Assessment of Banana Streak MY Virus-Based Infectious Clone Vectors in Musa Ssp. by Mary Nyambeki Onsarigo B. Ed. (Science)

Assessment of banana streak MY virus-based infectious clone vectors

in Musa ssp.

Mary Nyambeki Onsarigo

B. Ed. (Science) 1996

M. Sc. (Agricultural Biotechnology) 2008

M. Sc. (Bioinformatics) 2010

Centre for Tropical Crops and Biocommodities

Science and Engineering Faculty

A thesis submitted for the degree of Doctor of Philosophy Queensland University of Technology

2017

Keywords

Genotype, GFP, endogenous virus sequences, resistance

Abstract

Banana streak disease, caused by a complex of different banana streak viruses (BSVs), occurs in all banana-producing countries. BSVs are genetically very diverse and can exist both as episomal forms or integrated into the host genome and both can be infectious to banana. Several field studies have assessed the infectivity of one or more BSV species on different banana genotypes with significant differences reported in virus incidence and symptom expression between and within genotypes. These studies used a severity index, based on symptom expression, to determine the resistance/susceptibility levels of the genotypes. Because of the great genetic variability amongst BSV species, symptoms of banana streak disease may vary widely and may be influenced by the cultivar and/or environmental conditions. Also this system of screening does not reflect the level of viral DNA accumulation (i.e. the viral load) within infected plants. Furthermore, there are no reports on the level of BSV DNA accumulation in different banana cultivars or Musa sp. Researchers at QUT had previously developed an infectious clone of one BSV species, Banana streak MY virus (BSMYV). Therefore, this study aimed to investigate the infectivity of the BSMYV infectious clone in a broad range of Musa genotypes and cultivars. Further to this, several modified infectious clones were assessed for their infectivity, and ability to either express a heterologous green fluorescent protein (GFP) reporter gene, or to illicit gene silencing.

This PhD study addressed the use of an infectious clone of BSMYV (BSMYV-IC) to accurately screen diverse banana genotypes for resistance to BSV. A total of 24 banana accessions comprising of six different genomic groups (AAA, AA, BB, AAB, ABB, AT) were propagated and indexed for any episomal infection, or activation of endogenous BSMYV (eBSMYV) with all plants testing negative. Plants of all accessions were mechanically inoculated with the BSMYV-IC and monitored for development of disease symptoms for a period of 6 to 12 months. Banana streak disease infection was confirmed by polymerase chain reaction (PCR) and rolling-circle amplification (RCA) for A-only or B-genome bananas, respectively. Accumulation of BSMYV DNA in the different banana genotypes was quantified using quantitative PCR (qPCR) starting from the initial leaf with symptoms to the termination of the experiment. Also, a series of ten modified BSMYV infectious clones were evaluated for infectivity, expression and silencing ability in banana plants.

Virus indexing of all plants of different banana accessions by PCR and RCA using BSYMV- specific primers confirmed that all propagated plants were free of virus infection. Following inoculation of plants with BSYMV, 22 out of the 24 accessions assessed were susceptible to BSYMV based on symptom expression and molecular diagnosis using either PCR or RCA. The susceptible accessions comprised of the AAA, AA, AAB, ABB and AT genome types. Interestingly, only two diploid BB accessions M. balbisiana and Butuhan did not express BSMYV symptoms and tested negative for infection by RCA. The BSMYV-IC was shown to be highly infectious, with up to 100% infectivity in the 22 Musa accessions confirmed to be infected. The effect of virus infection on growth was evaluated based on plant height and the rate of leaf emergence. There was a significant reduction in plant height in 8 accessions including Akondro Mainty (AA), Ma. ssp. zebrina (AA), Pahang (AA), Yesing (AAB), Pacific Plantain (AAB), Ma. ssp. banksii (AA), Calcutta 4 (AA) and Pisang Bangkahulu (AA), and rapid death of plants in accession Asupina (AT). There was no significant difference in the rate of leaf emergence between infected and non-infected plants in all the accessions tested

In the current study, symptom variability was considerable with different Musa genotypes expressing distinct symptoms. Quantification of the levels of virus DNA showed that virus accumulation differs between genotypes, but also within plants of the same accession, and that severity scores do not correlate well with the viral load as measured using qPCR.

Modified vectors with either ORF1 or ORF2 deleted were not infectious and the addition of a GFP ORF into two sites in the genome did not result in expression of this heterologous sequence from the constructs used in this study. Interestingly, two constructs with small inserts, initially designed for the purpose of gene silencing, were found to retain infectivity and maintain a heterologous sequence up to 110 nt. These studies confirm that BSMYV is infective in a broad range of Musa genotypes and cultivars but that further work is required to develop suitable vectors for either gene expression or gene silencing studies in banana

Table of Contents

Keywords ...... i Abstract ...... ii Table of Contents ...... iv List of Figures ...... vii List of Tables ...... x List of Abbreviations ...... xi Statement of Original Authorship ...... xv Acknowledgments ...... xvi 1 CHAPTER 1: LITERATURE REVIEW ...... 1 1.1 Significance of banana ...... 1 1.2 Banana taxonomy ...... 1 1.3 Banana hybridisation and diversity ...... 2 1.1 Status of the wild diploid banana ...... 4 1.2 Edible diploid (AA) and triploid (AAA) banana ...... 6 1.3 Intraspecific classification of banana and plantains ...... 6 1.4 Constraints to banana production ...... 7 1.5 Plant DNA viruses ...... 8 1.6 Badnaviruses ...... 9 1.7 Banana streak viruses ...... 9 1.7.1 Transmission of BSV ...... 10 1.7.2 Endogenous BSV sequences in the host genome ...... 12 1.7.3 BSV diagnostic tests ...... 13 1.7.4 Screening of banana genotypes for BSV resistance ...... 14 1.7.5 Banana streak disease and effects on Musa ...... 15 1.7.6 Expression of BSV symptoms by different banana genotypes ...... 16 1.8 Plant-viral interaction outcomes ...... 17 1.8.1 Susceptibility ...... 21 1.8.2 Tolerance ...... 21 1.8.3 Resistance ...... 21 1.1 RNA silencing as an antiviral defence mechanism by plants ...... 22 1.2 Infectious clones of plant viruses ...... 25 1.2.1 Inoculation of infectious clones ...... 26 1.3 Viral vectors for gene expression ...... 27 1.4 DNA viruses as vectors for expression ...... 32 1.5 Aims and Objectives ...... 33 2 CHAPTER 2: GENERAL METHODS AND MATERIALS ...... 35 2.1 Introduction ...... 35 2.2 General materials ...... 35 2.2.1 Banana genotypes ...... 35 2.2.2 Bacterial strains ...... 35

2.2.3 Infectious clones ...... 35 2.3 General solutions ...... 38 2.3.1 Nucleic acid extraction buffers ...... 38 2.3.2 Alkali lysis solutions ...... 38 2.3.3 Bacterial growth media and antibiotics ...... 38 2.3.4 Gel electrophoresis ...... 39 2.3.5 Tissue culture media ...... 39 2.4 General methods ...... 40 2.4.1 Tissue culture of banana genotypes ...... 40 2.4.2 Inoculation of banana genotypes ...... 42 2.4.3 Symptom assessment ...... 45 2.4.4 Isolation of nucleic acids from plant leaf tissue ...... 47 2.4.5 Nucleic acid amplification, cloning and sequencing ...... 47 2.5 Real time PRC (qPCR) ...... 52 2.5.1 Preparation of standard curve ...... 52 2.5.2 Plasmid DNA quantification by QuantiFluor dsDNA system for standard curves ...... 52 2.5.3 Calculation of plasmid copy number ...... 52 2.5.4 Establishment of standard curve ...... 53 2.5.5 Real-time quantitative PCR ...... 53 3 CHAPTER 3: ESTABLISHMENT OF METHODS FOR LARGE SCALE SCREENING OF GENOTYPES UNDER GLASSHOUSE CONDITIONS ...... 54 3.1 Introduction ...... 54 3.2 Materials and methods ...... 55 3.2.1 Banana genotypes ...... 55 3.2.2 Tissue culture multiplication and glasshouse acclimatisation ...... 55 3.2.3 BSV inoculation, monitoring and scoring of symptom severity...... 55 3.2.4 Sampling of banana leaf tissue ...... 55 3.2.5 PCR, RCA and real-time qPCR ...... 56 3.3 Results ...... 56 3.3.1 Pilot Experiments ...... 56 3.3.2 Screening of additional banana genotypes for the presence of episomal BSMYV infection 68 3.3.3 Baseline copy number of BSMYV in additional genotypes using qPCR ...... 68 3.4 Discussion ...... 73 4 CHAPTER 4: GLASSHOUSE ASSESSMENT OF A DIVERSE COLLECTION OF MUSA GENOTYPES FOR RESISTANCE TO INFECTION WITH BANANA STREAK MY VIRUS ...... 77 4.1 Introduction ...... 77 4.2 Materials and methods ...... 79 4.2.1 Banana genotypes ...... 79 4.2.2 Tissue culture multiplication and glasshouse acclimatisation ...... 79 4.2.3 BSV inoculation, monitoring and scoring of symptom severity...... 79 4.2.4 Sampling of banana leaf tissue ...... 80 4.2.5 PCR and RCA detection of BSMYV ...... 80 4.3 Results ...... 80 4.3.1 Glasshouse screening of banana cultivars ...... 80 4.3.2 Disease incidence and plant survival ...... 81 4.3.3 Evaluation of growth rate ...... 104 4.3.4 Assessment of symptoms ...... 110 4.4 Discussion ...... 131 5 CHAPTER 5: ASSESSMENT OF BANANA STREAK MY VIRUS DNA LEVELS IN MUSA GENOTYPES USING QUANTITATIVE REAL-TIME-PCR ...... 138 5.1 Introduction ...... 138

5.2 Materials and methods ...... 139 5.2.1 Absolute quantification of viral DNA by real-time qPCR ...... 139 5.3 Results ...... 140 5.3.1 Quantification of BMYV DNA in leaves of Musa genotypes over time ...... 140 5.3.2 Comparison between severity scores and viral load ...... 148 5.3.3 Calculation of the viral load in genotypes with delayed infection (AB and ABB) ...... 160 5.4 Discussion ...... 164 6 CHAPTER 6: ASSESSMENT OF BANANA STREAK MY VIRUS BASED VECTORS FOR HETEROLOGOUS GENE EXPRESSION AND GENE SILENCING IN BANANA ...... 167 6.1 Introduction ...... 167 6.2 Methods and materials ...... 169 6.2.1 Plant materials ...... 169 6.2.2 Construction of deletion mutants of the native BSMYV infectious clone ...... 169 6.2.3 Transformation and inoculation of deletion mutants ...... 170 6.2.4 PCR and RCA amplification of BSMYV ...... 170 6.2.5 Visualisation of green fluorescent protein (GFP) expression ...... 170 6.3 Results ...... 174 6.3.1 Infectivity of deletion mutant constructs ...... 174 6.3.2 Assessment of putative expression constructs for infectivity and expression of GFP . 179 6.4 Discussion ...... 189 7 CHAPTER 7: GENERAL DISCUSSION, CONCLUSION AND RECOMMENDATION ...... 193 REFERENCES ...... 202 APPENDICES ...... 220 Appendix 1 Viral DNA copy number accumulated in leaves of the genotypes in experiment2, 4/5 and 6 220 Appendix 2 Comparison between severity scores and viral load for genotypes in experiments, 4/5 229

List of Figures

Figure 1.1 Schematic position of banana varieties based on different genome composition...... 3 Figure 1.2 Banana hybridisation and diversity...... 5 Figure 1.3 Genome organisation of BSV showing the three open reading frames...... 11 Figure 1.4 Electron micrograph of BSOLV particles with bacilliform shape...... 12 Figure 1.5 Symptoms of BSV infection displayed by two different genotypes in separate locations. .. 20 Figure 2.1 Scoring system for BSV symptom severity index (SSI)...... 46 Figure 3.1 Illustration of tissue sampling from a banana leaf using a one-hole plier punch ...... 57 Figure 3.2 Pre-screening of Dwarf Cavendish and Lady Finger plants for BSV using PCR or RCA...... 58 Figure 3.3 Symptoms of BSMYV infection in inoculated Dwarf Cavendish and Lady Finger banana plants. 60 Figure 3.4 Screening of banana plants for BSMYV in pilot experiment 1 at 12 weeks post-inoculation.61 Figure 3.5 Viral DNA quantified from individual leaf samples of three inoculated Dwarf Cavendish and Lady Finger banana plants in pilot experiment 1...... 64 Figure 3.6 PCR and RCA confirmation of BSMYV infection in pilot experiment 2 at 12 weeks post-inoculation...... 66 Figure 3.7 Average viral DNA quantified from leaf samples of nine Dwarf Cavendish or eight Lady Finger symptomatic banana plants in pilot experiment 2...... 67 Figure 3.8 PCR screening of TNA extracts from the 22 genotypes selected for glasshouse screening experiments for BSMYV using primers 18S-F/R...... 69 Figure 3.9 PCR screening of TNA extracts from the 15 genotypes selected for glasshouse screening experiments with no B-genome complement for BSMYV infection using primers Mys-F/R...... 70 Figure 3.10 RCA screening of TNA extracts from the seven genotypes selected for glasshouse screening experiments with some B-genome component for BSMYV infection...... 71 Figure 3.11 Baseline levels of BSMYV DNA determined using qPCR on TNA extracts...... 72 Figure 4.1 PCR screening of TNA extracts from eight genotypes tested in Experiment 1 using primers 18S-F/R. 85 Figure 4.2 PCR screening of TNA extracts from eight genotypes tested in Experiment 1 using primers Mys-F/R. 86 Figure 4.3 PCR screening of TNA extracts from seven genotypes with no B-genome complement tested in Experiment 2 using primers Mys-F/R...... 89 Figure 4.4 RCA screening of TNA extracts from plants of Ney Poovan tested in Experiment 2...... 90 Figure 4.5 PCR screening of TNA extracts from the four genotypes tested in Experiment 3 using primers Mys-F/R...... 92 Figure 4.6 PCR screening of TNA extracts from seven genotypes with no B-genome component tested in Experiment 4 using primers Mys-F/-R...... 94 Figure 4.7 RCA screening of TNA extracts from three genotypes with some B-genome component tested in Experiments 4/5...... 95 Figure 4.8 PCR screening of TNA extracts from three genotypes with no B-genome complement tested in Experiment 6 using primers Mys-F/R...... 98 Figure 4.9 RCA screening of TNA extracts from six genotypes with some B genome complement tested in Experiment 6...... 100 Figure 4.10 PCR and RCA screening of TNA extracts from genotypes tested in Experiment 7...... 103 Figure 4.11 Change in plant height in non-inoculated and inoculated plants in Experiments 3, 4/5 and 6 (measured at zero and 24 weeks post-inoculation)...... 108

Figure 4.12 Effect of BSMYV infection on plant growth...... 109 Figure 4.13 Comparison of the number of leaves to emerge in non-inoculated and inoculated plants over 24 weeks...... 112 Figure 4.14 Monthly mean minimum and maximum temperatures in Brisbane...... 114 Figure 4.15 Initial leaf number to express BSMYV symptoms post-inoculation in six different experiments.115 Figure 4.16 BSMYV symptoms observed on leaves of Calcutta 4, Khae Phrae, Ma ssp. banksii and Ma. ssp. zebrina at different developmental stages...... 118 Figure 4.17 BSMYV symptoms observed on leaves of Truncata, Pahang, Pisang Bangkahulu and Akondro Mainty at different developmental or maturity stages...... 119 Figure 4.18 BSMYV symptoms observed on leaves of Pisang Madu, Paka and Ney Poovan at different developmental stages...... 121 Figure 4.19. BSMYV symptoms observed on leaves of wild or cultivated triploid genotypes of Dwarf Cavendish, Williams, Gros Michel and Lady Finger at different developmental stages...... 123 Figure 4.20 BSMYV symptoms observed on leaves of wild or cultivated triploid genotypes of Pacific Plantain, Yesing, Pisang Gajih Merah and Saba at different developmental stages...... 124 Figure 4.21 BSMYV symptoms pseudostem and cigar leaves on different genotypes...... 126 Figure 4.22 Average symptom severity (ASS) for genotypes tested in Experiment 1...... 127 Figure 4.23 Average severity score (ASS) on the initial leaves to develop symptoms following inoculation with BSMYV...... 129 Figure 4.24 Average severity scores per leaf in five plants the control genotypes Dwarf Cavendish and Lady Finger from experiment 2 to 5...... 130 Figure 4.25 Average severity score index (ASSI) in control and test genotypes...... 132 Figure 5.1 Example standard curves generated during qPCR when quantifying BSMYV DNA in leaf samples. 141 Figure 5.2 Graphs showing how viral DNA copy number accumulated in each leaves of the control genotypes in experiment 2...... 144 Figure 5.3 Viral DNA copy number accumulated in leaves of the control and test genotypes in experiment 4/5...... 147 Figure 5.4 The average viral load at the first peak of accessions tested in experiment 6...... 149 Figure 5.5 Leaves of plant 3 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. 151 Figure 5.6 6 Leaves of plant 5 in genotype Dwarf Cavendish and the corresponding viral DNA copy number...... 152 Figure 5.7 Leaves of plant 6 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. 153 Figure 5.8 Leaves of plant 3 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. 154 Figure 5.9 6 Leaves of plant 5 in genotype Dwarf Cavendish and the corresponding viral DNA copy number...... 155 Figure 5.10 Leaves of plant 6 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. 156 Figure 5.11 Leaves of plant 4 in genotype Lady Finger and the corresponding viral DNA copy number.157 Figure 5.12 Leaves of plant 5 in genotype Lady Finger and the corresponding viral DNA copy number.158 Figure 5.13 Leaves of plant 6 in genotype Lady Finger and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores...... 159 Figure 5.14 Viral DNA copy number accumulated in leaves of the genotypes in experiment 6 and 7.162 Figure 5.15 Average Viral load accumulation of the highest value in leaves of Ney Poovan, Pisang Gajih Merah in experiment 6 and Saba in experiment 7...... 163 Figure 6.1 Vector map of native BSMYV-IC...... 171

Figure 6.2 Schematic representations of native BSMYV-IC and deletion mutant constructs...... 172 Figure 6.3 PCR screening of TNA extracts from 16 plants inoculated with the native BSMYV-IC and different constructs 16 weeks post-inoculation...... 175 Figure 6.4 PCR screening of TNA extracts from five plants inoculated with a mixture of BSMYV-ICΔ1 and BSMYV-ICΔ2, at 16 weeks post-inoculation...... 177 Figure 6.5 PCR screening of TNA extracts from plants inoculated with BSMYV-ICΔ0 and BSMYV-ICΔ0-GFP, at 16 weeks post-inoculation...... 180 Figure 6.6 Sequence analysis of amplicons generated from from plants inoculated with BSMYV-ICΔ0 at 16 weeks post-inoculation...... 181 Figure 6.7 Sequence analysis of amplicon derived from plants inoculated with BSMYV-ICΔ0-GFP...... 183 Figure 6.8 PCR amplification from TNA extracts from 10 plants inoculated with BSMYV-ICΔ0-50nt-GFP and with BSMYV-ICΔ0-110nt-GFP with 50 or 110 nt of GFP inserts using MY-ORF1-AsiSIF and MY-ORF2-SbfIR primers 16 weeks post-inoculation...... 186 Figure 6.9 Sequence analysis of PCR products from plants inoculated with BSMYV-ICΔ0-50nt-GFP and BSMYV-ICΔ0- 100nt-GFP 16 weeks post-inoculation...... 188

List of Tables

Table 1.1 Description of BSV symptoms ...... 19 Table 1.2 Types of resistance to viral infection in plants...... 23 Table 1.3 Infectious clones of different RNA and DNA viruses ...... 29 Table 2.1 Banana genotypes that were used in this study ...... 36 Table 2.2 BSMYV-IC deletion mutants for infectivity tests ...... 37 Table 2.3 Recipe for Morel and Wetmore vitamin stock solution (100x) ...... 41 Table 2.4 Recipe for multiplication media ...... 43 Table 2.5 Recipe for plant rooting media ...... 44 Table 2.6 PCR primers used in this study ...... 48 Table 3.1 Symptom severity scores for Dwarf Cavendish and Lady Finger plants in pilot experiment 2 at week 12 post-inoculation...... 65 Table 4.1 Summary of glasshouse screening experiments ...... 83 Table 4.2 Summary of inoculation Experiment 1 ...... 84 Table 4.3 Summary of inoculation Experiment 2 ...... 88 Table 4.4 Summary of inoculation Experiment 3 ...... 91 Table 4.5 Summary of inoculation Experiments 4 and 5 ...... 93 Table 4.6 Summary of inoculation Experiment 6 ...... 97 Table 4.7 Summary of inoculation Experiment 7 ...... 102 Table 4.8 Variability in leaf streak symptoms observed on banana genotypes ...... 116 Table 6.1 Infectious clone constructs used in this study ...... 173 Table 6.2 Sequence analysis of PCR products cloned from plants inoculated with BSMYV-ICΔ0-50nt-GFP.178 Table 6.3 Nucleotide composition of PCR products across ORF1 and ORF2 of plants inoculated with a mixture of BSMYV-ICΔ1 and BSMYV-ICΔ2 ...... 187 Table 7.1 Levels of BSMYV resistance in different banana genotypes ...... 197

List of Abbreviations

°C degrees Celsius µL microliter/s µM micromolar ABTV Abaca bunchy top virus ACMV African cassava mosaic virus ASS average symptom severity ASSI average symptom severity index BAP 6-benzylaminopurine BLAST basic local alignment search tool bp base pair/s BBTV Banana bunchy top virus BSVs Banana streak virus/es BBrMV Banana bract mosaic virus BanMMV Banana mild mosaic virus BVX Banana virus X BSGFV Banana streak GF virus BSIMV Banana streak IM virus BMV Brome mosaic virus BSMYV Banana streak MY virus BSUAV Banana streak UA virus BSOLV Banana streak OL virus BSCAV Banana streak CA virus BSD Banana streak disease CBDV Cardamom bushy dwarf virus cm centimetres CaMV Cauliflower mosaic virus CHMT II Chinese hamster metallothionine CLCuMuV Cotton leaf Curl Multan virus CMV Cucumber mosaic virus CP coat protein (capsid protein) ComYMV Commelina mottle yellow virus CTAB cetyl-trimethyl ammonium bromide CTCB Centre for Tropical Crops and Biocommodities

DAFF Department of Agriculture, Forestry and Fisheries DHFR dihydrofolate reductase dH20 distilled water DNA deoxyribonucleic acid dNTP deoxyribonucleoside triphosphate dsDNA double-stranded DNA EAHB East African highland banana eBSVs endogenous BSVs E. coli Escherichia coli EDTA ethylenediaminetetraacetic acid ELISA enzyme-linked immuno-sorbent assay FBNYV Faba bean necrotic yellows virus FHIA Fundación Hondureòa de Investgación Agricola FOC Fusarium oxysporum f.sp. cubense FriEPRV Fritillaria imperialis endogenous sequences g gram/s g relative centrifugal force in units of gravity gDNA genomic deoxyribonucleic acid GFP green fluorescent protein h hour/s IC infectious clone ICBN International code of Botanical Nomenclature IC-PCR immune-capture PCR ICTV International Committee on Taxonomy of Viruses IITA International Institute of Tropical Agriculture IPTG Isopropyl-β-D-thioglactopyranoside ISEM immunosorbent electron microscopy L litre/s LB Luria-Bertani M Molar Ma Musa acuminata MCS multiple cloning site MDV Milk vetch dwarf virus min minute/s mm millimeter

mM millimolar MS Murashige and Skoog basal salt mixture nm nanometre/s NCBI National Centre for Biotechnology Information nptII neomycin phosphotransferase gene OD optical density ORF open reading frame ORSV Odontoglossum ringspot virus PCR polymerase chain reaction pH - log (proton concentration) PVCV Petunia vein clearing virus PVX Potato virus X qPCR Real time PCR RBSDV Rice black streaked dwarf virus RCA rolling-circle amplification RDRPs RNA-dependent RNA polymerase RFLP restriction fragment length polymorphism RNAi RNA interference RNaseH ribonuclease H RT reverse transcriptase RTBV Rice tungro bacilliform virus s second/s ssp subspecies SCBMOV Sugarcane bacilliform MO virus SCMV Sugarcane mosaic virus SCSV Subterranean clover stunt virus. siRNA small interfering RNA SSRs microsatellites sDNA single-stranded DNA TAE Tris acetate EDTA TAS-ELISA triple-antibody sandwich ELISA TE Tris-EDTA TGMV Tomato golden mosaic virus TMV Tobacco mosaic virus TMoV Tomato mottle virus

TNA total nucleic acid Tris tris (hydroxymethyl)aminomethane TVCV Tobacco vein clearing virus U unit UTR untranslated region VIGS virus-induced gene silencing vsRNA virus-derived siRNAs W/V weight per volume X-gal 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside

Statement of Original Authorship

The work contained in this thesis has not been previously submitted to meet requirements for an award at this or any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made.

Signature: QUT Verified Signature

Date: November 2017

Acknowledgments

I am grateful to God for the good health and wellbeing that were necessary to complete this PhD study.

A very special gratitude goes to Distinguished Professor James Dale for accepting me as one of his PhD students and assimilating me into the banana group. Not only did you make me feel at home during my first days in Australia, but also provided scientific guidance and oversight throughout my study period. May God bless your lovely wife and family for being very kind to me during my stay at your home.

Dr. Anthony James, my principal supervisor, for perpetually encouraging me to rise to the occasion by tirelessly providing mentorship, guidance and crucial advice during the entire study period and preparation of this thesis. I really appreciate the moments you spent with me during the inoculations, data collection and cleaning my research stuff in the glasshouse.

Professor Rob Harding, my associate supervisor, I would like to express my sincere gratitude for the continuous support, aspiring guidance, invaluably constructive criticism and friendly advice during my entire study period. Thank you also for your patience, motivation and immense knowledge.

I acknowledge Australian Agency for International Development (AusAID) for awarding me the scholarship to undertake this PhD. Also thanks to the government of Kenya for granting me a study leave to pursue my PhD.

I would also like to thank Senior Research Fellow, Dr. Benjamin Dugdale for your great technical advice during occasional consultative meetings. Fellow HDR students: Stephen Buah, Benard Mware and Jimmy Tindamanyire for sharing your valued experiences in the different specialised areas. Thank you, Dr. Mark Chiang for volunteering to save my eye sight without paying you. May God bless you!

CTCB laboratory staff Maiko, I take this special moment to appreciate your skilled assistance in many aspects including the Northern blotting work. CTCB administrative staff for ensuring efficient running of all aspects connected with my research and welfare

My family especially my husband James, my children: Edwin, Melody, Sheila and Purity for your incredible patience and understanding during the stressful days and nights.

1CHAPTER 1: LITERATURE REVIEW

1.1 Significance of banana

Bananas (Musa spp.) are an important crop worldwide and are the largest fresh fruit crop traded internationally in terms of both volume and value (Paull and Duarte, 2011). They constitute a staple food and income source for millions of people, especially in Africa, with around 87% of the worldwide production remaining in domestic markets (Roux et al., 2008). Apart from their economic value, bananas are also nutritious being a good source of carbohydrates (Mohapatra et al., 2010), vitamins (Kanazawa and Sakakibara, 2000; Sharrock and Lusty, 2000) and minerals (Mohapatra et al., 2010).

1.2 Banana taxonomy

All varieties and hybrids of banana species belong to the genus Musa, family Musaceae and order Zingiberales. The genus Musa is grouped into five sections based on the basic number of chromosomes and the orientation and arrangement of flowers in the inflorescence. There are two sections with a basic chromosome number of 10 (2n = 20), namely Callimusa and Australimusa. The sections Eumusa and Rhodochlamys have a basic chromosome number of 11 (2n=22), while section Ingentimusa has a basic chromosome number of 7 (2n = 14). The section Eumusa contains 30-40 species including all of the edible, cultivated, parthenocarpic bananas with the exception of those belonging to the Fe’i section. Members of the section Eumusa with edible fruits are commonly referred to as either bananas, which are usually consumed raw and are also known as dessert types, or plantains (which are consumed after cooking). These include about 13-15 subgroups derived from Musa acuminata Colla (A genome) and Musa balbisiana Colla (B genome) by intra and/or interspecific hybridisation of the two (Simmonds and Shepherd, 1955; Vuylsteke et al., 1997). A range of diploid acuminata (AA) cs evolved due to natural hybridisation, while triploid acuminata types (AAA) were generated from AA genotypes by chromosome restitution. This is a process resulting when one of the several stages of meiosis fails and produces 2n gametes instead of the n gametes produced during the normal process of mitotic division. When the unreduced gamete containing 2n chromosomes (from pollen) fertilises a normal n-gamete, a triploid banana progeny is produced. An alternative mechanism leading to the formation of triploids is when a tetraploid (which occasionally occur naturally due

to spontaneous evolution by doubling of diploid genome) is crossed with a diploid. The latter process is the basis for breeding programs where tetraploids are produced (Heslop-Harrison and Schwarzacher, 2007). Inter-specific hybridisation between M. acuminata and M. balbisiana gave rise to various genotypes including AB, AAB, and ABB. Artificial cross-pollination of A and B genotypes has given rise to a range of tetraploid hybrids such as AABB, ABBB and AAAB (Figure 1.1). There are about 500 varieties of bananas and plantains. About 150 of these are primary clones and the rest are somatic mutants (Daniells, 1995; Vuylsteke et al., 1997).

1.3 Banana hybridisation and diversity

The cooked banana was given its first scientific name as M. paradisiaca Linn by Linnaeus in 1753 and in 1759 the dessert type was named as M. sapientum Linn. This classification was based on the fact that M. paradisiaca Linn was only palatable after cooking while M. sapientum could only be eaten as a fresh fruit after ripening. Other descriptors used include the morphology of the fruit and the male flowers. These scientific names remained in use for almost two centuries before Simmonds and Shepherd (1955) developed new recommendations on the classification of bananas as having two wild and seedy ancestors namely M. acuminata Colla and M. balbisiana Colla. However, they acknowledged Linnaeus’ classification of the edible M. paradisiaca Linn and M. sapientum Linn as being hybrids of M. acuminata and M. balbisiana because the descriptors he used were found in both M. acuminata and M. balbisiana.

This was supported by reports which indicated that the edible diploid and triploid bananas were derived from either pure M. acuminata (AA, AAA) or from hybrids of M. acuminata and M. balbisiana (AB, AAB, ABB) (Cheesman, 1947; Dodds and Simmonds, 1948). Simmonds and Shepherd (1955) also noted that there was no natural, edible, pure diploid (BB) or triploid (BBB) form of M. balbisiana known. ABBB is the only tetraploid of M. balbisiana that occur naturally. M. acuminata has been reported to easily go through evolutionary changes hence the reason it easily changed its ploidy level from 2 to 3 (diploid to triploid), as well as to parthenocarpic and sterile diploid forms. On the other hand, M. balbisiana has been shown to be highly stable and less amenable to these kinds of evolutionary changes. (Dodds, 1943; Dodds and Simmonds, 1948; Simmonds, 1953a, 1953b; Simmonds and Shepherd, 1955).

Figure 1.1 Schematic position of banana varieties based on different genome composition. Adapted from Stover and Simmonds (1987) as modified by Daniells (1995).

In the process of domesticating wild bananas, different levels of hybrids were achieved through different pathways of either direct crossing or backcrossing of edible and wild parents of M. acuminata and M. balbisiana (Figure 1.2). Simmonds and Shepherd (1955) described four different types of hybrids that could originate from edible M. acuminata with contributions from either wild M. acuminata and/or M. balbisiana. Hybrid I was as a result of the outcrossing of edible diploids of M. acuminata (AA) to wild M. acuminata (AA) or M. balbisiana (BB), namely A + A = AA or A + B = AB. The second type of hybrids are thought to have occurred because of backcrossing of diploid AB by M. acuminata (AB + A = AAB) or by crossing of edible diploid (AA) M. acuminata by M. balbisiana (AA + B = AAB). Hybrid III is believed to be because of backcrossing the diploid AB hybrid by M. balbisiana (AB + B = ABB). Both types of hybrid II and III were selected by humans for their traits of parthenocarpy and sterility, as well as larger fruit size. Edible triploid bananas derived from M. balbisiana were from hybrids II and III. The fourth type of hybrid subsequently resulted Hybrid III being pollinated by M. balbisiana (ABB + B = ABBB). However, there are no records of the existence of pure BBBB naturally (Pursglove, 1972). While experimentally it is possible to generate every genotype (Figure 1.2), the existence of some in nature is very rare. Hybridisation of M. acuminata and M. balbisiana has given rise to several hybrids that constitute the modern banana cultivar. (Figure 1.2). In an attempt to identify banana cultivar. and their synonyms, Valmayor et al. (1999) acknowledged that while AAB cultivar. were more numerous than ABB, hybrids of AB, AABB and ABBB were also very rare under natural circumstances.

1.1 Status of the wild diploid banana

There are two types of wild diploid bananas belonging to A and B genomes. Although they are of distinct species with different morphological characteristics, they can hybridise as discussed above (Simmonds and Shepherd, 1995; Cheesman, 1947). However, the A genome diploids are highly variable and have been classified into eight different subspecies namely: Musa acuminata (Ma) ssp. burmannica, Ma ssp. siamea, Ma. ssp banksii, Ma. ssp zebrina, Ma ssp. malaccensis, Ma ssp. macrocarpa, Ma ssp truncata, Ma ssp burmannicoides, using different approaches such morphological characteristics (Cheesman 1947), restriction fragment length polymorphism (RFLPs) (Wong et al., 2001), and microsatellites (SSRs) (Christelova et al., 2011). However, the B genome species seems not to be variable hence no further subspecies classification exists so far.

Figure 1.2 Banana hybridisation and diversity. M. acuminata and M. balbisiana were used in making various levels of banana hybrids. The genotypes known to occur naturally are in bold letters although every genotype can experimentally be generated. Modified from Simmonds and Shephard (1995).

1.2 Edible diploid (AA) and triploid (AAA) banana

The edible diploid bananas of A-genome may have entirely evolved from the wild A-genome species. Given the fact that this genome exists in several subspecies, numerous diploid edible diploids in turn may have originated out of them independently (Simmonds and Weatherup, 1990) as confirmed through flavonoids studies (Horry and Jay, 1988). Although most of them are seedless due to chromosome restitution, they basically belong to the same species as the wild parent (Trehane et al., 1995; Robinson, 1996). The edible triploid AAA may have resulted from natural hybridisation and/or by breeding programmes in which both wild and cultivated diploids with reduced female gametes were fertilised by normal haploid male gamete (Simmonds 1996). Like the edible diploids, different subspecies of A genome may have contributed independently in the production of the triploids (Howel et al., 1994). The subspecies malaccensis, banksii and zebrina that have varying anthocyanin pigments have been linked to contributing AAA hybrids (Horry and Jay 1988). The triploids are classified to belong to the same species as the wild edible AA parents (Pickersgill, 1986). There are no edible diploids or triploids of B only genome species (Simmonds, 1996).

1.3 Intraspecific classification of banana and plantains

The edible Musa fruits are commonly referred to as either bananas, which are usually consumed raw and are also known as dessert types, or plantains (which are consumed after cooking) (Simmonds and Shepherd, 1955; Vuylsteke et al., 1997). The International Code of Botanical Nomenclature (ICBN) recognises five infraspecific ranks: subspecies, variety, subvariety, form and sub-form (Stace, 1980). Subspecies, variety and form ranks are commonly used by taxonomists. Subspecies is used for geographical races, variety is used for local populations which are morphologically and possibly ecologically distinct. Form is used for a typical individual within a population. The three categories may be used for cultivated plants as well as wild plants.

The genus Musa includes both cultivated and wild taxa. The wild taxa have been ranked as subspecies since they retain their natural range and this rank is used to distinguish the geographical races found within the wild M. acuminata (Simmonds and Weatherup, 1990). However, the cultivated taxa do not show the natural range since they have been moved and

spread by humans far from their origins. Due to the wide range of variations in the cultivated banana and cannot be ranked as subspecies, ICBN suggested two categories i.e cultivar group and cultivar. However, the variations that still exists cannot fit into the ranking system suggested by ICBN of the two categories. Therefore, informal categories of cultivated bananas still exist.

In Musa, AAA groups still retain the classification proposed by Cheesman, 1933 of having three subgroups namely Cavendish, Gros Michel and Green red. Stover and Simmonds (1987) further classified the Cavendish subgroup into Dwarf Cavendish, Giant Cavendish, Grande Naine and Lacatan, which Daniells (1990) later attributed to somatic mutations leading diversification of a single progenitor. However, Lebot et al. (1994) could only view them as being morphotypes. The classification of the edible interspecies hybrid AAB into subgroups and clones for example, remains as suggested by the early authors (De Langhe and Valmayor, 1980; Swennen, 1988; Lebot et al., 1994). It has been classified as Plantains, Popoulu, Pacific plantain (Maia Maoli), Mysore, silk, Pome and Pisang Raja. Plantains were also classified by Simmonds (1966) into French (with persistent male buds) and Horn (with no male bud). Tezenas du montcel et al. (1983) classified the Horn into French horn, False horn and Horn. More work is needed to resolve and validate classification of the existing cultivated B-component genotypes. For example, two cultivated genotypes Cardaba and Saba have not been resolved whether they are BBB or ABB (Vakili, 1967; Valmayor et al., 1991; Janet and Litz, 1986)

1.4 Constraints to banana production

Banana production is threatened by both abiotic and biotic factors. Drought and declining soil fertility resulting from intensive land use have emerged as the major abiotic constraints to banana production (Ravi et al., 2013; Wairegi et al., 2010). Biotic constraints to banana production include both pests and diseases. Bananas are susceptible to a range of serious and debilitating diseases caused by fungi, bacteria, nematodes and viruses. Viral diseases severely hamper banana production. Six viruses, namely Banana bunchy top virus (BBTV), Banana streak virus/es (BSVs), Banana bract mosaic virus (BBrMV), Banana mild mosaic virus (BanMMV), Cucumber mosaic virus (CMV) and Banana virus X (BVX), are currently known to infect bananas worldwide. Of these, BBTV is considered the most important, usually causing complete yield loss in infected plants (Dale, 1987; Jones, 2000).

1.5 Plant DNA viruses

There are three families of plant DNA viruses namely the Geminiviridae, Nanoviridae and Caulimoviridae. Geminiviridae and Nanoviridae members have circular single-stranded DNA (ssDNA) genomes that replicate by a rolling circle mechanism (Brown et al., 2011) as well as by recombination-dependent replication (Jeske et al., 2001). The origin of rolling circle replication is a putative stem-loop structure within the intergenic region that contains highly conserved TA (A/T) TATTAC consensus sequences for the geminiviruses and nanoviruses, respectively (Geering and Hull, 2011). Geminiviruses have either mono- or bi-partite DNA genomes which are packaged in twinned (geminate) icosahedral particles as circular ssDNA of 2.5 – 3.0 Kb (Brown et al., 2011; Gutierrez, 2000). Nanoviruses are classified into two genera; namely Nanovirus and Babuvirus. Both have small (18-20 nm) isometric virions and possess a multipartite (6 – 8 components) circular ssDNA genome with each component about 1 Kb (Geering and Hull, 2011). The former consists of viruses that infect legumes and includes Faba bean necrotic yellows virus (FBNYV), Milk vetch dwarf virus (MDV) and Subterranean clover stunt virus (SCSV). The latter consists of the well characterised Banana bunchy top virus (BBTV) and other two putative members, Abaca bunchy top virus (ABTV) and Cardamom bushy dwarf virus (CBDV) (Palmer and Gleba, 2013).

