University, Magdeburg, Germany. 4 5 6 Histology and immunohistochemistry 7 Sacrificed mice were perfused with ice-cold PBS and then with 4% buffered 8 paraformaldehyde. Tissues were further fixed in 4% buffered paraformaldehyde for 2 days at 9 4oC, embedded in paraffin and processed for sectioning. Kidney injury was evaluated using 10 hematoxylin and eosin stained histological sections. Images of the outer third of the kidney 11 sections were randomly chosen and captured using an Olympus Bx43 Microscope (Olympus, 12 Hamburg, Germany). All tubuli within an image were individually scored on a scale of 0-4 13 based on the cellular damage as indicated by morphological signs of cell-swelling and 14 tubular dilatation.5 The following scores were assigned: 0 – no cellular or tubular damage 15 visible; 1 – damage visible, but less than 25% of the tubuli affected; 2 – 25% to 50% tubular 16 damage; 3 – 50% to 75% tubular damage; and 4 – more than 75% damage. At least 5 17 random images per mouse and at least 5 mice per group were included into each group. 18 Immunohistochemical analyses of YB-1 and OTUB1 was conducted essentially as previously 19 described.3 Paraffin embedded tissue sections were deparaffinised and rehydrated, 20 incubated with a specific primary antibody (1 h, at room temperature), washed 3 times with 21 PBS, and incubated with an appropriate, horseradish peroxidase-conjugated secondary 22 antibody. Peroxidase activity was detected using a DAB substrate (3,3’-diaminobenzidine) 23 and slides were counterstained with hematoxylin.3 Control images were obtained following 24 incubation with a non-specific primary antibody and were used for background correction. All 25 histological analyses were done by two independent blinded investigators. Images were 26 obtained using an Olympus Bx43 Microscope (Olympus, Hamburg, Gemany) at 20x or 40x 27 magnification. 28 29 Analyses of human tissue samples 30 Paraffin sections of human kidney biopsies obtained from patients with acute renal failure 31 were scored for the severity of tubular injury (H.J.G.). YB-1 staining was done by a blinded 32 investigator (K.S.) and staining intensity was scored by two independent and blinded 33 investigators (W.D. and H.W). Control sections were obtained from patients undergoing 34 tumor nephrectomy, but without any other renal disease. All patients and controls were 35 Caucasian. The study complied with the Declaration of Helsinki. Tissue samples were 36 collected according to the guidelines of the local ethics committees after giving written 37 informed consent (Ethic-Committee-No: 068/1999). Immunohistochemical staining was

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 4 1 essentially performed as outlined above using a rabbit anti-YB1 antibody (primary antibody, 2 abcam, ab12148) and a TRITC labelled polyclonal anti-rabbit antibody (secondary antibody, 3 Dako R0156). Sections were counterstained with DAPI. 4 5 Cell culture 6 BUMPT cells were routinely cultured in DMEM containing 10% FBS and maintained at 33oC 7 in the presence of interferon γ (10 U/ml) to enhance expression of a thermosensitive T 8 antigen.6 Under these conditions cells remain undifferentiated and proliferate. To induce 9 differentiation, BUMPT cells were grown for 2 days at 37oC in the same medium without 10 interferon γ. Differentiation was ascertained by expression of Na+/glucose transporter and 11 megalin, both specific markers of proximal tubular cells. Only differentiated cells were used 12 for hypoxia and reoxygenation experiments. 13 Mouse primary renal proximal tubular epithelial cells (rTEC) were isolated by using a 14 modification of previously described methods7,8. Mice were scarified by cervical dislocation. 15 Kidneys were immediately removed and placed in cold (4 oC) Hanks Balanced Salt Solution 16 (HBSS) (Life Technologies, Germany) with 1% antibiotic/antimycotic additive (Sigma-Aldrich, 17 Germany). After removal of renal capsules kidneys were bisected and the renal medulla was 18 discarded. The remaining cortical tissue was minced and transferred to 10 ml HBSS 19 containing collagenase (200 units/ml; Worthington Biochemical Corp., Lakewood, N.J.) and 20 Soybean Trypsin Inhibitor (0.5mg/ml, Life Technologies, Germany). The tubuli containing 21 suspension was incubated (37 oC, 70 rpm) for 15 minutes, re-suspended with a 10 ml pipette, 22 and incubated again for 15 minutes. Following digestion the suspension from each kidney 23 was re-suspended again and then distributed into two 15 ml conical tubes (two tubes with ~5 24 ml each per kidney). Density sedimentation with horse serum was used to inactivate 25 enzymes and enrich for rTECs. To accomplish this, 5 ml of sterile, heat inactivated horse 26 serum (Life Technologies, Germany) was added to each tube and the tube was vortexed for 27 30 seconds. After sedimentation of tissue remnants for 1 minute the supernatant containing 28 the rTECs was transferred to another tube and centrifuged (7 minutes, 200xg). The cell pellet 29 was washed once with 10 ml of HBSS and centrifuged (200xg, 7 minutes). The supernatant 30 was discarded and the rTECs isolated from one kidney were re-suspended and pooled in 60 31 ml of DMEM/F-12 culture media (Life Technologies, Germany) containing insulin/ transferrin/ 32 selenium (5 μg/ml, 2.75 μg/ml, and 3.35 ng/ml, respectively, Life Technologies, Germany), 33 APO transferrin (2.0 μg/ml), hydrocortisone (40 ng/ml, Sigma-Aldrich, Germany), 34 recombinant human epidermal growth factor (rhEGF, 0.01 μg/ml, R&D Systems, 35 Minneapolis, MN), and 1% antibiotic/antimycotic solution (10,000 units/ml penicillin, 0.1 36 mg/ml streptomycin, 0.25 μg/ml amphotericin B, Sigma-Aldrich Germany). rTECs were o 37 incubated at 37 C with 5% CO2. Culture media was replaced initially after 24 hours and

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 5 1 subsequently every 48–72 hours using DMEM/F-12 without rhEGF. By staining cells for 2 megalin a purity of at least 95% was confirmed. For routine passage cells were rinsed with a 3 calcium- and magnesium-free PBS and exposed to trypsin (0.05%)-EDTA (Life 4 Technologies, Germany) for 1 min. rTEC cells were grown in 12-well or P-100 dishes and 5 experiments conducted at confluence. 6 7 In vitro hypoxia and reoxygenation model 8 Hypoxia and reoxygenation of BUMPT cells and rTECs was conducted as previously 9 described.9 Differentiated and 80% confluent BUMPT cells or rTECs were serum deprived 10 overnight (0.5% FBS). For hypoxia injury cells were kept in HBSS (Life Technologies,

11 Darmstadt, Germany) in a hypoxic atmosphere containing 1% O2, 94% N2, 5% CO2. A 12 hypoxia chamber (Stemcell, Grenoble, France) was used to maintain cells under hypoxic

13 conditions. After 6 h hypoxia cells were returned to complete medium and 21% O2 14 (“reoxygenation” period). As controls we used cells which were likewise serum-starved and