All double-stranded DNA (dsDNA) plant viruses are also known as pararetroviruses. The Caulimoviridae is the only family of plant-infecting dsDNA viruses. According to the Tenth International Committee on Taxonomy of Viruses (ICTV) report this family has been divided into six genera namely Caulimovirus, Petuvirus, Tungrovirus, Badnavirus, Soymovirus and Cavemovirus (Bhat et al., 2016; Geering and Hull, 2011). Viruses in this family encapsidate a circular dsDNA of about 7.5–8.0 Kbp which contains site-specific, single-stranded discontinuities generated during replication (Bhat et al., 2016; Geering and Hull, 2011). They express their genome as a greater than full-length RNA transcript following its entry into the cell nucleus. The greater than unit length viral transcript is both a polycistronic mRNA and a replication template. Both negative and positive DNA strands are synthesised by the viral reverse transcriptase (RT) using the host tRNAmet and the viral encoded ribonuclease H (RNaseH) (Harper and Hull, 1998; Harper, Hull, et al., 2002). Members are distinguished by the number of open reading frames (ORFs), host range and the transmitting vectors (Geering and Hull, 2011; Purkayastha et al.,

2010; Rothnie et al., 1994). The Badnaviruses and Tungroviruses have bacilliform virions of approximately 30 × 130–150 nm while those of other genera have spherical virions.

1.6 Badnaviruses

Currently there are 32 recognised species within the genus Badnavirus, with another 20 awaiting formal recognition (Bhat et al., 2016). Badnaviruses are of great economic importance because they cause severe diseases in several important monocot and dicot crops. They are widely distributed in tropical and temperate regions of Asia, Australia, South and North America, Europe and Africa and they infect tropical and subtropical crops such as yam, cocoa, citrus, black pepper, taro and banana. Their genome size ranges between 7.2 to 9.2 Kb with three to seven open reading frames (ORFs) (Bhat et al., 2016). Many predicted ORFs have unknown functions, except for the large ORF III which encodes a polyprotein which is processed into functional units involved in replication, movement and encapsidation. ORF II has been associated with nucleic acid binding proteins (Jacquot et al., 1996) while ORF I in ComYMV has been associated with virions (Cheng et al., 1996; Medberry et al., 1990). Species within the genus are differentiated by their host range, less than 80% nucleotide sequence identity within the polymerase coding region (RT+RNaseH) and vector specificities (Geering and Hull, 2011).

Badnaviruses, being plant pararetroviruses, accumulate as episomal copies (minichromosomes) within the nucleus but do not integrate into the host genome as a part of their life cycle (Rothnie et al 1994; Staginnus et al 2009; Côte et al 2010). However, fragmented sequences have been identified in different plants such as tobacco (Tobacco vein clearing virus (TVCV; Jakowitsch et al., 1999), petunia (Petunia vein clearing virus (PVCV; Richert-Poggeler et al., 1997) and banana (BSV; Harper et al., 2002). These endogenous sequences, in some cases, can become activated and result in infectious virus, particularly in the case of BSV in bananas (Geering et al., 2001; Ndowara et al., 1999; Fort et al., 2017). Such integrated virus sequences further complicates diagnosis and disease management.

1.7 Banana streak viruses

There are currently 70 complete genome sequences of 28 different BSV species and 20 complete genome sequences representing 16 putative species in the NCBI GenBank (Bhat et al., 2016). The highly variable isolates from Uganda form one cluster, except for Banana streak UA virus

(BSUAV), while those having integrated sequences in the banana genome (commonly referred to as the endogenous BSVs (eBSVs)) without episomal counterparts, form a second cluster. The third cluster consists of the rest of the worldwide BSVs (Bhat et al., 2016). Currently there are nine distinctive species recognised by ICTV (Bhat et al., 2016). The double stranded DNA (dsDNA) is encapsidated with discontinuities on both strands. An example is banana streak MY virus with a genome size of 7650 bp with three opening reading frames (Figure 1.3). Banana streak viruses have bacilliform shaped particles with a diameter of 30 x 130-150nm (Figure 1.4).

1.7.1 Transmission of BSV BSVs are transmitted in a semi-persistent manner by mealybugs, which colonise the pseudostem or the rhizome of the banana plant (Harper et al., 2002; Jones, 1999). The spread of the disease is believed to be either by ants which move the mealybugs from one plant to the other or through infected suckers (Jones, 1999). BSV is transmitted by several different species of mealybugs, including Planococcus citri, P. ficus, Dysmicoccus brevipes, Saccharicoccus sacchari and Paracoccus burnerae (Williams, 1996; Kubiriba et al., 2001; Walton and Pringle 2004; Muturi et al., 2013; Thomas, 2007). Mealybugs can acquire the virus from an infected host plant within 24 hours with optimum acquisition usually taking three days. Depending on the species they can retain the virus for up to five days (Kubiriba et al., 2001). Following feeding by viruliferous mealybugs, infection can occur as quickly as four weeks depending on species as well as the host. For example, in banana plants inoculated with viruliferous pineapple mealybugs, BSV was detected after four weeks. In contrast, when viruliferous sugarcane mealybugs were used, BSV was not detected until six weeks post-inoculation (Kubiriba et al., 2001).

Although mealybugs are the natural vectors of BSV, their use for the purposes of large-scale screening of germplasm is tedious and labour intensive. The development and use of infectious virus clones enables large numbers of plants to be inoculated within a very short period in a controlled manner.

Figure 1.3 Genome organisation of BSV showing the three open reading frames. ORF1, ORF2 and ORF3 (the outer arcs), the double stranded DNA genome of 7650bp (complete circle) and the RNA transcripts mapping with 5’ and 3’ end positions (inner broken-line).

Figure 1.4 Electron micrograph of BSOLV particles with bacilliform shape. Scale bar = 100 nm. Source: Lockhart and Jones, 2000.

An infectious clone (IC) of Banana streak MY virus (BSMYV) was developed by Bjartan (2012). When inoculated into cultivar. Dwarf Cavendish (AAA) bananas via agroinoculation, symptoms developed after approximately 5 weeks and the rate of transmission was 100%.

1.7.2 Endogenous BSV sequences in the host genome Spontaneous BSV infection in previously BSV-negative genotypes, is thought to originate from activation of viral sequences that are integrated in the host's nuclear genome of banana with B component, called endogenous BSV (eBSV), rather than from external sources of infection (Lheureux et al., 2003; Ndowora et al., 1999; Côte et al., 2010). Several BSV species are known to

have eBSV counterparts including Banana streak OL virus (BSOLV), Banana streak GF virus (BSGFV), Banana streak IM virus (BSIMV) and BSMYV (Staginnus et al., 2009). However, only eBSVs of BSOLV, BSGFV and BSIMV are infective, while the eBSV counterpart of BSMYV is not (Iskra-Caruana. et al., 2010; Iskra-Caruana. et al., 2014; Fort et al., 2017). Further research has mapped the endogenous sequences of eBSIMV, eBSOLV and eBSGFV to a single locus each in the banana genome. Both eBSOLV and eBSGFV have two distinct alleles (eBSOLV-1/2, eBSGFV- 7/9) on chromosome 1 of which only one is infectious, while eBSIMV has two structurally identical alleles on chromosome 2, with both potentially infectious (Duroy et al., 2016; Chabannes and Iskra-Caruana, 2013; Chabannes et al., 2013; Gayral et al., 2010; Gayral and Iskra-Caruana, 2009; Meyer et al., 2008; Ndowora et al., 1999). The mechanism by which BSV sequence integration occurs into the host plant genome is not known. One theory however suggests that integration occurs by illegitimate homologous recombination of BSV sequences (Chabannes and Iskra-Caruana, 2013; Ndowora et al., 1999). In the recent literature, it has been established that during self-pollination or chromosome doubling of haploid M. balbisiana, both infectious and non-infectious eBSVs alleles segregate. Therefore, through segregation of the alleles, it is possible to breed bananas lacking eBSVs through self-pollination or by cross pollination of parents displaying complementary eBSVs pattern (Umber et al., 2016).

1.7.3 BSV diagnostic tests Serological methods were among the first laboratory tests used for detecting episomal infection of BSVs. However, the major disadvantage of this approach was the high level of serological variability amongst BSV isolates (Lockhart, 1986; Lockhart and Olszewski, 1993). An improvement of this method was the development of enzyme-linked immunosorbent assay (ELISA) using antisera produced against a wide range of isolates of BSVs and other closely related Badnaviruses. This method also face challenges in development of antisera for detection of new viruses (Rodoni et al., 1999; Barbara and Clark, 1982). End point polymerase chain reaction (PCR)-based diagnostic tests are useful for screening for episomal infection in banana genotypes with an A-only genome complement. This method relies on using primers designed to amplify part of the most conserved region of the badnavirus genome, namely the RT/RNaseH-coding region (Yang et al., 2003). However, this method gives false positives when screening bananas with a B-genome component because they have integrated sequences of BSVs. Other diagnostics that have been used include immunocapture PCR (IC-PCR), immunosorbent electron

microscopy (ISEM) and triple-antibody sandwich ELISA (TAS-ELISA) (Agindotan et al., 2006). The most reliable diagnostic method so far to detect and differentiate episomal infections of BSVs from its counterpart integrated sequences in banana genome, is rolling circle amplification (RCA) (James et al., 2011). Since it is sequence-independent, it selectively amplifies circular and not linear (integrated) DNA. The technology utilises bacteriophage Phi 29 DNA polymerase which has a strong-strand displacing capability and proof reading activity (Esteban et al., 1992). It very stable at 30°C for over 18 hours and therefore does not require thermal cycling for amplification. Consensus or degenerate primers specific to a conserved region of a genome can be used (Dean et al., 2001; Rector et al., 2004).

When RCA was utilised to detect new and/or episomal infection of BSVs, it was noted that restriction enzymes used for post-amplification varied by giving different restriction profiles for specific BSV species. The best enzyme would be one that recognises a single site in the viral genome to produce a linear fragment of about 7.5 Kbp. (James et al., 2011). For example, when KpnI was used, the following BSV species produced different digestion profiles: BSMYV (7,650 Kbp), BSOLV (7,389 Kbp), BSGFV (7,263 Kbp), BSVNV (7,801 Kbp) (James et al., 2011).

1.7.4 Screening of banana genotypes for BSV resistance Several field and greenhouse trials have been carried out to identify banana genotypes that are resistant to BSV for use in breeding programs. In a field study using 36 banana varieties growing at three different localities in Nigeria some tetraploid hybrids of (AAAA), (ABBB) and landraces of ABB and AAB genotypes did not express symptoms across different localities. However, there were other similar genotypes such Saba (ABB) and Bluggoe (ABB) which expressed symptoms in one locality but not in the others (Dahal et al., 2000). When 50 banana hybrids and 10 landraces were screened in both field and greenhouse conditions in Nigeria, in both environments, the hybrids had a higher incidence of symptoms and BSV antigens when observed and tested by ELISA respectively. On the other hand, the landraces remained symptomless with very low or undetectable amounts of BSV antigens (Dahal et al., 2000). Also, observed in the same experiment was a mixed infection of Cucumber mosaic virus (CMV) and Banana streak OL virus (BSOLV) on bananas that were on the farm trials (Dahal et al., 2000). In the case of mixed infections, symptoms alone may not indicate the specificity of the infecting virus.

Karanja et al., (2013) screened 15 genotypes with Banana streak GF virus (BSGFV) and Banana streak CA virus (BSCAV) primers in the field at different localities in Kenya and most of them tested positive and expressed BSV symptoms with significant variations between genotypes, localities and season. Five commercial genotypes out of the 15 that were evaluated by Karanja et al., (2013) in the field, were also screened in the greenhouse and over 55% tested positive with BSGFV and BSCAV primers (Nyaboga et al., 2008). The positive results with sets of specific primers from different species, may be an indication that there were mixed infections by different BSV species in the banana genotypes and based on these results it would have been hard to conclude using the observations on symptoms expressed by the infected genotypes was due to infection of a specific BSV isolate

The screening methods that have been used in the past, have utilised the natural infection by mealybugs whereby it is assumed that the BSV being transmitted is of single species and therefore the symptoms observed should be of the same species. However, this may not be the case given evidence from Uganda where diversity of BSV species has been found to be the highest so far (James et al., 2011b; Harper et al., 2004; 2005). Therefore, there is a likelihood that when such field trials were being conducted, more than one BSV species could have been transmitted in a single infection. This necessitated a new way of screening banana genotypes which ensures a single BSV species is used for infection to make a proper judgement on symptom expression and its DNA accumulation by different genotypes.

1.7.5 Banana streak disease and effects on Musa Banana streak disease (BSD) was first reported from Ivory Coast in 1968 (Lassoudière, 1974) and the causal virus first isolated and characterised from bananas growing in southern Morocco (Lockhart, 1986). Subsequently the disease has been recorded in over 40 countries across Africa, Asia, Australia, Europe and South and North America (Agindotan et al., 2006; Jones, 1999, 2000). Severely diseased plants may have reduced bunch size and misshapen fruits (Daniells et al., 2001). Yield losses of 7 to 90% were reported in Cote d'Ivoire on variety Poyo (AAA) (Lassoudière, 1974). In Nigeria and southern Cameroon, yield losses of up to 15% have been reported as a result of internal necrosis and death of plants (Gauhl et al., 1999). Dahal et al. (2000) found bunch weight loss varied with hybrids of tetraploid plantain from International

Institute of Tropical Agriculture (IITA) losing between 7-60% yields but those from Fundación Hondureòa de Investgación Agricola (FHIA), had less than 15% yield loss. However, Daniells et al., (2000) reported no significant effects of BSCAV infection on growth and yield of Cavendish bananas (AAA) other than a slight delay in bunch emergence (by 18 days) and yield reduction of 6% in newly planted Cavendish and 11% in the ratoon crop in Australia. In conclusion, the range of BSD effects may vary due to different cultivars and environmental conditions.

1.7.6 Expression of BSV symptoms by different banana genotypes BSD symptoms are variable due to the wide range of BSV isolates (Geering et al., 2000; Harper et al., 2004). The most characteristic foliar symptoms include chlorotic and necrotic streaks on the leaves. Additional symptoms include narrowing and thickening of the leaf, internal pseudostem necrosis, splitting of the base of the leaf sheaths and detachment of leaves, stunting, choking of the bunch on emergence and plant death (Dahal et al., 1999). Symptoms expressed by genotypes fluctuated during the lifespan of the infected bananas (Dahal et al., 1998; Dahal et al., 2000). Under field conditions, different researchers have observed different patterns of streaks on different banana genotypes and have given specific descriptions (Table 1.1).

Most experiments were conducted in the field and there is no clear information on specific BSV species infecting and displaying specific patterns of symptoms (Dahal et al., 2000; Daniells et al., 2001; Harper et al., 2002; James et al., 2011; Jones, 1999). Jones (1999) assigned specific symptom description to the specific genotype ‘Mysore’ (AAB) in Honduras as having chlorotic stripes, spindle and eye-shaped streaks on the leaf with the pseudostem having black streaks. The same cultivar had black stripes on the leaf in Australia. Cultivar ‘Enyeru’ (AAA) had yellow blotchy symptoms on the leaves in Uganda. However, the BSV isolate causing the disease was not mentioned. Harper et al., (2002) also gave a range of symptom descriptions (chlorotic and necrotic, fine, long and narrow to short and broad, diamond- or lozenge-shaped, speckling rather than streaking, interveinal mottle and mosaic) to the clones of triploid East African Highland (AAA-EAH) bananas, Gros Michel (AAA) and Gonja (AAB) (Table 1.1; Figure 1.5).

1.8 Plant-viral interaction outcomes

There is a broad spectrum of interactions between plants and viruses, with two specific categories of interactions known as either compatible or non-compatible relationships. These in turn depends on the effectiveness of plants defence mechanisms and on the ability of the virus to counteract these defence responses. There are two extreme responses of plants to viral infection, resistance or susceptibility. A non-compatible interaction has been interpreted as plants being resistant or having complete immunity. Compatible relationships have been characterised by the establishment of a systemic infection and therefore the plants are termed as susceptible. Alternatively, plants are termed tolerant if they fall in between the resistant and susceptible (Fraile and García-Arenal, 2010; Lecoq et al., 1979; Lecoq et al., 2004; Liu et al., 2014; Palukaitis et al., 2013).

Table 1.1 Description of BSV symptoms

Banana cultivar. and genotype Country Symptom description References Williams (AAA) Morocco Chlorotic streaking (Lockhart, 1995) Dwarf Cavendish (AAA) Uganda Fine streaks (Harper, Hart, et al., 2002) Enyeru (AAA) Uganda Yellow blotchy symptoms (Jones, 1999) Gros Michel (AAA) Uganda Green vein banding (Harper, Hart, et al., 2002) Mudwale (AAA-EAH) Uganda Broad chlorotic and mosaic (Harper, Hart, et al., 2002) Ndizi (AB) Uganda Interveinal mottle (Harper, Hart, et al., 2002) Sukali ndizi (AB) Uganda Short and broad streaks (Harper, Hart, et al., 2002) Gonja (AAB) Uganda Broad chlorotic streaks (Harper, Hart, et al., 2002) cultivar Kamaramasenge (AAB) Rwanda Cigar-leaf necrosis, systemic necrosis (Lockhart, 1995) and Mysore (AAB) Country not stated Chlorotic and brown necrotic streaks (Lockhart, 1995) Mysore (AAB) Honduras Chlorotic stripe, spindle and eye-shaped (Jones, 2000) Mysore (AAB) Honduras Black stripe symptoms on pseudostem (Jones, 2000) Mysore (AAB) Australia Black stripe symptoms (Jones, 2000)

Figure 1.5 Symptoms of BSV infection displayed by two different genotypes in separate locations. A = ‘Enyeru’ (AAA, Lujugira-Mutika subgroup) with yellow blotchy symptoms of banana streak disease from Uganda, B = ‘Mysore’ (AAB) showing chlorotic stripe, spindle and eye-shaped symptoms of banana streak disease in Honduras, C = ‘Mysore’ (AAB) with black stripe symptoms of banana streak disease on the pseudostem in Honduras, D = ‘Mysore’ (AAB) with black stripe symptoms of banana streak disease on Badu Island in the Torres strait region of Australia. Sourced from Jones (1999).

1.8.1 Susceptibility Susceptibility is the extreme reaction of plants to virus infection that can lead to death in most cases. It is when virus replication and accumulation proceeds within the plant system without hindrance from the plant. The first trait that is usually used to assess plant susceptibility is the visual qualitative symptom expression (Doumayrou et al., 2013). Induction of chlorotic symptoms in infected plants is contributed by an accumulation of viral proteins inside the chloroplasts to such levels that comprises the normal functioning of the plant manifested as symptoms (Bengyella et al., 2015; Liu et al., 2014). The virus overcomes all suppressors fronted by the plant as well as any preformed anti-pathogen compounds (Zhang et al., 2013). The virus replicates and continues invading new cells and accumulates to levels that lead to the eventual death of the plant. Another characteristic in susceptible genotypes is that symptoms increase in intensity and severity continuously until the plant dies (Fraile and García-Arenal, 2010; Ghoshal and Sanfaçon, 2015).

1.8.2 Tolerance In between the extreme reactions of plants to viral infection (susceptibility and resistance) are plants that have been referred to as tolerant. They show varying degrees of resistance or susceptibility between the two extremes (extreme susceptibility being plant death and extreme resistance being no infection). They are characterised by their ability to allow viral infection and virus accumulation to such levels that an equilibrium is reached (meta-stability) where virus can replicate without adversely affecting the plant’s life (Bengyella et al., 2015; Fraile and García- Arenal, 2010; Goic and Saleh, 2012). Such an interaction has been found to favour the virus as a source of inoculum or reservoir for primary viral acquisition by insect vectors (Biswas et al., 2012). Symptom fluctuations from severe to mild is also a common observation (Liu et al., 2014).

1.8.3 Resistance Resistance or complete immunity has been defined as the host’s natural ability of defence against pathogens. Fraile and García-Arenal (2010) defines resistance as the plant’s ability to limit virus multiplication by interfering with the disease cycle. Lecoq et al. (2004) supported by Anjanappa et al. (2016) explains complete immunity as the plants being unable to sustain virus replication. Resistance in a broader perspective is diverse and may range from

interference with virus development at cell, organ, individual plant or population level. These levels are usually assessed in comparison with the susceptible counter-part (Table 1.2). Acquired-resistance is when the virus infects the plant but due to a strong defence mechanism by the plant, the virus is maintained at very low levels which cannot be transmitted by vector. The plant manages to restrict virus multiplication, hence reduced availability to the vector for secondary infection (Lecoq et al., 2004). The other type of resistance is when the virus itself is unable to move from cell to cell or long distance for systemic infection. This could be either the plant defence mechanism is preventing the virus or the virus movement proteins are not compatible with the system (Carrington et al., 1996; Tatineni and French, 2014). There is also resistance due to escape of infection because of the plant’s developmental stage. For example, mature leaves or adult plants can escape infection (Lecoq et al., 2004; Nie and Molen, 2015).

1.1 RNA silencing as an antiviral defence mechanism by plants

RNA silencing or RNA interference (RNAi) refers to a combined process played by small non- coding RNAs of 20-30 nucleotides in inactivating homologous sequences, promoting endonuclease activity, translational arrest, and/or chromatic or DNA modification to negatively regulate sequence-specific gene expression (Meister et al., 2004; Meister and Tuschl, 2004; Zhou et al., 2010). In this process specific enzymes detect double-stranded RNA (dsRNA) not normally found in cells and destroy it by digesting it into small pieces (Baulcombe, 2004; Susi et al., 2004). Plant viruses could be both the target and trigger for RNA silencing mechanisms used by plants as defence (Foreman et al., 2012) as implicated by different evidences. For example, the virus- derived siRNAs (vsRNA) that quickly accumulates within the plant infected with RNA or DNA viruses (Blevins et al., 2006; Hamilton and Baulcombe, 1999), the post-transcriptional and transcriptional silencing of transgenes and endogenous genes that share high homology with (recombinant) viruses and viroid sequence due to virus and viroid infections (Al-Kaff et al., 1998) and also the viral suppressor proteins that interfere with various steps of endogenous and transgene-induced silencing pathways (Voinnet et al., 1999). The major antiviral defence mechanism is based on RNA silencing generating short interfering RNAs (siRNAs) that can potentially block viral genes post-transcriptionally through RNA-cleavage and transcriptionally through DNA cytosine methylation (Rajeswaran et al., 2014).

Table 1.2 Types of resistance to viral infection in plants.

Type of resistance Virus-plant interaction Comments Reference

Resistance to virus Plant allows virus to replicate and multiply at the initial stages and Plant’s active immune mechanism is able to (Lecoq et al., 2004) acquisition by a vector even cause symptoms but later the plant manages to restrict virus maintain the virus at very low levels not to multiplication hence reduced availability to the vector for be available for transmission by vector (acquired –resistance) secondary infection

Resistance to virus Plant minimizes viral replication and accumulation to maintains it The virus may become systemic but it is (Gray et al., 1986) multiplication at very un-consequential low levels always at very low levels in plant tissues

Resistance to long Plant controls the systemic infection by limiting its movement Slow infection, Virus blocked from entry into (Murphy and Kyle, 1995; distance movement of within the plant vasculature. Sometimes systemic Tatineni and French, virus within the plant hypersensitivity occurs 2014)

Resistance to virus Virus gains entry into plant virus is sequestrated to islands of cells Plant defence mechanism confines the virus (Lecoq et al., 2004) movement between cells without induction of necrosis to inoculated cells

Complete resistance There’s contact between plant and virus but virus does not either Virus may lack some necessary factors for (Anjanappa et al., 2016; (immunity) gain entry or is not allowed to replicate after entry pathogenesis or the plant’s defence is strong Kohm et al., 1993; to combat virus replication Legnani et al., 1995)

Resistance due to escape mature plant escaping infection at adult stage but not earlier Virus does not overcome the initial passive (Caranta et al., 1997) of infection (same level of inoculum is used) defence barriers of the plant (rigid cell walls)

Resistance to inoculation There is no contact between plant and virus Vectors are not able to transmit the virus for (Jones, 1998; Lecoq et by vectors some reason al., 1979)

While there are different types of small RNAs in plants, interestingly, they are generated by a related set of multiple genes following different pathways. There are four major sets of protein families which include Dicer-like, dsRNA binding, RNA-dependent RNA polymerase (RDRPs) and Argonautes that have inter-related roles in the silencing machinery (Foreman et al., 2012; Konakalla et al., 2016; Rajeswaran et al., 2014). Production of double-stranded RNA (dsRNA) molecules is the main substrate for silencing pathways and depending on whether the target is RDR-independent or RDR-dependent different pathway will be followed (Foreman et al., 2012). In the RDR-independent pathways, dsRNAs are produced directly from either miRNA precursors, hairpin transgenes, overlapping transcripts or viral replication intermediates which have regions of internal complementarity and can fold to produce dsRNA. RDR-dependent pathways use ssRNA which include sense transgenes, trans-acting siRNAs (tasiRNA precursor), transcriptional gene silencing (Promoter RNA) and single-stranded viral RNA (viral ssRNA) as a substrate to produce dsRNAs (Foreman et al., 2012; Konakalla et al., 2016; F. Wang et al., 2016). Dicer-like participate in producing different sizes of siRNA/miRNAs. DCL2, DCL3 and DLC4 produce siRNAs of 22, 24 and 21 nt siRNAs which participate in post-transcriptional silencing (Mlotshwa et al., 2008; Foreman et al., 2012; Lakato et al., 2006; Ding and Voinnet et al., 2007).

In susceptible plants, viruses generate viral small RNAs (vsiRNA) upon infection within the host. They are generated either via viral double-stranded RNA replicative intermediates or from the plant RNA-dependent RNA polymerase activities on the infecting viral templates (Garcia-Ruiz et al., 2010; Molnár et al., 2005; Wang et al., 2010). Small viral RNAs (vsiRNA) of 21 and 22 nt with adenosine bias at the 5’ terminus through deep sequencing were profiled from maize plants infected by Sugarcane mosaic virus (SCMV) (Xia et al., 2014). Similar size of vsiRNA with a cytosine bias at the 5’ end were profiled from Cotton leaf Curl Multan virus CLCuMuV) infecting cotton and were thought to aid in infection (Wang et al., 2016). In bananas that were persistently infected with BSV isolates, it was noted that the viruses always evaded the silencing mechanism and a new class of 20 nt siRNAs were produced in addition to the 21 nt to 24 nt siRNAs produced in a virus infected plant (Rajeswaran et al., 2014).

Molecular and biotechnological tools have been used to artificially integrate specific viral sequences into plant genomes to confer resistance against the corresponding invading viruses. A hairpin constructed transgene targeting four genes (RNA-dependent RNA polymerase, putative

core protein, RNA silencing suppressor and outer capsid protein) expressed 21 to 24 nt siRNA which effectively conferred resistance against Rice black streaked dwarf virus (RBSDV) (Wang et al., 2016). Under natural circumstances, plants with endogenous viral sequences are thought to have contributed resistance to infection from exogenous viruses of related sequences, much like viral transgenes (Covey and Al-Kaff, 2000; Teycheney and Tepfer, 2007). A high level accumulation of 24 nt small RNAs believed to target Fritillaria imperialis endogenous sequences (FriEPRV) were described which clearly indicated an RNA-dependent DNA methylation (Becher et al., 2014). Since viral dsDNA accumulates in the nucleus as multiple minichromosomes (Pilartz and Jeske, 2003) they are potentially subject to transcriptional gene silencing and heterochromatisation. The different sizes of siRNAs have distinguishable roles in silencing activities (Rajeswaran et al., 2014).

1.2 Infectious clones of plant viruses

Since the first reports on the generation of infectious clones in the early 1980s, the technology has almost become a standard laboratory technique, providing an excellent tool for the research of viral gene functions, rapid germplasm screening for virus resistance (Zheng et al., 2015), use in RNA silencing studies and for the preparation of viral expression vectors. An infectious clone is a self-replicating cloned copy of a virus genome. Infectious clones of RNA viruses have been prepared by cloning cDNAs covering the full-length of the RNA genome under the control of a strong promoter, allowing in vitro transcription (e.g Tobacco mosaic virus (TMV)). Infectivity of multi-component RNA viruses requires the preparation of cDNA clones from all genomic components which are mixed for inoculation (e.g Brome mosaic virus (BMV)) (Ahlquist et al., 1984; Dawson et al., 1986; Zhang et al., 2015; Zheng et al., 2015). However, production of cDNA clones is a labour-intensive procedure compared to the preparation of DNA virus infectious clones.

Preparation of infectious clones from DNA viruses also depends on the ability to obtain a full- length viral genome, and usually requires the preparation of a greater than unit-length construct. Rolling circle amplification (RCA) has commonly been used to amplify full-length genomes of DNA viruses due to the circular nature of the genomes (Haible et al., 2006; Johne et al., 2009). The genomes of bipartite, single stranded DNA begomoviruses (Geminiviridae family) have been isolated by RCA and prepared as infectious clones by separately cloning full-length

sequences of both DNA components in binary vectors and subsequently mixing the cloned DNA for inoculation of test plants using Agrobacterium. An alternative strategy to this has been cloning of both DNA components as tandem dimers into a single plasmid for inoculation. Early examples include African cassava mosaic virus (ACMV) and Tomato golden mosaic virus (TGMV) (Hayes et al., 1988; Stanley, 1983). The same strategy can also be used when preparing infectious clones from geminiviruses with single component genomes such as mastreviruses (Grimsley et al., 1987). The first Caulimovirus to be prepared as an infectious clone was Cauliflower mosaic virus (CaMV). The cloned DNA of CaMV was infectious as either a full-length or more than full genome length DNA excised from the plasmid and mechanically inoculated (Lebeurier et al., 1980). Infectious clones of dsDNA viruses from the genera tungrovirus (e.g Rice tungro baciliform virus (RTBV)) and badnavirus (e.g Commelina mosaic virus (CoYMV)) have also been generated as either full-length or greater than full genome length clones. An infectious clone of CoYMV was prepared by constructing a more than full-length construct (full length genome plus a duplicated 120 nucleotide portion of the intergenic region required for expression of viral genes) while RTBV DNA cloned as a partial dimer with repeated intergenic regions was infectious to rice (Dasgupta et al., 1991). The genome of Sugarcane bacilliform MO virus (SCBMOV) cloned in the same way was shown to be infectious on both rice and banana (Bouhida et al., 1993). More recently, an infectious clone of BSMYV was prepared by Bjartan (2012) using the same strategy and successfully infected banana.

1.2.1 Inoculation of infectious clones A range of different methods have been used to deliver infectious clones into intact plant cells. So far, the most common method in use is Agrobacterium harbouring binary constructs with cloned virus genomes which can be inoculated by several methods (Table 1.3). These include (i) rubbing, (ii) stabbing using a toothpick, (iii) needle pricking, (iv) injecting into different tissues of the test plant and (v) syringe or vacuum infiltration. Other mechanical inoculation methods include biolistics, where infectious clone DNA or infectious clone RNA is precipitated onto tungsten or gold particles before it is bombarded into the host plant (Schaffer et al., 1995), and electroporation, where a mixture of the recombinant nucleic acid and plant cells is exposed to high voltage pulse (Van Wert and Saunders, 1992). The choice of inoculation method used is determined by the type of IC to be inoculated, the plant species and nature of the viral genome.

Agrobacterium harbouring cloned genomes of viruses such as TMV, Potato virus X (PVX), Tomato mottle virus (TMoV), and CaMV have been inoculated into test plants by either syringe or vacuum-infiltration, or by rubbing or spraying seedlings with Agrobacterium (Dawson et al., 1986; Gilbertson et al., 1993; Lebeurier et al., 1980). BMV was inoculated by first dusting the leaf surface with carborundum powder followed rubbing the leaf with in vitro transcripts (Ahlquist et al., 1984). In the case of the BSMYV-infectious clone, infectivity in Cavendish banana was tested using three inoculation methods, namely corm injection, leaf infiltration and needle pricking. Results from this study showed that of the three methods used, corm injection was the most effective with a 100% infection rate (Bjartan, 2012).

1.3 Viral vectors for gene expression

Plant virus-based vectors have been used as a tool to assist in the genetic improvement of crops, speed up sexual crosses by expressing genes that will break dormancy where there are delays in flowering and fruiting, and have offered an effective complement to traditional transformation methods. They have also provided a rapid means to test genes using transient viral vector expression systems (Böhlenius et al., 2006; Dawson and Folimonova, 2013). The first demonstration of plant virus-based expression vectors was by TMV which was modified to express a bacterial chloramphenicol acetyl transferase (CAT) gene in tobacco upon inoculation (Takamatsu et al., 1987). Since then, considerable progress has been achieved and many lessons learnt. Building an effective viral vector for heterologous gene expression is influenced by the structure as well as replication and expression strategies of the virus genome. Continuous improvement has led to moving from first generation vectors of “add-a-gene”, where foreign genes are expressed in addition to the complete genome of the wild-type virus (full virus strategy), to second generation vectors (deconstructed virus) where only the viral elements required for efficient expression of the sequence of interest are maintained, while eliminating functions that are either limiting (e.g too host plant specific) or undesired (e.g the ability to create functional infectious viral particles) (Dawson and Folimonova, 2013; Gleba et al., 2004; 2007; 2004; Nagyová and Subr, 2007). General limitations of first generation vectors include i) a limit on the size of inserts to less than 1 Kb; (ii) systemic infection could be limited to specific tissues depending on the virus/host system; and (iii) modified viruses were often unstable due to homologous recombination that led to deletion of the inserted sequences.

Table 1.3 Infectious clones of different RNA and DNA viruses

Type of virus Family Genus Virus spp. Reference Inoculation method Host genome Tobacco mosaic Agrobacterium (Syringe or vacuum Tobacco (Nicotiana RNA Virgaviridae Tobamovirus Dawson et al., 1986 virus infiltration of leaf) tabacum) Agrobacterium (Leaf surface dusted Bromoviridae Bromovirus Brome mosaic virus Ahlquist et al., 1984 Barley (Hordeum vulgare L.) with carborundum powder) African cassava ssDNA Geminiviridae Begomovirus Stanley, 1983 Agrobacterium N. benthamiana mosaic virus Tomato golden Hamilton et al., 1983; Begomovirus Agrobacterium N. benthamiana mosaic virus Hayes et al., 1988 Tomato (Solanum Begomovirus Tomato mottle virus Gibertoson, 1993 Agrobacterium (Rub leaf surface) lycopersicum) Cauliflower mosaic Howell et al., 1980; dsDNA Caulimoviridae Caulimovirus Agrobacterium (Rub leaf surface) Turnip (Brassica rapa) virus Lebeurier et al., 1980 Tungrovirus Rice tungro virus Dasgupta et al., 1991 Agrobacterium Rice (Oryza sativa) Sugarcane Rice (Oryza sativa) and Badnavirus Bouhida et al., 1993 Agrobacterium baciliform virus Banana (M. acuminata) Commelina yellow Climbing Dayflower Badnavirus Medberry et al., 1990 Agrobacterium mottle virus (Commelina diffusa) Banana streak MY Badnavirus Bjartan, 2012 Agrobacterium (Corm injection) Banana (M. acuminata) virus

Second generation vectors have improved designs with better replication and movement efficiencies, many with deletions of non-essential viral ORFs to reduce constraints due to maximum genome size. These vectors are often able to transiently express foreign gene sequences throughout the whole plant (Gleba et al., 2007; Mallory et al., 2002; Toth et al., 2002).

Modified viral vectors are often initially tested using reporter genes prior to inserting/expressing other genes of interest. This allows visualisation of gene expression to assess the effects of modifications. Two widely used reporter genes are β-glucuronidase and green fluorescent protein (GFP) (Hayes et al., 1988; Hayes et al., 1989; Kain et al., 1995). As alluded to previously, several approaches have been applied in the construction/modification of viral vectors including (i) gene addition, (ii) gene replacement, (iii) deletion of non-essential ORFs, and (iv) use of heterologous promoters. i) Gene addition and optimising insert location In this approach, an additional coding sequence is inserted into various positions in a complete virus genome to identify sites that will result in expression of the heterologous sequence. For example, early TMV vectors were modified by inserting the CAT gene, under the control of a duplicated TMV sub-genomic promoter sequence, at two positions to assess/compare expression levels. In one construct, the CAT gene was inserted between the gene encoding the TMV 30K protein and the CP gene of the TMV viral subgenomic RNA (CAT-CP), while a second construct had the CAT gene inserted between CP and the 3’ untranslated region (UTR) of the virus (CP-CAT). The first construct replicated at levels comparable to wild-type TMV but the inserted gene sequence was deleted because of homologous recombination between the duplicated promoter sequences. The second construct maintained the inserted gene but did not replicate well compared with wild type TMV, resulting in low levels of CAT expression (Dawson et al., 1989). ii) Gene replacement/substitution To reduce the possible detrimental effects of increased genomic size changes that might occur upon addition of foreign genes, the replacement of nonessential viral genes with the gene of interest was examined. The first successful attempts involved the replacement of genes encoding the viral coat protein or genes with products associated with insect transmission. For example, the genomes of both TMV and BMV RNA3 were modified by replacing the CP-encoding

gene with sequences encoding CAT (Dawson et al., 1989). Since the presence of the CP was essential for virus movement, these viral vectors lost the ability for both cell-to-cell and systemic infection. In contrast, CP exchange in geminiviruses containing a bipartite DNA genome, such as ACMV and TGMV, did not affect virus movement although there were constraints on the size of the DNA that could be inserted (Hayes et al., 1989; Stanley, 1983). When the insect transmission gene of CaMV (ORFII) was substituted with a bacterial dihydrofolate reductase (DHFR) gene (240bp), this virus vector was able to replicate, spread and express the gene which conferred resistance against methotrexate in E.coli (Brisson et al., 1984). Later it was demonstrated that the CaMV insect transmission gene could also be successfully replaced with the ~500 bp human interferon Alpha D IFN gene (De Zoeten et al., 1989) as well as a ~200 bp Chinese hamster metallothionine (CHMT II) gene (Lefebvre, 1990). The maximum reported size of a gene successfully cloned into the CaMV genome is the ~1000 bp neomycin phosphotransferase- encoding gene (Fütterer et al., 1990). iii) Deletion of non-essential ORFS Further improvements on managing the effects of increased genome size due to addition of foreign genes were made by deleting non-essential genes while maintaining genes associated with replication and movement. RTBV has been modified as an expression vector by deleting ORF 1 and 2 which have been demonstrated to be dispensable for infection (Purkayastha et al., 2010). iv) Heterologous promoter Progressive improvement of vector construction has focused on increasing expression by inserting additional promoter sequences upstream of the gene of interest. In constructing TMV vectors, the CAT gene was placed upstream the subgenomic RNA of CP promoter (CAT- CP) or after (CP-CAT) the coat protein downstream of the promoter. Expression levels from the inserted gene were higher when additional sub-genomic promoter sequences were fused upstream the gene of interest as compared to when inserted downstream of the CP. As explained elsewhere, the presence of repeated sequences can lead to homologous recombination resulting in the deletion of inserted sequences (Dawson et al., 1989). Donson et al., (1991) constructed a hybrid TMV RNA vector with sequences from TMV-U1 and Odontoglossum ringspot virus (ORSV). The use of a heterologous subgenomic RNA promoter from ORSV to control the expression of the foreign ORF in the TMV vector resulted in systemic and stable movement of the foreign gene into non-inoculated leaves with no

deletion of the insert. Since then, constitutive and/or high level expressing promoters have been used in various viral gene expression systems (Nagyová and Subr, 2007; Purkayastha et al., 2010)

1.4 DNA viruses as vectors for expression

DNA viruses are generally more easily manipulated in vitro and, unlike many RNA viruses which require the generation of in vitro transcripts for plant inoculation, can be inoculated directly from cloned DNA either mechanically or using Agrobacterium. Although single-stranded DNA viruses from the Geminiviridae have been used as expression vectors, their genome organisation has limited their exploitation as vectors. They have proved very difficult to successfully regenerate plants with integrated replication-competent geminiviral genomes. Secondly, their delivery and spread into most plants for transient expression has not been effectively achieved, although in some cases mastreviral vectors have been successful as vectors for transient expression (Gutierrez et al., 2004; Hanley-Bowdoin et al., 2004; Palmer and Rybicki, 2001; Rybicki and Martin, 2014). Although infectious clones have been developed for several dsDNA viruses, very few viruses have been modified into expression vectors. CaMV was the first dsDNA virus-based vector to express foreign genes in plants (Howell, 1983). The first foreign sequence (an 8 bp EcoRI linker) was successfully inserted at the intergenic region between open reading frames VI and I while in later studies, a ~1000 bp fragment encoding the neomycin phosphotransferase gene was successfully expressed (Fütterer et al., 1990; Gronenborn et al., 1981; Howell, 1983).