15 maintained in HBSS for 6 h, but these cells were continuously maintained at 21% O2. Cells 16 were harvested for RNA and protein isolation at various time-points after reoxygenation. In a 17 subset of experiments cells were pre-treated (30 min before hypoxia) with aPC (20 nM), the 18 protein biosynthesis inhibitor cycloheximide (10 µg/ml), the proteasome inhibitor MG132 (10 19 µM), PAR1, PAR2, PAR3, or PAR4 agonist peptide or control peptide (each 10 µM, see 20 Supplementary Table S1), or blocking antibodies towards PAR1, PAR2, PAR3, PAR4, or 21 EPCR (each 20 µg/ml). Two different PAR-1 activating peptides were used, corresponding to 22 the thrombin-specific tethered ligand (P1 AP2, TFLLR) or the aPC-specific tethered ligand 23 (P1 AP1, NPNDKYEPFWEDEEKNESGL). In all cases cells were pre-treated for 30 min. All 24 concentrations are final concentrations in the cell-culture medium. 25 26 Proteomics 27 We transfected BUMPT cells with a flag-tagged YB-1 overexpression construct or an 28 appropriate control construct. Cells were lysed 24h after transfection in RIPA buffer and 29 protein complexes were pulled down with an ANTI-FLAG® M2 Affinity Gel. 30 Immunoprecipitated samples were diluted with 50mM ABC (ammonium bicarbonate) and 31 then reduced with 25 mM DTT (dithiothreitol) in 20mM ABC for 60 min at 60°C. This was 32 followed by alkylation using 100 mM of IA (2-Iodoacetamide) in 20 mM ABC for 30 min at 33 37°C in dark. These modified proteins were digested using trypsin 20 ng/µl for 15-16 h by 34 incubating at 37°C. The digestion was stopped using 1% acetic acid and samples were 35 purified using ZipTip C18 (Millipore Corp., Billerica, MA, USA). This mixture was subjected to 36 LC-MS/MS analysis. The digested peptides were first enriched on a nanoAcquity UPLC 2G- 37 V/Mtrap Symmetry C18 pre-column (2 cm length, 180 µm inner diameter and 5 µm particle

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 6 1 size) from Water Corporation and separated using NanoAcquity BEH130 C18 column (10 cm 2 length, 100 µM inner diameter and 1.7 µm particle size from Water Corporation) on a 3 nanoAcquity UPLC. The separation was achieved by the formation of a linear gradient over 4 92 min using buffer A (2% acetonitrile, 2% DMSO in water with 0.1% acetic acid) and buffer 5 B (5% DMSO in acetonitrile with 0.1% acetic acid; gradient: 1-5% buffer B in 2 min, 5-25% B 6 in 63 min, 25-60% B in 25 min, 60-99% B in 2 min). The peptides were eluted at a flow rate 7 of 400 nL/ min and were analyzed using LTQ-Orbitrap Velos mass spectrometer (Thermo 8 Electron Corporation, Germany) equipped with a nano-ESI source installed with a Picotip 9 Emmitter (New Objective, USA). 10 The MS was operated in positive mode and in data-dependent mode to automatically switch 11 between Orbitrap-MS and LTQ-MS/MS acquisition. Survey full scan MS spectra (from m/z 12 300 to 1700) were acquired in the Orbitrap with resolution, R=30 000 with a target value of 1 13 x E6. The method allowed sequential isolation of the twenty most intense ions depending on 14 signal intensity and were subjected for CID fragmentation with an isolation width of 2 Da and 15 a target value of 3 x E4 or with a maximum ion time of 100 ms. Target ions already selected 16 for MS/MS were dynamically excluded for 60 s. General MS conditions were electrospray 17 voltage, 1.7 kV; no sheath and auxiliary gas flow, capillary temperature of 300°C. Ion 18 selection threshold was 2000 counts for MS/MS, activation time of 10 ms, and activation 19 energy of 35% normalized were also applied for MS/MS. Only doubly and triply charged ions 20 were triggered for tandem MS analysis. 21 The raw data acquired on the MS instrument was further analysed for protein identifications 22 using Proteome Discoverer 1.4.1.14 (Thermo Scientific, USA). The MS spectral data was 23 searched against human FASTA formatted Uniprot/SwissProt database using SequestHT 24 algorithm. Database searches were performed with carbamidomethylation on cysteine as 25 fixed modification and oxidation on methionine as variable modification. Enzyme specificity 26 was selected to trypsin with up to two missed cleavages allowed using 10 ppm peptide ion 27 and 0.8 Da MS/MS tolerances.10 Peptides with a false discovery rate (FDR) of less than 1% 28 were accepted and estimated by Percolator. Gene ontology (GO) classification and location, 29 biological process, and molecular function was performed using ProteinCenter software 30 (Thermo Scientific). 31 32 Immunoblotting and Immunoprecipitation 33 Following deep anaesthesia and before perfusion of animals the renal artery and vein of one 34 kidney was ligated, then removed and flash frozen in liquid nitrogen for protein and RNA 35 isolation. Proteins were isolated using RIPA buffer and the concentration was determined 36 using the BCA protein assay (Thermo Fisher Scientific, Waltham, MA, USA).

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 7 1 Kidney and cell extracts were separated by SDS/PAGE and transferred to PVDF membranes. 2 Membranes were blocked in Tris-buffered saline with 0.1% Tween 20 with 5% non-fat dry 3 milk or bovine serum albumin. Membranes were incubated with appropriate primary 4 antibodies overnight at 4°C. After washing 5 times with 1 x TBS-T membranes were 5 incubated with an appropriate secondary peroxidase-conjugated antibody, and 6 immunoreactive proteins were visualized using an enhanced chemiluminescence system 7 (Millipore, Darmstadt, Germany). For Immunoprecipitation, protein lysates were precleared 8 with protein A/G-agarose beads to reduce non-specific binding. Cleared protein lysates were 9 incubated with anti-YB-1 or irrelevant IgG antibodies. Antigen-antibody complexes were 10 precipitated following incubation with protein A/G-agarose beads at 4°C overnight by 11 centrifugation, and washed in cold lysis buffer (RIPA-buffer). The precipitates were boiled for 12 5 min in SDS loading buffer and subjected to immunoblotting.11 13 14 RT-PCR 15 Kidney tissue was thawed on ice and transferred into TRIZOL (Life Technologies, Darmstadt, 16 Germany) for isolation of total RNA following the manufacturer’s protocol. Quality of total 17 RNA was ensured on an agarose gel and by analyses of the A260/280 ratio. The reverse 18 transcription reaction was conducted with 1 μg of total RNA using the Super Script reagents 19 and oligo(dT) primers (Life Technologies, Darmstadt, Germany). cDNA was amplified using 20 the primers listed in the Supplementary Table S2. 21 22

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 8 1 Supplementary Tables 2 Name Abbreviation Peptide sequence PAR1 agonist peptide (aPC) P1 AP1 NPNDKYEPFWEDEEKNESGL PAR1 agonist peptide (aPC) control CON P1 GDENENEKPNWYELKEPDSF PAR1 agonist peptide (thrombin) P1 AP2 TFLLR PAR1 agonist peptide (thrombin) control CON P1 RLLFT PAR2 agonist peptide P2 AP SLIGRL PAR2 agonist peptide control CON P2 LSIGRL PAR3 agonist peptide P3 AP SFNGGP PAR3 agonist peptide control CON P3 FSNGGP PAR4 agonist peptide P4 AP AYPGKF PAR4 agonist peptide control CON P4 YAPGKF

3 Supplementary Table S1: PAR agonist peptides and control peptides sequences 4 5 6 7 8 Gene Forward Reverse mPAR1 5’ CCGGCACTGATTGGCAGTT 3’ 5’ GACTGGATCGGATACACCACC 3’ mPAR2 5’ CACCACCTGCCACGATGT 3’ 5’ CGATTCACAGTGCGGACAC 3’ mPAR3 5’ ATGGGCATCAACCGCTAC 3’ 5’ GCTGTCGGTATTGTGGTAG 3’ mPAR4 5’ AACGCCTCACTACTGGACTCT 3’ 5’ GAGCCAGCTAATCGGAAGGTC 3’ mEPCR 5’ AATGCCTACAACCGGACTCG 3’ 5’ ACCAGTGATGTGTAAGAGCGA 3’ mβ-actin 5’CCGTAAAGACCTCTATGCCAACA 3’ 5’ CGGACTCATCGTACTCCTGCT 3’ 9 Supplementary Table S2: Sequences of mouse primers used within the current study. 10 11 12 13