The only bacilliform dsDNA virus constructed as an expression vector so far is RTBV. An infectious clone of RTBV was modified as an expression vector by deleting ORFs 1 and 2. Additional modifications replaced the native RTBV tissue-specific viral promoter with the constitutive maize ubiquitin promoter to allow expression in all plant tissues. Other sequences such as the tRNA-binding site to allow reverse transcription during replication and those that were necessary for optimal translation initiation of the viral genes were also added (Purkayastha et al., 2010). Despite the many successes achieved in this area, there are still challenges and limitations in constructing vectors from plant viruses. A thorough understanding and knowledge of virus genome replication and gene expression is an essential pre-requisite to vector development. Due to genome size limits, some viruses may become non-functional if additional

gene sequences are included. Further, an ideal viral vector for the expression of foreign sequences would give mild symptoms, or no symptoms, so as not to mask the phenotype of the foreign sequences expressed. In most cases virus vectors display symptoms like the native virus (Dawson et al., 1986; Dawson et al., 1988; Purkayastha et al., 2010; Scholthof et al., 1996). As such, research into the effects of gene deletion on the infectivity and symptom development on modified viral vectors is needed.

1.5 Aims and Objectives

The most desirable approach to control plant viral diseases is by circumvention of the viruses themselves either through physical separation of the pathogen and host, or the deployment of genetic resistance in the host to prevent or limit the extent of infection. Deployment of resistant plants targeted against viruses would be the best approach. However, there are no published reports of banana genotypes that are resistant to BSV. Tolerant varieties have been reported, on the basis of not being significantly affected in terms of their growth characteristics in the presence of the virus, despite the fact that some express symptoms and have a high virus titre (Dahal et al., 2000). Screening of banana genotypes for resistance to BSV has only used natural spread by mealybug vectors, which transmit BSVs in a semi-persistent manner. The capacity of mealybugs to transmit BSV decreases exponentially over time (Ng and Falk, 2006; Ravichandra, 2013). Therefore, this mode of transmission may be unreliable when screening germplasm for resistance. The development of infectious clones has made it easier to screen a vast number of plants within a very brief period in a controlled manner. The BSMYV-IC developed by Bjartan (2012), when inoculated in cultivar Dwarf Cavendish via Agrobacterium took approximately 5 weeks for symptoms to develop and resulted in 100% transmission. The method is extremely easy since it just requires the inoculum, needle and syringe to inject the plants for infection.

This study therefore aimed at using the previously reported BSMYV infectious clone to evaluate its reaction in a diverse collection of wild and cultivated banana genotypes under glasshouse conditions. Specifically, the research assessed the effectiveness of infection by the infectious clone across different banana genotypes, the accumulation of viral DNA within the genotypes over a period and the expression of BSV symptoms by different genotypes. The study further explored the mechanism of resistance in those genotypes that did not express any visible BSV symptoms with no episomal infection of the virus after being inoculated with the infectious

clone. Finally, to explore whether the infectious clone could be modified and be used as a vector for heterologous gene expression in bananas, deletion and insertion mutants were developed from the BSMYV-IC and were tested for both infectivity and expression in Cavendish bananas.

2CHAPTER 2: GENERAL METHODS AND MATERIALS

2.1 Introduction

This chapter outlines the general methods and materials used in this study. The first section describes general solutions used in plant tissue culture, nucleic acid extraction and amplification, cloning and sequencing. Detailed lists of Musa genotypes and BSMYV infectious clone (IC) vectors are also provided. The second section details general methods applied to achieve the aims of the study. However, specialised methods and protocols used to achieve specific objectives are provided in their respective Chapters.

2.2 General materials

2.2.1 Banana genotypes Twenty-four banana genotypes with a diverse range of genome compositions were used in this study (Table 2.1). Twenty of the Musa genotypes were provided as tissue culture (TC) accessions by Dr. Sharon Hamill of the Maroochy Research Station, Department of Agriculture, Forestry and Fisheries (DAFF). The remaining four accessions were provided by QUT.

2.2.2 Bacterial strains Heat-shock competent Escherichia coli (E. coli) strain XL1-blue cells and electro-competent Agrobacterium tumefaciens (A. tumefaciens) strain AGL1 cells were used in this study. E.coli was used for general plasmid cloning experiments, while A. tumefaciens was used for infectivity testing of banana using the IC constructs. Both strains were supplied by the Centre for Tropical Crops and Biocommodities (CTCB).

2.2.3 Infectious clones The Banana streak MY virus infectious clone (BSMYV-IC) previously generated at the CTCB (Bjartan, 2012) was used for screening of banana genotypes. In addition, a collection of deletion mutants and expression constructs prepared using wild-type BSMYV-IC were also provided by CTCB (Table 2.2).

Table 2.1 Banana genotypes that were used in this study

Accession name Genome type Source Calcutta 4 (Ma1 ssp. burmannica) AA DEEDI (1642)

Khae Phrae (Ma ssp. siamea) AA DEEDI (838)

Ma. ssp. banksii AA DEEDI (286)

Ma. ssp. zebrina AA DEEDI (1743)

Pahang (Ma ssp. malaccensis) AA DEEDI (1649)

Pisang Bangkahulu (Ma ssp. zebrina) AA DEEDI (817)

Truncata (Ma ssp. microcarpa) AA DEEDI (427)

Akondro Mainty AA DEEDI (1299)

Paka AA DEEDI (1776)

Pisang Madu AA DEEDI (926)

Ma. ssp. malaccensis (Mal-R)2 AA QUT

Ma. ssp. malaccensis (Mal-S)3 AA QUT

Gros Michel AAA DEEDI (1574)

Cavendish (cultivar Williams) AAA DEEDI (1645)

Cavendish (cultivar Dwarf Cavendish) AAA QUT

Ney Poovan AB (or AAB) DEEDI (1775)

Pacific Plantain AAB DEEDI (1669)

Yesing AAB DEEDI (1421)

Lady Finger AAB QUT

Saba ABB DEEDI (1042)

Pisang Gajih Merah ABB (or BBB) DEEDI (1779)

Butuhan (M. balbisiana) BB DEEDI (457)

M. balbisiana BB DEEDI (1740)

Asupina AT4 DEEDI (1264)

1Ma = Musa acuminata 2Mal-R = Fusarium oxysporum f.sp. cubense (FOC) resistant Ma ssp. malaccensis accession 3Mal-S = FOC susceptible Ma. ssp. malaccensis accession 4T = Musa troglodytarum

Table 2.2 BSMYV-IC deletion mutants for infectivity tests

Construct name Abbreviation Purpose Native Banana streak MY virus IC BSMYV-IC Control vector Null mutant with cloning site BSMYV-ICΔ0 ORF 1 deletion mutant BSMYV-ICΔ1 ORF 2 deletion mutant BSMYV-ICΔ2 Test for infectivity ORF 1&2 deletion mutant BSMYV-ICΔ1/2 ORF 1 deletion mutant with GFP ORF BSMYV-ICΔ1-GFP ORF 2 deletion mutant with GFP ORF BSMYV-ICΔ2-GFP ORF 1&2 deletion mutant with GFP ORF BSMYV-ICΔ1/2-GFP Test for expression of GFP Null mutant with GFP ORF BSMYV-ICΔ0-GFP Native BSMYV-IC with 3` GFP ORF BSMYV-3`GFP Null mutant with 50 nt of GFP BSMYV-ICΔ0-50nt-GFP Test for silencing of GFP Null mutant with 110 nt of GFP BSMYV-ICΔ0-110nt-GFP

2.3 General solutions

2.3.1 Nucleic acid extraction buffers

CHCl3-IAA: A 24:1 mixture of chloroform and isoamyl-alcohol, respectively.

CTAB buffer: 0.1 M Tris-HCl (pH 8.0), 1.4 M NaCl, 0.02 M EDTA, 2% CTAB and 2% PVP.

TE: Tris-EDTA buffer comprised of 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA.

2.3.2 Alkali lysis solutions Solution 1: GTE buffer (25 mM Tris-HCl, 10 mM EDTA, 50 mM glucose)

Combine 2.5 ml of 1 M Tris-HCl pH 8.0, 2 ml of 0.5 M EDTA pH 8.0 and 0.9 g of glucose in a final volume of 100 ml of double distilled water (ddH2O). Autoclave at 121°C for 15 min.

Solution 2: Lysis buffer (0.2 M NaOH, 1% SDS).

Prepare two stock solutions – 1 M NaOH and 5% SDS. Combine NaOH, SDS and ddH2O in a 1:1:3 ratio, respectively. Prepare fresh each time it is used.

Solution 3: Neutralisation solution

For 100 ml combine 60 ml of 5 M potassium acetate, 11.5 ml of glacial acetic acid and 28.5 ml ddH2O pH 7.5.

2.3.3 Bacterial growth media and antibiotics LB liquid media: 1% (w/v) bacto-tryptone, 0.5% (w/v) bacto-yeast extract, 170 mM NaCl (pH

7.0). For 1 L, combine 10 g of tryptone, 5 g of yeast extract and 10 g NaCl in ddH2O and adjust the pH to 7.0. Autoclave at 121°C for 15 min.

LB solid agar media: Liquid LB media prepare as above, with 1.5% bacto-agar added. Autoclave at 121°C for 15 min.

Ampicillin: Prepare a 100 mg/ml solution in ddH2O, filter sterilise and store at -20°C.

X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside): Prepare a 20 mg/ml solution in dimethylformamide.

IPTG (Isopropyl-β-D-thioglactopyranoside): Prepare a solution by dissolving 0.2 g in 1 ml water, filter sterilise and store at -20°C.

Kanamycin (100 mg/ml): Dissolve 1 g of kanamycin in 10 ml of ddH2O, filter sterilise and store at -20°C.

Rifampicin (25 mg/ml): Dissolve 25 mg of rifampicin in 1 ml of dimethyl sulfoxide (DMSO), filter sterilise and store at -20°C.

2.3.4 Gel electrophoresis Agarose gels: unless otherwise stated gel electrophoresis analysis was done in a 1.5% (w/v) agarose gel (1.5 g agarose dissolved in 100 ml of TAE containing 0.025% (v/v) SYBR Safe-DNA gel stain (Thermo-Fisher Scientific)).

Agarose gel loading dye (6x): 0.25 % (w/v) bromophenol blue dissolved in Tris-EDTA/glycerol (1:1).

TAE Buffer (10x): Tris-acetate-EDTA buffer was prepared using 48.4 g Tris-base, 11.4 ml glacial acetic acid and 3.7 g of EDTA- dissolved in ddH2O in a final volume of 1 L. Adjust pH to 8.3.

2.3.5 Tissue culture media Murashige and Skoog basal salt mixture (MS) stock solutions: In 1 L add 50 ml of 10x macronutrients (MS 1), 10 ml of 100x of micronutrients (MS 2), 10 ml of 100x Fe-EDTA and 1 ml of 100x of Morel and Wetmore vitamin stock (Morel and Wetmore 1951; Table 2.3); see recipes of stock solutions below.

Macronutrients (MS stock 1, 10x): For 1 L of a 10x stock solution add 16.5 grams of ammonium nitrate (NH4NO3), 19 g of potassium nitrate (KNO3), 4.4 g of calcium chloride

(CaCl22H2O), 3.7 g hydrated magnesium sulphate (MgSO47H2O) and 1.7 g of potassium hydrogen phosphate (KH2PO4).

Micronutrients (MS stock 2, 100x): For 1 L of a 100x stock solution add 1.69 g of manganese sulphate (MnSO4H2O), 0.86 g of hydrated zinc sulphate (ZnSO47H2O), 0.62 g of perboric acid (H3BO4), 830 µl of a 10% solution (in water) of potassium iodide (KI), 250 µl of a 10% solution (in water) of sodium molybdite (NaMoO42H2O), 0.025 g of copper (II) sulphate

(CuSO45H2O) and 0.025 g of hydrated cobalt (II) chloride (CoCl26H2O).

Fe-EDTA (100x): For 1 L add 3.7 g of di-sodium ethylene diamine-tetra-acetic acid

(Na2EDTA2H2O) and 2.784 g of hydrated iron (II) sulphate (FeSO47H2O).

2.4 General methods

General molecular experiments were performed based on published protocols and procedures (Sambrook and Russell, 2001) as well as according to manufacturer’s instructions specified in relevant sections. A detailed description is provided in specific chapters and sections where significant alterations were made from existing published protocols.

2.4.1 Tissue culture of banana genotypes Banana plants were cultured and maintained in tissue culture using established Centre for Tropical Crops and Biocommodities (CTCB) laboratory protocols described below.

2.4.1.2 Shoot multiplication Multiplication medium was prepared as described in Table 2.4. Shoots of different genotypes were split to induce multiplication and placed in the medium. After seven days in multiplication medium, the explants were transferred to fresh medium after the outer darkened leaves and shoot base were trimmed away to expose new side shoots. After 2-3 weeks, the emerging shoots were carefully separated with a scalpel and transferred again to fresh medium. Sub-culturing was then done at an interval of 3 weeks. Mature shoots were picked at each sub-culturing and placed into root induction medium.

Table 2.3 Recipe for Morel and Wetmore vitamin stock solution (100x)

Ingredients Milligrams/10 ml

Myo-inositol 100

Nicotinic acid (free acid) 1

Pyridoxine HCl 1

Thiamine HCl 1

Ca Pantothenate 1

Biotin 0.1

2.4.1.3 Root Induction Mature shoots were carefully transferred into root induction medium which was prepared as described in in Table 2.5. Plants were then grown for 6-7 weeks at 25°C until roots had fully developed.

2.4.1.4 Acclimatisation of genotypes Tissue-culture banana plants were deflasked and washed free of medium then potted into “Premium potting mix” (Searles) in 50 mm seedling tubes. Tubes were then placed in 22 L plastic trays (People in Plastic) and covered with clear plastic film to maintain high humidity. After 4-6 weeks, plants were transferred into 150 mm pots containing “Premium potting mix” (Searles) with 1 g/L “Osmocote Plus” slow release complete nutrient fertiliser (Scotts Australia Pty Ltd). Plants were allowed to grow to approximately 30 cm high before inoculating.

2.4.2 Inoculation of banana genotypes 2.4.2.1 Preparation of A. tumefaciens inoculum A. tumefaciens strain AGL1 was used for all plant inoculations. Cells containing the required BSMYV-IC construct were cultured for 72 h at 28°C with shaking at 200 rpm in LB media supplemented with Rifampicin (25 mg/L) and Kanamycin (50 mg/L). The cultures were centrifuged at 5,000 x ɡ for 15 min and the bacterial pellet resuspended in MMA-solution

(10 mM MES (containing 2-N-morpholino-ethane-sulphonic acid), 10 mM MgCl2 and 200 μM acetosyringone), with the O.D. adjusted to an A600 of 0.5. The AGL1 suspension was then incubated at room temperature with shaking at 200 rpm for 2 h.

Table 2.4 Recipe for multiplication media

Ingredients To prepare 1 L

10x MS stock 1 100 ml

100x MS stock 2 10 ml

100x Fe-EDTA stock 10 ml

100x Morel and Wetmore vitamin stock 1 ml

6-benzylaminopurine (BAP) (1 mg/ml) 2.5 ml

Sucrose 30 g pH 5.8 adjust using either KOH or HCl

Agar 2 g

Table 2.5 Recipe for plant rooting media

Ingredients To prepare 1 L

10x MS stock 1 100 ml

100x MS stock 2 10 ml

100x Fe-EDTA stock 10 ml

100x Morel and Wetmore vitamin stock 1 ml

Sucrose 30 g pH 5.8 adjust using either KOH or HCl

Agar 3 g

2.4.2.2 Injecting bananas with agro-inoculum Banana plants were inoculated with recombinant A. tumefaciens containing BSMYV-IC constructs in either the PC2 growth room facility at QUT Gardens Point campus or the PC2 Planthouse facility at QUT Carseldine. Acclimatised plants were placed into plastic trays prior to inoculation to ensure that any A. tumefaciens not remaining on the plants following inoculation would be retained for appropriate destruction. A. tumefaciens inoculum (1 ml) with O.D. adjusted to an A600 of 0.5 was injected into the pseudostem of each banana plant using a needle size 19Gx1.5’ and a 10ml syringe.

2.4.3 Symptom assessment Symptom severity was assessed on all leaves of inoculated and control plants from each genotype. The severity was scored on a scale of 0 to 3 as described by Dahal et al. (1998), which bases the assessment on the area of the leaf showing the typical streak symptoms associated with BSMYV infection. A score of zero indicates no visible symptoms; a score of 1 indicates very few streaks or chlorotic flecks on the leaf lamina (<10% of the lamina affected); a score of 2 indicates streaks or chlorotic flecks covering a moderate portion of the lamina (> 10% to < 50%); and a score of 3 indicates that most of the leaf lamina was covered with streaks or chlorotic flecks (>50% of the leaf area) (Figure 2.1). Scoring was carried out beginning with the first leaf that expressed symptoms when it was fully developed until each experiment was terminated. A symptom severity index (SSI) was calculated from the severity score of individual leaves as SS= (0[a] +1[b] +2[c] +3[d])/n where a, b, c, and d were the number of leaves with scores 0, 1, 2, or 3 while n equalled the number of leaves observed. The mean SSI value of all plants within a genotype was used as the average symptom severity index (ASSI).

Figure 2.1 Scoring system for BSV symptom severity index (SSI). (A) Leaf with no BSV symptoms (score = 0); (B) leaf with 10% BSV symptoms (score = 1); (C) leaf with >10% but <50% BSV symptoms (score = 2); (D) leaf with > 50% BSV symptoms (score = 3).

2.4.4 Isolation of nucleic acids from plant leaf tissue The CTAB-based method described by James et al., (2011) was used to extract genomic DNA from leaf tissue. Approximately 0.4 g of fresh leaf discs in 2 ml tubes containing lead beads was frozen in liquid nitrogen before ground into fine powder using a TissueLyser (QIAGEN®) at 30 Hz for 1 min. To the ground leaf tissue, 1 ml CTAB extraction buffer was added, and the homogenate was incubated at 65°C for 30 min in a water bath with the tubes gently inverted several times every 10 min. The homogenate was centrifuged at 18,000 x ɡ for 5 min. Supernatant (750 µl) was extracted with an equal volume of chloroform-isoamyl alcohol

(CHCl3-IAA) solution (24:1 v/v). The phases were vortexed thoroughly and the tubes centrifuged at 18,000 x ɡ for 5 min. Supernatant (600 µl) was removed and extracted a second time with an equal volume of CHCl3-IAA and centrifuged as before. The supernatant (450 µl) was again removed and nucleic acids (NA) precipitated by adding an equal volume of 100% isopropanol and incubating for 10 min at RT. Total NA was collected by centrifugation at 18,000 x ɡ for 5 min, and pellets washed using 500 µl of 70% ethanol followed by centrifugation at 18,000 x ɡ for 1 min. Pellets were air dried and resuspended in 50 µl of ddH2O at 4°C overnight. Where indicated, NA extracts were analysed using the NanoDrop 2000 (Thermo Fisher Scientific) spectrophotometer, or fluorometrically using the QuantiFluor™ dsDNA system (Promega-E2670).

2.4.5 Nucleic acid amplification, cloning and sequencing 2.4.5.1 Oligonucleotides Oligonucleotides were designed using Vector NTI suite v10 (Invitrogen) based on published nucleotide sequences unless otherwise stated in the specific results chapter and purchased from GeneWorks Pty Ltd. Stock solutions were reconstituted using nuclease-free water to 200 µM which were further diluted to a working concentration of 10 µM. For a list of the primer sequences used in this study see Table 2.6.

Table 2.6 PCR primers used in this study

Primer name Sequence Size of amplicon (and purpose) INT-F GCCGATCGCAAGGAAGCGTGAAGAGGACCC 1030 bp (amplification of BSMYV intergenic region) INT-R GCTTAATTAAGCGATCGCAATTAGCTTTGGTTCAAGGTTTAAG ORF2- GCTTAATTAACCTGCAGGATGAGTCTAGCCAACACCAAGGC 960 bp (amplification of BSMYV ORF2 and partial BstXI-R GCCCACTTCCATGGCTGATATGATAGACC ORF3) MY-ORF1-F GCGCGATCGCCTGGATACTTACTGGGATAA 551 bp (amplification of BSMYV ORF1) MY-ORF1-R GCCCTGCAGGTCATCCAATAATAACTTTCTC MY-ORF2-F GCGCGATCGCATGAGTCTAGCCAACACCAAG 419 bp (amplification of BSMYV ORF1) MY-ORF2-R GCCCTGCAGGTCATTGTAGGGATCTTAGAAT 18S-F CATCACAGGATTTCGGTCCT 500 bp (amplification of banana 18S gene to test 18S-R AGACAAATCGCTCCACCAAC quality of DNA) Mys-F TAAAAGCACAGCTCAGAACAAACC 589 bp (for detection of BSMYV) Mys-R CTCCGTGATTTCTTCGTGGTC BSMYVqPCR-F TATGGCTTTCATGGGGTAATTC 205 bp (to quantify BSMYV) BSMYVqPCR-R CTTCTCATCGCCTCTTTCCTAA GFP-F GCAGAAGAACGGCATCAAGG 50 bp (detection of GFP fragment in IC) GFP-R TCCTCGATGTTGTGGCGG AGL1-F GCCTTAAAATCATTTGTAGCGACTTCG 738 bp (for detection of AGL1 ) AGL1-R TCATCGCTAGCTCAAACCTGCTTCTG

2.4.5.2 Polymerase chain reaction All PCRs used the GoTaq® Green PCR Master Mix system (Promega) in which the reaction mix comprised of the supplied PCR master premix (Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers), 10 ρmol of each primer, TNA template and nuclease-free water to a final volume of 20 µl. The reaction mixes were subjected to initial denaturation at 94°C for 2 min followed by 35 cycles at 94°C for 20s, annealing at various temperatures for 30s and extension at 72°C for 1 min per Kb, followed by a final extension step at 72°C for 2 min.

2.4.5.3 Rolling circle amplification (RCA) RCA was carried out using the Illustra TempliPhi 100 Amplification kit (GE Healthcare), according to the manufacturer’s instructions but with slight modifications as described by James et al. (2011). TNA extract (1 µl) was mixed with 3 µl of kit sample buffer and 1 µl of a 5 µM stock solution (approximately 4.16 ρmol/µl of each primer) of degenerate primers. The mixture was denatured at 95°C for 3 min and cooled on ice for another 3 min, and subsequently kit reaction buffer (5 µ) and polymerase (0.2 µl) was added. The mixture was incubated at 30°C for 18 h and then 65°C for 10 min. To diagnose the presence of BSMYV in RCA products, amplified DNA was digested using 2 units of the restriction enzyme StuI, which cuts BSMYV DNA at a single site, and products were visualised on a 1% agarose gel. The presence of a distinct band at approximately 7.5 Kb is diagnostic for the presence of full- length BSMYV DNA irrespective of the presence of large molecular weight reaction products which can also been seen on agarose gels because of non-target amplification in RCA.

2.4.5.4 Electrophoresis The concentration of agarose gels prepared depended upon the size of the product/s to be analysed and varied from 1% to 1.5% (w/v). Nucleic acids were visualised using 0.25x SYBR® safe (Invitrogen). Samples were electrophoresed at 80 V for 35 min for PCR products and small fragments (<500 bp) or 110 V for 1 h for RCA and mini-prep DNA restriction digest products (fragments >500 bp). Nucleic acids were subsequently visualised on a Safe

ImagerTM blue light trans-illuminator (Invitrogen) using the Syngene Geldoc System (Syngene).

2.4.5.5 Isolation and purification of DNA from agarose gels Fragments of interest were excised from agarose gels using sterile scalpel blades and subsequently purified using either a High Pure PCR Product Purification Kit (Roche) or Quantum Prep® Freeze ‘N Squeeze™ kit (Bio-Rad), following the manufacturer’s instructions.

2.4.5.6 DNA ligation and bacterial transformation Purified DNA was ligated into 50 ng of the T-tailed vector pGEM®-T Easy (Promega) following the manufacturer’s instructions. Escherichia coli strain XLI-Blue was used for all general plasmid cloning. Heat-shock competent E. coli were prepared as described by Sambrook and Russell (2001) and transformed by combining approximately 1 ng of purified plasmid DNA or 10 µl of ligation reaction mixture with 50 µl of competent cells, incubating on ice for 15 min and then at 42°C for 90 s. Cells were then placed into ice for 2 min and subsequently resuspended in 150 µl LB media and incubated at 37°C for 1 h with shaking at 200 rpm. Following resuscitation, cells were spread-plated onto LB agar plates containing the appropriate antibiotics and incubated at 37°C overnight. Liquid cultures were initiated from either a single colony or 50 µl of glycerol stock (when available) and inoculated into 4 ml liquid LB media, containing the appropriate antibiotics, and grown at 37°C for up to 16 h with shaking.

2.4.5.7 Isolation of plasmid DNA from E. coli Plasmid DNA was isolated from approximately 4 ml of overnight culture using either the Wizard® Plus SV Miniprep DNA purification kit (Promega) as per the manufacturer’s instructions or using the protocol described in Sambrook and Russell (2001), described briefly herein. Bacterial cells were pelleted in a microfuge at 18,000 x ɡ for 30 s. Pellets were resuspended in 150 µl GTE buffer (2.3.2) by vortexing. Cells were then lysed by the addition of 150 µl of lysis buffer (solution 2, 2.3.2), followed by gentle inversion. Chromosomal DNA

and proteins were precipitated by adding 150 µl potassium acetate solution followed by 200

µl of CHCl3-IAA solution (24:1) followed by centrifugation at 18,000 x ɡ for 5 min. Supernatant (400 µl) was removed and the DNA precipitated with 900 µl ethanol (100%), before centrifuging at 18,000 x ɡ for 5 min. The DNA pellets were washed in 350 µl ethanol (70% v/v) and centrifuged again at 18,000 x ɡ for 2 min. The pellets were air dried and resuspended in 50 µl ddH2O. The quality/quantity of purified plasmid was analysed by agarose gel electrophoresis and/or spectrophotometry prior to any further analysis.

2.4.5.8 Restriction enzyme DNA digestion Digestion of plasmid DNA was carried out to confirm inserts of the expected size. All digests were carried out in a volume of 10 µl containing 1 µl of 10x restriction buffer (NEB), 1 U of

NotI-HF enzyme, 5 µl of plasmid DNA and 3.5 µl of ddH2O. The mixture was incubated at 37°C for at least 2 h.

2.4.5.9 DNA sequencing Sequencing was performed using either M13 universal primers or gene-specific primers and the BigDye Terminator v3.1 sequencing system (Thermo Fisher Scientific). Reaction mixtures contained 2 µl of purified plasmid DNA, 3.5 µl of 5x sequencing buffer, 1 µl (3.33 ρmol) primer and ddH2O in a reaction volume of 20 µl. Thermal cycling was carried out as follows: denaturation at 95°C for 30s, annealing at 50°C for 20 s and extension at 60°C for 4 min, repeated for 30 cycles. Sequencing reactions were cleaned by precipitation by adding 2 μl of

3 M sodium acetate (pH 5.2) and 2 μl of 125 mM Na2-EDTA (pH 8.0), mixing briefly and then adding 50 μl of 100% ethanol. Samples were incubated at room temperature for 15 min then centrifuged at 18,000 x ɡ before decanting the supernatant and washing the pellet with 250 μl of 70% ethanol. The pellet was dried under vacuum for 10 min and samples were delivered to the QUT Molecular Genetic Research Facility for sequencing using the 3500 Genetic Analyser (Applied Biosystems™).

Sequences were analysed using either the ContigExpress or AlignX packages of the Vector NTI suite v10 (Invitrogen). Further analysis was done by Basic Logical Alignment Search Tool

(BLAST) searches online at the National Centre for Biotechnology Information (NCBI) databases.

2.5 Real time PRC (qPCR)

2.5.1 Preparation of standard curve To prepare recombinant plasmids a standard PCR was done to amplify the respective BSMYV-IC DNA fragments followed by cloning into pGem®-T Easy and sequencing as described previously.

2.5.2 Plasmid DNA quantification by QuantiFluor dsDNA system for standard curves Plasmid DNA quantification was performed using a QuantiFluor™ dsDNA System (Promega- E2670). The system contains a fluorescent double-stranded DNA-binding dye (504 nm Ex/531 nm Em) for sensitive quantitation of double-stranded DNA (dsDNA) as well as 20x TE buffer and 50x Lambda DNA standard for plasmid quantity estimation. In quantification of the plasmid DNA, the dye was thawed on ice while covered with aluminium foil to prevent exposure to light while 20x TE buffer was diluted to 1x using nuclease-free water. The 200x Quantifluor dsDNA dye was also diluted to 1x using TE buffer. The 50x lambda DNA was reconstituted to 1x in TE buffer to give a starting concentration of 2 ng/µl. A two-fold serial dilution of the standard lambda DNA was then prepared in 1x TE buffer. The lambda DNA standard curve and test samples were aliquoted (100 µl) into triplicate wells in a 96 well optiplate, 100 µl of the 1x Quantifluor dsDNA dye was added to each well and the plate covered with aluminium foil to incubate at room temperature for 5 min. The optiplate was then read at 530/540 wavelength using a L550B luminescence spectrometer.

2.5.3 Calculation of plasmid copy number The measurements obtained from the luminescence spectrometer in section 2.4.7.3 were exported to Microsoft Excel and a scatter plot was prepared and fitted with a linear regression trend line displaying linear equation and coefficient of correlation (R2) based on

RFUs (corrected using buffer-only controls) against the lambda DNA standard curve. The linear regression equation was then used to calculate the concentration of the test samples. Plasmid copy number for qPCR was then calculated based on the following formula: Number of copies (copies/μl) = (total mass of plasmid (calculated concentration (g/μl)/ (mass of 1 recombinant plasmid (n*1.096E-21); where n is the total base pairs of the recombinant plasmid and 1.096E-21 is the mass in grams per base pair (g/bp). The plasmid DNA was dispensed in small aliquots sufficient for one serial standard dilution and stored at -20°C until needed for qPCR. General formula:

m = [n] [1.096e-21ɡ/bp] where n = plasmid size (bp), m = mass, e-21= x10-21

2.5.4 Establishment of standard curve Purified plasmid prepared as described above was used to prepare a 10-fold serial dilution from 1.0 × 108 to 1.0 × 101 copies/μl. The resulting cycle threshold values from the reaction (see below) were used to establish a standard curve by plotting the threshold cycle (Ct) on the Y-axis and the natural log of concentration (copies/μl) on the x-axis. Linear regression equation y = m x + b where m is the slope/gradient and b the y intercept and coefficient of correlation (R2) were displayed on the standard curve. Following the optimisation of the plasmid standard curve, qPCR analysis of the unknown samples was carried out using the plasmid standard curve to determine the absolute copy number.

2.5.5 Real-time quantitative PCR All qPCR assays for absolute quantification were carried out on a Rotor-Gene Q series (Corbett Life Science, Qiagen). A reaction volume of 20 μl, containing 10 μl of 2x SYBR® Green 1 real-time PCR master mix (Promega), 1 μl (10 µM) of each forward and reverse qPCR primers, 3 μl nuclease free water and 5 μl (10 ng/µl) of sample DNA was set up. Cycling conditions for all reactions were as follows: 2 min at 50°C then 2 min at 95°C followed by 40 cycles of 15 s at 95°C, 30 s at 60°C, 72°C for 5 s and 82°C for 5 s with the data acquired at 60°C using SYBR® green 1 at wavelength of 510 nm. All experiments used three technical replicates for each biological sample tested. Ct values, slope, PCR efficiency and correlation coefficient (R2) were calculated using the default settings of Rotor-Gene Q Series Software v1.7 while the raw data was imported to Microsoft Excel for further analysis.

3CHAPTER 3: ESTABLISHMENT OF METHODS FOR LARGE SCALE SCREENING OF GENOTYPES UNDER GLASSHOUSE CONDITIONS

3.1 Introduction

Screening of banana genotypes for resistance to BSV has previously been done using mealybug vectors, which transmit BSVs in a semi-persistent manner. Apart from the difficulties associated with rearing insects in the laboratory, one of the problems with this approach is the exponential decrease in the capacity of mealybugs to transmit BSV over time (Ng and Falk, 2006; Ravichandra, 2013). As such, this mode of transmission may be unreliable when screening germplasm for virus resistance. The development of infectious clones has made it easier to inoculate large numbers of plants within a very short period in a controlled manner. The BSMYV-IC developed by Bjartan (2012) was shown to be an efficient and reliable means of infecting banana plants. When inoculated onto cultivar Dwarf Cavendish via agro-inoculation, symptoms developed after approximately 5 weeks and 100% infection was reported. Further, this method is extremely easy, requiring only the inoculum, and a needle and syringe to inject the plants.

Several BSV species are known to have eBSV counterparts integrated in the banana genome especially those with the B-genome component. Under stress such as tissue culture, such sequences are known to be activated resulting in episomal infection. For this reason, it is necessary to test tissue-cultured banana plants for BSV prior to inoculation to confirm the absence of stress-activated episomal BSV infection. The work presented in this chapter was aimed at using the previously reported BSMYV infectious clone to inoculate both Dwarf Cavendish and Lady Finger bananas to evaluate its infectivity in both genotypes before embarking on large-scale screening experiments. In addition, protocols for assessment of symptoms and quantification of viral DNA copy number needed to be established.

Therefore, the specific objectives of this chapter were to: 1. Validate the infectivity of the BSMYV infectious clone in two banana genotypes (AAA and AAB) and establish protocols for assessment of symptom development and quantification of viral DNA;

2. Multiply and screen a large number of genotypes for the presence of episomal BSMYV infection; and 3. Establish qPCR baseline detection levels of BSMYV DNA in the inoculated genotypes.

3.2 Materials and methods

3.2.1 Banana genotypes Two banana genotypes, namely Dwarf Cavendish and Lady Finger, were selected for two pilot experiments to establish protocols for subsequent large-scale screening of genotypes using the BSMYV infectious clone (BSMYV-IC). These two genotypes were later used as controls throughout the infectivity tests.

3.2.2 Tissue culture multiplication and glasshouse acclimatisation Banana plantlets were cultured on multiplication media as described in section 2.4.1.1 with subculturing at four-week intervals until sufficient replicates were generated for glasshouse trials. Plants were then transferred to rooting media as described in section 2.4.1.2 for a further 8-12 weeks until sufficient roots had developed, prior to transport to the glasshouse for acclimatisation as described in section 2.4.2.

3.2.3 BSV inoculation, monitoring and scoring of symptom severity In all the experiments, inoculation was carried out by injecting banana pseudostems with 1 ml of A. tumefaciens (OD600 = 0.5) suspension containing the native BSMYV-IC as described in section 3.4.3. Plants were observed for symptoms and assessed as described in section 2.4.4 for a period of 24 weeks post-inoculation.

3.2.4 Sampling of banana leaf tissue Leaf tissue was collected from all plants before inoculation to screen for the presence of BSMYV prior to inoculation. Samples were then collected from the first leaf to develop symptoms in every inoculated plant and sampling continued until 24 weeks post-inoculation. A one-hole plier punch (6 mm) (Officeworks) was used to collect 10 leaf discs from each side

of the leaf lamina as shown in Figure 3.1 and samples were stored at -80°C until DNA extraction was carried out.

3.2.5 PCR, RCA and real-time qPCR TNA was extracted from samples as described in section 2.4.5.1. A control PCR assay to confirm the quality of TNA extracts was carried out as described in section 2.4.6.2 using 18S- F/R primers (Table 2.6) with an annealing temperature of 55°C. PCR for screening residual A. tumefaciens was carried out as described in section 2.4.6.2 using AGL1-F/R primers (Table 2.6) with an annealing temperature of 64°C. For banana genotypes with an A-only genome component, detection of BSMYV was done by PCR (section 2.4.5.2) using Mys-F/R primers (Table 2.6) with an annealing temperature of 61°C. For genotypes with some B-genome component, RCA was used for BSV detection (section 2.4.5.3). All absolute quantification of viral DNA used 50ng of genomic (gDNA) as template with real-time qPCR carried out as described in section 2.5.

3.3 Results

3.3.1 Pilot Experiments Prior to the commencement of large-scale screening studies, two pilot experiments were carried out to establish the methodology and protocols.

Pilot Experiment 1 The first pilot experiment assessed the infectivity of the native BSMYV-IC in two banana genotypes, namely cultivar Dwarf Cavendish (AAA) and Lady Finger (AAB). Prior to inoculation, TNA was extracted (section 2.4.5.1) from six plants of each genotype. As a nucleic acid extraction control, all extracts were first tested by PCR using primers 18S-F/R designed to amplify a 500 bp fragment of the banana 18S gene. In all samples (including the positive control), an amplicon of the expected size was generated (Fig 3.2A). To avoid the possibility

Figure 3.1 Illustration of tissue sampling from a banana leaf using a one-hole plier punch Size of circle = 6 mm.

Figure 3.2 Pre-screening of Dwarf Cavendish and Lady Finger plants for BSV using PCR or RCA. A) 18S PCR to check the quality of TNA extracts from Dwarf Cavendish (DC) and Lady Finger (LF) plants; B) AGL1-specific PCR to test for the presence of residual Agrobacterium. Samples from left to right are Dwarf Cavendish plants 1 to 5 (DC1-DC5), Lady Finger plants 1 to 5 (LF1-LF5), - = negative control, + = positive control, all plants tested negative; C) PCR testing of five Dwarf Cavendish plants (DC1 - DC5) for BSMYV using Mys-F/R primers; D) testing of five Lady Finger plants (LF1-LF5) for BSMYV using RCA; . +ve = positive control, -ve = negative control), M is EasyLadder I (Bioline) in A, B and C or HyperLadder I (Bioline) in D.

of detecting false positives due to the presence of residual A. tumefaciens, samples were also tested using Agrobacterium AGL1-specific primers VC-F/-R designed to amplify a 738 bp fragment of the Agrobacterium VirC operon. Apart from the positive control, all samples tested negative (Figure 3.2B). The banana genotypes were then screened for BSV using either RCA or PCR. When extracts from the Dwarf Cavendish (AAA) plants were screened by PCR using BSMYV-specific primers Mys-F1/-R1, the expected amplicon of 589 bp was only observed in the positive control (Figure 3.2C). Similarly, when Lady Finger (AAB) plants were screened for BSYMV using RCA, all samples were negative except for the positive control in which the expected ~8 Kb band representing linearised, full-length BSMYV genomic DNA, was observed (Fig 3.2D).

Five plants from each genotype were then agro-inoculated with the native BSMYV-IC prepared (section 2.4.3.1) while one plant of each genotype was maintained as a non- inoculated control. Plants were observed for symptoms for a period of 24 weeks. The first symptoms of BSMYV infection were observed at five weeks post-inoculation on at least one plant of both Dwarf Cavendish and Lady Finger genotypes. Whereas all five inoculated Dwarf Cavendish plants had developed symptoms by week 8, only one inoculated Lady Finger plant showed symptoms at 24 weeks post-inoculation. In both Dwarf Cavendish and Lady Finger, the symptoms ranged from mild streaks (severity score of 1) to severe streaks (severity score of 3) which eventually turned necrotic (Figure 3.3). To confirm the presence/absence of BSMYV in the inoculated plants and to assess the levels of viral DNA, TNA was extracted from selected leaf samples. As described above, the quality of the extracts was initially tested by PCR using 18S-specific primers with an amplicon of the expected size generated in all samples (results not shown). To confirm the presence/absence of BSYMV, leaf samples taken from all five plants 8 weeks post-inoculation were tested using PCR (Dwarf Cavendish) or RCA (Lady Finger) as described previously. An amplicon of the expected size (589 bp) was detected in samples from all five inoculated Dwarf Cavendish plants showing symptoms (Figure 3.4A), while extracts from only two of the five inoculated Lady Finger plants tested positive by RCA (which included the one plant showing symptoms) (Figure 3.4B). All DNA samples were subsequently diluted to 10 ng/µL for qPCR analysis (section 2.4.7.6).