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 9 1 References: 2 1. Esmon, CT, Esmon, NL, Le Bonniec, BF, Johnson, AE: Protein C activation. Methods in 3 enzymology, 222: 359-385, 1993. 4 2. Taylor, FB, Jr., Chang, A, Esmon, CT, D'Angelo, A, Vigano-D'Angelo, S, Blick, KE: Protein C 5 prevents the coagulopathic and lethal effects of Escherichia coli infusion in the baboon. The 6 Journal of clinical investigation, 79: 918-925, 1987. 7 3. Isermann, B, Vinnikov, IA, Madhusudhan, T, Herzog, S, Kashif, M, Blautzik, J, Corat, MA, Zeier, M, 8 Blessing, E, Oh, J, Gerlitz, B, Berg, DT, Grinnell, BW, Chavakis, T, Esmon, CT, Weiler, H, 9 Bierhaus, A, Nawroth, PP: Activated protein C protects against diabetic nephropathy by 10 inhibiting endothelial and podocyte apoptosis. Nature medicine, 13: 1349-1358, 2007. 11 4. Lima-Oliveira, G, Lippi, G, Salvagno, GL, Danese, E, Montagnana, M, Brocco, G, Voi, M, Picheth, 12 G, Guidi, GC: Does laboratory automation for the preanalytical phase improve data quality? 13 Journal of laboratory automation, 18: 375-381, 2013. 14 5. Fan, H, Yang, HC, You, L, Wang, YY, He, WJ, Hao, CM: The histone deacetylase, SIRT1, 15 contributes to the resistance of young mice to ischemia/reperfusion-induced acute kidney 16 injury. Kidney international, 83: 404-413, 2013. 17 6. Sinha, D, Wang, Z, Price, VR, Schwartz, JH, Lieberthal, W: Chemical anoxia of tubular cells induces 18 activation of c-Src and its translocation to the zonula adherens. American journal of physiology 19 Renal physiology, 284: F488-497, 2003. 20 7. Sheridan, AM, Schwartz, JH, Kroshian, VM, Tercyak, AM, Laraia, J, Masino, S, Lieberthal, W: Renal 21 mouse proximal tubular cells are more susceptible than MDCK cells to chemical anoxia. The 22 American journal of physiology, 265: F342-350, 1993. 23 8. Breggia, AC, Himmelfarb, J: Primary mouse renal tubular epithelial cells have variable injury 24 tolerance to ischemic and chemical mediators of oxidative stress. Oxidative medicine and 25 cellular longevity, 1: 33-38, 2008. 26 9. Conde, E, Alegre, L, Blanco-Sanchez, I, Saenz-Morales, D, Aguado-Fraile, E, Ponte, B, Ramos, E, 27 Saiz, A, Jimenez, C, Ordonez, A, Lopez-Cabrera, M, del Peso, L, de Landazuri, MO, Liano, F, 28 Selgas, R, Sanchez-Tomero, JA, Garcia-Bermejo, ML: Hypoxia inducible factor 1-alpha (HIF-1 29 alpha) is induced during reperfusion after renal ischemia and is critical for proximal tubule cell 30 survival. PloS one, 7: e33258, 2012. 31 10. Jehmlich, N, Golatowski, C, Murr, A, Salazar, G, Dhople, VM, Hammer, E, Volker, U: Comparative 32 evaluation of peptide desalting methods for salivary proteome analysis. Clinica chimica acta; 33 international journal of clinical chemistry, 434: 16-20, 2014. 34 11. Madhusudhan, T, Wang, H, Straub, BK, Grone, E, Zhou, Q, Shahzad, K, Muller-Krebs, S, 35 Schwenger, V, Gerlitz, B, Grinnell, BW, Griffin, JH, Reiser, J, Grone, HJ, Esmon, CT, 36 Nawroth, PP, Isermann, B: Cytoprotective signaling by activated protein C requires protease- 37 activated receptor-3 in podocytes. Blood, 119: 874-883, 2012. 38 39

Dong et al., aPC regulates YB-1 in renal IRI, Supplementary M&M 10 Figure S1 A B F Control IRI HIF-1α β-actin 2.0 **

α 1.5 1.0 HIF-1

expression 0.5 0.0 Sham IRI C D E G H 50 ** * * ** 120 ** * * ** 2.0 ** * * * 2.5 * * * * 1.5 40 2.0 * * * * 90 1.5 1.0