Figure 3.3 Symptoms of BSMYV infection in inoculated Dwarf Cavendish and Lady Finger banana plants. A) Symptoms in Dwarf Cavendish showing leaf (1) with severity score of 1 having broad discontinuous spindle- shaped yellow streaks covering up to 10% of the leaf lamina, leaf (2) with severity score of 2 with yellow streaks covering between 10% and 50 % of the lamina and leaf (3) having greenish-yellow blotchy symptoms covering over 50% of the leaf lamina; and B) symptoms in Lady Finger showing leaf (1) with severity score 1 with broad discontinuous yellow streaks, leaf (2) with severity score of 2 with discontinuous and continuous yellow streaks and leaf (3) with severity score of 3 with discontinuous, coalesced blotchy streaks.

Figure 3.4 Screening of banana plants for BSMYV in pilot experiment 1 at 12 weeks post-inoculation. A) PCR for BSMYV on inoculated Dwarf Cavendish plants at 12 weeks post-inoculation. Samples loaded from left to right are Dwarf Cavendish plants 1 to 5 (DC1-DC5), and B) RCA screening for BSMYV in inoculated Lady Finger plants at 12 weeks post-inoculation. Sample loaded from left to right are Lady Finger plants 1 to 5 (LF1- LF5), +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline) in A and HyperLadder I (Bioline) in B.

Real-time qPCR was then used to quantify the amount of BSMYV DNA present in three of the five inoculated Dwarf Cavendish and Lady Finger plants (which included the one Lady Finger plant showing symptoms) as well as the respective non-inoculated control plants. The samples tested were from the youngest fully expanded leaf at week five post-inoculation in addition to samples taken at week 7, 11, 15, 19 and 24 post-inoculation.

Non-inoculated plants from both Dwarf Cavendish and Lady Finger had viral DNA copy numbers comparable to the non-template control. In all three symptomatic Dwarf Cavendish plants assayed, the viral load was highest at week 11 post-inoculation and varied from approximately 2.10E+05 copies/50 ng gDNA to 5.10E+05 copies/50 ng gDNA. The accumulation of the viral DNA copy number in the three plants fluctuated over the course of the experiment with the viral DNA load decreasing two- to three-fold from its peak by week 24. In the LF plant showing symptoms (LF-3 in Figure 3.5), the highest viral load of approximately 1.85E+5 copies/50 ng gDNA was observed at week 15. Interestingly, while qPCR analyses indicated that one of the inoculated symptomless Lady Finger plants (LF-2) was not infected, the second inoculated but symptomless Lady Finger plant (LF-1) was found to contain relatively low levels of BSMYV which also peaked at week 15 at approximately 8.00E+04 copies/50 ng gDNA (Figure 3.5). As with the three Cavendish plants, the viral load in the two infected Lady Finger plants decreased significantly by week 24. The highest copy number of BSMYV DNA in Dwarf Cavendish was approximately three times higher than the highest in Lady Finger.

Pilot Experiment 2 In the second pilot experiment, 10 plants each of Dwarf Cavendish and Lady Finger were inoculated as described previously and one plant was maintained as a non-inoculated control. Plants were observed for a period of 24 weeks. Similar to the first pilot experiment, the first symptoms of BSMYV infection were observed at five weeks post-inoculation in both Dwarf Cavendish and Lady Finger. By the end of week 8 post-inoculation, all 10 Dwarf Cavendish plants and eight of the 10 Lady Finger plants showed symptoms, the severity of which varied throughout the experiment. Some leaves had mild streaks on the leaf lamina (severity score of 1) while others had more severe streaks (severity score of 3) and this was observed to occur interchangeably as new leaves emerged in both genotypes. Based on

these severity scores, the symptom severity index (SSI) was calculated (section 2.4.4) at week 10 post-inoculation using all leaves to emerge since initial symptoms were observed. Dwarf Cavendish had an ASSI of 2.4 while Lady Finger had an ASSI of 2.19 (Table 3.1). One Dwarf Cavendish subsequently died at week 10.

TNA extracts were again prepared from leaf samples collected at 12 weeks post-inoculation and all tested positive by PCR for the presence of the 18S house-keeping gene and negative for the presence of residual Agrobacterium (results not shown). When TNA extracts were tested for BSMYV, all nine surviving Dwarf Cavendish plants tested by PCR using primers Mys-F1/-R1 tested positive for BSMYV (Figure 3.6A), while screening of the Lady Finger plants using RCA confirmed that 8 of the plants, all with symptoms, were infected (Figure 3.6B). Real-time qPCR was then used to quantify the levels of BSMYV DNA in leaves from the nine-surviving symptomatic Dwarf Cavendish plants as well as the eight symptomatic Lady Finger plants and the non-inoculated controls. The samples tested by qPCR included TNA extracts prepared from the youngest fully expanded leaf collected at weeks 4, 8, 10, 12, 14, 16, 18 and 24 post-inoculation.

In the nine Dwarf Cavendish plants analysed, the viral load was found to increase over the first 10 weeks post-inoculation with a peak observed at week 10 post-inoculation. There was a significant decrease in the viral load from week 10 to 12, with the level of BSMYV DNA then fluctuating continuously until week 24 (Figure 3.7). The highest average viral load for the eight Lady Finger samples analysed was at week 8, although the viral load at week 10 and 14 was not significantly different from that of week 8. There was a significant decrease in viral load from week 10 to 12, followed by significant fluctuations in the amount of viral DNA continuously until week 24 (Figure 3.7). The first peak in viral load observed at week 8 remained the highest throughout the experiment. As in the first pilot experiment, the highest copy number of BSMYV DNA in Dwarf Cavendish was again approximately three times higher than the highest in Lady Finger.

Based on these results, the methods used for inoculation, TNA extraction, assessing symptoms and testing for the presence of BSMYV were considered suitable for use in large scale glasshouse studies

600000

500000

Wk 5 400000 Wk 7

300000 Wk 11 Wk 15 200000 Wk 19 Wk 25

Average viral DNA copy number 100000

0 DC-1 DC-2 DC-3 DC-NI LF-1 LF-2 LF-3 LF-NI

Figure 3.5 Viral DNA quantified from individual leaf samples of three inoculated Dwarf Cavendish and Lady Finger banana plants in pilot experiment 1. Average viral DNA copy number was calculated as the average of the technical replicates of each sample in 50 ng total gDNA. DC-1 to -3 = Dwarf Cavendish plants 1 to 3, LF-1 to -3 = Lady Finger plants 1 to 3, Wk = weeks post-inoculation, NI = non-inoculated plant. Error bars show the standard error of the mean (n = 3 technical replicates).

Table 3.1 Symptom severity scores for Dwarf Cavendish and Lady Finger plants in pilot experiment 2 at week 12 post-inoculation.

Replicate

Genotype 1 2 3 4 5 6 7 8 9 10 ASSI1

Dwarf 2.4 3 3 1.3 3 1.7 3 2 3 - 2.3 Cavendish (±0.22)

Lady 2.19 3 3 3 1.3 0 0 2.6 3 3 3 Finger (±0.40)

1 ASSI is the average symptom severity index.

Figure 3.6 PCR and RCA confirmation of BSMYV infection in pilot experiment 2 at 12 weeks post-inoculation. A) PCR screening of Dwarf Cavendish plants 1 to 9 (DC1-DC9) using Mys-F/R primers; and B) RCA screening of Lady Finger plants 1 to 10 (LF1-LF10), +ve = positive control, -ve = negative control, M is EasyLadder I (Bioline) in A or HyperLadder I (Bioline) in B.

200000 180000 160000 140000 120000 LF 100000 LF-NI 80000 DC 60000 DC-NI 40000

Average viral DNA copy number 20000 0 0 4 8 101214161824

Figure 3.7 Average viral DNA quantified from leaf samples of nine Dwarf Cavendish or eight Lady Finger symptomatic banana plants in pilot experiment 2. Average viral DNA copy number was calculated as the average of the viral DNA copy numbers quantified in 50 ng of gDNA. DC = Dwarf Cavendish, LF = Lady Finger, NI = non-inoculated plant. Error bars show the standard error of the mean (n = 9 for DC or n = 10 for LF).

3.3.2 Screening of additional banana genotypes for the presence of episomal BSMYV infection Following the development and testing of the methodology on two different banana genotypes as described above, an additional 22 banana genotypes (Table 2.1) as well as the two control cultivars Dwarf Cavendish and Lady Finger were selected for larger scale BSMYV infectivity studies. Since all the genotypes to be used in this study were multiplied by tissue culture, it was necessary to test the banana genotypes for episomal infection before inoculation with BSMYV. Therefore, prior to inoculation, all genotypes were indexed for the presence of episomal BSMYV using either PCR or RCA.

TNA extracts were prepared from leaf tissue as described previously and the quality of these extracts was assessed using the 18S gene-specific primers. For each genotype, five individual plants were tested and in all cases amplification of the expected 500 bp product was obtained, including in the positive controls (Figure 3.8A-K). Extracts prepared from the 15 genotypes with no B-genome component were then tested by PCR to test for the presence of BSMYV and all plants tested negative (Figure 3.9A-H). Extracts from the remaining seven genotypes with some B-genome component were then screened for the presence of BSMYV using RCA and again all plants tested negative (Figure 3.10A&B). In all cases, positive controls amplified successfully. Following this initial screening work, all tissue culture derived plants to be used in subsequent infectivity studies (Chapter 4) were free from episomal BSMYV.

3.3.3 Baseline copy number of BSMYV in additional genotypes using qPCR Musa spp. accessions possessing a B-genome are known, generally, to contain integrated sequences of BSMYV DNA. Therefore, prior to the larger scale inoculation of the additional genotypes with BSMYV and subsequent quantification of BSMYV DNA levels in the different genotypes over time, it was necessary to establish the baseline BSMYV DNA levels. TNA extracts from five plants of each genotype prepared as described in 3.3.2 were diluted to 10 ng/μL and subjected to qPCR (section 2.4.7.6). When extracts prepared from the 16 genotypes with no B-genome component were assessed, all had a baseline amplification level ranging from approximately 10 copies to 80 copies/50 ng gDNA (Figure 3.11A). For 12 of the genotypes, the level of BSYMV DNA was comparable to the non-template control

Figure 3.8 PCR screening of TNA extracts from the 22 genotypes selected for glasshouse screening experiments for BSMYV using primers 18S-F/R. A) CA1 to CA5 is Calcutta 4 plant 1 to 5; KH1 to KH5 is Khae Phrae plants 1 to 5; B) BA1 to BA5 is Ma. ssp. banksii plants 1 to 5, ZB1 to ZB5 is Ma. ssp. zebrina plants 1 to 5; C) PH1 to PH5 is Pahang plants 1 to 5, PB1 to PB5 is Pisang Bangkahulu plants 1 to 5; D) TR1 to TR5 is Truncata plants 1 to 5, AK1 to AK5 is Akondro Mainty plants 1-5; E) PA1 to PA5 is Paka plants 1 to 5, PM1 to PM5 is Pisang Madu plants 1 to 5; F) MR1 to MR5 is Mal- R plants 1 to 5, MS1 to MS5 is Mal-S plants 1 to 5; G) GM1 to GM5 is Gros Michel plants 1 to 5, W1 to W5 is Williams plants 1 to 5; H) NP1 to NP5 is Ney Poovan plants 1 to 5, PP1 to PP5 is Pacific Plantain plants 1 to 5; I) YS1 to YS5 is Yesing plants 1 to 5, SB1 to SB5 is Saba plants 1 to 5; J) PG1 to PG5 is Pisang Gajih Merah plants 1 to 5, BT1 to BT5 is Butuhan plants 1 to 5; and K) BB1 to BB5 is M. balbisiana plants 1 to 5, AS1 to AS5 is Asupina plants 1 to 5. +ve = positive control, -ve = negative control, M is EasyLadder I (Bioline).

Figure 3.9 PCR screening of TNA extracts from the 15 genotypes selected for glasshouse screening experiments with no B-genome complement for BSMYV infection using primers Mys-F/R. A) CA1 to CA 5 is Calcutta 4 plants 1 to 5; KH1 to KH5 is Khae Phrae plants 1 to 5; B) BA1 to BA5 is Ma. ssp. banksii plants 1 to 5, ZB1 to ZB5 is Ma. ssp. zebrina plants 1 to 5; C) PH1 to PH5 is Pahang plants 1 to 5, PB1 to PB5 is Pisang Bangkahulu plants 1 to 5; D) TR1 to TR5 is Truncata plants 1 to 5, AK1 to AK5 is Akondro Mainty plants 1-5; E) PA1 to PA5 is Paka plants 1 to 5, PM1 to PM5 is Pisang Madu plants 1 to 5; F) MR1 to MR5 is Mal- R plants 1 to 5, MS1 to MS5 is Mal-S plants 1 to 5; G) GM1 to GM5 is Gros Michel plants 1 to 5, W1 to W5 is Williams plants 1 to 5; H) AS1 to AS5 is Asupina plants 1 to 5. +ve = positive control, -ve = negative control, M is EasyLadder I (Bioline).

Figure 3.10 RCA screening of TNA extracts from the seven genotypes selected for glasshouse screening experiments with some B-genome component for BSMYV infection. A) NP1 to NP 5 is Ney Poovan plants 1 to 5, PP1 to PP5 is Pacific Plantain plants 1 to 5; B) YS1 to YS5 is Yesing plants 1 to 5, SB1 to SB5 is Saba plants 1 to 5; C) PG1 to PG5 is Pisang Gajih Merah plants 1 to 5, BT1 to BT5 is Butuhan plants 1 to 5; D) BB1 to BB5 is M. balbisiana plants 1 to 5. +ve = positive control, -ve = negative control, M is HyperLadder I (Bioline).

160

140

120

100

0 BSMYV DNA copy number in 10 ng of TNA extract in 10 ng of BSMYV DNA copy number DC CA KH BA ZB PH PB TR AK PA PM MR MS GM W AS NTC Genotype

5000 4500 4000 3500 3000 2500 2000 1500 1000 500 BSMYV DNA copy number in 50 ng of gDNA in 50 ng of BSMYV DNA copy number 0 LF NP PP YS SB PG BT BB NTC Genotype

Figure 3.11 Baseline levels of BSMYV DNA determined using qPCR on TNA extracts. A) Genotypes with no B-genome component. DC = Dwarf Cavendish, CA = Calcutta 4, KH = Khae Phrae, BA = Ma. spp. banksii, Ma. ssp. zebrina, PH = Pahang, PB = Pisang Bangkahulu, TR = Truncata, AK = Akondro Mainty, PA = Paka, PM = Pisang Madu, MR = Mal-R, MS = Mal-S, GM = Gros Michel, W = Williams, AS = Asupina; B) Genotypes with some B-genome component. LF = Lady Finger, NP = Ney Poovan, PP = Pacific Plantain, YS = Yesing, SB = Saba, PG = Pisang Gajih Merah, BT = Butuhan, BB = M balbisiana. NTC = no-template control. Error bars show the standard error of the mean (n = 5 in A and B).

(NTC), which had a baseline amplification level of approximately 10 copies per 50 ng of gDNA. Dwarf Cavendish had a baseline level approximately three times the NTC, while Ma. ssp. banksii, Akondro Mainty and Asupina were significantly higher than this with approximately 50 to 80 copies/50 ng gDNA. When the eight genotypes with some B-genome component were assessed, two genotypes, namely Pacific Plantain and Yesing, had levels of BSMYV DNA comparable to the NTC (approximately 50 copies/50 ng gDNA), while Lady Finger, Ney Poovan, M. balbisiana, Butuhan and Saba had relatively similar levels of BSMYV DNA with approximately 400-700 copies/50 ng gDNA. In contrast, Pisang Gajih Merah had significantly higher levels of BSMYV DNA with approximately 3800 copies/50 ng gDNA (Figure 3.11B).

3.4 Discussion

Prior to this study, screening of banana genotypes for resistance to BSV has only used natural transmission by mealybug vectors, which transmit BSVs in a semi-persistent manner. Consequently, the infectivity study conducted in this chapter is the first report of the use of an infectious clone of any BSV species to screen a wide range of cultivated and wild banana accessions. In order to carry out large-scale screening experiments, a number of protocols had to be established and validated. Therefore, two initial pilot studies were undertaken to establish working protocols and gain experience with the banana-BSV pathosystem.

The native BSMYV-IC used in this study had previously been tested for infectivity in only a single banana cultivar, Dwarf Cavendish (AAA) (Bjartan (2012), where a pseudostem agro- injection method resulted in 100% infectivity. In the two pilot experiments described here, cultivar Lady Finger (AAB) was also included in order to assess infectivity in a genotype with some B-genome component. In both pilot experiments, the IC was shown to infect both genotypes and, consistent with observations of Bjartan (2012), symptoms developed after 5 weeks post-inoculation. However, whereas all Dwarf Cavendish plants became infected in both pilot experiments, the infection rate in Lady Finger plants was 40% and 80% in experiments 1 and 2, respectively.

Analysis of symptom severity in the two genotypes in pilot experiment 2 showed that Dwarf Cavendish had a slightly lower ASSI compared with Lady Finger, although the difference was not significant (Table 3.1). The symptom severity, as measured at 12 weeks post-inoculation, varied considerably in both genotypes with scores of 1.3 to 3 in Dwarf Cavendish and scores of 0 to 3 in Lady Finger. Such variation in symptom appearance and severity has been previously reported in both screenhouse and field studies (Lockhart, 1995; Dahal et al., 1998a; 1999, 2000).

When qPCR was used to determine the viral DNA copy number (or viral load) in inoculated plants, there was significant variability within and between the two genotypes over the study period. The maximum viral DNA accumulation for Dwarf Cavendish was seen at weeks 10 to 11 in both pilot experiments. In contrast, for Lady Finger the maximum viral load was seen at 15 weeks in pilot experiment 1 but at 8 to 10 weeks in pilot experiment 2. This inconsistency observed in Lady Finger may be related to differences in plant growth rates between experiments, or may simply be a reflection of the smaller sample size in experiment 1. Interestingly, in both genotypes it appeared that there was an initial maximum or ‘peak’ in the viral load after which there was a significant decrease (Figure 3.5 and 3.7). A similar phenomenon was reported by Dahal et al., (1998b) who observed a decrease in virus titre in a plantain tetraploid hybrid TMPx and a cooking and dessert Agbagba cultivars between seasons when using the triple-antibody sandwich enzyme linked immunosorbent assay (TAS- ELISA) for BSV. In the current study, the highest viral DNA accumulation of BSMYV DNA in Dwarf Cavendish was approximately three times higher than that in Lady Finger in both pilot experiments. This finding is consistent with another study (Dahal et al., 1999) describing variability in BSV titre between different genotypes.

The banana plants used in the pilot infectivity studies described in the present study and those to be used in larger scale infectivity studies described in Chapter 4 were all multiplied in tissue culture. There are several reports of episomal BSV infection resulting from the activation of integrated sequences in the B genomes of some banana accessions during tissue culture propagation (Lheureux et al., 2003; Ndowora et al., 1999). As such, initial virus indexing was needed to confirm the absence of episomal infection in the plant materials, particularly due to the possible activation of integrated sequences present in the B genomes

of some banana accessions. Virus indexing of accessions with A-only genome component by PCR using BSMYV-specific primers revealed all were free of infection. Similarly, testing of accessions with some B-genome component using RCA also showed that all accessions were free from infection. This result supports previous studies where the eBSV counterpart of BSMYV was shown to not be infective (Iskra-Caruana et al., 2010; 2014), even though its presence has been reported in several AAB and ABB banana genotypes (Geering et al., 2005; Stainton et al., 2015; Sharma et al., 2015).

Quantitative PCR is a sensitive technique which can be used for the quantification of a target nucleic acid molecule. Since some of the banana accessions to be infected in this study possess a B genome which may contain eBSMYV sequences, it was necessary to validate the baseline levels of amplification/detection using the qPCR assay before attempting to measure the levels of BSMYV DNA in infected plants. A standard curve was constructed based on a dilution series of purified plasmid DNA as described by Lee et al., (2006). The amount of BSMYV DNA in test samples was then calculated based on this standard curve, which was included in all qPCR runs. Based on these standard curves, the genotypes with no B-genome component were shown to have very low levels of amplification, which were essentially equivalent to background noise as seen in the non-template control samples (Figure 3.11). When TNA extracts from virus-free samples derived from accessions with some B-genome component were assessed by qPCR, Lady Finger, Ney Poovan, Saba, Butuhan and M. balbisiana all had approximately 500 copies of BSMYV DNA in 50 ng gDNA, while the levels of BSMYV DNA in Pisang Gajih Merah were significantly higher than this. Interestingly, both Pacific Plantain (AAB) and Yesing (AAB) had negligible levels of BSMYV DNA detected, similar to A-only genotypes. Whether the increase in the amount of BSMYV DNA in extracts from Pisang Gajih Merah is related to the number of copies of BSMYV integrated into the genome of this accession is unknown, however, these findings are in agreement with earlier reports on the presence of integrated sequences in B-genomes of some banana accessions (Harper et al., 1999; 2002; Geering et al., 2001; Chabannes et al., 2013; Umber et al., 2016).

Integration of BSVs is widespread in banana genotypes. BSMYV, along with Banana streak OL virus (BSOLV), Banana streak GF virus (BSGFV) and Banana streak IM virus (BSIMV) are all

known to have eBSV counterparts in the genomes of some bananas, however compared to the latter three, those of BSMYV are not known to be activatable/infective. The results of this chapter have shown that the BSMYV infectious clone is infective in at least two banana genotypes, with symptom severity and levels of viral DNA highly variable. Based on qPCR, the presence of integrated BSMYV sequences was demonstrated in several bananas with a B-genome component as depicted by the higher levels of BSMYV DNA in healthy plants with some B-genome. There was no activation of eBSMYV detected in any of the genotypes, consistent with previous reports.

4CHAPTER 4: GLASSHOUSE ASSESSMENT OF A DIVERSE COLLECTION OF MUSA GENOTYPES FOR RESISTANCE TO INFECTION WITH BANANA STREAK MY VIRUS

4.1 Introduction

Thousands of banana accessions exist in banana germplasm collection centres around the world with a significant level of genetic diversity (Creste et al., 2004; Nsabimana and Van Staden, 2007; Onguso et al., 2004; Perrier et al., 2011). Despite this rich genetic diversity, the production of banana is threatened by a range of economically important diseases. This is mainly due to the over reliance on a limited number of cultivars which are used in large-scale plantation farming systems, predominantly for the export market. Such practices have had severe consequences in the past, for example, the loss of what was once the world’s leading export banana ‘Gros Michel’ whose large-scale production was ended by Fusarium wilt disease (Ploetz, 2005).

Banana streak disease (BSD) caused by a collection of banana streak viruses (BSVs) has been a major constraint to banana germplasm movement and breeding worldwide. To complicate matters, further, some Musa genotypes with a B-genomes harbour integrated sequences of several BSVs, which under certain conditions can become activated to produce infectious, episomal virus (Geering et al., 2001; Fort et al., 2017). To date there are no reports on any banana genotypes that are resistant to BSV infection.

Published reports on the incidence and distribution of banana streak disease indicate that most genotypes/cultivars can become infected. In Nigeria, for example, 15% of triploid landraces such as Agbagba, Saba, Obino l’Ewai, Fougamou, Bluggoe, Cardaba, Pisang Ceylan, Pelipita, Yangambi Km-5 and Valery, as well as a range of tetraploid hybrids could be infected with BSV (Dahal et al., 2000). In Uganda, there was up to 86% infection in the field in the locally popular East Africa highland banana (EAH) cultivars from the Mutika/Lujugira subgroup (AAA-EAH) as well as in plantains (AAB) (Harper et al., 2002). Similarly, in Kenyan studies, five commercial banana varieties, namely FHIA-17 (AAAA), FHIA-18 (AAAB), Chinese

Cavendish (AAA), and Solio and Nusu Ng’ombe (AAA-EAH), showed up to 55% infection in screenhouse studies and up to 23% infection when tested under field conditions (Nyaboga et al., 2008). The popular commercially cultivated triploids Gros Michel (AAA), Cavendish (AAA) and Lady Finger (AAB) have been reported to be infected in studies carried out in Uganda, Morocco, and Australia. A survey and screening for BSV infection that showed a 86% infection in Uganda included Lady Finger, Gros Michel and cultivar Dwarf Cavendish genotypes. In Morocco, BSV was diagnosed in the field while in Australia, infection of Cavendish subgroup resulted in 11% yield reduction (Harper et al., 2002; Lockhart, 1995; Daniells et al., 2001).

Therefore, the challenge now lies with identifying BSV-resistant banana genotypes in existing germplasm in national collection centres that can be exploited for conventional and/or molecular breeding. Screening of banana genotypes for resistance to BSV has to-date only used natural transmission by mealybug vectors. This mode of transmission may be unreliable when screening germplasm for resistance, however, since the capacity of mealybugs to transmit BSV decreases exponentially over time (Ng and Falk, 2006; Ravichandra, 2013). The development of infectious clones has made it easier to screen large number of plants within a very short period in a controlled manner. In Chapter 3 it was demonstrated that the BSMYV-IC can reliably infect both Dwarf Cavendish and Lady Finger bananas. As an extension to this previous work, the assessment of a much larger collection of wild and cultivated bananas to inoculation with the BSMYV-IC is required in attempt to identify resistant cultivars.

Therefore, the specific objectives of this chapter were to:

1. Inoculate a diverse collection of banana genotypes and determine the infectivity of the BSMYV infectious clone; 2. Evaluate the growth rate of BSMYV-infected plants under the glasshouse conditions; 3. Evaluate symptom expression of BSMYV-infected plants under glasshouse conditions and assess the symptom severity.

4.2 Materials and methods

4.2.1 Banana genotypes 24 banana genotypes (Table 2.1) were selected for the infectivity testing of the BSMYV-IC. Two of these genotypes, namely Dwarf Cavendish and Lady Finger which were previously used in two pilot experiments described in Chapter 3, were used as controls throughout the infectivity tests.

4.2.2 Tissue culture multiplication and glasshouse acclimatisation Banana plantlets were cultured on multiplication media as described in section 2.4.1.1 with subculturing at four-week intervals until sufficient replicates were generated for glasshouse experiments. Plants were then transferred to rooting media as described in section 2.4.1.2 for a further 8-12 weeks until sufficient roots had developed, prior to transport to the glasshouse for acclimatisation as described in section 2.4.2.

4.2.3 BSV inoculation, monitoring and scoring of symptom severity In all the experiments, inoculation was carried out by injecting banana pseudostems with 1 ml of A. tumefaciens (OD A600 = 0.5) suspension containing the native BSMYV-IC as described in section 2.4.3. The youngest fully expanded leaf was marked at the time of inoculation while the leaf that emerged thereafter was marked as leaf +1, the second to emerge as +2 and so on until the end of the experiment. The youngest fully expanded leaf of non- inoculated control plants were also marked at the time of inoculation with subsequent leaves also marked as above. Plant height of both inoculated and non-inoculated plants was assessed at the time of inoculation and at the end of the experiment by measuring the pseudostem from its base to the base of the petiole on the youngest fully expanded leaf using a ruler. Symptom expression was monitored and assessed as described in section 2.4.4.

4.2.4 Sampling of banana leaf tissue Leaf tissue was collected from all plants before inoculation to screen for the presence of BSMYV. Samples were then collected from the first leaf to develop symptoms in every inoculated plant and sampling continued until (in most cases) 24 weeks post-inoculation. In a few cases, described in the results section below, some plants were monitored for a longer period of time and samples were collected later to confirm infection. A one-hole plier punch (Officeworks) was used to collect 10 leaf discs from each side of the leaf lamina as shown in Figure 3.1 and stored at -80°C until DNA extraction was carried out.

4.2.5 PCR and RCA detection of BSMYV TNA was extracted from samples as described in section 2.4.5 and a control PCR assay to confirm the quality of TNA extracts was carried out as described in section 2.4.6.2 using 18S F/R primers (Table 2.6) with an annealing temperature of 55°C. PCR for screening residual A. tumefaciens was also carried out as described in section 2.4.6.2 using AGL1 F/R primers (Table 2.6) with an annealing temperature of 64°C, while PCR to detect BSMYV carried out as described in section 2.4.6.2 using Mys-F/R primers (Table 2.6) with an annealing temperature of 61°C. Whereas PCR was used to detect BSMYV in A-only genotypes, RCA was used to detect BSMYV in genotypes with B-genome component and was carried out as described in section 2.4.6.3.

4.3 Results

4.3.1 Glasshouse screening of banana cultivars Seven glasshouse screening experiments were carried out over a 33 month period from February, 2014 to November, 2016 (Table 4.1). Plants were acclimatised and inoculated with the BSMYV-IC at different times of the year, with different genotypes included in each experiment, dependent upon the availability of plantlets following multiplication in tissue culture. All experiments included two control cultivars (Dwarf Cavendish and Lady Finger) which had been used for the pilot experiments described earlier. Experiments were carried out over a period of 24 weeks from the date of inoculation, with most plants discarded at

this time. However, plants from Akondro Mainty, Pisang Madu and Pacific Plantain from experiment 5, as well as Pisang Gajih Merah from experiments 4, 5 and 6 were maintained beyond the planned 24 weeks post-inoculation to observe any possible delayed effects.

Prior to inoculation, leaf samples were collected from all plants and total nucleic acid was extracted. As an extraction control, the nucleic acid extracts were initially assessed by PCR using primers which amplify the banana 18S gene. Depending on genotype, extracts from the test plants were then screened using either PCR or RCA to detect episomal BSMYV infection.

In all experiments, the disease incidence was recorded based on the expression of symptoms following inoculation with the BSMYV infectious clone. Leaf samples were collected to confirm infection with BSMYV by molecular assays. Symptom severity was scored for each experiment except experiment 7. In experiment 1, all leaves with symptoms were scored collectively at 12 weeks post-inoculation, while for experiments 2-6, all leaves which developed up to 24 weeks post-inoculation were scored individually (once fully developed). These severity scores were subsequently used to calculate the average symptom severity index (ASSI) as described in section 2.4.4. Detailed records of the types of symptoms were collected and for some experiments photographs of leaves, whole plants, and in some cases pseudostem symptoms were taken. In some experiments plant height was measured at both the time of inoculation and also at 24 weeks post-inoculation to compare differences in plant growth. Similarly, in some experiments the rate of leaf emergence was also determined by counting the number of new leaves to emerge over a period of 24 weeks post-inoculation. Following the first observation of symptoms, leaf samples were collected from all leaves from all plants until 24 weeks post-inoculation and stored at -80°C.

4.3.2 Disease incidence and plant survival Disease incidence, based on the observation of symptoms associated with BSMYV infection, was recorded during each inoculation experiment. In each experiment (except experiment 6), Dwarf Cavendish and Lady Finger were included as positive controls and had 100% disease incidence in all inoculations.

Experiment 1

In addition to the two controls, this experiment included eight genotypes comprising a range of wild and cultivated bananas all with an A-only genome complement (Table 4.2). At 24 weeks post-inoculation, survival in all genotypes was 100% and all eight test genotypes had a disease incidence of 100% based on the development of symptoms. Initial symptoms of infection developed within 4-6 weeks post-inoculation, depending on the genotype, similar to the two controls which also developed initial symptoms at 5 weeks post-inoculation. Leaf tissue from the youngest fully-expanded leaf was collected fortnightly throughout the 24 weeks. To confirm the presence of BSMYV in inoculated plants, TNA was extracted from leaf tissue collected at 16 weeks post-inoculation and tested using PCR with primers 18S-F/R and Mys-F/R (Table 2.6). All plants from the eight genotypes tested positive for both the 18S housekeeping assay and for BSMYV (Figure. 4.1A-D and 4.2A-D).

Table 4.1 Summary of glasshouse screening experiments

Experiment No. Date of inoculation No. of genotypes assessed

1 7.2.2014 8

2 7.7.2014 7

3 7.11.2014 3

4 11.9.2015 10

5 13.9.2015 10

6 10.2.2016 9

7 17.4.2016 5

Table 4.2 Summary of inoculation Experiment 1

Accession name Genotype No. of First % ASSI3 plants symptoms survival2 inoculated observed1

Dwarf AAA 5 5 100 2.6 Cavendish

Lady Finger AAB 5 5 100 2

Calcutta 4 AA 5 6 100 2.4

Ma. ssp. banksii AA 5 5 100 2.2

Truncata AA 5 5 100 2.2

Paka AA 5 6 100 2.2

Pisang Madu AA 5 5 100 3

Mal-R AA 5 5 100 2.4

Mal-S AA 5 5 100 2.6

Gros Michel AAA 5 4 100 2.6

1Number of weeks post-inoculation. 2At 24 weeks post-inoculation. 3ASSI = average symptom severity index. AASI was calculated at 12 weeks post-inoculation from all leaves to emerge from the first leaf to develop symptoms.

Figure 4.1 PCR screening of TNA extracts from eight genotypes tested in Experiment 1 using primers 18S-F/R. Five plants of each genotype were tested. A) CA1 to CA5: Calcutta 4 plants 1 to 5, BA1 to BA5: Ma. spp. banksii plants 1 to 5; B) TR1 to TR5: Truncata plants 1 to 5, PA1 to PA5: Paka plants 1 to 5; C) PM1 to PM5: Pisang Madu plants 1 to 5, MR1 to MR5: Mal-R plants 1 to 5; and D) MS1 to MS5: Mal-S plants 1 to 5, GM1 to GM5: Gros Michel plants 1 to 5. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

Figure 4.2 PCR screening of TNA extracts from eight genotypes tested in Experiment 1 using primers Mys-F/R. Five plants of each genotype were tested. A) CA1 to CA5: Calcutta 4 plants 1 to 5, BA1 to BA5: Ma. spp. banksii plants 1 to 5; B) TR1 to TR5: Truncata plants 1 to 5, PA1 to PA5: Paka plants 1 to 5; C) PM1 to PM5: Pisang Madu plants 1 to 5, MR1 to MR5: Mal-R plants 1 to 5; and D) MS1 to MS5: Mal-S plants 1 to 5, GM1 to GM5: Gros Michel plants 1 to 5. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

Experiment 2

Eight genotypes were inoculated in this experiment (Table 4.3). Seven of the eight genotypes had an A-only genome, while Ney Poovan has some B-genome component. Compared with experiment 1, symptoms developed more slowly, with all plants of the two controls (Dwarf Cavendish and Lady Finger) developing symptoms about 10-11 weeks post-inoculation, and all plants in the test genotypes developing symptoms between 10 and 18 weeks post- inoculation. Survival in all genotypes was 100% at 24 weeks post-inoculation, except for Khae Phrae where one plant died, giving a survival rate of 80%. Leaf samples were collected starting with the first leaf to express symptoms and subsequently from all leaves for all inoculated plants up to 24 weeks post-inoculation. For the seven A-only genotypes, infection with BSMYV was confirmed at 16 weeks post-inoculation using PCR as previously and all plants tested positive (Figure 4.3A-D), while for Ney Poovan, infection with BSMYV was confirmed at week 20 post-inoculation (Ney Poovan infection was delayed) using RCA and all plants tested positive (Figure 4.4).

Experiment 3

Two wild diploids as well as two cultivated triploids, all with A-only genome types (Table 4.4) were inoculated. As with experiment 1, all plants from the four test genotypes as well as the two controls developed symptoms within 4-5 weeks post-inoculation and survival in all genotypes was 100% at 24 weeks post-inoculation. PCR was used to confirm at 16 weeks post-inoculation that all plants from the four test genotypes were infected with BSMYV (Figure 4.5 A &B).

Experiments 4 and 5

These two experiments were conducted concurrently with control and test plants randomly divided into two groups of five plants and inoculations carried out two days apart (Table 4.5). An additional set of five non-inoculated control plants for each genotype was also maintained. In experiment 4, disease incidence in all genotypes was 100%, with the exception of Pisang Gajih Merah, where no plants showed symptoms at 24 weeks post- inoculation. These plants were maintained for a total of 48 weeks post-inoculation and remained free of symptoms until this time. When the plants of the nine genotypes with symptoms were screened for

Table 4.3 Summary of inoculation Experiment 2

Accession name Genotype No. of First % survival2 ASSI3 plants symptoms

inoculated observed1

Dwarf Cavendish AAA 5 10 100 2.7

Lady Finger AAB 5 11 100 2.4

Khae Phrae AA 5 13 80 2.9

Ma. ssp. zebrina AA 5 12 100 2.2

Pisang Bangkahulu AA 3 10 100 2.9

Mal-R AA 5 11 100 2.5

Mal-S AA 5 11 100 2.6

Gros Michel AAA 5 10 100 2.7

Williams AAA 5 11 100 2.5

Ney Poovan AAB 4 18 100 2.8

1Number of weeks post-inoculation. 2At 24 weeks post-inoculation. 3 ASSI = average symptom severity index. ASSI was calculated using all leaves to emerge from the first leaf to develop symptoms.

Figure 4.3 PCR screening of TNA extracts from seven genotypes with no B-genome complement tested in Experiment 2 using primers Mys-F/R. Five plants of each genotype were tested except for Pisang Bangkahulu with 3 plants tested. A) KH1 to KH5: Khae Phrae plants 1 to 5, ZB1 to ZB5: Ma. ssp zebrina plants 1 to 5; B) MR1 to MR5: Mal-R plants 1 to 5, MS1 to MS5: Mal- S plants 1 to 5; C) GM1 to GM5: Gros Michel plants 1 to 5, W1 to W5: Williams plants 1 to 5; and D) PB1 to PB3: Pisang Bangkahulu plants 1 to 3. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

Figure 4.4 RCA screening of TNA extracts from plants of Ney Poovan tested in Experiment 2. Four plants were tested. NP1 to NP4: Ney Poovan plants 1 to 4. +ve = positive control, -ve = negative control. M is the HyperLadder I (Bioline).

Table 4.4 Summary of inoculation Experiment 3

Accession name Genotype No. of First % survival2 ASSI3 plants symptoms

inoculated observed1

Dwarf Cavendish AAA 5 5 100 2.6

Lady Finger AAB 5 5 100 2.56

Mal-R AA 5 5 100 2.48

Mal-S AA 5 5 100 2.48

Gros Michel AAA 5 4 100 2.54

Williams AAA 5 5 100 2.37

1Number of weeks post-inoculation. 2At 24 weeks post-inoculation. 3 ASSI = average symptom severity index. ASSI was calculated using all leaves to emerge from the first leaf to develop symptoms.

Figure 4.5 PCR screening of TNA extracts from the four genotypes tested in Experiment 3 using primers Mys-F/R. Five plants of each genotype were tested. A) MR1 to MR5: Mal-R plants 1 to 5, MS1 to MS5: Mal-S plants 1 to 5; B) GM1 to GM5: Gros Michel plants 1 to 5, W1 to W5: Williams plants 1 to 5. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

Table 4.5 Summary of inoculation Experiments 4 and 5

Accession Genotyp No. of First symptoms % ASSI3 e plants observed1 survival2 inoculat ed Dwarf Cavendish AAA 5 5 100 2.45 Lady Finger AAB 5 5 100 2.75 Calcutta 4 AA 5 7 100 2.61 Khae Phrae AA 5 5 40 2.8 Ma. ssp. banksii AA 5 6 80 2.6 Truncata AA 5 6 100 2.01 Akondro Mainty AA 5 4 60 2.88 Paka AA 5 5 100 2.4

EXPERIMENT 4 EXPERIMENT Pisang Madu AA 5 4 100 2.1 Pacific Plantain AAB 5 6 100 2.72 Yesing AAB 5 6 100 2.5 Pisang Gajih Merah ABB 5 No symptoms 100 developed Dwarf Cavendish AAA 5 5 100 2.19 Lady Finger AAB 5 5 100 2.87 Calcutta 4 AA 5 7 100 2.32 Khae Phrae AA 5 5 40 2.7 Ma. ssp. banksii AA 5 6 100 2.01 Truncata AA 5 6 100 2.5 Akondro Mainty AA 5 4 100 2.79 Paka AA 5 5 100 2.4

EXPERIMENT 5 EXPERIMENT Pisang Madu AA 5 4 100 2.7 Pacific Plantain AAB 5 6 100 2.6 Yesing AAB 5 6 40 2.96 Pisang Gajih Merah ABB 5 No symptoms 100 developed 1Number of weeks post-inoculation. 2At 24 weeks post-inoculation. 3 ASSI = average symptom severity index. ASSI was calculated using all leaves to emerge from the first leaf to develop symptoms.

Figure 4.6 PCR screening of TNA extracts from seven genotypes with no B-genome component tested in Experiment 4 using primers Mys-F/-R. Five plants of each genotype were tested. A) CA1 to CA5: Calcutta 4 plants 1 to 5, KH1 to KH5: Khae Phrae plants 1 to 5; B) BA1 to BA5: Ma. ssp banksii plants 1 to 5, TR1 to TR5: Truncata plants 1 to 5; C) AK1 to AK5: Akondro Mainty plants 1 to 5, PA1 to PA5: Paka plants 1 to 5. +ve is the positive control, -ve is the negative control. M is the EasyLadder I (Bioline).

Figure 4.7 RCA screening of TNA extracts from three genotypes with some B-genome component tested in Experiments 4/5. 10 plants of each genotype were tested. A) PP1 to PP10: Pacific Plantain plants 1 to 10; B) YS1 to YS10: Yesing plants 1 to 10; C) PG1 to PG10: Pisang Gajih Merah plants 1 to 10. +ve = positive control, -ve = negative control. M is HypeLadder I (Bioline).

BSMYV at week 16 post-inoculation using either PCR or RCA all plants tested positive (Figure 4.6A-D & 4.7A-B). When leaf samples from the 10 Pisang Gajih Merah plants (collected at 48 weeks post-inoculation) were tested for BSMYV using RCA, all plants tested negative (Figure 4.7C). Of the 10 genotypes tested, there was 100% survival in seven of the genotypes, whereas survival in Khae Phrae, Akondro Mainty and Ma. ssp. banksii was 40%, 60% and 80%, respectively (Table 4.5). For experiment 5, symptom development (Table 4.5) and disease incidence were identical to experiment 4. Plant survival in eight of the genotypes was 100% at 24 weeks post-inoculation, however only two out of five plants of Khae Phrae and Yesing survived (Table 4.5). PCR (results not shown) and RCA (Figure 4.7, plants 6-10 in each panel) were again used to confirm that all plants except those of Pisang Gajih Merah were infected. Plants of four genotypes, namely Pisang Madu, Calcutta 4, Akondro Mainty and Pacific Plantain were selected randomly and maintained for an additional 24 weeks for observation of the long term effects of BSMYV infection. Calcutta 4 and Pisang Madu did not show any additional effects. However, all five plants of Akondro Mainty and Pacific Plantain died within the additional 24 weeks. Plants of Akondro Mainty did not develop any new leaves after 24 weeks post-inoculation, with cigar leaf necrosis observed from this time and a systemic necrosis subsequently developing in all plants and they eventually died. Plants of Pacific Plantain continued to develop new leaves until 40 weeks post-inoculation, when cigar leaf necrosis also developed, eventually leading to their death.

Experiment 6

A diverse collection of genotypes including three wild diploid M. acuminata types (AA), six wild or cultivated types with some B-genome component, and the Fe’i type banana accession Asupina (AT) (Table 4.6) were inoculated. Between five and 10 plants were inoculated for each genotype. For five of the 10 genotypes assessed all plants developed symptoms within 3-5 weeks of inoculation, while plants of Ney Poovan did not develop symptoms until at least 18 weeks post-inoculation. All plants of these six genotypes developed symptoms by 24 weeks post-inoculation and all except Asupina and Ney Poovan were confirmed positive for BSMYV infection by PCR or RCA at 16 weeks post-inoculation (Figure 4.8A-C; Figure 4.9E). Ney Poovan plants were confirmed of infection by RCA at 20 weeks post-inoculation (Figure 4.9 D) while

Table 4.6 Summary of inoculation Experiment 6

Accession Genotype No. of First % ASSI3 plants symptoms survival2 inoculated observed1

Ma. ssp. zebrina AA 9 4 100 2.39

Pahang AA 10 5 100 2.35

Pisang AA 7 4 100 2.5 Bangkahulu

Ney Poovan AAB 10 18 100 2.6

Yesing AAB 10 4 90 2.7

Saba ABB 10 100 No Pisang Gajih ABB 5 100 symptoms Merah developed Butuhan BB 10 100

M. balbisiana BB 10 100

Asupina AT 10 3 0 2.75 (based on all 10 plants which died soon after)

1Number of weeks post-inoculation. 2At 24 weeks post-inoculation. 3 ASSI = average symptom severity index. ASSI was calculated using all leaves to emerge from the first leaf to develop symptoms.

Figure 4.8 PCR screening of TNA extracts from three genotypes with no B-genome complement tested in Experiment 6 using primers Mys-F/R. Ten to seven plants of each genotype were tested. A) PH1 to PH10: Pahang plants 1 to 10; B) ZB1 to ZB9: Ma. ssp. zebrina plants 1 to 9;: C) PB1 to PB7: Pisang Bangkahulu plants 1 to 7. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

Figure 4.9 RCA screening of TNA extracts from six genotypes with some B genome complement tested in Experiment 6. Five to ten plants of each genotype were tested. A) SB1 to SB5: Saba plants 1 to 5; B) BT1 to BT5: Butuhan plants 1 to 5; C) BB1 to BB5: M. balbisiana plants 1 to 5; D) NP1 to NP10: Ney Poovan plants 1 to 10; E) YS1 to YS10: Yesing plants 1 to 10; F) PG1 to PG5: Pisang Gajih Merah plants 1 to 5. +ve = positive control, -ve negative control. M is HyperLadder I (Bioline).

100

Asupina was confirmed at week 10 post-inoculation (Results not shown). All plants of Saba, Pisang Gajih Merah, Butuhan and M. balbisiana remained free of symptoms at 24 weeks post-inoculation and when 5 plants of each genotype were screened using RCA no plants tested positive (Figure 4.9A-C; Pisang Gajih Merah not shown). Interestingly, when the five Pisang Gajih Merah plants were maintained beyond the 24 week period, all developed symptoms at 28 weeks post-inoculation and all subsequently tested positive when screened using RCA (Figure 4.9F). In 8 of the 10 genotypes, survival at 24 weeks post-inoculation was 100%, while in Yesing one plant died, giving a survival rate of 90%. In contrast, all Asupina plants initially developed symptoms of BSMYV infection by 4 weeks post-inoculation and then quickly developed necrosis on the cigar leaves and no further leaves developed. Subsequently, all plants died by 12 weeks post-inoculation. In order to rule out the effects of Agrobacterium in leading to the death of Asupina plants following inoculation with the BSMYV infectious clone, three additional Asupina plants were later inoculated with a culture of Agrobacterium which did not harbour the infectious clone and at 12 weeks post- inoculation all three plants appeared to be healthy and growing normally. This result suggests that the infection of Asupina with BSMYV leads to plant death.

Experiment 7

Five genotypes were inoculated, of which four were wild diploids with either AA or BB genomes, with an additional cultivated banana with a triploid genome consisting of ABB or BBB (Table 4.7). Between 5 and 9 plants of each genotype were inoculated (including the two controls). Of the five genotypes assessed, Ma. ssp. zebrina and Pahang both expressed initial symptoms between 5-6 weeks post-inoculation and all plants had symptoms by 24 weeks post-inoculation. All plants of Saba, Butuhan and M. balbisiana remained free of symptoms at 24 weeks post-inoculation, however all plants of Saba later developed symptoms at 32 weeks post-inoculation. When five plants each of Ma. ssp. zebrina and Pahang were selected and tested at 16 weeks for BSMYV infection using PCR all were positive (Figure 5.10A), while all five plants of Saba were tested at 32 weeks using RCA and all were positive (Figure 5.10B). When five plants each of Butuhan and M. balbisiana were screened at 24 weeks using RCA, all plants tested negative (results not shown). Survival rate for the five genotypes was 100% at 24 weeks post-inoculation.

101

Table 4.7 Summary of inoculation Experiment 7

Accession name Genotype No. of First % survival2 ASSI3 plants symptoms

inoculated observed1

Dwarf Cavendish AAA 9 5 100

Lady Finger AAB 6 5 100

Ma. ssp zebrina AA 5 5 100

Pahang AA 6 6 100

Saba ABB 5 32 100

Butuhan BB 9 No 100 symptoms

M. balbisiana BB 6 No 100 symptoms

1Number of weeks post-inoculation. 2At 24 weeks post-inoculation. 3 ASSI = average symptom severity index. Not done for Experiment 7.

102

Figure 4.10 PCR and RCA screening of TNA extracts from genotypes tested in Experiment 7. A) PCR using primers Mys-F/R. Five plants of each genotype were tested. A) ZB1 to ZB5: Ma. ssp. zebrina plants 1 to 5; B) PH1 to PH5: Pahang plants 1 to 5; B) RCA screening of five plants of Saba at 32 weeks post-inoculation. SB1 to 5: Saba plants 1 to 5. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

103

Average plant survival rates

Of the 22 genotypes which became infected with BSMYV, plant survival ranged from zero to 100% of the inoculated plants. For 15 of the genotypes, survival at 24 weeks in all experiments was 100%, which was also the case for the two control cultivars Dwarf Cavendish and Lady Finger. Of the five cultivars where plant survival was below 100%, Asupina was the most severely affected with all inoculated plants dying by 12 weeks post- inoculation. In three experiments where Yesing was inoculated with BSMYV, survival varied from 100% in experiment 4, to 40% in experiment 6, with an average survival of 80%. Ma. ssp. banksii had an average of 93% survival across 3 experiments with only one out of 15 plants inoculated not surviving to 24 weeks post-inoculation. Khae Phrae, which was also tested in 3 inoculation experiments, had an average survival rate of 53% at 24 weeks post- inoculation, while Akondro Mainty had an average survival of 80% across 2 inoculation experiments.

Plants of several cultivars were maintained in the glasshouse for a longer time period to observe any further effects of inoculation with BSMYV. Interestingly, plants of Akondro Mainty stopped growing by 24 weeks post-inoculation, with no new leaves ever developing and they subsequently all died due to severe systemic necrosis that began at the bottom of the plant. Plants of Pacific Plantain had an average of 100% survival at 24 weeks post- inoculation. However, when all five plants from experiment 5 were maintained for an additional 24 weeks, all plants continued to develop new leaves until 40 weeks post- inoculation when all plants developed necrosis on their cigar leaves and also subsequently died.

4.3.3 Evaluation of growth rate Two traits were used to evaluate the effects of BSMYV infection on the growth rate of different banana genotypes. Firstly, plant height was measured for both inoculated and non- inoculated controls at the time of inoculation and again at 24 weeks post-inoculation. This was done for all genotypes where plants developed symptoms in experiments 3, 4, 5 and 6,

104

with the exception of Asupina where all plants had died by 12 weeks post-inoculation. Secondly, the leaf emergence rate was compared in inoculated and non-inoculated controls over a period of 24 weeks from the time of inoculation, also in experiments 3, 4, 5 and 6. The number of plants inoculated in these experiments ranged between 5 and 10, and for non- inoculated controls between 3 and 5, respectively. As experiments 4 and 5 were inoculated two days apart, the results for these two groups of plants were combined.

Plant height

There was no significant difference in the change in plant height between the inoculated and non-inoculated Dwarf Cavendish plants over the 24 weeks from either experiment 3 or experiments 4/5 (Figure 4.11A). In contrast, for Lady Finger, in both experiments 3 and 4/5 there was a significant difference in the change in plant height over the 24 weeks, with the change in plant height in the non-inoculated plants significantly greater than the change in plant height in the inoculated plants (Figure 4.11A). The difference in plant height in the non-inoculated Lady Finger controls was 17% and 23% greater, respectively, than the difference in the inoculated plants in experiments 3 and 4/5. Therefore, Dwarf Cavendish as a control genotype was not affected in terms of change in plant height, while in Lady Finger the non-inoculated plants grew significantly taller than the inoculated plants. When the differences in the change in plant height between the inoculated and non-inoculated control plants of the four genotypes in experiment 3 were assessed, Mal-S, Gros Michel and Williams did not show a significant difference between inoculated and non-inoculated plants. However, the non-inoculated plants of Mal-R were significantly taller than the non- inoculated plants, with a difference of 8% (Figure 4.11B). Similarly, for the nine genotypes assessed in experiment 4/5, Khae Phrae, Truncata and Paka, did not show significant differences between inoculated and non-inoculated plants (Figure 4.11C). However, the non- inoculated plants of Akondro Mainty, Yesing, Pacific Plantain, Ma. ssp. banksii and Calcutta 4 all grew significantly taller, with a difference of 44%, 28%, 27%, 26% and 25%, respectively, in height compared with the inoculated plants (Figure 4.11C and Figure 4.12). Conversely, the inoculated plants of Pisang Madu were significantly taller than the non-inoculated plants after 24 weeks, with a difference of 17% (Figure 4.11C). In experiment 6 there was no significant difference in the change in plant height in non-inoculated and inoculated plants of Ney Poovan, however non-inoculated plants of Ma. ssp. zebrina, Pahang and Pisang

105

Bangkahulu grew significantly taller compared to the inoculated plants by 43%, 30% and 18%, respectively (Figure 4.11D).

106

A Non-inoculated Inoculated

50 45 40 35 30 25 20 Change in plant height in in plant height cm Change 15 10 5 0 Dwarf Cavendish Lady Finger Dwarf Cavendish Lady Finger Exp 3 Exp 4/5

B Non-inoculated Inoculated

20 Change in height in cm 10

0 Mal-R Mal-S Gros Michel Williams Exp 3

107

C Non-inoculated Inoculated

Change in plant height in in plant height cm Change 10

0 Calcutta 4 Khae Ma. ssp. Truncata Akondro Paka Pisang Pacific Yesing Phrae banksii Mainty Madu Plantain Exp 4/5

D Non-inoculated Inoculated

20 Changein plant heightin cm 10

0 Ma. ssp. zebrina Pahang Pisang Bangkahulu Ney Poovan Exp 6

Figure 4.11 Change in plant height in non-inoculated and inoculated plants in Experiments 3, 4/5 and 6 (measured at zero and 24 weeks post-inoculation). A) Change in plant height in the control genotypes (Dwarf Cavendish and Lady Finger) in Experiments 3 and 4/5; B) Change in plant height in the test genotypes in Experiment 3; C) Change in plant height in the test genotypes in Experiment 4/5; and D) Change in plant height in the test genotypes in Experiment 6. All measurements are in cm. Values shown are the average of all plants surviving to 24 weeks post-inoculation. Error bars indicate standard error of the mean. (Exp 3 all genotypes inoculated plants n = 5, non-inoculated plants n = 3; Exp 4/5 all genotypes inoculated plants n = 10, non-inoculated plants n = 5; Exp 6 inoculated plants for Ma. ssp zebrina n = 9, Pisang Bangkahulu n = 7, Pahang and Ney Poovan n = 10, in all genotypes non-inoculated plants n = 5).

108

1 2 3 4 B

1 2 3 4

Figure 4.12 Effect of BSMYV infection on plant growth. A) Plants of genotype Akondro Mainty from experiment 4 showing the inoculated plants significantly shorter than non-inoculated plant. (1 is non-inoculated, 2, 3, and 4 are inoculated plants); and B) Plants of genotype Yesing from experiment 4 showing the inoculated plants significantly shorter than non-inoculated plant. (1 is non-inoculated, 2, 3, and 4 are inoculated).

109

Leaf emergence rate

When Dwarf Cavendish and Lady Finger plants were assessed for leaf emergence over a period of 24 weeks post-inoculation, there was no significant difference between the inoculated and non-inoculated plants assessed in experiments 3 and 4/5 (Figure 4.13A). When the leaf emergence rate in the four genotypes assessed in experiment 3 was compared, there was no significant difference in leaf emergence between the non- inoculated and inoculated plants of Gros Michel or Williams, while non-inoculated plants of Mal-R and Mal-S showed a 16-17% higher rate of leaf emergence, respectively, compared to the inoculated plants (Figure 4.13B). In the nine genotypes assessed in experiment 4/5, there was no significant difference between inoculated and non-inoculated plants of genotypes Khae Phrae, Truncata, Paka, Pisang Madu and Pacific Plantain (Figure 4.13C). In contrast, non-inoculated plants of Ma. ssp. banksii, Akondro Mainty and Yesing had a small, but significantly higher, leaf emergence rate with a difference of 12%, 11% and 6%, respectively compared to inoculated plants. Conversely, inoculated plants of Calcutta 4 had a small, but significantly higher, leaf emergence rate with a difference of 11% compared to non- inoculated plants (Figure 4.13C). Similarly, in experiment 6 among the four genotypes assessed, there was significantly higher leaf emergence in non-inoculated plants of Pisang Bangkahulu, Pahang and Ma. ssp. zebrina with a difference of 18%, 11% and 9%, respectively as compared to the inoculated plants. However, there was no significant difference between the inoculated and non-inoculated plants of Ney Poovan (Figure 4.13D).

4.3.4 Assessment of symptoms Symptom emergence

For each glasshouse inoculation experiment, symptom emergence was monitored and the time taken for first symptoms to appear was recorded (Tables 4.2-4.7). As described previously, nearly all genotypes developed symptoms between 4 and 5 weeks post- inoculation in experiments 1, and 3-7, with Asupina the fastest at 3 weeks (in experiment 6) and Paka slightly slower than average, developing initial symptoms at 7 weeks in experiments 4 and 5. In contrast, initial symptom development in experiment 2 was around 10-13 weeks

110

111

Figure 4.13 Comparison of the number of leaves to emerge in non-inoculated and inoculated plants over 24 weeks. A) Leaf emergence comparison in the control genotypes (Dwarf Cavendish and Lady Finger) in Experiments 3 and 4/5; B) Leaf emergence comparison in the test genotypes in Experiment 3; C) Leaf emergence comparison in the test genotypes in Experiment 4/5; and D) Leaf emergence comparison in the test genotypes in Experiment 6. Values shown are the average of all plants surviving to 24 weeks post-inoculation. Error bars indicate standard error of the mean. (Exp 3 all genotypes inoculated plants n = 5, non-inoculated plants n = 3; Exp 4/5 all genotypes inoculated plants n = 10, non-inoculated plants n = 5; Exp 6 inoculated plants for Ma. Ssp zebrina n = 9, Pisang Bangkahulu n = 7, Pahang and Ney Poovan n = 10, in all genotypes non-inoculated plants n = 5).

112

in all genotypes, except Ney Poovan, which developed initial symptoms at 18 weeks post- inoculation (Table 4.3). This variability is probably explained by the timing of inoculation of Experiment 2, which was inoculated in July, with July and August being the coldest months in Brisbane (Figure 4.14). Although not as significant, there was also a slight delay (on average) when comparing the time to initial symptoms between plants grown in early spring (experiments 4/5) and those grown in late spring/summer (experiments 1, 3 and 6), but as noted earlier the two controls developed initial symptoms at the same time in these experiments. Of note was the significant delay in the development of initial symptoms in Pisang Gajih Merah, which developed initial symptoms at 28 weeks (experiment 6) and Saba, which developed initial symptoms at 32 weeks (experiment 7). All leaves (starting from the first one that emerged after inoculation) were numbered and the first leaf to express symptoms was also recorded. When the average of the first leaf to express symptoms was calculated for the two control genotypes (DC and LF) in experiments 2 to 5 symptom emergence was delayed significantly in experiment 2 compared to experiments 3 and 4/5 (Figure 4.15A). Similarly, in experiments 3 to 6 symptom emergence in all test genotypes developed in leaves +4 to +6 post-inoculation, while in experiment 2 symptom emergence in the test genotypes was in leaves +8 to +10. The exception again was Ney Poovan, with a delay in the first leaf to develop symptoms relative to the other genotypes, concomitant with the delay in time to develop symptoms described previously (Figure 4.15B).

Symptom variability

A range of different symptoms were observed which included typical leaf streaks (chlorotic flecks), cigar leaf necrosis and blackening of the pseudostem. Leaf streaks varied considerably between the genotypes, including variations in colour (white, yellow, orange, green, red and brown), shape (fine or broad, spindle- or ‘eye-shaped’, speckles) and length (continuous/discontinuous) (Table 4.8). In some genotypes, broad ‘blotches’ developed between the veins of the leaves. Shorter streaks often coalesced into long streaks which joined together into large chlorotic areas, and in most genotypes the colour of the streaks darkened as the leaves matured. Necrosis also developed on the leaves of several genotypes. Notably, symptoms were often characteristic to specific genotypes, particularly for the diploid AA accessions, even from the initial stages of expression.

113

35 2010 2011 30 2012 25 2013 20 2014

15 2015 2016 10 2010 5 2011 0 2012 Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Monthly mean temperatures in Brisbane 2013

Figure 4.14 Monthly mean minimum and maximum temperatures in Brisbane. In nine years period, the month of July has the lowest temperatures in Brisbane. Courtesy of Climate Data Online, Bureau of Meteorology. Copyright Commonwealth of Australia, 2016.

114

A 12

4 Average leaf number

0 Dwarf Cavendish Lady Finger Dwarf Cavendish Lady Finger Dwarf Cavendish Lady Finger Exp 2 Exp 3 Exp 4/5

16 14 12 10 Exp 2 8 Exp 3 6 Exp 4 4 Average leaf number 2 Exp 5 0 Exp 6

Figure 4.15 Initial leaf number to express BSMYV symptoms post-inoculation in six different experiments. A) Average of initial leaf number of the control genotypes Dwarf Cavendish and Lady Finger to develop BSMYV symptoms in experiments 2, 3, and 4/5; B) Average of the initial leaf number to develop symptoms in test genotypes in experiments 2 to 6. Error bars indicate standard error of the mean (Exp 2 all genotypes n = 5 expect for Pisang Bangkahulu n = 3 and Ney Poovan n = 4; Exp 3, 4 and 5 all genotypes n = 5, Exp 6 Ma. ssp zebrina n = 9, Pisang Bangkahulu n = 7, Pahang, Ney Poovan and yesing n = 10).

115

Table 4.8 Variability in leaf streak symptoms observed on banana genotypes

Accession Leaf streak shape Leaf streak colour Long/ Short and/or spindle-shaped1 Blotches Speckles Continuous Orange Yellow Brown White Green Black

Broad, Red Broad, Fine, Fine, discontinuo Fine Coarse continuous discontinuous continuous us

Calcutta 4 X X X X X Khae Phrae X X X X X Ma. ssp. banksii X X X X X X Ma. ssp. zebrina S/X S/X X X X Pahang X XXXXX Pisang Bangkahulu S/X X X X X X Truncata X/S S/X X X X Akondro Mainty X X X X X X Paka S/X S/X X X Pisang Madu S/X S/X X X Mal-R X XXXXX Mal-S X XXXXX Gros Michel X X X X X Williams X X X X X Dwarf Cavendish S/X S/X X X X X Ney Poovan S/X X X Pacific Plantain X X X S/X X X Yesing X X X X Lady Finger S/X S/X X X X X Pisang Gajih Merah S/X X X Saba X X X 1’S’ denotes spindle shaped streaks while ‘X’ denotes short or rod-shaped streaks.

116

In a number of genotypes, particularly triploids, the types of symptoms observed changed markedly over time.

Distinguishing ‘streak’ symptoms expressed by diploid banana genotypes

Calcutta 4 (Ma ssp. burmannica) initially expressed blotchy yellow symptoms that started from the midrib and thinned out towards the leaf margin. Later leaves developed coarse, yellow and brown speckles that also began from the mid rib and became fewer towards the leaf margin. As the symptomatic leaves became older, the brown speckles became larger and turned black in colour (Figure 4.16A-C). Calcutta 4 was the only accession to follow this pattern of symptom development.

In contrast, Khae Phrae (Ma ssp. siamea) initially developed greenish-yellow, fine, short discontinuous (sometimes continuous) streaks in between the veins of the leaf lamina. Later leaves developed green and/or yellow blotchy symptoms where streaks coalesced on parts of the leaf lamina. When severe symptoms developed, streaks became more yellow in colour and necrotic patches developed where the streaks coalesced into blotches covering most of the leaf area (Figure 4.16D-F). Similarly, Ma ssp. banksii also initially developed irregular light yellow streaks which darkened on subsequent leaves to emerge. On older leaves the streaks coalesced into broad irregular streaks which varied in colour from greenish-yellow to reddish-orange, and occasionally also developed some necrosis (Figure 4.16G-I). Ma ssp. zebrina initially developed irregular, short/discontinuous streaks which were bright yellow and sometimes spindle-shaped. These sometimes coalesced into continuous streaks along the veins. As the leaves aged, the spindle-shaped streaks became reddish-orange in colour or sometimes appeared as islands with orange or yellow borders and yellow or green interiors. On leaves with severe symptoms the spindle-shaped streaks became continuous but maintained their broad, irregular shape and often developed white patches (Figure 4.16J-L). These symptoms were very similar to those observed on Truncata (Ma ssp. macrocarpa) (Figure 4.17A-C), with the major difference that the streaks on Truncata were narrower compared to Ma ssp. zebrina.

117

Figure 4.16 BSMYV symptoms observed on leaves of Calcutta 4, Khae Phrae, Ma ssp. banksii and Ma. ssp. zebrina at different developmental stages. Calcutta 4 is A, B, C showing Initial symptoms (A), later and older leaf (B) and much older leaf (C; Khae Phrae is D, E, F showing initial symptoms (D), later leaf (E) and severe symptoms (F); Ma. ssp. banksii is G, H, I showing initial symptoms (G), older leaf (H) and severe symptoms in (I); Ma. ssp. zebrina is J, K, L showing initial symptoms (J), older leaf (K) and severe symptom (L).

118

Figure 4.17 BSMYV symptoms observed on leaves of Truncata, Pahang, Pisang Bangkahulu and Akondro Mainty at different developmental or maturity stages. Truncata is A, B, C showing Initial symptoms (A), later and older leaf (B) and much older leaf (C); Pahang is D, E, F showing initial symptoms (D), older leaf (E) and much older (F); Pisang Bangkahulu is G, H, I showing initial symptoms (G), later leaf (H) and later with severe symptoms (I); Akondro Mainty is J, K, L showing initial symptoms (J), older leaf (K) and severe symptom (L).

119

Pahang and the two additional Ma ssp. malaccensis accessions, Mal-R and Mal-S, also developed symptoms which were characteristic and distinct from the other genotypes. These three accessions all developed streaks which were long, and continuous from the midrib to the leaf margin. Initially the streaks varied in colour from green to a mild yellow, but changed colour to red, brown and black on older leaves, and sometimes coalesced into large dark areas. These streaks almost always covered the entire lamina of affected leaves. In addition, Mal-R and Mal-S also sometimes developed the more typical discontinuous yellow flecks associated with streak disease, which also sometimes coalesced into broad yellow/chlorotic areas (Figure 4.17D-F).

In contrast to the other Ma ssp zebrina accession described previously, Pisang Bankahulu developed another set of distinct, characteristic symptoms. Initial symptoms on this accession showed a fine, yellow speckle which was much more prominent on the leaf margin compared to the area nearer the midrib. As later leaves emerged the streaks became continuous and much longer, nearly reaching the midrib in some cases, and were often greenish-yellow in colour, or in severe cases, white. Another distinct symptom which emerged on some later leaves was broad, spindle-shaped streaks which were yellow with green centres (Figure 4.17G-I).

Akondro Mainty also developed distinct symptoms compared to the other diploids. Initial symptoms were long, mostly continuous, orange-yellow blotches with irregular margins. As the leaves aged the blotches broadened and became brown, often with necrotic centres and when severe the leaves were almost completely yellow with some islands of green tissue and large necrotic areas (Figure 4.17J-L). Similar symptoms were not observed on any other diploid tested, but were common on several triploids (described below). Of all the diploids tested, Paka was probably the least distinctive by way of symptom development. Both Paka and Pisang Madu developed typical yellow chlorotic flecks as the initial symptom of infection. In both accessions the flecks could be short and discontinuous, or could coalesce into large areas (Figure 4.18A&D).

120

Figure 4.18 BSMYV symptoms observed on leaves of Pisang Madu, Paka and Ney Poovan at different developmental stages. Pisang Madu is A, B, C showing Initial symptoms (A), later leaf (B) and much older leaf (C); Paka is D, E, F showing initial symptoms (D), later leaf (E) severe symptom on much older leaf (F); Ney Poovan is G, H, I showing initial symptoms (G), underneath silver/white streaks (H) and later with severe symptoms (I).

121

Leaves of Paka often maintained this appearance with streaks being greenish-yellow and having diffuse margins, while in Pisang Madu the flecks often broadened into very clear spindle-shaped streaks which were yellow with red centres (Figure 4.18B). In both accessions, severe symptoms sometimes presented as large islands of yellow chlorosis with irregular or diffuse margins and extending from the midrib to the leaf margin (Figure 4.18C&F). However, the clear spindle-shaped streaks with brown centres, which coalesced into continuous streaks along the veins, was unique to Pisang Madu (Figure 4.18B). Ney Poovan, which has a possible diploid genotype, will also be described in this section due to the distinctive symptoms seen only in this accession. Ney Poovan generally displayed mild, discontinuous, yellow flecks typical of streak disease, with the streaks initially very sparsely distributed across the lamina. Interestingly, when viewed from below the leaf, these flecks were much more prominent and appeared white or light green in colour. When more severe symptoms developed, the streaks covered a larger area and coalesced into areas of continuous chlorosis, but it remained mild in appearance with a light green colour observed (Figure 4.18G-I).

Symptom expression in triploid banana accessions

Six of the triploid accessions developed symptoms following inoculation (Table 4.8). Of these, five accessions initially developed typical chlorotic flecking type symptoms of infection consisting of discontinuous and/or continuous yellow streaks parallel with the veins. These included Dwarf Cavendish, Williams, Gros Michel, Lady Finger and Pacific Plantain (Figure 4.19A-I and Figure 4.20A-C). These areas of yellow flecking would alternate between sparse and dense on different leaves and different regions of the same leaf. The shape also varied, with some rod-shaped flecks with definite margins, and others spindle- shaped or with diffuse margins. In four of the five accessions, later symptoms sometimes appeared as large yellow blotches with diffuse margins and occasionally with necrotic patches (such as Lady Finger and Gros Michel in Figure 4.19I&L), similar to Akondro Mainty (Figure 4.17l), Pisang Madu (Figure 4.18C) and Paka (Figure 4.18F). In contrast, Pacific Plantain only developed a greater area of affected leaf lamina displaying the typical yellow rod or spindle-shaped streaks, some of which coalesced into larger chlorotic areas (Figure 4.20A-C).

122

Figure 4.19. BSMYV symptoms observed on leaves of wild or cultivated triploid genotypes of Dwarf Cavendish, Williams, Gros Michel and Lady Finger at different developmental stages. Dwarf Cavendish is A, B, C showing Initial symptoms (A), different leaf with initial symptoms (B) later and older leaf with severe symptom (C); Williams is D, E, F showing initial symptoms (D), older leaf (E) and much older and severe symptomatic leaf (F); Gros Michel is G, H, I showing initial symptoms (G), later leaf (H) and later with severe symptoms (I); Lady Finger is J, K, L showing initial symptoms (J), older leaf (K) and severe symptom (L).

123

Figure 4.20 BSMYV symptoms observed on leaves of wild or cultivated triploid genotypes of Pacific Plantain, Yesing, Pisang Gajih Merah and Saba at different developmental stages. Pacific Plantain is A, B, C showing Initial symptoms (A), later and older leaf (B) and later leaf with severe symptoms (C); Yesing is D, E, F showing initial symptoms (D), later leaf (E) and older leaf with severe symptoms (F); Pisang Gajih Merah is G, H, I showing initial symptoms (G), later leaf (H) and severe symptoms in (I); Saba is J, K, L showing initial symptoms from different plants.

124

Symptoms on Yesing were quite distinct from the other triploids. Initial symptoms comprised diffuse long continuous white or yellow streaks along the veins. Later symptoms nearly always included large areas of yellow chlorosis starting from the margins of the leaves, which was usually accompanied by necrosis, also commencing at the margins of the leaves (Figure4.20D-F). Saba was the only triploid that developed characteristic and distinct streaks similar to those observed in diploids of Pahang, Mal-R and Mal-S. The streaks were long and continuous from midrib to the leaf margin with varying colours of green and yellow (Figure 4.20J-L). Pisang Gajih Merah developed broad discontinuous flecks that were yellow in colour. In some leaves very distinct elongated spindle-shaped streaks with green centres similar to those observed in Pisang Bangkahulu developed. The elongated spindle-shaped streaks were only observed in this genotype (Figure 4.20G-I).

Other symptoms

Other than the symptoms described above, cigar leaf necrosis and black stripes on the pseudostem was observed on some genotypes. Three genotypes developed cigar leaf necrosis, namely Asupina, Akondro Mainty and Pacific Plantain. All 10 plants of Asupina inoculated in Experiment 6 developed cigar leaf necrosis three to four weeks after inoculation. The plants also developed systemic necrosis which led to the collapse of the pseudostem and their eventual death. Two plants of Akondro Mainty from experiment 4 developed cigar leaf necrosis 18 weeks after inoculation while all 5 plants from experiment 5 which were kept for 48 weeks developed cigar necrosis after 24 weeks. The five plants of Pacific Plantain from experiment 5 which were kept for 48 weeks post-inoculation all developed cigar leaf necrosis at 40 weeks post-inoculation, and all five plants subsequently died. Although plants of both Akondro Mainty and Pacific plantain developed systemic necrosis, their pseudostems did not collapse as was the case with Asupina (Figure 4.21A-C). Only one genotype, namely Pahang, developed black stripes on the pseudostem (Figure 4.21D&E) in addition to the symptoms described previously.

125

Figure 4.21 BSMYV symptoms pseudostem and cigar leaves on different genotypes. A) Asupina showing cigar leaf necrosis, B) is Cigar leaf necrosis in Akondro Mainty plant, C) Pacific Plantain developing cigar leaf necrosis, D) Pahang showing black stripes on the pseudostem and E) is non-inoculated control plant of Pahang showing a health pseudostem.

126

3.5

2.5

1.5

Average severity score Average severity 1

0.5

Figure 4.22 Average symptom severity (ASS) for genotypes tested in Experiment 1. Symptoms were scored once at 12 weeks post-inoculation. Error bars indicate standard error of the mean. (n = 5).

127

Symptom severity

In experiment 1, symptom severity was scored once at 12 weeks post-inoculation, with all remaining leaves on all plants scored at this time and the ASSI calculated. The ASSI varied from 2 in Lady Finger to the maximum of 3 in Pisang Madu (Figure 4.22). The other accessions, including the Dwarf Cavendish control plants, all scored an ASSI of greater than 2. For experiments 2 to 6 the symptom severity was scored for all leaves, starting with the first leaf to develop symptoms and both the average symptom severity (ASS), calculated based on averages of selected leaves, and the average symptom severity index (ASSI), based on all leaves to develop after initial symptoms were observed until 24 weeks post- inoculation, were calculated. In the control genotypes (Dwarf Cavendish and Lady Finger), the average symptom severity (ASS) of the first leaf to express symptoms varied between Dwarf Cavendish and Lady Finger with Dwarf Cavendish scoring 1.6 to 1.8 and Lady Finger scoring 2.4 to 2.7 in experiments 2, 3 and 4/5 (Figure 4.23A). When the ASS was calculated for each genotype based on the first leaf to develop symptoms, the ASS ranged from 1.4 in Williams (experiment 2) to 3 in Pisang Bankahulu (experiment 2). Although Ma. ssp. zebrina and Gros Michel had an ASS of 1.8 and 1. 6 in experiment 2 and 3 respectively, these and all other genotypes tested had an ASS of 2 or greater in experiments 2 to 6, with eight genotypes having an ASS of greater than 2.5 in at least one experiment, demonstrating that initial symptoms of infection with BSMYV are generally severe (Figure 4.23B).

When the ASS was calculated separately for each symptomatic leaf to emerge for the two control genotypes in experiments 2 to 5, the first leaf of Dwarf Cavendish always had an ASS of less than 2.5 while the ASS of the second leaf was always higher than 2.5 (Figure 4.24A). The ASS in subsequent leaves was generally high (greater than 2.5) except in experiment 5 where the ASS decreased as leaves developed. As with Dwarf Cavendish, plants of Lady Finger generally had the lowest ASS in the first leaf to develop symptoms, with subsequent leaves having a higher ASS and this high ASS being maintained throughout the experiment (Figure 4.24B).

128

A 3.5 3 2.5 2 1.5 1 0.5 0 Average severity score Dwarf Lady Finger Dwarf Lady Finger Dwarf Lady Finger Cavendish Cavendish Cavendish Exp 2 Exp 3 Exp 4/5

B 3.5

2.5

1.5

1 Average severity score Average severity 0.5

0 Paka Mal-S Mal-S Mal-R Mal-R Yesing Yesing Pahang Williams Williams Truncata Calcuuta 4 Calcuuta Khae Phrae Khae Phrae Ney Poovan Ney Ney Poovan Ney Gros Michel Gros Michel Pisang Madu Pisang Pisang Bangk Pisang Pisang Bangk Pisang Pacific Plantain Pacific Ma. ssp.banksii Ma. ssp.zebrina Akondro Mainty Ma. ssp. zebrina Ma. ssp. Exp 2 Exp 3 Exp 4/5 Exp 6

Figure 4.23 Average severity score (ASS) on the initial leaves to develop symptoms following inoculation with BSMYV. A) ASS on the first leaves to develop symptoms in control genotypes Dwarf Cavendish and Lady Finger in independent inoculations of experiment 2, 3 and 4/5; B) ASS on the first leaves to develop symptoms in test genotypes in experiments 2, 3, 4/5 and 6. Error bars indicate standard error of the mean. (Exp 2 all genotypes n = 5 expect for Pisang Bangkahulu n = 3 and Ney Poovan n = 4; Exp 3, all genotypes n = 5, Exp 4/5 all genotypes n = 10; Exp 6 Ma. ssp zebrina n = 9, Pisang Bangkahulu n = 7, Pahang, Ney Poovan and Yesing n = 10).

129

Dwarf Cavendish

3.5 3 2.5 2 1.5 1 0.5 Average severity score 0 123456 Leaf number

Exp 2 Exp 3 Exp 4/5

Lady Finger 3.5 3 2.5 2 1.5 1 0.5 0 Average severity score 123456 Leaf number

Exp 2 Exp 3 Exp 4/5

Figure 4.24 Average severity scores per leaf in five plants the control genotypes Dwarf Cavendish and Lady Finger from experiment 2 to 5. 1 to 6 is leaf 1 to leaf 6 of the five plants of Dwarf Cavendish and Lady Finger. Plants did not produce the same number of leaves in all experiments. Error bars indicate standard error of the mean. (Exp 2 and 3 n = 5 for leaves 1 to 4 in Lady Finger and 1 to 6 in Dwarf Cavendish , Exp 4/5 n = 10 for leaves 1 to 5 in Lady Finger and 1 to 6 in Dwarf Cavendish).

130

Average symptom severity index (ASSI)

The ASSI was calculated based on all leaves that developed over the course of each experiment. The ASSI in the two control genotypes was calculated for experiments 2, 3 and 4/5 and was similar in experiments 2 and 3. However, in experiment 4/5, Lady Finger had a slightly significant higher ASSI of 2.8 as compared to Dwarf Cavendish that had 2.3 (Figure 4.25A).