30 mol/L) 1.5 µ 60 1.0 20 1.0 0.5 30 0.5 10 (AU) score 0.5 Pathological Crea ( Crea BUN (mmol/L)BUN YB-1 expression YB-1 0 0 0.0 KIM1 expression 0.0 0.0 Sham Sham Sham Sham Sham IRI+HA IRI+HA IRI+HA IRI+HA IRI+HA IRI+aPC IRI+aPC IRI+aPC IRI+aPC IRI+aPC IRI+PBS IRI+PBS IRI+PBS IRI+PBS IRI+PBS Sham+HA Sham+HA Sham+HA Sham+HA Sham+HA IRI+HA+aPC IRI+HA+aPC IRI+HA+aPC IRI+HAa+PC IRI+HA+aPC

Figure S1: aPC’s protective effect in renal IRI is independent of its anticoagulant function A: Efficient hypoxic stress was ascertained by determining HIF-1α expression in renal cortex extracts. Exemplary immunoblot of HIF-1α (132 kDa) and β-actin (loading control, 45 kDa) and bar graph summarizing results. B: Scheme of the murine renal IRI model. Renal pedicles were bilaterally occluded for 30 min (ischemia) and the mice were sacrificed 24h after reperfusion. In a subset of mice aPC (0.5 mg/kg body weight i.p.) was administered 30 min prior to renal ischemia (bottom). C-E: Serum urea nitrogen (BUN, C), creatinine (Crea, D), and pathological score (E) in control (sham, open bars), experimental (ischemia reperfusion injury, IRI+PBS, black bars), and wild type IRI mice receiving either aPC (0.5 mg/kg aPC, dark grey, IRI+aPC) or aPC (0.5 mg/kg) pre-incubated with the HAPC1573 antibody (light grey bars, IRI+HA+aPC). Treatment with the antibody HAPC1573 alone has no impact in sham (Sham+HA, striated) or IRI (IRI+HA, chequered) wild-type mice on these parameters. F-H: Treatment of wild-type IRI mice with aPC or aPC–HAPC1573 complex (0.5 mg/kg) efficiently diminished KIM1 expression while preserving YB-1 levels; representative immunoblots (F) of kidney lysates obtained from control (Sham, open bars), IRI (black), and IRI mice treated with aPC (dark grey) or the aPC–HAPC1573 (light grey) complex. The antibody HAPC1573 itself has not impact on KIM1 or YB-1 expression in wild-type sham (Sham+HA, striated) or IRI (IRI+HA, chequered) mice. Bar graphs (G, H) summarizing results. Bar graphs representing mean value ± SD of at least 6 mice per group (B, C, D); : P<0.05, : P<0.01 (ANOVA). Figure S2 A B C

E Normoxia Hypoxia F Normoxia Hypoxia HIF-1α HIF-1α β-actin β-actin

** * 2 2 α α

1 HIF-1 1 HIF-1 expression expression

0 0 Normoxia Hypoxia Normoxia Hypoxia Figure S2: Loss of YB-1 expression following acute renal injury in mice and humans A: Following IRI tubular YB-1 expression is diminished in WT and TMPro/Pro, but not in APChigh mice. Exemplary immunohistochemical images of renal paraffin embedded tissue sections obtained from control (sham-operated) or IRI mice. YB-1 antigen detected by HRP-DAB reaction (brown), hematoxylin counterstain (blue); scale bar: 20 µm. B: Dot blot summarizing results of YB-1 expression in human renal biopsies of patients with acute renal injury graded as mild, moderate, or severe by an experienced pathologists. Expression of YB-1, determined by immunohistochemical analyses, declines with an increasing severity of acute renal injury. Dot blot corresponding to the exemplary immunohistochemical images shown in Figure 2B; : P<0.05, : P<0.01 (Wilcoxon-Mann-Whitney-test). C,D: Expression of KIM1 and YB-1 remains stable under normoxic conditions in primary rTEC (C) and BUMPT (D) cells. Representative immunoblots of three repeat experiments. E,F: Efficient hypoxic stress was ascertained by determining HIF-1α expression in cell lysates of BUMPT cells (E) and rTECs (F). Exemplary immunoblot of HIF-1α (132 kDa) and β-actin (45 kDa, loading control) and bar graph summarizing results of three independent repeat experiments (each in triplicates). Figure S3