When the ASSI was calculated for each genotype based on all leaves to develop over the course of each experiment, genotypes with the A only genomes had an ASSI varying between 2.2 (Ma. ssp. zebrina, experiment 2) as the lowest value and 2.9 (Khae Phrae and Pisang Bangkahulu, experiment 2) as the highest. The rest of the genotypes ranged between 2.3 and 2.8 with all the genotypes with B-genome compliment notably having either 2.7 or 2.8 in all experiments (Figure 4.25B).

4.4 Discussion

Work reported in this chapter aimed at determining the infectivity of a BSMYV infectious clone across a diverse collection of 24 banana accessions with six different genotypes (AAA, AA, BB, AAB, ABB, AT) and to subsequently evaluate the growth rate and symptom expression of BSMYV-infected plants under glasshouse conditions. The banana accessions included in this study comprised both wild and cultivated diploid and triploid bananas derived from several Musa species. Out of the 24 accessions assessed, 22 were found to be susceptible to BSYMV based on symptoms and molecular diagnosis using either PCR or RCA. The susceptible accessions contained genome types of AAA, AA, AAB, ABB or AT. Interestingly, the two diploid BB accessions M. balbisiana and Butuhan did not express any BSMYV symptoms and tested negative for the virus by RCA. Diploid M. balbisiana has been reported to possess valuable agronomic traits, such as resistance to diseases and the ability to confer drought tolerance (Ude et al., 2002). Therefore, the absence of BSMYV infection in these two accessions may be associated with its ability to confer disease resistance.

131

3.5

2.5

2 DC 1.5 LF

1 Average severity score index 0.5

0 Exp 2 Exp 3 Exp 4/5

B 3.5 3 2.5 2 1.5 1 0.5 0 Paka Average severity score indexI Mal-S Mal-S Mal-R Mal-R Yesing Yesing Pahang Williams Williams Truncata Calcutta 4 Khae Phrae Khae Phrae Ney Poovan Ney Ney Poovan Ney Gros Michel Gros Michel Pisang Madu Pisang Pacific Plantain Pacific Ma. ssp. banksii Ma. ssp. Akondro Mainty Ma. ssp. zebrina Ma. ssp. Ma. ssp. zebrina Ma. ssp. Pisang Bangkahulu Pisang Pisang Bangkahulu Pisang Exp 2 Exp 3 Exp 4/5 Exp 6

Figure 4.25 Average severity score index (ASSI) in control and test genotypes. A) ASSI in control genotypes Dwarf Cavendish and Lady Finger in experiment 2, 3 and 4/5; B) ASSI in test genotypes in experiments 2, 3, 4/5 and 6. Error bars indicate standard error of the mean (Exp 2 all genotypes n = 5 expect for Pisang Bangkahulu n = 3 and Ney Poovan n = 4; Exp 3, all genotypes n = 5, Exp 4/5 all genotypes n = 10; Exp 6 Ma. ssp zebrina n = 9, Pisang Bangkahulu n = 7, Pahang, Ney Poovan and Yesing n = 10).

132

The BSMYV infectious clone was shown to be highly infectious, with 100% infectivity in the 22 out of 24 accessions which became infected. These levels are high compared with previous reports, where infectivity ranged from 11% to 57% (Dahal et al., 1999, 2000; Nyaboga et al., 2008). The absence of symptoms in a number of field studies reported previously may simply be associated with escape of infection due to plant age (adult plants are more resistant to viral infection) (Lecoq et al., 2004), the inability of vectors to acquire and transmit the virus, or a consequence of the semi-persistent transmission of BSV by mealybug vectors (Ng and Falk, 2006; Lecoq et al., 2004). his result alone demonstrates the great practical utility of infectious clones to screen germplasm for disease resistance.

In the current study, the effects of virus infection on two growth characteristics, namely the leaf emergence rate and the plant height, were evaluated. The effects of BSMYV infection varied from the rapid death of plants in accession Asupina (AT) to a significant reduction in the plant height in a number of accessions, such as Akondro Mainty (AA), Ma. ssp. zebrina (AA), Pahang (AA), Yesing (AAB), Pacific Plantain (AAB), Ma. ssp. banksii (AA), Calcutta 4 (AA) and Pisang Bangkahulu (AA). In contrast, there was no significant difference in the rate of leaf emergence between the infected and non-infected plants in any of the accessions tested. Although there was a significant reduction of bunch weight by 15% and a delay of bunch emergence by 9 days in BSV-infected Dwarf Cavendish bananas in Australia (Dahal et al., 2000; Daniells et al., 2001), this is the first record demonstrating the effects of BSMYV on plant height and leaf emergence.

Infected plants showed a considerable amount of variation in the time to develop symptoms. For example, Asupina expressed symptoms as early as 3 weeks post-inoculation, while several genotypes with some B-genome component did not develop symptoms until more than 24 weeks after inoculation. Generally, however, most accessions developed symptoms within five to six weeks post-inoculation. During field and screen-house trials carried out in Nigeria, infection by BSV occurred within four to eight weeks, which is consistent with the majority of results from the present study (Dahal et al., 1999).

133

A range of different symptoms were observed which included typical leaf streaks (chlorotic flecks), cigar leaf necrosis and blackening of the pseudostem. Leaf streaks varied considerably between the genotypes, including variations in colour (white, yellow, orange, green, red and brown), shape (fine or broad, spindle- or ‘eye-shaped’, speckles) and length (continuous/discontinuous). Notably, symptoms were often characteristic to specific genotypes, particularly for the diploid AA accessions, especially at the initial stages of expression. Within a genotype, the type of streaks sometimes changed remarkably during disease progression. Variability of symptoms in triploids sometimes reflected those observed in several diploids.

Cigar-leaf necrosis and systemic necrosis and collapse of the pseudostem were reported on cultivar Kamaramasenge (AAB) in Rwanda (Lockhart, 1995). In the current study this type of symptom was observed in four accessions, namely Asupina (AT), Akondro Mainty (AA), Pacific Plantain (AAB) and Khae Phrae (AA). Asupina suffered cigar-leaf necrosis and severe systemic necrosis with subsequent collapse of the pseudostem. Akondro Mainty and Pacific Plantain also had cigar-leaf necrosis but the pseudostem did not collapse. Khae Phrae suffered systemic necrosis and collapse of the pseudostem but did not show any cigar-leaf necrosis. Black stripe symptoms on the pseudostem were observed on Mysore (AAB) in Honduras (Jones, 2000). This type of symptom was observed on Pahang (AA) in the current study. Unfortunately, in the previous studies the species of BSV infecting was not characterised and so direct comparisons with the types of symptoms seen are difficult to make.

There was also considerable variation in the way symptoms were distributed within the same leaf and between leaves of the same plant across genotypes. Leaves of the same plant would vary in their severity score from zero (no symptoms) to three (severe symptoms). Leaves occasionally emerged with no streaks (score zero) before and/or after those with severe symptoms (score 3). This was not a unique observation in BSV infected bananas for leaves to emerge with no streaks in between leaves with symptoms because Dahal et al., (1998) reported a similar trend during an assessment of effects of intra-plant variation in

134

viral accumulation. It was observed that when infecting banana genotypes with BSMYV, the ASSI was very high in all cultivars. This suggests that, at least in the case of BSMYV, ASSI is not a useful measure for differentiating the reaction of banana accessions. However, further studies with other BSV species might show that in other combinations of BSV species/banana accessions the ASSI can be useful to discriminate between accessions/genotypes.

Unique and characteristic symptoms were observed in most diploids. Calcutta 4 (Ma ssp. burmannica), for example, expressed initial blotchy yellow symptoms that started from the midrib and thinned out towards the leaf margin and on later leaves brown speckle-like symptoms developed. This is the first report showing that Calcutta 4 can become infected with BSV, since in previous studies relying on natural infection in Nigeria this accession did not express symptoms (Dahal et al., 1999). However, since the plants described were not tested for the presence of BSV they may have simply not become infected. Long continuous streaks, beginning from the midrib to the leaf margin with alternating colours of green and yellow were exclusively observed in the Ma. ssp. malaccensis (Pahang, Mal-R and Mal-S). A similar symptom description of fine longitudinal chlorosis was observed on naturally- infected tetraploid hybrids of AAAB with BSOLV in Nigeria (Dahal et al., 1999). However, there was no pictorial evidence to compare with what was observed in this study. Genotype Akondro Mainty expressed symptoms of orange blotches that were unique from the other diploids. This description was given to the cultivar ‘Enyeru’ (AAA) in Uganda by Jones (2000) however again the BSV isolate present was not identified.

Triploids with a genome composition of AAB (Lady Finger, Pacific Plantain and Yesing) expressed symptoms which varied considerably and often appeared similar to several of the diploid accessions. Lady Finger expressed symptoms similar to both Ma. ssp. zebrina and Akondro Mainty, while Pacific Plantain had symptoms similar to Truncata and Ma ssp. banksii. Yesing had necrotic portions on every infected leaf in addition to diffuse, long, continuous streaks along the veins on the initial leaves to show symptoms, which changed to whitish-yellow streaks and orange-yellow blotches on leaves that developed later. In Uganda, triploids with a similar genome composition including cultivar Kamaramasenge

135

(AAB) expressed cigar leaf necrosis, while Gonja (AAB) had broad chlorotic streaks (Lockhart, 1995). Cultivar Mysore (AAB) in Honduras expressed spindle/eye-shaped streaks and black stripes on the pseudostem. In Australia and Trinidad, the same genotype had black stripes on the leaves (Jones, 2000; Lockhart, 1995). Dwarf Cavendish in this study had broad greenish-yellow, short, discontinuous spindle-shaped streaks, while on later leaves orange- yellow blotchy symptoms were seen. In Uganda, the same genotype expressed fine streaks (Harper et al., 2002). When infected with the BSMYV infectious clone, Gros Michel developed symptoms that were different from what was observed in Uganda as being green vein banding (Harper et al., 2002). However, it is difficult in most cases to compare symptoms describe in previous reports with those observed in the present study since in most cases, the BSV isolates in these earlier published studies was not identified. To gain a clearer understanding of the symptom expression in different accessions/genotypes further studies with additional infectious clones must be undertaken.

In the current study, some diploids classified in the same subspecies expressed the same leaf streaks. For example, genotype Pahang, Mal-R and Mal-S expressed a similar symptom pattern and all belong to the subgroup Ma. ssp. malaccensis. Other diploids expressed different symptom patterns and yet were classified under the same subspecies. For example, Pisang Bangkahulu and Ma ssp. zebrina expressed different symptom patterns although they both belong to the subgroup Ma ssp. zebrina. However, accessions such as Calcutta 4 and Pisang Bangkahulu, classified as Ma ssp. burmannica and Ma ssp. zebrina, respectively, also expressed similar symptoms. This result suggests that not all accessions from a particular genotype could be expected to reproduce the symptoms seen in one member.

In conclusion, this chapter has demonstrated that using the BSMYV infectious clone to screen banana genotypes is highly reliable, rapid and convenient. This study confirms that different banana genotypes react differently to the same BSV isolate. The effects of BSMYV range from rapid death as observed in Asupina to significant decrease in plant height as observed in a number of the genotypes tested. The current research has demonstrated that all genotypes with genome composition of AT, AA, AAA, AB, AAB and ABB were susceptible to BSMYV, whereas genotypes with a genome composition of BB were resistant. As a diverse

136

collection of BSV species infects bananas in different geographic regions worldwide, further work on the effects of these viruses on plant growth and symptomatology could be carried out using infectious clones of other BSV species. This would demonstrate if the growth effects and symptoms observed following BSMYV infection are consistent with infection in these banana genotypes by other BSV species.

137

5CHAPTER 5: ASSESSMENT OF BANANA STREAK MY VIRUS DNA LEVELS IN MUSA GENOTYPES USING QUANTITATIVE REAL-TIME-PCR

5.1 Introduction

Evaluation of banana streak virus (BSV) infection in fields and screen houses has shown tremendous variation in symptom expression. It has been shown that symptoms vary according to Musa genotypes and also with environmental conditions. This variation has also been associated with geographical locations, seasons of the year and different years. Variation of BSV infection according to different parts of the banana plant has also been reported (Gauhl and Pasberg-Gauhl, 1999; Dahal et al., 1998, 1999; Karanja et al., 2013). Different isolates of BSV produce varying symptoms in Musa genotypes under natural conditions (Lockhart, 1995; Dahal et al., 1998; 2000).

In the previous chapter, it was reported that different banana genotypes react differently in terms of symptom expression to the same BSV species under glasshouse conditions. End point polymerase chain reaction (PCR) as a diagnostic method is limited to the detection of viral DNA in banana genotypes without any B-genome component using species-specific primers. Whereas rolling-circle amplification (RCA) can differentiate episomal infections from the presence of integrated BSV sequences (James et al., 2011b), it cannot quantify the level of viral DNA in the plant. Immuno-capture based methods such as enzyme-linked immunosorbent assay (ELISA) or immuno-capture-PCR have been used for detection and to determine the relative concentration of the viral antigens (Rodoni et al., 1999; Barbara and Clark, 1982), but may not be sensitive enough to show differences in the virus levels between genotypes. Real-time PCR has been used to effectively detect BSV using specific primers (Delanoy et al., 2003). Elsewhere, because of its sensitivity, real-time PCR has been used to quantify virus DNA levels, with as few as 10 viral genome copies of Tomato yellow leaf curl Sardinia virus (TYLCSV) measured in infected plants (Mason et al., 2008). Despite numerous reports on the variations in symptoms produced due to BSV infection, there are no reports estimating and comparing viral loads across different banana genotypes over a given time. Evaluation of BSV infection in Musa using symptoms is unreliable because symptom expression is highly influenced by genotype, as demonstrated in the previous

138

chapter. Therefore estimating viral load in different genotypes may reveal how different genotypes react to the same BSV isolate. This formed the basis of work reported in the present chapter where BSMYV viral DNA was quantified using quantitative real-time PCR to determine the viral load across different Musa genotype over time.

The, the specific objectives of this part of the project were: 1. To quantify the levels of BSMYV DNA in genotypes which became infected; 2. To investigate whether there is any specific trend in viral accumulation across different genotypes; and 3. To investigate if there was any correlation between viral load and symptom severity scores.

5.2 Materials and methods

5.2.1 Absolute quantification of viral DNA by real-time qPCR Total nucleic acid extracts were previously prepared from leaf samples collected in the glasshouse screening experiments described in Chapter 4. To enable absolute quantification of the viral load, a standard curve was prepared using a 10-fold serial dilution of plasmid DNA which contained a copy of the qPCR amplicon. The plasmid DNA was prepared and quantified as described in sections 2.5.1 and 2.5.2 and the standard curve was prepared as described in sections 2.5.3 and 2.5.4. Absolute quantification of viral DNA by real-time qPCR was done as described in section 2.5.5.

To normalise the amount of TNA in each sample, extracts were quantified using a NanoDrop

2000 UV/Vis spectrophotometer. The A260/A280 ratio was determined for all TNA extracts and those within the range of 1.8 to 2.2 were used for subsequent analysis by qPCR. All extracts were tested in triplicate to generate technical replicates and in each qPCR run a plasmid DNA standard curve was included, which was used to estimate the viral load in the test samples. Additional controls included in all analysis were an extract from a non-inoculated plant from each genotype tested (on the same qPCR run as the respective test samples), as well as no- template controls on all runs. The absolute copy number of BSMYV DNA in test samples was calculated using the default settings of the Rotor-Gene Q series software v1.7 using the

139

standard curve generated from the plasmid DNA. As a control for variation between qPCR runs the PCR efficiency, based on the slope of the standard curve, was considered acceptable between a range of 90 and 105 (Figure 5.1). Raw data was exported to Microsoft Excel for further analysis. Means of the technical replicates for each sample and the associated standard error were calculated using Excel. In some cases, during the analysis to determine average values, as well as maximum and minimum normal values for each genotype, outliers were excluded. Background qPCR values calculated from non-inoculated control plants of each accession were subtracted from the calculated viral load in each test plant of the same accession.

5.3 Results

5.3.1 Quantification of BMYV DNA in leaves of Musa genotypes over time In Chapter 4, seven independent glasshouse experiments were carried out to assess the infectivity, growth rate and symptom expression in a collection of banana genotypes inoculated with the native BSMYV infectious clone. Experiments 2, 4/5 and 6 all included 8- 10 accessions, in addition to the two control accessions (Dwarf Cavendish and Lady Finger) which were included in experiments 2 and 4/5. Leaf samples were collected, beginning with the first leaf to express symptoms, up to 24 weeks post-inoculation. For the analysis in the present chapter, the first leaf to develop symptoms was labelled leaf 1, with each successive leaf labelled in series. At the time of sampling all leaves were scored for symptom severity (described previously in Chapter 4). TNA was extracted from all leaf samples and PCR carried out using 18S primers (Table 2.6) to confirm suitability for screening by PCR (results not shown). Extracts which tested positive were considered suitable for qPCR analysis. Estimation of the viral load in all samples was made by comparison to plasmid DNA standard curves included with each qPCR run (Figure 5.1).

Experiment 2 (see Table 4.3) Ten accessions were inoculated in this experiment (Table 4.3) including the two controls Dwarf Cavendish and Lady Finger. Seven of the eight test genotypes had an A-only genome, while Ney Poovan has some B-genome complement. All plants of the two controls (Dwarf Cavendish and

140

Figure 5.1 Example standard curves generated during qPCR when quantifying BSMYV DNA in leaf samples. A) Example standard curve generated when testing plants from glasshouse inoculation experiment 2 showing efficiency of 97%; B) Example standard curve generated when testing plants from glasshouse inoculation experiment 4 showing efficiency of 100%.

141

Lady Finger) developed symptoms about 10-11 weeks post-inoculation, with plants from seven of the test accessions also developing symptoms from about 10-13 weeks. However, plants of Ney Poovan developed symptoms from 18 weeks post-inoculation. As a result there were fewer leaves of Ney Poovan available for qPCR analysis over the study period and for this reason Ney Poovan was excluded from the analysis in this section. For the two controls and other seven accessions the viral load was determined from all leaves to develop after initial symptoms were observed.

In the Dwarf Cavendish control plants seven leaves were assessed from each of the five plants over the study period. Based on the viral load determined in all samples, the levels of BSMYV DNA were observed to fluctuate considerably, both within plants and between plants (Figure 5.2A). The viral load ranged from its lowest of 4.2 x 102 to 1.57 x 104 across the five plants up to its highest of 4 x 105 to 9.72 x 105 copies/50ng gDNA across the five plants. The first highest peak observed in different plants was in a range of 31,000 to 94,000 copies/50ng gDNA. The peak was observed in either leaf 2 or 3 after the initial symptoms (Figure 5.2A). The only obvious trend observed was an increase in the viral load, which reached a maximum in the second or third leaf to develop symptoms, and was followed by a significant decrease in the viral load in subsequent leaves which developed. In 3 of the 5 plants, a second distinct peak in the viral load was observed, two to three leaves later than the initial maximum. However, in the other two Dwarf Cavendish plants in experiment 2 (labelled as plants 2 and 3 in Figure 5.2A) there is an upward trend in the qPCR values, suggesting a copy number increase may be commencing in these plants too. The average of the first peak in the viral load for the five plants was 5 x 104 genome copies (Figure 5.2C). Interestingly, when plants 1, 4 and 5 with an obvious second peak are considered, the second peak in viral load is higher than the first (Figure 5.2C).

Similarly, in the Lady Finger control plants, 6 to 7 leaves were assessed from each of the five plants over the study period. As with the Dwarf Cavendish plants the viral load was observed to fluctuate considerably both within and between plants. The range of the lowest viral load for each plant was 1.17 x 104 to 5.18 x 105 genome copies, up to a range of 1.03 x 105 to 1.93 x 105 genome copies observed as the maximum (Figure 5.2B). Also similar to Cavendish was the observation of an initial peak in the viral load in all five plants in the second to fourth

142

leaves to show symptoms, which again decreased significantly in the subsequent leaves, and again increased to a second peak in four out of five plants (not in plant 3). Interestingly, in plant 5 there was also a third peak obvious by leaf 7 post-inoculation. The second peak in the viral load in Lady Finger plants was higher than the first peak in two plants (plants 2 and 4), but lower than the first peak in another two plants (plants 1 and 5), with no obvious second peak in the remaining plant (plant 3) based on the samples assessed. However, on average, the number of genome copies in these second peaks was lower in Lady Finger when compared to the first peak (5.2C).

In the other seven accessions assessed in experiment 2, samples were collected from between 6 and 8 leaves for each plant from the onset of symptoms until 24 weeks post- inoculation. A trend similar to the controls was also observed in these accessions, with significant fluctuations in the viral load in all accessions, again both within plants and between plants (Appendix 1.1). The minimum level of BSMYV DNA quantified across the accessions varied from several hundred copies, to several thousand copies in most plants, although in 28.5% of cases the lowest value recorded was in the order of x 105. The maximum level of BSMYV DNA quantified across the accessions also varied considerably, from tens of thousands of genome copies up to several hundred thousands of copies. With the exception of Williams, where the highest viral load measured was 9.61 x 104, all accessions had a maximum value of over 2 x 105, with over 8 x 105 copies/50ng gDNA detected in one leaf from accessions Mal-S. The ranges of lowest and highest viral load in five of the accessions was comparable with the two control accessions, however in Mal-R and Mal-S the maximum values were significantly higher when compared to the controls and other test accessions. But these high maximum values reflect the effect of some very high viral loads measured in one or two plants for each, which affects the averages considerably. As with the controls, the observation of an initial first peak in the viral load within the first four leaves was consistent in all accessions (Appendix 1.1). The average values of this initial peak varied from equal or less than Dwarf Cavendish in Khae Phrae, Gros Michel and Williams, to equal or greater than Lady Finger in the other four accessions (Figure 5.2C). Where a clear second peak in the viral load could be observed, this was higher than the first peak in three accessions, lower than the first peak in one accession and equal to the first peak in one accession (Figure 5.2C).

143

120000

100000

Plant-1 80000 Plant-2 60000 Plant-3 40000 Plant-4 Plant-5 20000 Average viral DNA copy number 0 Leaf-1 Leaf-2 Leaf-3 Leaf-4 Leaf-5 Leaf-6 Leaf-7

250000

200000 Plant-1 150000 Plant-2 Plant-3 100000 Plant-4

50000 Plant-5 Average viral DNA copy number 0 Leaf-1 Leaf-2 Leaf-3 Leaf-4 Leaf-5 Leaf-6 Leaf-7

C 350000 300000 250000 200000 150000 100000 50000 0

Genotype Average viral DNA copy number

peak 1 peak 2

Figure 5.2 Graphs showing how viral DNA copy number accumulated in each leaves of the control genotypes in experiment 2. A) Viral load accumulation in leaves of Dwarf Cavendish plants B) Viral load accumulation in leaves of Lady Finger plants; c) Average viral load of the first and second maximum accumulation in the nine accessions. Error bars indicate standard error of the mean. (All genotypes n = 5 expect for Pisang Bangkahulu n = 3 and Ney Poovan n = 4).

144

Experiment 4/5 (see Table 4.5) Eleven of the 12 accessions inoculated in experiments 4/5 developed symptoms within 4-7 weeks of inoculation (Table 4.5). Plants of Pisang Gajih Merah did not develop symptoms and tested negative for BSMYV infection and so were omitted from the qPCR analysis. As several plants of genotypes Khae Phrae, Ma ssp. banksii and Akondro Mainty died during the experiment, these plants were also omitted from the qPCR analysis. The viral load was determined from all leaves to develop, after the observation of initial symptoms, from all other plants.

As in experiment 2, the viral load fluctuated between leaves of the same plant and also between plants of the same accession. In Dwarf Cavendish the range of minimum viral load measurements obtained was similar to experiment 2, however, the range of maximum viral load measurements in this experiment were higher than experiment 2 and ranged from 4 x 104 to 3.92 x 105 copies/50ng gDNA (Figure 5.3A). In Lady Finger, the range of both the minimum and maximum values for each plant were within the ranges obtained in experiment 2 (with the exception of plant 7 leaf 2 with a very high viral load detected (Figure 5.3B). The trend in change of viral load over time was similar to experiment 2 where an increase of viral load reached a maximum in the second and third leaf to develop symptoms in Dwarf Cavendish and between second and fourth leaf in Lady Finger. This peak in the viral load was followed by a significant decrease in the viral load in subsequent leaves which developed in both accessions. However, in this experiment, the number of leaves which developed in the control plants were fewer when compared with experiment 2 and therefore the second peak was only observed in two plants in Dwarf Cavendish and two plants in Lady Finger. The average viral load of the first peak was 2.3 x 105 in Dwarf Cavendish and 1.13 x 105 in Lady Finger copies/50ng gDNA (Figure 5.3C).

As with the two control accessions, the number of leaves available for assessment in the experiments 4/5 was usually 3 to 7 for each plant. As previously, the viral load in all accessions fluctuated between leaves of the same plant and also between plants of the same genotype. The ranges of both the minimum and maximum viral load calculated in all accessions were within the ranges obtained in the two control genotypes (Appendix 1.2). Most plants from most accessions reached an initial peak in the viral load within the first two

145

to four leaves to develop symptoms. The average of the first peak was lowest in Ma ssp. banksii and Truncata with 5.0 x 104 and 4.2 x 104 copies/50ng gDNA, respectively, followed by Yesing with 6.1 x 104. These three accessions were all significantly lower than the controls and the other genotypes tested in experiment 4/5. Pisang Madu and Pacific Plantain plants had similar values to the Lady Finger control, with an initial peak of 1.24 x 105 and 1.4 x 105, respectively. Calcutta 4, Khae Phrae, Akondro Mainty and Paka had similar levels of BSMYV DNA to the Dwarf Cavendish plants (Figure 5.3C).

Of the nine accessions assessed in experiment 4/5, probably the best example of the fluctuating trend in viral accumulation was observed in Ma ssp. banksii (Appendix 1.2C). Most of the plants of this accession developed 6 or more leaves which were assessed using qPCR. Interestingly, in 7 out 10 plants there are two clear peaks in the viral load, but in one of these plants (plant 1), there is also a clear third peak in the viral load seen, suggesting this phenomenon of viral DNA fluctuation continues beyond the two clear peaks seen in a number of plants from different accessions. In the other accessions, some plants in some genotypes also showed an obvious second peak, however due to variability in plant growth between genotypes, not all plants showed this second peak (Appendix 1.2). In most cases, where a second peak was observed, it was higher than the first peak.

Experiment 6 (see Table 4.6) Of the ten accessions inoculated in experiment 6, six became infected with BSMYV (Table 4.6). Of these, Asupina plants all died shortly after infection, while Ney Poovan plants developed symptoms from 18 weeks onwards, and so these two accessions were excluded from the qPCR analysis. The remaining four accessions developed symptoms within four to five weeks post-inoculation and so qPCR was carried out on all leaves from this time until 24 weeks post-inoculation. As in the previous experiments the viral load fluctuated between leaves of the same plant and also between plants of the same accession (Appendix 1.3). The range of minimum and maximum of the viral loads in the four accessions were within the ranges observed in experiments 2 and 4/5. In all accessions, an initial peak in the viral load was observed within the first three leaves to develop symptoms.

146

B 300000 Plant 1 250000 Plant 2 Plant 3 200000 Plant 4 150000 Plant 5 100000 Plant 6 Plant 8 50000 Plant 9 0 Plant 10 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5

C 450000 400000 350000 300000 250000 200000 150000 100000 50000 0 Average viral DNA copy number

Figure 5.3 Viral DNA copy number accumulated in leaves of the control and test genotypes in experiment 4/5. A) Viral load accumulation in leaves of Dwarf Cavendish plants B) Viral load accumulation in leaves of Lady Finger plants; c) Average viral load of the first maximum accumulation in the eleven test accessions. Error bars indicate standard error of the mean (All genotypes n = 10).

147

This peak was significantly lower in Pisang Bangkahulu (5.2 x 104 copies/50ng gDNA) compared with the three other genotypes, while Ma ssp. zebrina was also significantly lower (9.5 x 104 copies/50ng gDNA) compared to Pahang and Yesing (1.55 x 105 and 1.53 x 105 copies/50ng gDNA, respectively) (Figure 5.4). In Pahang, 5 of the 10 plants had an obvious second peak in the viral load, with the second peak higher than the first peak in 2 out of the 5 plants (Appendix 3A). Similarly, in Ma. ssp. zebrina, 4 of the 9 plants tested had an obvious second peak in the viral load, with the second peak higher in two of the plants. In Pisang Bankahulu the growth rate was slower compared to the previous two genotypes, so fewer leaves were available to assess the change in viral load over time. For two of the seven plants assessed a second, higher, peak in the viral load was detected while in three additional plants the trend in viral load was increasing in the final sample collected, indicative that maybe a higher viral load was forthcoming. Yesing also grew more slowly compared to Pahang and Ma. ssp. zebrina, with one peak in viral load observed in the first two to three leaves in all nine plants assessed, with two plants showing a second peak in the viral load, although this second peak was lower.

5.3.2 Comparison between severity scores and viral load In experiment 4/5, all leaves from all plants were given a severity score, beginning with the first leaf which developed symptoms. Samples were then collected from all leaves, TNA extracted and infection confirmed using PCR or RCA (see Chapter 4). To determine if there was a correlation between the symptom severity and the levels of BSMYV DNA in infected plants, qPCR was carried out on all leaves which developed from the initial symptoms until 24 weeks post-inoculation.

148

200000 180000 160000 140000 120000 100000 80000 60000 40000

Average viral DNA copy number 20000 0 Pahang Ma. ssp. Zebrina Pisang Bangkahulu Yesing Genotypes

Figure 5.4 The average viral load at the first peak of accessions tested in experiment 6. Error bars indicate standard error of the mean (Ma. ssp zebrina n = 9, Pisang Bangkahulu n = 7, Pahang and Yesing n = 10).

149

The viral load of BSMYV DNA was determined for all leaves of Dwarf Cavendish plants 3, 5 and 6 from experiment 4/5 and was compared with the symptom severity. In plant 3, seven leaves were assessed and the severity scores compared to the viral DNA copy number quantified. Leaf 1 had a score of 1 while leaves 2, 3, 4, 5 and 7 had a score of 3 and leaf 6 had a score of 2 (Figure 5.5). In six of the seven leaves tested by qPCR, approximately 1 x 105 copies or less were detected, however leaf 4 was significantly higher at over 2 x 105 copies. Similarly, in Dwarf Cavendish plant 5, of the six leaves assessed, four had a score of 3 (leaves 2, 3, 4, and 6) while leaf 1 and 6 had a score of 2 and 1, respectively. However, leaves 2, 3, 4, and 6 with the same severity score accumulated significantly different viral DNA copy numbers, ranging from 1 x 104 copies in leaf 6 to 2.75 x 105 copies in leaf 3 (Figure 5.6). In Dwarf Cavendish plant 6, there was also a significant difference in the symptom severity between the six leaves which developed over the course of the experiment, as well as the BSMYV DNA copy number in each leaf as determined using qPCR (Figure 5.7).

As in Dwarf Cavendish, the viral load was determined for all leaves of Lady Finger plants 4, 5 and 6 from experiment 4/5 and was again compared with the symptom severity. As in Dwarf Cavendish plants, the symptom severity in individual leaves from Lady Finger did not correlate with the amount of viral DNA quantified using qPCR (Figures 5.8-5.10). In plant 4, an initial increase in the viral load was consistent with an increase in the symptom severity, however in leaves 3 to 6 the symptom severity reached a maximum of 3, but the amount of virus DNA fluctuated significantly between 1 x 104 and 7.5 x 104 copies, and was much less than leaf 2 (1.6 x 105 copies) which also had a severity score of 3. Leaf 1, with severity score 1, had a viral load higher than leaf 3 to 5 which had a severity score of 2 or 3 (Figure 5.8). Similarly, in plants 5 and 6, there was a significant fluctuation in the viral load between leaves. In plant 5 the trend was for low levels of BSMYV DNA in the first two leaves, where a score of 2 was recorded, with higher levels of virus DNA in subsequent leaves, correlating with an increase in the symptom severity (Figure 5.9). In contrast, in plant 6 the symptom severity and viral load were not correlated with 5 out 6 leaves having a severity score of 3, but the viral load ranging from 1.5 x 103 (leaf 6) to 1.25 x 105 (leaf 2; Figure 5.10). When the severity scores from leaves from the other test accessions in experiment 4/5 were compared with the level of BSMYV DNA as determined by qPCR the results were, in most cases, like the two controls (Appendix 2).

150

3 250000

2.5 200000

2 150000 1.5 100000

Severity score 1

50000 0.5 Average viral number dna copy

0 0 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6 Leaf 7

Viral DNA copy number severity score

Figure 5.5 Leaves of plant 3 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. A) Leaves 1 to 7 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

151

B 3 300000

2.5 250000

2 200000

1.5 150000

Severity score 1 100000

0.5 50000 Average viral DNA copy number

0 0 Leaf 1Leaf 2Leaf 3Leaf 4Leaf 5Leaf 6

Viral DNA copy number severity score

Figure 5.6 6 Leaves of plant 5 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

152

B 3 300000

2.5 250000

2 200000

1.5 150000

Severity score 1 100000

0.5 50000 Average viral DNA copy number

0 0 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6

Viral DNA copy number severity score

Figure 5.7 Leaves of plant 6 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

153

3 250000

2.5 200000

2 150000 1.5 100000

Severity score 1

50000 0.5 Average viral number dna copy

0 0 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6 Leaf 7

Viral DNA copy number severity score

Figure 5.8 Leaves of plant 3 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. A) Leaves 1 to 7 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

154

B 3 300000

2.5 250000

2 200000

1.5 150000

Severity score 1 100000

0.5 50000 Average viral DNA copy number

0 0 Leaf 1Leaf 2Leaf 3Leaf 4Leaf 5Leaf 6

Viral DNA copy number severity score

Figure 5.9 6 Leaves of plant 5 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

155

B 3 300000

2.5 250000

2 200000

1.5 150000

Severity score 1 100000

0.5 50000 Average viral DNA copy number

0 0 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6

Viral DNA copy number severity score

Figure 5.10 Leaves of plant 6 in genotype Dwarf Cavendish and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

156

B 3 180000 160000 2.5 140000 2 120000 100000 1.5 80000 1 60000 Severity score 40000 0.5 20000 0 0 Average viral DNA copy number Leaf 1Leaf 2Leaf 3Leaf 4Leaf 5Leaf 6 Axis Title

Viral DNA copy number severity score

Figure 5.11 Leaves of plant 4 in genotype Lady Finger and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

157

3 160000

140000 2.5 120000 2 100000

1.5 80000

60000

Severity score 1 40000 0.5 20000 Average viral DNA copy number 0 0 Leaf 1Leaf 2Leaf 3Leaf 4Leaf 5

Viral DNA copy number severity score

Figure 5.12 Leaves of plant 5 in genotype Lady Finger and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

158

3 140000

2.5 120000 100000 2 80000 1.5 60000 1 40000 Severity score 0.5 20000 0 0 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6 Average viral DNA copy number Axis Title

Viral DNA copy number severity score

Figure 5.13 Leaves of plant 6 in genotype Lady Finger and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores.

159

5.3.3 Calculation of the viral load in genotypes with delayed infection (AB and ABB) In genotypes Ney Poovan, Saba and Pisang Gajih Merah there was a significant delay in the development of symptoms following inoculation with the infectious clone in Chapter 4. Four plants of Ney Poovan were inoculated in experiment 2, with plants not developing symptoms until 18 weeks post-inoculation. Similarly, in experiment 6, ten plants were inoculated and infection again was delayed until 18 weeks post-inoculation. Ten plants of Pisang Gajih Merah were inoculated in experiments 4/5 and did not develop symptoms however 5 plants inoculated in experiment 6 developed symptoms from 28 weeks post- inoculation. Similarly, ten plants of Saba inoculated in experiment 6 did not become infected however five plants inoculated in experiment 7 developed symptoms after 32 weeks post- inoculation.

As the plants from these genotypes became infected much later than the other genotypes tested they were assessed separately in the present work. To quantify the viral load, infected plants of genotype Ney Poovan and Pisang Gajih Merah from experiment 6 and Saba plants from experiment 7 were used. The number of leaves which emerged between the initial symptoms and at the end of the experiment varied between plants. For all of the plants which were assessed for viral load using qPCR, only plants with between 3 and 5 symptomatic leaves were included.

In Ney Poovan, plants 3 and 7 had five symptomatic leaves, plants 2 and 8 had four symptomatic leaves, plants 4 and 6 had three symptomatic leaves, while plants 5, 9 and 10 had two symptomatic leaves and plant 1 had only one symptomatic leaf. Therefore only 6 plants with three or more leaves were included in viral load analysis. Of the six plants assessed the viral load was generally low in four of the plants, ranging from 2.07 x 104 to 4.16 x 104 copies/50ng gDNA (plants 2, 4, 6 and 8 in Figure 5.11A). However, in two plants (3 and 7 in Figure 5.11A) the viral load was considerably higher than the other four plants assessed. In plant 7 the initial viral load detected was very high, however by the 5th leaf this had decreased significantly to a similar level as plants 2, 4, 6 & 8. Similarly, in plant 3, the viral load increased to be 1.8 x 105 copies/50ng gDNA in the second leaf and subsequently decreased in leaves 3 to 5. The average viral load determined based on the highest viral load

160

level in each plant assessed was 7.9 x 104 copies/50ng gDNA (Figure 5.12). For Pisang Gajih Merah plants sampled in experiment 6, only three leaves were available to sample from each plant. For two of the five plants the first leaf sampled showed the highest viral load, while the viral load in plants 2 and 3 was still increasing in the third leaf. Interestingly the viral load in plant 4 was significantly higher than the other four plants and showed a significant increase from leaves 1 to 2 and then a significant decrease from leaf 2 to 3 (Figure 5.11B). The average of the highest values from the 5 plants was 1.28 x 105 copies/50ng gDNA (Figure 5.12).

For Saba plants sampled in experiment 7, four out of the five plants tested had between three and five leaves available for analysis. In three plants there was a clear, significantly higher peak in the viral load in the first or second leaf sampled, which decreased significantly in the subsequent leaves to develop (Figure 5.11C). In contrast the viral load in plant 2 remained relatively low throughout the five leaves tested. The average of the highest values across the four plants analysed was 1.516 X105 copies/50ng gDNA which was not significantly different from Ney Poovan and Pisang Gajih Merah (Figure 5.12).

The average of the highest viral load value determined in these three genotypes (Ney Poovan, Pisang Gajih Merah and Saba) was within the range of values observed in experiment 2 (Figure 5.2), 4/5 (Figure 5.3) and 6 (Figure 5.4). The highest viral load in experiment 2 was approximately 1.6 x 105 in Pisang Bangkahulu, while the lowest was approximately 4 x 104 in Khae Phrae. In experiment 4/5 the highest viral load was 3 x 105 in Paka and lowest approximately 5 x 104 in Truncata and Ma. ssp banksii. While in experiment 6 the highest viral load of approximately 1.4 x 105 was in Pahang and Yesing, while the lowest was Pisang Bangkahulu with a viral load of 5 x 104 copies/50ng gDNA.

161

400000 350000 Plant 2 300000 250000 Plant 3 200000 Plant 4 150000 Plant 6 100000 Plant 7 50000 Plant 8 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5

400000 350000 300000 Plant 1 250000 Plant 2 200000 Plant 3 150000 Plant 4 100000 Plant 5 50000

Average viral DNA copy number 0 leaf 1 leaf 2 leaf 3

C 250000

200000

Plant 1 150000 Plant 2 100000 Plant 3 Plant 4 50000

0 Average viral DNA copy number leaf 1leaf 2leaf 3leaf 4leaf 5

Figure 5.14 Viral DNA copy number accumulated in leaves of the genotypes in experiment 6 and 7. A) Viral load accumulation in leaves of Ney Poovan in experiment 6; B) Viral load accumulation in leaves of Pisang Gajih Merah plants in experiment 6; and C) Viral load accumulation in leaves of Saba plants in experiment 7.

162

250000

200000

150000

100000

50000 Average viral DNA copy number

0 Ney Poovan Ney Poovan Pisang Gajih Pisang Gajih Saba Saba Non- Non-infected Merah Merah Non- infected infected

Figure 5.15 Average Viral load accumulation of the highest value in leaves of Ney Poovan, Pisang Gajih Merah in experiment 6 and Saba in experiment 7. Error bars indicate standard error of the mean (Ney Poovan n = 10, Pisang Gajih Merah and Saba n = 5).

163

5.4 Discussion

Estimation of virus accumulation in plants can be used to evaluate their resistance or tolerance as well as for basic studies of plant-virus interactions (Ferriol et al. 2011; Balaji et al., 2003). This chapter aimed at quantifying the levels of BSMYV DNA in leaves of infected banana accessions over time, to investigate if there was a specific trend in BSMYV DNA accumulation across different banana accessions and to determine if any correlation existed between viral load and symptom severity scores. Based on the viral load determined in all leaf samples, the levels of BSMYV DNA were observed to fluctuate considerably both within plants and between plants. In general, the viral load increased to an initial first peak before it significantly decreased. A second or a third peak was sometimes observed, followed by associated significant decreases in the viral load in plants that produced a greater number of leaves.

In general, the first or second peaks in the viral load were reached at different times in different plants both within and between accessions. A similar fluctuation in virus accumulation has been reported in broad bean (Vicia faba) where Broad bean wilt virus-1 reached an initial peak in the viral load at 7 days post-inoculation, followed by a second peak at 23 days, with a significant decrease observed at 19 days post-inoculation. Similarly, in Chenopodium quinoa plants an initial peak in the BBWV-1 viral load was observed at 19 days post-inoculation followed by a significant decrease by day 23 (Ferriol et aL., 2011). The significant variation in viral load between leaves of the same plant of different banana accessions seen in the present study is also consistent with previous work in citrus with Citrus tristeza virus (CTV) accumulating to different levels in different parts of infected plants (Ruiz-Ruiz et al., 2007). Previous studies of BSV infection in banana in Nigeria showed that incidence of symptoms, percentage of leaves per plant with symptoms and ASSI values of tetraploid TMPx banana hybrids fluctuated according to seasons (Dahal et al., 2000). Based on the qPCR results to determine the viral load in accessions inoculated at different times of the year in this study with experiment 6, 2 and 4/5 inoculated in February, July and September respectively, there appears to be no significant difference in the trend in viral DNA accumulation or in the levels of viral DNA determined based on the time of year that plants are inoculated/grown. Whether this trend is specific to infection with BSMYV will only

164

be determined by inoculating similar banana accessions with alternate BSV species. Alternatively, the reaction seen in tetraploid hybrids, not included in the present study, may be different from the predominantly wild diploid and cultivated triploid accessions available.

Screening of the collection of banana accessions in chapter 4 showed that several accessions with genotypes of AB or ABB had a significant delay in symptom development. This contrasted with the majority of accessions with AA, AAA and AAB genotypes where symptom development was observed much sooner following inoculation (usually 4 to 5 weeks). Although fewer leaves of the AB and ABB genotypes were available for assessing, qPCR was carried out to investigate whether the viral load in these genotypes was equivalent to the accessions from other genotypes. In general, when considering the first peak in the viral load, accessions with AA, AAA and AAB genome compositions accumulated higher amounts of BSVMYV DNA, in the order of 1.98 x 105 (±3.72 x 104) genome copies compared to AB and ABB genotypes which accumulated significantly lower viral DNA levels of 1.2 x 105 (±2.14 x 104) genome copies/50ng gDNA. Quantification of viral DNA accumulation in different cultivars, has not been done before and this was the first time to be done. Therefore, it will be interesting if a similar study was done using a different BSV species and compare with the current data.

Variation in symptom expression, distribution of symptoms, relative concentration between and within plants as well as variations within individual leaves was reported by Dahal et al., (1998). However, the virus isolate/s in these studies were not characterised. In the present study, it is confirmed that different genotypes accumulate and react differently to BSMYV. In most cases, the viral DNA accumulated in individual leaves did not correlate with the symptom severity expressed on the same leaf. In the same genotype, the initial leaves with symptoms varied between plants in terms of symptoms coverage. However, the viral DNA quantified did not correlate with the severity score. The first or second peak of viral DNA accumulation was reached on leaves that did not necessarily have the highest severity score. Similarly, the lowest viral DNA accumulated did not always occur on leaves with the lowest severity scores. In conclusion, different banana accessions reacted differently to BSMYV as observed in viral DNA accumulation. Generally, the AA, AAA and AAB genotypes accumulated significantly higher viral load as compared to accessions with AB and ABB

165

genotypes. All genotypes demonstrated a consistent pattern of viral DNA accumulation, with obvious peaks in the viral load followed by significantly lower levels detected in subsequent leaves. This variation in the viral load was not consistent with the symptom severity scores.

166

6CHAPTER 6: ASSESSMENT OF BANANA STREAK MY VIRUS BASED VECTORS FOR HETEROLOGOUS GENE EXPRESSION AND GENE SILENCING IN BANANA

6.1 Introduction

The exploitation of plant viruses as infectious clones (IC) provides an excellent tool for research into viral gene functions as well as virus-host interactions. To date, infectious clones of many RNA and DNA plant viruses have been generated and used as either gene expression vectors or vectors for virus-induced gene silencing (VIGS) (Dawson and Folimonova, 2013; Purkayastha and Dasgupta, 2009, Purkayastha et al., 2010). A number of approaches have been applied in the construction/modification of viral infectious clones into vectors including (i) sequence addition, (ii) sequence replacement, (iii) deletion of non- essential ORFs and (iv) the use of heterologous promoters. Several RNA and DNA viruses have been modified to facilitate gene expression and silencing in both dicots and monocots.

The first RNA virus to be modified was Tobacco mosaic tobamovirus (TMV), where the heterologous gene Phytoene desaturase (pds) was added to the virus genome, and was subsequently expressed in inoculated Nicotiana benthamiana plants, leading to a photo- bleaching phenotype as a result of silencing of pds in leaves (Takamatsu, 1987; Kumagai et al., 1995). Since these early reports improvements have been made to TMV vectors, leading to the development of hybrid vectors involving virus sequences from a combination of different viruses in the genus Tobamovirus.

The first DNA virus to be used as an infectious clone or for the expression of heterologous sequences in plants was the dsDNA virus Cauliflower mosaic caulimovirus (CaMV). CaMV was initially modified by the addition of an 8 nt EcoRI linker which was successfully inserted at the intergenic region between ORFs VI and I. In later studies, an ~1 Kb fragment encoding the neomycin phosphotransferase gene (nptII) was also successfully expressed (Fütterer et al., 1990; Gronenborn et al., 1981; Howell, 1983). Similarly, the tungrovirus, Rice tungro bacilliform virus (RTBV), which also possesses a dsDNA genome and belongs in the family Caulimoviridae, has been used as an expression vector. The RTBV infectious clone was constructed by preparing a greater than full-length RTBV genomic DNA cloned into a plant

167

expression vector. This clone contained the complete virus genome, with a second intergenic region present downstream of the coding sequences, to enable expression of the greater than unit-length RNA transcript produced when the virus DNA is expressed in plant cells. Following inoculation into rice plants this infectious clone was detected using PCR and also caused symptoms. The original infectious clone was subsequently modified by deleting two small ORFs of unknown function, namely ORF1 and ORF2, but retained the complete sequence of the large ORF3 which encodes the major gene products required for the virus life cycle. As before this construct was shown to be infective in rice plants. To improve its infectivity, additional modifications replaced the native RTBV tissue-specific viral promoter with the constitutive maize ubiquitin promoter to allow expression in all plant tissues. Other sequences such as the tRNA-binding site to allow reverse transcription during replication and those that were necessary for optimal translation initiation of the viral genes were also added (Purkayastha et al., 2010).

The modification of RTBV into a vector was the initial basis for the development of an infectious clone of Banana streak MY virus (BSMYV-IC) reported by Bjartan (2012). Since BSMYV has a similar genome organisation as RTBV, it was considered to be a suitable candidate for manipulation as a vector for gene expression or silencing studies in banana. Bananas are an important crop worldwide and are a major research focus within the CTCB, particularly in the areas of biofortification and disease resistance. The development of a plant virus vector for the purposes of gene expression and/or silencing in banana would provide an important research tool with a multitude of applications.

The BSMYV infectious clone generated by Bjartan (2012) was shown previously in this study to infect a large collection of banana genotypes, demonstrating that it may be suitable for gene expression and silencing studies in a range of Musa sp. genotypes. The identification of infectious BSMYV clones capable of heterologous gene expression or gene silencing would provide a rapid and high throughput tool for a range of genetic studies in bananas. The aim of work reported in this chapter, therefore, was to assess a range of modified BSMYV clones for their infectivity in banana and to assess their potential as vectors for either expression of foreign sequences or to elicit silencing.

168

Therefore, the specific objectives were: 1. Assess a series of BSMYV deletion mutants for infectivity in banana; 2. Assess putative BSMYV-based expression constructs for infectivity and expression of a reporter gene; and 3. Assess putative BSMYV-based gfp silencing constructs for infectivity and silencing capability.

6.2 Methods and materials

6.2.1 Plant materials Transgenic Lady Finger banana plants transformed with construct pART-test7, containing a Cauliflower mosaic virus 35S promoter driving expression of a jellyfish (Aequorea victoria) green fluorescent protein (GFP) gene, were provided by CTCB. Plants of Musa acuminata ssp. malaccensis (Mal), Dwarf Cavendish and Gros Michel were prepared as described in sections 2.4.1.1, 2.4.1.2 and 2.4.2.

6.2.2 Construction of deletion mutants of the native BSMYV infectious clone A number of deletion mutants of the BSMYV-IC based vectors, previously prepared in the CTCB (Table 6.1), were used in this study. These constructs were prepared using a PCR-based strategy described here briefly. The native BSMYV-IC (Figure 6.1) was digested using PvuI and BstXI to excise the 5` intergenic region (IR), ORF1, ORF2 and 5` part of ORF3. Four PCR- amplified fragments were generated using specific primers (Table 2.1) including (i) the IR only (primers INT-F/INT-R); (ii) a complete ORF2 and partial (first 464 nucleotides until the BstXI site) ORF3 sequence using primers ORF2-F/BstXI-R; (iii) the IR and complete ORF1 using primers INT-F/ORF1-R; and (iv) only the partial ORF3 sequence using primers ORF3-F/BstXI-R. An ORF1 deletion mutant (BSMYV-ICΔ1) was constructed by ligating fragments 1 and 2 into the PvuI/BstXI digested native BSMYV-IC (Figure 6.2B). In a similar fashion, an ORF2 deletion mutant (BSMYV-ICΔ2) (Figure 6.2C) and an ORF1/2 deletion mutant (BSMYV-ICΔ1/2) (Figure 6.2D) were constructed by ligating fragments 3 & 4 or 1 & 4, respectively. As a control for cloning the PCR-derived fragments, a fourth vector (BSMYV-ICΔ0) combined fragments 2 and 3 to re-construct the ‘native’ BSMYV-IC with the inclusion of two restriction enzymes sites engineered between ORF1 and 2 (Figure 6.2E).

169

Four additional constructs were derived from these by cloning a GFP reporter gene ORF possessing a 5` PstI and 3` SbfI site into the junction of the two PCR-derived fragments used to construct each clone described previously. A native BSMYV-IC construct containing a GFP ORF in the 3` UTR was also prepared (by CTCB and provided for use in this study) to investigate an alternative position for the insertion of a foreign sequence. Finally, to investigate silencing of previously transformed Lady Finger plants with construct pART-test7, two potential silencing constructs were derived from BSMYV-ICΔ0 (again provided by CTCB) which possessed either a 50 nt sequence from the 3` end of the GFP ORF (BSMYV-ICΔ0-50nt- GFP) or a 110 nt sequence from the 3` end of the GFP ORF (BSMYV-ICΔ0-110nt-GFP) inserted at the MCS between ORF1 and 2. In total eleven different constructs were used in this study in addition to the native BSMYV construct described previously (Table 6.1).

6.2.3 Transformation and inoculation of deletion mutants All constructs were transformed into A. tumefaciens as described in section 2.4.6.8. Preparation of A. tumefaciens and subsequent plant inoculation was done as described in sections 2.4.3.1 to 2.4.3.2. In all experiments, the native BSMYV-IC was used as a positive control.

6.2.4 PCR and RCA amplification of BSMYV TNA was extracted from samples as described in section 2.4.5.1 and all PCRs were done as described in section 2.4.6.2. Control PCR assays to confirm the quality of TNA extracts used primers 18S-F/R (Table 2.1) with an annealing temperature of 55°C. PCR screening for residual A. tumefaciens used primers AGL1-F/R (Table 2.1) with an annealing temperature of 64°C. PCR to detect BSMYV used primers Mys-F/R (Table 2.1) with an annealing temperature of 61°C and PCR screening for GFP used primers GFP-F/R with an annealing temperature of 55°C. RCA was carried out as described in section 2.4.6.4.

6.2.5 Visualisation of green fluorescent protein (GFP) expression Banana leaves were analysed using a Leica MZ12 stereomicroscope with a GFP-plus fluorescence module. A green barrier filter (BGG22, Chroma Technology) was used to visualise GFP fluorescence in leaf tissue containing chlorophyll.

170

Figure 6.1 Vector map of native BSMYV-IC. The restriction sites PvuI and BstXI were utilised in the development of the deletion mutant constructs

171

Figure 6.2 Schematic representations of native BSMYV-IC and deletion mutant constructs. The red bar indicates the multiple cloning site for insertion of additional sequence.

172

Table 6.1 Infectious clone constructs used in this study

Construct name Abbreviation Purpose Native Banana streak MY virus IC BSMYV-IC Control vector Null mutant with cloning site BSMYV-ICΔ0 ORF1 deletion mutant BSMYV-ICΔ1 ORF2 deletion mutant BSMYV-ICΔ2 Test for infectivity ORF1&2 deletion mutant BSMYV-ICΔ1/2 ORF1 deletion mutant with GFP ORF BSMYV-ICΔ1-GFP ORF2 deletion mutant with GFP ORF BSMYV-ICΔ2-GFP Test for expression of ORF1&2 deletion mutant with GFP ORF BSMYV-ICΔ1/2-GFP GFP Null mutant with GFP ORF BSMYV-ICΔ0-GFP Native BSMYV-IC with 3` GFP ORF BSMYV-3`GFP Null mutant with 50 nt of GFP BSMYV-ICΔ0-50nt-GFP Test for silencing of GFP Null mutant with 110 nt of GFP BSMYV-ICΔ0-110nt-GFP

173

6.3 Results

6.3.1 Infectivity of deletion mutant constructs Three deletion mutant constructs were initially assessed for their infectivity in banana. These constructs included an ORF1 deletion mutant (BSMYV-ICΔ1), an ORF2 deletion mutant (BSMYV-ICΔ2), and a deletion mutant with both ORF1 and 2 deleted (BSMYV-ICΔ1/2). As a control, the native BSMYV infectious clone (BSMYV-IC) was used. For each construct four plants of Musa acuminata ssp. malaccensis (Mal) were agro-inoculated as described in sections 3.4.3.1 to 3.4.3.2 and plants were monitored for 32 weeks.

Initial sampling was carried out at 8 weeks post-inoculation, at which time no plants had developed symptoms. When TNA extracts from all plants were screened using primers 18S- F/R (housekeeping PCR assay) an amplicon of the expected 500 bp size was observed in all samples tested (results not shown). When extracts were screened using primers Mys-F/R, the four extracts from plants inoculated with the native BSMYV-IC all amplified the expected 589 bp PCR product, while the extracts prepared from the plants inoculated with the three deletion mutant constructs all tested negative (Figure 6.3). All plants were subsequently sampled at week 16 post-inoculation at this time all four plants inoculated with the native IC had developed typical symptoms of BSMYV infection, while all plants inoculated with the deletion mutant constructs remained symptom-free. PCR screening results were the same as at 8 weeks post-inoculation, with all four plants inoculated using the native BSMYV-IC testing positive by PCR, while all plants inoculated using the three deletion mutants again tested negative. When the plants were tested at 32 weeks post-inoculation there was no change from the results at 16 weeks.

A second inoculation experiment was carried out with each construct agro-inoculated into five Mal plants and plants monitored for a period of 24 weeks. As before, plants inoculated

174

Figure 6.3 PCR screening of TNA extracts from 16 plants inoculated with the native BSMYV-IC and different constructs 16 weeks post-inoculation. A) A1 to A4: plants 1 to 4 inoculated with native BSMYV-IC, B1 to B4: plants inoculated with construct BSMYV-ICΔ1; and B) C1 to C4: plants inoculated with construct BSMYV-ICΔ2, D1 to D4: plants inoculated with construct BSMYV- ICΔ1/2. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

175

with all three deletion mutants remained free of symptoms for the entire period and tested negative for BSMYV infection using PCR, while all five plants inoculated with the native BSMYV-IC developed symptoms and tested positive for BSMYV infection using PCR (at 16 weeks post-inoculation).

In addition to the four inoculations described, an additional set of five plants of cultivar Gros Michel were agro-inoculated with a 1:1 mixture of BSMYV-ICΔ1 and BSMYV-ICΔ2. At 16 weeks post-inoculation, four out of five plants had developed typical disease symptoms and all five plants tested BSMYV positive by PCR using primers Mys-F/R. To investigate the sequence of the putative recombinant virus/es, further analysis was carried out. PCR was done using primers MY-ORF1-F and MY-ORF2-R (Table 2.1) which amplify the complete ORF1 and ORF2 region of the BSMYV genome. PCR products generated from the five plants varied in size compared to the expected size of approximately 930 nt (Fig 6.4a; Table 6.3). Two additional PCRs were done to amplify either ORF1 (using primers MY-ORF1-F/R; Table 2.1) or ORF2 (using primers MY-ORF2-F/R; Table 2.1). Amplicons of the expected sizes were obtained from all plants (Figure 6.4b&c). The ORF1 and ORF2 PCR products from all plants were cloned and sequenced as described in sections 3.4.6.7 to 3.4.6.10. Sequencing of these PCR products confirmed the complete ORF1 and ORF2 sequences were present in all plants.

To determine the nucleotide sequences of the full ORF1/2 PCR products, these were also cloned into pGemT-Easy and for each plant three independent clones were completely sequenced in both directions (Table 6.2). In plant 1, all three clones contained an identical 828 nt insert, with the first 240 nt being identical to the 5` 240 nt of ORF1, and the last 399 nt being identical to the complete ORF2 sequence. There was also an additional 189 nt of unknown sequence between the ORF1 and 2 sequences, with no significant homology to any published sequence in the NCBI database when used as a query in BLASTN analysis as described in section 2.4.6.13. In plant 2, all three clones contained an identical 815 nt insert. These inserts included the 5` 416 nt of ORF1 and the complete 399 nt of ORF2. Interestingly there were no additional sequences in the clones from plant 2. In plant 4, all three clones contained an identical 887 nt insert which included the 5` 454 nt of ORF1 and the complete ORF2 sequence, as well as an additional 34 nt of unknown sequence between the ORF1 and

176

Figure 6.4 PCR screening of TNA extracts from five plants inoculated with a mixture of BSMYV-ICΔ1 and BSMYV- ICΔ2, at 16 weeks post-inoculation. A) PCR amplification of ORF1 and 2 using MY-ORF1-F and MY-ORF2-R primers; B) PCR amplification of ORF1 using MY-ORF1-F/R; and C) PCR amplification of ORF2 using MY ORF2-F/R primers. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

177

Table 6.2 Sequence analysis of PCR products cloned from plants inoculated with BSMYV-ICΔ0-50nt-GFP.

Plant no. Fragment PCR product ORF1 PacI site GFP SbfI site ORF2 Other no. size (nt) size present size present size (nt) sequence (nt) (nt) (nt) 1 1 996 531 Yes 50 Yes 399 2 308 262 46 3 298 262 36 2 1 996 531 Yes 50 Yes 399 3 1 996 531 Yes 50 Yes 399 2 632 341 291 3 298 262 36 4 1 996 531 Yes 50 Yes 399 7 1 988 531 Yes 50 No 399 2 779 531 230 18 Expected result 996 531 Yes 50 Yes 399 n/a

178

2 sequences. Similarly, in plant 5 all three clones contained an identical 930 nt insert which included the complete ORF1 and ORF2 sequences and were identical to the native BSMYV sequence. The PCR amplicons from plant 3 included 2 clones of 1005 nt comprising the complete ORF1 and ORF2 sequences with 75 nt of unknown sequence between them, while the third clone had the 5` 531 nt of ORF1 and the 3` 399 nt of ORF2 in the correct configuration.

6.3.2 Assessment of putative expression constructs for infectivity and expression of GFP A series of constructs which encoded GFP were used to assess the potential for using BSMYV as an expression vector. These vectors were based on either a reconstructed native BSMYV vector sequence containing a multiple cloning site between ORF1 and 2, named BSMYV-ICΔ0 or the ORF1 and 2 deletion mutant vectors described previously (Table 6.1). One additional vector included a GFP ORF inserted into the 3` intergenic region of the native BSMYV-IC, namely BSMYV-3`GFP.

Four Mal plants were inoculated with BSMYV-ICΔ0 to confirm infectivity with the additional 20 nt sequence containing two restriction enzyme recognition sites between ORF1 and 2. Three out of four plants displayed symptoms at 16 weeks post-inoculation and all three plants with symptoms were confirmed positive for BSMYV infection using PCR (Figure 6.5). To confirm whether the infectious virus had retained the two restriction sites, PCR was used to amplify the full ORF1/2 sequence from the three plants which tested positive, and these were subsequently cloned and sequenced. Sequence analysis showed that the BSMYV sequence in plant 1 had retained both the PacI and SbfI sties (Figure 6.6a), while in plant 2 only partial sequences of the cloning sites remained (Figure 6.6b). In plant 3, the entire cloning sites were missing (Figure 6.6c). This result was confirmed in a second infectivity test with BSMYV-ICΔ0 where cloning and sequencing of the region spanning the multiple cloning site (MCS) from different infected plants again showed several different sequences being maintained in different infected plants, including some with and without the MCS (Figure 6.6d). The three deletion mutant constructs containing a full-length GFP ORF as well as BSMYV-ICΔ0-GFP were then each inoculated into four Mal plants and observed for 32 weeks.

179

Figure 6.5 PCR screening of TNA extracts from plants inoculated with BSMYV-ICΔ0 and BSMYV-ICΔ0-GFP, at 16 weeks post-inoculation. A1 to A4 are plants inoculated with BSMYV-ICΔ0 while B1 to B4 are inoculated with BSMYV-ICΔ0-GFP. +ve = positive control, -ve = negative control. M is EasyLadder I (Bioline).

180

Figure 6.6 Sequence analysis of amplicons generated from from plants inoculated with BSMYV-ICΔ0 at 16 weeks post-inoculation. A) Sequence analysis of PCR amplicons generated from plant 1 showing multiple cloning site (MCS) of PacI/SbfI intact (black box includes sites for Pacl (TTAATTAA) and SbfI (CCTGCAGG)); B) sequence analysis of PCR amplicons generated from plant 2 showing SbfI site (black box) and extra 4 nucleotides (CTAA) on the left side (black underline); C) sequence analysis of PCR amplicons generated from plant 3 with no cloning site in between ORF1 and ORF2; and D) sequence analysis of 10 clones from 3 independent plants assessed in the repeat inoculation experiment, with four out of ten showing the presence of the PacI/SbfI MCS (black box). Labels MON indicate sequence reads from independent clones used in the alignment with ORF1 and ORF2 of BSMYV. Text highlighted in yellow indicates mismatches in the sequence alignment.

181

At the end of 32 weeks all plants inoculated with either BSMYV-ICΔ1-GFP, BSMYV-ICΔ2-GFP or BSMYV-ICΔ1/2-GFP remained free from symptoms of infection and all plants tested negative by PCR using primers Mys-F/R (18S PCR was positive). In contrast, one out of four plants inoculated with BSMYV-ICΔ0-GFP had developed symptoms by 16 weeks post- inoculation and also tested PCR positive for BSMYV (Figure 6.5).

To assess the presence of visual expression of GFP, leaf samples from all inoculated plants as well as non-inoculated controls and plants inoculated with the native BSMYV-IC were collected at 8 and 16 weeks post-inoculation. As a positive control, leaf tissue from a banana plant transformed with GFP was used. When leaf samples from the positive control were observed using a GFP microscope there was a clear green fluorescence observed, which was not present in the non-inoculated banana leaf sample or samples from plants inoculated using the native BSMYV-IC. When leaf samples from the four IC constructs with GFP were observed under the microscope no fluorescence was detected at either 8 or 16 weeks, including in the one plant inoculated with BSMYV-ICΔ0-GFP which had developed symptoms.

To investigate whether the BSMYV-ICΔ0-GFP-inoculated plant which had developed symptoms had retained the GFP sequence, PCR was used to amplify across the entire ORF1 and ORF2 region. A PCR product of about 1 Kb was amplified from TNA of a leaf sample collected at week 8 post-inoculation and this was cloned and sequenced. Sequence analysis revealed that BSMYV-ICΔ0-GFP infected plant maintained a 67 nt region identical to the 3’end of the GFP sequence as well as the 8 nt SbfI restriction site used for preparing the vector (Figure 6.7a). Similar analysis done at week 16 post-inoculation confirmed this 75 nt insert was retained within the virus genome (Figure 6.7b).

In a repeat inoculation experiment, three of the four constructs (BSMYV-ICΔ1-GFP, BSMYV- ICΔ2-GFP and BSMYV-ICΔ1/2-GFP) were inoculated into five Mal plants, while BSMYV-ICΔ0- GFP was inoculated into 10 Mal plants. As before, the three ORF1 and/or 2 deletion mutants did not develop symptoms and were PCR negative for BSMYV at 16 weeks post-inoculation

182

Figure 6.7 Sequence analysis of amplicon derived from plants inoculated with BSMYV-ICΔ0-GFP. A) Sequence analysis of PCR amplicon generated from plant 2 at 8 weeks post-inoculation showing a partial GFP fragment of 67 nt inserted between ORF1 and ORF2 (black underline) and SbfI site (CCTGCAGG) retained (black box); B) sequence analysis of the same plant as (A) after 16 weeks post-inoculation retaining the same insert of partial GFP fragment (black underline); and C) sequence analysis of plant 5 in a repeat inoculation expressing BSMYV symptoms showing a partial GFP fragment of 122 nt (black underline) and partial PacI site (TTAA) small box flanking to the left side of sequence and full site of SbfI (CCTGCAGG) (black box) to the right side.

183

and no GFP expression was observed in leaf tissue collected from these plants. Of the ten plants inoculated with BSMYV-ICΔ0-GFP, one plant had developed symptoms by 16 weeks post-inoculation, however, three plants tested positive for BSMYV using PCR. These additional two plants eventually developed symptoms by 24 weeks post-inoculation. As with the other three GFP constructs no GFP expression was observed in any of the plants inoculated with BSMYV-ICΔ0-GFP. Cloning and sequencing across the ORF1/2 region of the virus from the three infected plants confirmed that one of the three plants had retained a 122 nt fragment from the 3` end of the GFP ORF, as well as a partial sequence of the PacI restriction site and the full SbfI restriction site (Figure 6.7c), while the other two plants did not have any additional sequence remaining between ORF1 and ORF2.

As an alternative to inserting a foreign sequence between ORF1 and 2, an additional construct was assessed which contained the GFP ORF inserted into the 3` IR (BSMYV-3`GFP). When this construct was agro-inoculated into 10 Mal plants, nine plants developed symptoms of BSMYV infection and tested PCR positive at 8 weeks post-inoculation. However, when leaf samples from these ten plants were assessed for GFP expression by microscopy at 16 weeks post-inoculation no GFP expression was observed. When TNA extracts from the 10 plants were screened by PCR for the presence of the GFP ORF all plants tested negative. To determine if the infectious virus in the plants with symptoms retained any of the GFP ORF, PCR was carried out on TNA extracts prepared from leaf samples collected at 16 weeks post-inoculation using primers INT-F/INT-R (Table 3.1) and the amplicon from five plants was cloned and sequenced. Sequence analysis of the PCR amplicon from the five plants showed that none of the GFP ORF sequence remained with the IR sequence reverting to match the native sequence.

6.3.2.1 Putative silencing vectors

Based on the earlier results of screening using the construct BSMYV-ICΔ0, with and without the GFP ORF sequence, two putative silencing constructs were assessed for infectivity, their ability to retain a foreign sequence and their potential for silencing a transgene. These two constructs were derived from BSMYV-ICΔ0 and possessed either a 50 nt sequence from the 3` end of the GFP ORF (BSMYV-ICΔ0-50nt-GFP) or 110 nt sequence from the 3` end of the

184

GFP ORF (BSMYV-ICΔ0-110nt-GFP) inserted at the MCS between ORF1 and 2. These constructs were agro-inoculated into 10 plants each of transgenic Lady Finger bananas representing 10 putative independent lines stably transformed using a 35S-GFP construct. At 6 weeks post-inoculation all 10 Lady Finger plants inoculated using BSMYV-ICΔ0-110nt-GFP developed symptoms of infection with BSMYV, while nine out of 10 Lady Finger plants inoculated using BSMYV-ICΔ0-50nt-GFP developed symptoms. TNA was extracted from all plants and PCR screening using primers Mys-F/R confirmed that all plants with symptoms were infected.

To confirm whether the virus in the infected plants had retained the inserted GFP fragments, PCR was carried out using primers which amplify the complete ORF1 and 2 region of BSMYV. PCR from the 20 plants resulted in a range of products which varied between plants. In all ten plants inoculated with BSMYV-ICΔ0-110nt-GFP an amplicon of approximately 1 Kb was present while nine out ten plants inoculated with BSMYV-ICΔ0-50nt-GFP also had an approximately 1 Kb amplicon, although in some plants this amplicon was faint (Figure 6.8). In addition to the expected approximately 1 Kb amplicon a number of unexpected, smaller products were also generated from the PCR screening. To determine if the expected, approximately 1 Kb products retained the inserted GFP sequences, as well as to determine the nucleotide sequences of some of the smaller PCR products, a selection were cloned and sequenced (Table 6.3). Sequencing of the approximately 1 Kb amplicon from plants 1, 2, 3 and 4 inoculated with BSMYV-ICΔ0-50nt-GFP confirmed a 996 nt amplicon which was identical to the expected sequence from the original IC construct. In contrast, sequencing of the approximately 1 Kb amplicon from plant 7 inoculated with BSMYV-ICΔ0-50nt-GFP identified a 988 nt sequence with only the SbfI site not present when compared to the original construct sequence. Two additional PCR products of approximately 400 nt and 300 nt were cloned and sequenced from plant 1 (Table 6.3). Sequence analysis of these two amplicons showed that the larger fragment comprised 308 nt, of which 262 nt were identical to ORF1 and the remaining 46 nt had no significant sequence match, while the smaller fragment comprised 298 nt which (like the 308 nt fragment) also had 262 nt identical to ORF1 and the remaining 36 nt had no significant sequence match. As with plant 1, two additional PCR amplicons, of approximately 700 nt and 300 nt, from plant 3 were cloned and sequenced.

185

Figure 6.8 PCR amplification from TNA extracts from 10 plants inoculated with BSMYV-ICΔ0-50nt-GFP and with BSMYV-ICΔ0-110nt-GFP with 50 or 110 nt of GFP inserts using MY-ORF1-AsiSIF and MY-ORF2-SbfIR primers 16 weeks post-inoculation. A) PCR amplification from plants inoculated with BSMYV-ICΔ0-50nt-GFP; and B) PCR amplification from plants inoculated with BSMYV-ICΔ0-110nt-GFP. +ve = positive control, -ve = negative control. M is HyperLadder I (Bioline).

186

Table 6.3 Nucleotide composition of PCR products across ORF1 and ORF2 of plants inoculated with a mixture of BSMYV-ICΔ1 and BSMYV-ICΔ2

Plant no. PCR product ORF1 size ORF2 size Missing Additional size (nt) (nt) (nt) sequence (nt) sequence1 (nt) 1 828 240 399 291 189 2 815 416 399 115 3 1005 531 399 75 926 531 399 4 887 454 399 77 34 5 930 531 399 Expected 926 531 399 n/a n/a 1 All additional sequences located between ORF1 and ORF2.

187

Figure 6.9 Sequence analysis of PCR products from plants inoculated with BSMYV-ICΔ0-50nt-GFP and BSMYV-ICΔ0-100nt-GFP 16 weeks post-inoculation. Sequence analysis of 5 plants showing the presence of the 50 nt GFP insert (underlined) as well as the PacI (left box) and SbfI (right box) sites; and B) sequence analysis from plant 8 showing the presence of the 110 nt GFP insert (underlined) as well as the PacI (left box) and SbfI (right box) sites. Text highlighted in yellow indicates mismatches in the sequence alignment.

188

Sequencing showed that the larger fragment comprised 632 nt of which 341 nt was identical to ORF1 and 291 nt was identical to ORF2 with no GFP sequence or restriction sites retained. The smaller amplicon comprised 298 nt, of which 262 nt was identical to ORF1 and the remaining 36 nt had no significant sequence match. This fragment was identical to the similar 298 nt amplicon from plant 1. From plant 7, an approximately 800 nt amplicon was also cloned and sequenced and found to comprise 779 nt with 531 nt identical to ORF1, 230 nt identical to ORF2 and an additional 18 nt present which had no significant sequence match. Sequencing of the approximately 1 Kb amplicon from plant 8 (as a representative) inoculated with BSMYV-ICΔ0-110nt-GFP confirmed a 1056 nt amplicon which was identical to the expected sequence from the original IC construct.

6.4 Discussion

The aims of the work reported on in this chapter were to assess a series of BSMYV deletion mutants, putative BSMYV-based expression constructs and putative BSMYV-based GFP silencing constructs for infectivity in banana. In addition, the putative expression constructs were assessed for their capacity to maintain and express a GFP sequence, while the silencing constructs were assessed for their ability to silence GFP in transgenic bananas.

Three deletion mutant constructs, which included an ORF1 deletion mutant (BSMYV-ICΔ1), an ORF2 deletion mutant (BSMYV-ICΔ2) and a deletion mutant with both ORF1 and 2 deleted (BSMYV-ICΔ1/2), were not found to be infective when tested in banana. This was in contrast to the results obtained using an infectious clone of Rice tungro bacilliform virus (RTBV) where deletion of ORF1 and 2 had no effect on infectivity (Purkayastha et al., 2010). However, in the present study, a mixture of BSMYV-ICΔ1 and BSMYV-ICΔ2 resulted in the development of symptoms at four months post-inoculation in banana genotype Gros Michel. To determine if recombination had occurred between the two vectors which were inoculated, PCR and sequence analysis across the region of ORF1 and ORF2 was carried out. These analyses revealed that recombination had indeed occurred, with all recombinants having a complete ORF2 whereas the ORF1 sequences varied with as much as 291 nt missing. In some cases, the recombinant virus randomly acquired up to 189 nt of sequence with no homology with known sequences. This result indicated that the virus could be

189

infective with only a partial ORF1 sequence, suggesting that this part of the genome may be expendable and allow additional sequences to be inserted. Although the functions of ORF1 and ORF2 of BSMYV have not been characterised, this study has demonstrated that while a complete ORF2 is essential for infectivity, only a partial ORF1 sequence may be required.

To investigate suitable sites within the BSMYV genome in which to insert heterologous sequences, a complete ORF of GFP was inserted within the 3` intergenic region of the native BSMYV infectious clone or between ORF1 and ORF2. Although insertion of the GFP ORF in the 3` intergenic region did not affect virus infectivity, sequence analysis revealed that the virus did not retain any of the GFP sequence at this position. It seems likely that insertions at this position interfere with viral replication or encapsulation in mature viral particles possibly resulting in the virus deleting the additional sequence. It is also possible that, due to presence of an alternative intergenic region in the construct with no insertion at the 5` end, replication of this unmodified region may have been favoured. BSMYV like any Badnavirus, replicates via linear single stranded pregenomic RNA and mature viral particles have capsid protein (Hohn and Rothnie, 2013). However, the presence of heterogenous encapsulated DNA molecules could suggested another replication approach which may involve homologous recombination between repeated sequences and this may favour the regions without any foreign sequence. When the infectivity of the BSMYV clone containing the GFP ORF inserted between ORF1 and ORF2 was assessed, only 10% of plants became infected. Subsequent sequence analysis of BSMYV in these plants revealed that the virus deleted most of the GFP sequence and only retained partial sequences of up to 110 nt. This result demonstrated that BSMYV could tolerate a modification of the native genome organisation with the overlapping ORF1/2 start/stop codon being separated by up to 110 nt of foreign sequence and so gave some insight into the potential for developing vectors for gene silencing studies.

Two putative silencing constructs were subsequently prepared which contained either 50 or 110 nt of GFP. Despite these constructs both resulting in 100% infection in GFP-transgenic Lady Finger banana plants, no visual evidence of GFP silencing was observed in any of the inoculated plants. The reasons for the inability of the two constructs to silence GFP are unknown. However, gene silencing in target plants is known to be affected by varied factors

190

including gene target position, insert length and orientation. Also, viral silencing suppressors may hinder the silencing of target gene (Becker et al., 2010; Burch-Smith et al., 2006; Rodrigo et al., 2011; Senthil-Kumara and Mysore, 2011). The minimum size of homologous sequences required for triggering silencing has been reported to be as little as 23 nt (Thomas et al., 2001). Since the modified BSMYV vectors retained up to 110 nt of GFP sequence, the size of the GFP insert is unlikely to be the reason for the lack of silencing. It is possible, therefore, that other strategies may be required such as the use of short-inverted repeats which have been reported to enhance silencing in Turnip yellow mosaic virus (TYMV) and Tobacco mosaic virus (TMV)- based vectors (Lacomme and Hrubikova, 2003; Pflieger et al., 2008).

In conclusion, the results from the deletion mutant studies imply that both complete or partial ORF1 and complete ORF2 are critical for BSV infectivity. The most appropriate position in the BSV genome to insert a foreign sequence was found to be between ORF1 and ORF2 since at this position, the virus could tolerate up to 110 nt of GFP and remain infectious. Although the putative silencing constructs were unable to silence GFP as intended, the fact that they were still highly infectious suggests that, with further research, it may still be possible to develop a BSMYV-based VIGS vector for use in banana.

191

192

7CHAPTER 7: GENERAL DISCUSSION, CONCLUSION AND RECOMMENDATION

A collection of banana streak viruses (BSVs) cause banana streak disease (BSD) in bananas and plantains. Since the first report in Morocco in 1974 (Lassoudière, 1974) BSD has been reported from nearly all countries where bananas are grown. BSV species are known to be genetically very diverse at population, subpopulation and intra-species levels (Borah et al., 2013; Côte et al.,2010; Harper et al., 2005; James et al., 2011; Sharma et al.,2015; Stainton et al., 2015). Since the isolation of BSOLV from banana cultivar Obino l’Ewai (AAB) in Nigeria (Harper and Hull, 1998), 10 additional distinct BSV species have been reported worldwide (James et al., 2011; Geering and Hull, 2011). Discovery of new isolates of the respective BSV species seems to be a continuous process across banana growing regions. The discovery of two new strains of BSOLV in banana cultivar “Safet-Velchi” (AB) from India as recent as 2013 (Baranwal et al., 2013) and three other isolates of BSMYV from India in cultivar Chini Champa (AAB), Malbhong (AAB) and Monthan (ABB) as recent as 2015, (Sharma et al., 2015), is a confirmation that more BSV species exist and it’s a matter of time before more are identified. So far, BSOLV has the highest intra-subspecies diversity while BSMYV has the least diversity although it has the highest number of isolates currently across the continents (Duroy et al., 2016; Bhat et al., 2016).

BSV genomes exist episomally or integrated into the host genome and both forms can be infectious to banana. Of the known BSV species, only BSOLV, BSGFV and BSIMV have infectious alleles as integrated sequences in B genome bananas. Therefore, because of the great genetic diversity that exists in the BSV species, symptoms of streak disease caused by them may vary widely and may be influenced by the cultivar and/or environmental conditions. The accumulation of each species in different banana genotypes may also vary. Breeding for resistance is a long and costly process, therefore to be cost effective the resistant germplasm should be thoroughly and accurately screened.