1 -

shRNAc shRNA Control YB-1 (50 kDa)

β-actin (45 kDa)

Figure S3: YB-1 knock down in tubular cells Immunoblot of non-transfected tubular (BUMPT) cells and BUMPT cells stably transfected with non-specific control shRNA (shRNAc) or YB-1 specific RNA (shRNA YB-1). Exemplary immunoblot, showing reduced YB-1 expression in shRNA YB-1 cells; β-actin as loading control. Figure S4

A B C IP IP

1 IP - IgG IgG Marker Marker YB OTUB1 IP

70 kDa

70 kDa 55 kDa 1 IB 55 kDa - YB 25 kDa OTUB1 IB 25 kDa

Figure S4: IgG controls for immunoprecipitation experiments and OTUB1 expression in renal tissue A: Immunoblotting of YB-1 (YB-1 IB) following immunoprecipitation using antibodies against YB-1 or IgG control (IgG IP) from whole cell lysates of control mouse tubular cells. B: Immunoblotting of OTUB1 (OTUB1 IB) following immunoprecipitation using antibodies against OTUB1 or IgG control (IgG IP) from whole cell lysates of control mouse tubular cells. C: Following IRI tubular OTUB1 expression is diminished in WT and TMPro/Pro, but not in APChigh mice. Exemplary immunohistochemical images of renal paraffin embedded tissue sections obtained from control (sham-operated) or IRI mice. OTUB1 antigen detected by HRP-DAB reaction (brown); hematoxylin counterstain (blue); scale bar: 20 µm.

Figure S5 OTUB1 A untranslated region genomic locus OTUB1 exons

targeting vector targeted exons

frameshift

targeted loxP site OTUB1 allele FRT site

OTUB1loxP F3 site

OTUB1Δ

B LoxP C D E

- LoxP 1.5 +/+ LoxP/ +/ +/ +/+ ** OTUB1+/+ OTUB1+/-

1.0 O O

2 2 OTUB1 OTUB1 OTUB1 M H OTUB1 OTUB1 M H OTUB1

376 bp 411 bp β-actin 0.5 216 bp 216 bp (fold changes) 0.0 +/+ +/- OTUB1 expressionOTUB1 OTUB1 OTUB1 Figure S5: Generation of heterozygous OTUB1 mice A: Schematic representation of the gene targeting strategy to obtain heterozygous OTUB1 mice. Initially, a targeting construct containing a NeoR and PuroR expression cassette flanking exon 2 and 3 of the OTUB1 gene and two loxP-sites was generated and used to target murine embryonic stem cells. The NeorR and PuroR cassettes were removed by flp- mediated recombination, yielding OTUB1LoxP mice. Subsequently, exon 2 and 3 were removed by breeding heterozygous OTUB1LoxP mice with C57BL/6 Rosa 26-Cre+/- mice, resulting in germline inactivation of one OTUB1 allel. B: PCR of tail DNA from the indicated mice showing a 216 bp band in case of OTUB1+/+, a 216 and a 376 bp band in case of heterozygous OTUB1+/LoxP, and a 376 bp band in case of OTUB1LoxP /LoxP mice. C: Standard PCR of tail DNA obtained from OTUB1+/+ mice (216 bp) or OTUB1+/- (411 bp) mice. D,E: Exemplary immunoblot showing OTUB1 expression in renal cortex samples obtained from OTUB1+/+ and OTUB1+/- mice (D) and bar graph summarizing results of 8 mice per group (E); mean ± SD; t-test, : P<0.01. Figure S6

OTUB1

Control shRNA shRNAc OTUB1 (31 kDa)

β-actin (45 kDa)

Figure S6: OTUB1 knock down in tubular cells Immunoblot of non-transfected tubular (BUMPT) cells and BUMPT cells stably transfected with non-specific control shRNA (shRNAc) or OTUB1 specific RNA (shRNA OTUB1). Exemplary immunoblot, showing reduced OTUB1 expression in shRNA OTUB1 cells; β-actin as loading control.