Prior to this study, screening of banana genotypes for resistance to BSVs has been based on natural spread by mealybug vectors, which transmit BSVs in a semi-persistent manner. This method of transmission has limitations including escape of infection due to the failure of

193

vectors to transmit the viruses (Ng and Falk, 2006), or due to the phenomenon commonly referred to as “mature plant resistance” (Lecoq et al., 2004). The capacity of mealybugs to transmit BSV also decreases exponentially over time (Ng and Falk, 2006; Ravichandra, 2013). Further, in a number of field studies, the BSV isolate/s were not characterised, raising the question of which BSV species the resistance is assessing.

Therefore, the main aims of this study were to firstly assess the infectivity and effects of the BSMYV-IC (because its infectious clone was available for mechanical inoculations) in a diverse collection of Musa genotypes, including wild diploid bananas and cultivated bananas. Secondly, the infectivity of a collection of modified BSMYV-IC vectors, prepared for gene expression or gene silencing in bananas, were assessed. Prior to large scale inoculation in the glasshouse, all accessions were pre-screened for BSMYV infection. It was confirmed that even though the test genotypes underwent tissue culture stress, there was no activation of endogenous BSMYV sequences in accessions with some B genome component. This result supports previous work showing that BSMYV may not have infectious alleles (Iskra-Caruana et al., 2010; 2014). As such, any infection detected in the accessions studied was due to the inoculation of BSMYV-IC via Agrobacterium.

One finding of the current study was to show that variations in the time to initial symptom expression can result from variations in temperature at the time of infection. In experiment 2, which was done during the coldest time of the year in Brisbane, all infected accessions had a delay in symptom expression (up to 10 weeks instead of 5 to 6 weeks) as compared to the other experiments done during warmer times of the year (September, December or February), except for Ney Poovan, which showed a delay in symptom expression compared to the other accessions tested (18 weeks post-inoculation). This delay was observed in both cold and warm weather.

The age of the inoculated plants played a role in some accessions becoming infected. For example, Pisang Gajih Merah and Saba did not become infected when plants of approximately 30 cm in height were inoculated, which was the standard practice for screening experiments. However, in experiment 6 and 7, when smaller plants of 10 to 15 cm

194

in height were inoculated, both accessions became infected and developed typical symptoms of BSV infection.

Based on the glasshouse screening experiments to assess the infectivity, symptoms and effects on growth, five types of BSMYV resistance were observed (Table 7.1). The first category was highly resistant (HR). Genotypes in this group did not become infected, even when inoculated at a very early age. This category only included the two accessions possessing a diploid BB genotype, namely M. balbisiana and Butuhan.

The second category was partially resistant (PR). Accessions in this group developed symptoms between 4 and 8 months post-inoculation. Plants which became infected did not suffer any effects on growth characteristics such plant height and leaf emergence. Accessions in this group include hybrids of M. acuminata and M. balbisiana, but only possessed a single A genome component, namely Ney Poovan (AB), Pisang Gajih Merah (ABB) and Saba (ABB).

The third category was tolerant (T). Accessions in this group developed symptoms generally within 5 to 6 weeks post-inoculation. Symptom severity fluctuated continuously but there was no obvious effect on plant height and leaf emergence. Accessions in this group included a number of diploid and triploid A-only genotypes, as well as the genotype AAB accessions. (Pisang madu (AA), Calcutta 4, Truncata (AA), Paka (AA), Khae Phrae(AA), Lady Finger (AAB), Ma. ssp. malaccensis (Mal-R)(AA), Ma. ssp. malaccensis (Mal-S) (AA), Gros Michel (AAA), cultivar Dwarf Cavendish (AAA), cultivar Williams (AAA)).

The fourth category consisted of genotypes that were affected grossly in terms of growth rate and leaf emergence and were considered susceptible (S). However, plants continued to grow and did not die. This included, Ma. ssp banksii (AA), Yesing (AA), Pisang Bangkahulu (AA), Pahang (AA) and Ma. ssp. zebrina (AA). The fifth category consisted of accessions which died after becoming infected and were labelled highly susceptible (HS). These accessions always developed symptoms very quickly after inoculation and symptoms were persistently expressed. Plants in this group often developed the cigar leaf necrosis symptom which was

195

followed by plant death. Accessions in this group include Akondro Mainty (AA), Pacific Plantain (AAB) and Asupina (AT).

196

Table 7.1 Levels of BSMYV resistance in different banana genotypes

Reaction Description Genotype

Highly resistant No BSV symptom development Butuhan (BB), M. balbisiana (BB)

Partially resistant Delayed developing BSV symptoms until Ney Poovan (AB), Pisang Gajih Merah after 4 to 8 months post-inoculation. (ABB), Saba (ABB/BBB)

Tolerant Genotype developed BSV symptoms Pisang madu (AA), Calcutta 4 (AA), within 5 weeks of infection. Symptoms Truncata (AA), Paka (AA), Lady Finger severity fluctuated frequently. Plants (AAB), Ma. ssp. malaccensis (Mal- did not show any effects on growth and R)(AA), Ma. ssp. malaccensis (Mal-S) leaf emergence. (AA), Gros Michel (AAA), cultivar Dwarf Cavendish (AAA), cultivar Williams (AAA), Khae Phrae (AA)

Susceptible Genotypes were affected grossly in Ma. ssp banksii (AA), Yesing (AA), terms of growth rate and leaf Pisang Bangkahulu (AA), Pahang (AA), emergence were considered susceptible Ma. ssp. zebrina (AA) (S). However, plants continued to grow and did not die

Highly susceptible Two groups of genotypes

1. Genotypes which developed BSV 1. Akondro Mainty (AA), Pacific symptoms within 5 to 6 weeks post- Plantain (AAB) inoculation. They developed symptoms with fluctuating severity and later

severe symptoms become persistent which eventually led to the death of the plants. Some of these genotypes were affected grossly in terms of growth rate and leaf emergence

2. Genotypes that developed symptoms 2. Asupina (AT) within 3 weeks of post-inoculation and

immediately the cigar leaf and pseudostem were necrotic and plants died within 3 months of infection.

The absence of symptoms and infection by BSMYV in the diploid BB genotype in the current study may demonstrate what has been hypothesised earlier of M. balbisiana (BB) being resistant to BSV infection because of the presence of eBSV sequences. Diploid BB bananas have been recorded to harbour eBSV sequences of eBSOLV, eBSGFV, BSIMV, and eBSMYV

197

including both infective and non-infective alleles (Umber et al 2016; Fort et al., 2017). Most AAB hybrids harbour either a non-infective allele which is highly rearranged, or are free from eBSVs, whereas ABB hybrids can retain allelic diversity similar to BB diploids (Gayral et al., 2010; Chabannes et al., 2013; Duroy et al 2016; Umber et al 2016; Fort et al., 2017). Duroy et al., (2016) reported the complete absence of eBSIMV in the plantains from India, while African plantains harboured infective alleles of both eBSOLV and eBSGFV. These authors also noted that most dessert AAB genotype bananas from India harboured the non-infective alleles or were free from eBSVs, while those from south-east Asia, showed more rearranged infective eBSV alleles in AAB hybrids. Therefore, it is most likely that the Pacific Plantain (AAB) accession included in this study harbours rearranged or non-infective eBSMYV rather than infective eBSV.

Resistance mechanisms are very diverse and interact with various stages of the virus life cycle in the host plant. Resistance mechanisms may differ in their specificity, stability and durability. In the current study, it was demonstrated that all accessions with some A-genome component were susceptible to BSMYV infection. However, most accessions survived even with high levels of BSMYV DNA present. M. acuminata has been found to generate within its silencing machinery abundant 21 to 24 nucleotide short interfering RNAs. However, the BSV DNA infecting banana has been reported to evade siRNA-directed DNA methylation and thereby avoid transcriptional silencing (Rajeswaran et al., 2014). This may explain partially why all the genotypes with some A-genome component became infected. It will be interesting to know what categories of short interfering RNAs are generated within the silencing machinery of M. balbisiana, since in the current study, genotypes consisting only of the B-genome did not become infected.

Can symptoms be used in classification of bananas? Different molecular markers have been used to classify different banana genotypes which include ploidy level, isozymes (Bhat et al., 1992;), nuclear restrictions (Carreel et al., 1994), amplified fragment length polymorphism (AFLP) (Wong et al .,2001), rapid amplified polymorphic DNA (RAPD) (Bhat et al., 1995), chloroplast restriction fragment length

198

polymorphisms (RFLPS) (Gawel and Jarret , 1991; Gawel et al., 1992; Carreel et al., 2002) and microsatellites (Grapin et al. 1998). Morphological characteristics and anthocyanin patterns have also been used in classification of banana genotypes (Stover and Simmonds, 1987; Horry and Jay, 1988; Karamura, 1998; Pilley et al., 2001).

However, the phenotypical traits produced as symptoms when bananas are infected by viruses have not been used to relate different genotypes in terms of ancestry. In this study, it has been demonstrated that different banana genotype react to a specific BSV isolate differently by producing different symptoms. Therefore, it was possible to compare the different symptoms produced by different genotypes and relate them to different hybrid bananas as possible parental ancestors because of the similar symptoms produced. Infected Akondro Mainty (AA), for example, developed orange yellow blotchy symptoms along the leaf lamina. This symptom has been reported previously on genotype ‘Enyeru’ (AAA-EAH) in Uganda by Jones (2000). Akondro Mainty, also known as ‘Mlali’, has been reported to contribute to the formation of the East African Highland subgroups of bananas, as well as the plantains (Lentfer and Green, 2004; Perrier et al., 2011). Gros Michel (AAA), Cavendish (AAA) and Pome (AAB) as revealed by short sequence repeats, are hybrids of unreduced 2N gametes derived from Akondro Mainty (AA) and reduced gamete N from a genotype known as ‘Khai’ (AA) (Perrier et al., 2011). In the present study, Dwarf Cavendish, Gros Michel, Williams and Lady Finger all developed orange-yellow blotchy symptoms similar to those observed in Akondro Mainty.

Diploid AA bananas documented to contribute parental gametes to hybrids include Ma. ssp zebrina and Ma. ssp. banksii for AAA hybrids while Ma. ssp. banksii and BB for AAB hybrids (Perrier et al., 2009; Raboin et al., 2005). Akondro Mainty has been reported to provide the 2N unreduced gametes of several popular triploid bananas such the Cavendish/Gros Michel and their clones (AAA) (Blench, 2009). In the current study, Lady Finger also expressed symptoms like those in Ma. ssp zebrina and Akondro Mainty while Pacific Plantain expressed those like Truncata and Ma. ssp. banksii. Ma. ssp banksii and the Ma. ssp. zebrina/microcarpa complex is believed to contribute the A component of silk/plantains, (AAB) and most probably the Bluggoe subgroup (ABB) (Denham and Donohue, 2009). Also by comparison of symptoms, we may hypothesise that Ma. ssp. malaccensis (Pahang) may be

199

contributing the A component in genotype Saba (ABB) and may shed light on the actual genome composition of Saba as ABB and not BBB since its exact genome composition is unclear (Vakili, 1967, Valmayor et al., 1991, Jarret and Litz 1986).

BSMYV as a plant viral vector Plant viral vectors are valuable tools for heterologous gene expression and, because of virus- induced gene silencing (VIGS), they also have important applications as reverse genetics tools for gene function studies. Viral vectors are especially useful for plants such as banana that are recalcitrant to transformation. Previously, BSMYV-IC was developed (Bjartan, 2012) for screening of bananas for resistance through mechanical inoculation and it was found 91.6% efficient across diverse banana genotypes in the current study. This further made it a viable candidate as a VIGS vector for use across a diverse range of banana genotypes.

A range of strategies have been reported in the design and construction of virus vectors. However, the nature of the genome of the virus chosen dictates the best approach to be used. Previously Rice tungro bacilliform virus (RTBV), which is closely related to BSMYV, was modified as a VIGS vector to silence the phytoene desaturase (PDS) gene in rice (Purkayastha et al., 2010). Following a similar strategy, BSMYV was shown to be non-infective when ORF1 or ORF2 were deleted, as in RTBV. However, the native virus genome of BSMYV could tolerate the addition of up to 110 nt of GFP at the junction of ORF1 and ORF2 while remaining infective. This result is a critical outcome for the further modification of BSMYV-IC as a VIGS vector, with further work exploring the use of sense and/or antisense orientations of the target sequences, as well as alternative locations within the genome to position inserts.

In conclusion, use of BSMYV infectious clone in large scale screening of banana genotypes for resistance proved to be cost effective, thorough and most probably accurate. Symptom expressed due to BSMYV infection were largely dependent on specific genotype. Only two genotypes possessing diploid BB genotype, namely M. balbisiana and Butuhan were highly resistance to BSMYV infection. BSMYV having been developed as an infectious clone, its assessment for infectivity as a vector, showed that it could tolerate addition of up to 110 nt of GFP at the junction of ORF1 and ORF2 while remaining infective. Further work would be

200

good to study the resistance mechanism to BSV infection in genotypes possessing diploid BB. Other BSV species could be used to screen genotypes to compare symptoms and growth characteristics to the results of the current study. The native BSMYV-IC has proved to hold 110nt heterologous sequences, further work to develop infectious clone vectors is continuing based on the results from this study.

201

REFERENCES

Agindotan, B., Winter, S., Lesemann, D., Uwaifo, A., Mignouna, J., Hughes, J. A., and Thottappilly, G. (2006). Diversity of banana streak-inducing viruses in Nigeria and Ghana: Twice as many sources detected by immunoelectron microscopy (IEM) than by TAS-ELISA or IC-PCR. African Journal of Biotechnology, 5(12).

Ahlquist, P., French, R., Janda, M., and Loesch-Fries, L. S. (1984). Multicomponent RNA plant virus infection derived from cloned viral cDNA. Proceedings of the National Academy of Sciences, 81(22), 7066-7070.

Anjanappa, R. B., Mehta, D., Maruthi, M. N., Kanju, E., Gruissem, W., and Vanderschuren, H. (2016). Characterization of Brown Streak Virus–Resistant Cassava. Molecular Plant-Microbe Interactions, MPMI-01-16-0027-R.

Balaji, B., Bucholtz, D. B., and Anderson, J. M. (2003). Barley yellow dwarf virus and Cereal yellow dwarf virus quantification by real-time polymerase chain reaction in resistant and susceptible plants. Phytopathology, 93(11), 1386-1392.

Baranwal, V. K., Sharma, S. K., Khurana, D., and Verma, R. (2014). Sequence analysis of shorter than genome length episomal Banana streak OL virus like sequences isolated from banana in India. Virus Genes, 48(1), 120-127.

Barbara, D. J., and Clark, M. F. (1982). A simple indirect ELISA using F (ab′) 2 fragments of immunoglobulin. Journal of General Virology, 58(2), 315-322.

Baulcombe, D. (2004). RNA silencing in plants. Nature, 431(7006), 356-363.

Becher, H., Ma, L., Kelly, L. J., Kovarik, A., Leitch, I. J., and Leitch, A. R. (2014). Endogenous pararetrovirus sequences associated with 24 nt small RNAs at the centromeres of Fritillaria imperialis L.(Liliaceae), a species with a giant genome. The Plant Journal, 80(5), 823-833.

Becker, A., and Lange, M. (2010). VIGS–genomics goes functional. Trends In Plant Science, 15(1), 1-4.

Bengyella, L., Waikhom, S. D., Allie, F., and Rey, C. (2015). Virus tolerance and recovery from viral induced- symptoms in plants are associated with transcriptome reprograming. Plant Molecular Biology, 89(3), 243-252.

Bhat, A. I., Hohn, T., and Selvarajan, R. (2016). Badnaviruses: The Current Global Scenario. Viruses, 8(6), 177.

202

Bhat, K. V., Bhat, S. R., and Chandel, K. P. S. (1992). Survey of isozyme polymorphism for clonal identification in Musa.: I. Esterase, acid phosphatase and catalase. Journal of Horticultural Science, 67(4), 501-507.

Bhat, K. V., and Jarret, R. L. (1995). Random amplified polymorphic DNA and genetic diversity in IndianMusa germplasm. Genetic Resources And Crop Evolution, 42(2), 107-118.

Biswas, K. K., Tarafdar, A., and Biswas, K. (2012). Viral Diseases and its Mixed Infection in Mungbean and Urdbean: Major Biotic Constrains in Production of Food Pulses in India. Modern Trends In Microbial Biodiversity of Natural Ecosystem, 301-317.

Bjartan, P. K. B. (2012). Optimisation of Banana streak virus (BSV) diagnostic assays. Queensland University of Technology.

Blench, R. (2009). Bananas and plantains in Africa: re-interpreting the linguistic evidence.

Blevins, T., Rajeswaran, R., Shivaprasad, P. V., Beknazariants, D., Si-Ammour, A., Park, H. S., Vazquez, F., Robertson, D., Meins, F., and Hohn, T. (2006). Four plant Dicers mediate viral small RNA biogenesis and DNA virus induced silencing. Nucleic Acids Research, 34(21), 6233-6246.

Böhlenius, H., Huang, T., Charbonnel-Campaa, L., Brunner, A. M., Jansson, S., Strauss, S. H., and Nilsson, O. (2006). CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science, 312(5776), 1040-1043.

Borah, B. K., Sharma, S., Kant, R., Johnson, A. M. A., Saigopal, D. V. R., and Dasgupta, I. (2013). Bacilliform DNA-containing plant viruses in the tropics: commonalities within a genetically diverse group. Molecular Plant Pathology.

Bouhida, M., Lockhart, B. E., and Olszewski, N. E. (1993). An analysis of the complete sequence of a sugarcane bacilliform virus genome infectious to banana and rice. The Journal Of General Virology, 74, 15.

Brisson, N., Paszkowski, J., Penswick, J. R., Gronenborn, B., Potrykus, I., and Hohn, T. (1984). Expression of a bacterial gene in plants by using a viral vector.

Brown, J.K., Fauquet, C. M., Briddon, R. W., Zerbini, M., Moriones, E. and Navas-Castillo, J. (2011). Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Burlington: Elsevier

Burch-Smith, T. M., Schiff, M., Liu, Y., and Dinesh-Kumar, S. P. (2006). Efficient virus-induced gene silencing in Arabidopsis. Plant Physiology, 142(1), 21-27.

203

Caranta, C., Palloix, A., Lefebvre, V., and Daubeze, A. (1997). QTLs for a component of partial resistance to cucumber mosaic virus in pepper: restriction of virus installation in host-cells. Theoretical And Applied Genetics, 94(3-4), 431-438.

Carreel, F., De Leon, D. G., Lagoda, P., Lanaud, C., Jenny, C., Horry, J. P., and Du Montcel, H. T. (2002). Ascertaining maternal and paternal lineage within Musa by chloroplast and mitochondrial DNA RFLP analyses. Genome, 45(4), 679-692.

Carrington, J. C., Kasschau, K. D., Mahajan, S. K., and Schaad, M. C. (1996). Cell-to-cell and long-distance transport of viruses in plants. The Plant Cell, 8(10), 1669.

Chabannes, M., Baurens, F., Duroy, P., Bocs, S., Vernerey, M., Rodier-Goud, M., Barbe, V., Gayral, P., and Iskra-Caruana, M. (2013). Three Infectious Viral Species Lying in Wait in the Banana Genome. Journal Of Virology.

Chabannes, M., and Iskra-Caruana, M. L. (2013). Endogenous pararetroviruses—a reservoir of virus infection in plants. Current Opinion In Virology, 3(6), 615-620.

Cheesman, E. E. (1947). Classification of the bananas: The genus ensete horan. Kew bulletin, 97-106.

Cheesman, E. E., Wardlaw, C. W., and Spencer, G. L. (1933). The Cavendish group of banana varieties. Tropical Agriculture, Trinidad, 10, 218-221.

Cheng, C. P., Lockhart, B., and Olszewski, N. E. (1996). The ORF I and II Proteins ofCommelinaYellow Mottle Virus Are Virion-Associated. Virology, 223(2), 263-271.

Christelová, p., Valárik, M., Hřibová, E., Channelière, S., Roux, N., and Doležel, J. (2011). A platform for efficient genotyping in Musa using microsatellite markers. AoB Plants, 2011, plr024.

Côte, F. X., Galzi, S., Folliot, M., Lamagnère, Y., Teycheney, P., and Iskra-Caruana, M. (2010). Micropropagation by tissue culture triggers differential expression of infectious endogenous Banana streak virus sequences (eBSV) present in the B genome of natural and synthetic interspecific banana plantains. Molecular Plant Pathology, 11(1), 137-144.

Covey, S. N., and Al-Kaff, N. S. (2000). Plant DNA viruses and gene silencing. Plant Molecular Biology, 43(2), 307-322.

Creste, S., Neto, A. T., Vencovsky, R., de Oliveira Silva, S., and Figueira, A. (2004). Genetic diversity of Musa diploid and triploid accessions from the Brazilian banana breeding program estimated by microsatellite markers. Genetic Resources And Crop Evolution, 51(7), 723-733.

Dahal, G., Gauhl, F., PASBERG-GAUHL, C., Hughes, J. D., Thottappilly, G., and Lockhart, B. E. L. (1999). Evaluation of micropropagated plantain and banana (Musa spp.) for banana streak badnavirus

204

incidence under field and screenhouse conditions in Nigeria. Annals of Applied Biology, 134(2), 181-191.

Dahal, G., Hughes, J. d. A., Thottappilly, G., and Lockhart, B. E. L. (1998). Effect of temperature on symptom expression and reliability of banana streak badnavirus detection in naturally infected plantain and banana (Musa spp.). Plant Disease, 82(1), 16-21.

Dahal, G., Ortiz, R., Tenkouano, A., Hughes, J. A., Thottappilly, G., Vuylsteke, D., and Lockhart, B. E. L. (2000). Relationship between natural occurrence of banana streak badnavirus and symptom expression, relative concentration of viral antigen, and yield characteristics of some micropropagated Musa spp. Plant Pathology, 49(1), 68-79.

Dahal, G., PASBERG-GAUHL, C., Gauhl, F., Thottappilly, G., and Hughes, J. d. A. (1998). Studies on a Nigerian isolate of Banana streak badnavirus: II. Effect of intraplant variation on virus accumulation and reliability of diagnosis by ELISA. Annals of Applied Biology, 132(2), 263-275.

Dale, J. L. (1987). Banana bunchy top: an economically important tropical plant virus disease. Advances In Virus Research, 33, 301-326.

Daniells, J. W. (1990). The Cavendish subgroup, distinct and less distinct cultivars. Identification of Genetic Diversity in the Genus Musa. INIBAP, Montpellier, France, 29-35.

Daniells, J. W. (1995). Illustrated guide to the identification of banana varieties in the South Pacific: ACIAR.

Daniells, J. W., Geering, A. D. W., Bryde, N., J,, and Thomas, J. E. (2001). The effect of Banana streak virus on the growth and yield of dessert bananas in tropical Australia. Annals of Applied Biology, 139(1), 51-60.

Dasgupta, I., Hull, R., Eastop, S., Poggi-Pollini, C., Blakebrough, M., Boulton, M. I., and Davies, J. W. (1991). Rice tungro bacilliform virus DNA independently infects rice after Agrobacterium-mediated transfer. Journal Of General Virology, 72(6), 1215-1221.

Dawson, W. O., Beck, D. L., Knorr, D. A., and Grantham, G. L. (1986). cDNA cloning of the complete genome of tobacco mosaic virus and production of infectious transcripts. Proceedings of the National Academy Of Sciences, 83(6), 1832-1836.

Dawson, W. O., and Folimonova, S. Y. (2013). Virus-Based Transient Expression Vectors for Woody Crops: A New Frontier for Vector Design and Use. Annual Review of Phytopathology(0).

Dawson, W. O., Lewandowski, D. J., Hilf, M. E., Bubrick, P., Raffo, A. J., Shaw, J. J., Grantham, G. L., and Desjardins, P. R. (1989). A tobacco mosaic virus-hybrid expresses and loses an added gene. Virology, 172(1), 285-292.

205

De Langhe, E., and Valmayor, R. V. (1980). French plantains in Southeast Asia. Newsletter-Regional Committee for Southeast Asia (IBPGR).

De Zoeten, G. A., Penswick, J. R., Horisberger, M. A., Ahl, P., Schultze, M., and Hohn, T. (1989). The expression, localization, and effect of a human interferon in plants. Virology, 172(1), 213-222.

Dean, F. B., Nelson, J. R., Giesler, T. L., and Lasken, R. S. (2001). Rapid amplification of plasmid and phage DNA using phi29 DNA polymerase and multiply-primed rolling circle amplification. Genome Research, 11(6), 1095-1099.

Delanoy, M., Salmon, M., Kummert, J., Frison, E., and Lepoivre, P. (2003). Development of real-time PCR for the rapid detection of episomal Banana streak virus (BSV). Plant Disease, 87(1), 33-38.

Denham, T., and Donohue, M. (2009). Pre-Austronesian dispersal of banana cultivars west from New Guinea: linguistic relics from eastern Indonesia. Archaeology In Oceania, 44(1), 18-28.

Ding, S. W., and Voinnet, O. (2007). Antiviral immunity directed by small RNAs. Cell, 130(3), 413-426.

Dodds, K. S. (1943). Genetical and cytological studies of Musa. V. Certain edible diploids. Journal Of Genetics, 45, 113-138.

Dodds, K. S., and Simmonds, N. W. (1948). Sterility and parthenocarpy in diploid hybrids of Musa. Heredity, 2(Pt 1), 101-117.

Donson, J., Kearney, C. M., Hilf, M. E., and Dawson, W. O. (1991). Systemic expression of a bacterial gene by a tobacco mosaic virus-based vector. Proceedings of the National Academy of Sciences, 88(16), 7204-7208.

Doumayrou, J., Leblaye, S., Froissart, R., and Michalakis, Y. (2013). Reduction of leaf area and symptom severity as proxies of disease-induced plant mortality: The example of the Cauliflower mosaic virus infecting two Brassicaceae hosts. Virus Research, 176(1), 91-100.

Duroy, P. O., Perrier, X., Laboureau, N., Jacquemoud-Collet, J. P., and Iskra-Caruana, M. L. (2016). How endogenous plant pararetroviruses shed light on Musa evolution. Annals of Botany, mcw011.

Esteban, J. A., Salas, M., and Blanco, L. (1992). Fidelity of phi29 DNA polymerase. Comparison between protein-primed initiation.

Ferriol, I., Rubio, L., Pérez-Panadés, J., Carbonell, E. A., Davino, S., and Belliure, B. (2013). Transmissibility of Broad bean wilt virus 1 by aphids: influence of virus accumulation in plants, virus genotype and aphid species. Annals of Applied Biology, 162(1), 71-79.

206

Ferriol, I., Ruiz-Ruiz, S., and Rubio, L. (2011). Detection and absolute quantitation of Broad bean wilt virus 1 (BBWV-1) and BBWV-2 by real time RT-PCR. Journal Of Virological Methods, 177(2), 202-205.

Foreman, A. W., Pruss, G. J., and Vance, V. B. (2012). Plant-Virus Interaction: Defense and Counter- Defense. In Molecular Plant Immunity (pp. 169-185): Wiley-Blackwell.

Fort, G., Pineau, K., Giougou, C., Pressat, G., Lambert, F., Umber, M., Dubois, C., Salmon, F., and Teycheney, P.-Y. (2017). Activation of infectious endogenous Banana streak viruses in banana interspecific varieties under field conditions in Guadeloupe. P01.

Fraile, A., and García-Arenal, F. (2010). The coevolution of plants and viruses: resistance and pathogenicity. Advances In Virus Research, 76, 1-32.

Fütterer, J., Bonneville, J. M., and Hohn, T. (1990). Cauliflower mosaic virus as a gene expression vector for plants. Physiologia Plantarum, 79(1), 154-157.

Garcia-Ruiz, H., Takeda, A., Chapman, E. J., Sullivan, C. M., Fahlgren, N., Brempelis, K. J., and Carrington, J. C. (2010). Arabidopsis RNA-dependent RNA polymerases and dicer-like proteins in antiviral defense and small interfering RNA biogenesis during Turnip Mosaic Virus infection. The Plant Cell, 22(2), 481-496.

Gauhl, F., Pasberg-Gauhl, C., Lockhart, B. E. L., Hughes, J. D., and Dahal, G. (1999). Incidence and distribution of banana streak badnavirus in the plantain production region of southern Nigeria. International Journal Of Pest Management, 45(3), 167-171.

Gawel, N. J., and Jarret, R. L. (1991). Chloroplast DNA restriction fragment length polymorphisms (RFLPs) in Musa species. TAG Theoretical And Applied Genetics, 81(6), 783-786.

Gawel, N. J., Jarret, R. L., and Whittemore, A. P. (1992). Restriction fragment length polymorphism (RFLP)- based phylogenetic analysis of Musa. TAG Theoretical And Applied Genetics, 84(3), 286-290.

Gayral, P., Blondin, L., Guidolin, O., Carreel, F., Hippolyte, I., Perrier, X., and Iskra-Caruana, M. L. (2010). Evolution of endogenous sequences of banana streak virus: what can we learn from banana (Musa sp.) evolution? Journal of Virology, 84(14), 7346-7359.

Gayral, P., and Iskra-Caruana, M. L. (2009). Phylogeny of Banana streak virus reveals recent and repetitive endogenization in the genome of its banana host (Musa sp.). Journal of Molecular Evolution, 69(1), 65-80.

Geering, A. D. W., McMichael, L. A., Dietzgen, R. G., and Thomas, J. E. (2000). Genetic diversity among Banana streak virus isolates from Australia. Phytopathology, 90(8), 921-927.

207

Geering, A. D. W., Olszewski, N. E., Dahal, G., Thomas, J. E., and Lockhart, B. E. L. (2001). Analysis of the distribution and structure of integrated Banana streak virus DNA in a range of Musa cultivars. Molecular Plant Pathology, 2(4), 207-213.

Geering, A. D. W., Pooggin, M. M., Olszewski, N. E., Lockhart, B. E. L., and Thomas, J. E. (2005). Characterisation of Banana streak Mysore virus and evidence that its DNA is integrated in the B genome of cultivated Musa. Archives Of Virology, 150(4), 787-796.

Geering, A. D. W., and Hull, R. (2011). Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Burlington: Elsevier.

Ghoshal, B., and Sanfaçon, H. (2015). Symptom recovery in virus-infected plants: Revisiting the role of RNA silencing mechanisms. Virology, 479, 167-179.

Gilbertson, R. L., Hidayat, S. H., Paplomatas, E. J., Rojas, M. R., Hou, Y., and Maxwell, D. P. (1993). Pseudorecombination between infectious cloned DNA components of tomato mottle and bean dwarf mosaic geminiviruses. The Journal Of General Virology, 74, 23-31.

Gleba, Y., Klimyuk, V., and Marillonnet, S. (2007). Viral vectors for the expression of proteins in plants. Current Opinion In Biotechnology, 18(2), 134-141.

Gleba, Y., Marillonnet, S., and Klimyuk, V. (2004). Engineering viral expression vectors for plants: the ‘full virus’ and the ‘deconstructed virus’ strategies. Current Opinion In Plant Biology, 7(2), 182-188.

Goic, B., and Saleh, M.-C. (2012). Living with the enemy: viral persistent infections from a friendly viewpoint. Current Opinion In Microbiology, 15(4), 531-537.

Grapin, A., Noyer, J. L., Carreel, F., Dambier, D., Baurens, F. C., Lanaud, C., and Lagoda, P. J. L. (1998). Diploid Musa acuminata genetic diversity assayed with sequence-tagged microsatellite sites. Electrophoresis, 19(8-9), 1374-1380.

Gray, S. M., Moyer, J. W., Kennedy, G. G., and Campbell, C. L. (1986). Virus-suppression and aphid resistance effects on spatial and temporal spread of watermelon mosaic virus 2. Phytopathology, 76(11), 1254-1259.

Grimsley, N., Hohn, T., Davies, J. W., and Hohn, B. (1987). Agrobacterium-mediated delivery of infectious maize streak virus into maize plants.

Gronenborn, B., Gardner, R. C., Schaefer, S., and Shepherd, R. J. (1981). Propagation of foreign DNA in plants using cauliflower mosaic virus as vector.

208

Gutierrez, C. (2000). DNA replication and cell cycle in plants: learning from geminiviruses. The EMBO Journal, 19(5), 792-799.

Gutierrez, C., Ramirez-Parra, E., Mar Castellano, M., Sanz-Burgos, A. P., Luque, A., and Missich, R. (2004). Geminivirus DNA replication and cell cycle interactions. Veterinary Microbiology, 98(2), 111-119.

Haible, D., Kober, S., and Jeske, H. (2006). Rolling circle amplification revolutionizes diagnosis and genomics of geminiviruses. Journal of Virological Methods, 135(1), 9-16.

Hamilton, A. J., and Baulcombe, D. C. (1999). A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286(5441), 950-952.

Hanley-Bowdoin, L., Settlage, S. B., and Robertson, D. (2004). Reprogramming plant gene expression: a prerequisite to geminivirus DNA replication. Molecular Plant Pathology, 5(2), 149-156.

Harper, G., Hart, D., Moult, S., and Hull, R. (2004). Banana streak virus is very diverse in Uganda. Virus Research, 100(1), 51-56.

Harper, G., Hart, D., Moult, S., Hull, R., Geering, A., and Thomas, J. (2005). The diversity of Banana streak virus isolates in Uganda. Archives of Virology, 150(12), 2407-2420.

Harper, G., and Hull, R. (1998). Cloning and sequence analysis of banana streak virus DNA. Virus Genes, 17(3), 271-278.

Harper, G., Hull, R., Lockhart, B., and Olszewski, N. (2002). Viral sequences integrated into plant genomes. Annual Review Of Phytopathology, 40(1), 119-136.

Harper, G., Osuji, J. O., Heslop-Harrison, J. S., and Hull, R. (1999). Integration of banana streak badnavirus into the Musa genome: molecular and cytogenetic evidence. Virology, 255(2), 207-207..

Hayes, R. J., Brough, C. L., Prince, V. E., Coutts, R. H. A., and Buck, K. W. (1988). Infection of Nicotiana benthamiana with uncut cloned tandem dimers of tomato golden mosaic virus DNA. Journal Of General Virology, 69(1), 209-218.

Hayes, R. J., Coutts, R. H. A., and Buck, K. W. (1989). Stability and expression of bacterial genes in replicating geminivirus vectors in plants. Nucleic Acids Research, 17(7), 2391-2403.

Heslop-Harrison, J. S., and Schwarzacher, T. (2007). Domestication, genomics and the future for banana. Annals Of Botany, 100(5), 1073-1084.

Hohn, T., and Rothnie, H. (2013). Plant pararetroviruses: replication and expression. Current opinion in virology, 3(6), 621-628

209

Horry, J. P., and Jay, M. (1988). Distribution of anthocyanins in wild and cultivated banana varieties. Phytochemistry, 27(8), 2667-2672.

Howell, E. C., Newbury, H. J., Swennen, R. L., Withers, L. A., and Ford-Lloyd, B. V. (1994). The use of RAPD for identifying and classifying Musa germplasm. Genome, 37(2), 328-332.

Howell, S. H. (Singer-songwriter). (1983). Cloned cauliflower mosaic virus DNA as a plant vehicle. On: Google Patents.

Howell, S. H., Walker, L. L., and Dudley, R. K. (1980). Cloned cauliflower mosaic virus DNA infects turnips (Brassica rapa). Science, 208(4449), 1265-1267.

Iskra-Caruana., M. L., Baurens, F. C., Gayral, P., and Chabannes, M. (2010). A four-partner plant-virus interaction: enemies can also come from within. Molecular Plant-Microbe Interactions, 23(11), 1394-1402.

Iskra-Caruana., M. l., Chabannes, M., Duroy, P. O., and Muller, E. (2014). A possible scenario for the evolution of Banana streak virus in banana. Virus Research, 186(0), 155-162.

Jacquot, E., Hagen, L. S., Jacquemond, M., and Yot, P. (1996). The open reading frame 2 product of cacao swollen shoot badnavirus is a nucleic acid-binding protein. Virology, 225(1), 191-195.

Jakowitsch, J., Mette, M. F., J., v. D. W., Matzke, M. A., and Matzke, A. J. M. (1999). Integrated pararetroviral sequences define a unique class of dispersed repetitive DNA in plants. Proceedings of the National Academy of Sciences, 96(23), 13241-13246.

James, A. P., Geijskes, R. J., Dale, J. L., and Harding, R. M. (2011a). Development of a novel rolling-circle amplification technique to detect Banana streak virus that also discriminates between integrated and episomal virus sequences. Plant Disease, 95(1), 57-62.

James, A. P., Geijskes, R. J., Dale, J. L., and Harding, R. M. (2011b). Molecular characterisation of six badnavirus species associated with leaf streak disease of banana in East Africa. Annals Of Applied Biology, 158(3), 346-353.

Jarret, R. L., and Litz, R. E. (1986). Enzyme polymorphism in Musa acuminata Colla. Journal Of Heredity, 77(3), 183-188.

Johne, R., Müller, H., Rector, A., Van Ranst, M., and Stevens, H. (2009). Rolling-circle amplification of viral DNA genomes using phi29 polymerase. Trends In Microbiology, 17(5), 205-211.

Jones, D. R. (1999). Diseases of banana, abacá and enset: CABI publishing.

210

Jones, D. R. (2000). Introduction to banana, abaca and enset. Diseases of Banana, Abacá and Enset (DR Jones, ed.). CABI Publishing, Wallingford, UK, 1-36.

Kain, S. R., Adams, M., Kondepudi, A., Yang, T. T., Ward, W. W., and Kitts, P. (1995). Green fluorescent protein as a reporter of gene expression and protein localization. Biotechniques, 19(4), 650.

Kanazawa, K., and Sakakibara, H. (2000). High content of dopamine, a strong antioxidant, in cavendish banana. Journal of Agricultural And Food Chemistry, 48(3), 844-848.

Karamura, D. A. (1998). Numerical taxonomic studies of the East African highland bananas (Musa AAA- East Africa) in Uganda: Bioversity International.

Karanja, L., Wangai, A., Pathak, R. S., and Harper, G. (2013). Effect of environment and cultivar on the expression of banana streak disease symptoms in Kenya. African Journal of Biotechnology, 12(16).

Kohm, B. A., Goulden, M. G., Gilbert, J. E., Kavanagh, T. A., and Baulcombe, D. C. (1993). A Potato virus X resistance gene mediates an induced, nonspecific resistance in protoplasts. The Plant Cell, 5(8), 913-920.

Konakalla, N. C., Kaldis, A., Berbati, M., Masarapu, H., and Voloudakis, A. E. (2016). Exogenous application of double-stranded RNA molecules from TMV p126 and CP genes confers resistance against TMV in tobacco. [journal article]. Planta, 1-9.

Kubiriba, J., Legg, J. P., Tushemereirwe, W., and Adipala, E. (2001). Vector transmission of Banana streak virus in the screenhouse in Uganda. Annals Of Applied Biology, 139(1), 37-43.

Kumagai, M. H., Donson, J., Della-Cioppa, G., Harvey, D., Hanley, K., and Grill, L. (1995). Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proceedings Of The National Academy of Sciences, 92(5), 1679-1683.

Lacomme, C., and Hrubikova, K. (2003). Enhancement of virus-induced gene silencing through viral-based production of inverted-repeats. The Plant Journal, 34(4), 543-553.

Lassoudière, A. (1974). La mosaïque dite “à tirets” du bananier Poyo en Côte d’Ivoire. Fruits, 29, 349-357.

Lebeurier, G., Hirth, L., Hohn, T., and Hohn, B. (1980). Infectivities of native and cloned DNA of cauliflower mosaic virus. Gene, 12(1–2), 139-146.

Lebot, V., Meilleur, B. A., and Manshardt, R. M. (1994). Genetic diversity in eastern Polynesian Eumusa bananas. Pacific Science, 48(1), 16-31.

211

Lecoq, H., Cohen, S., Pitrat, M., and Labonne, G. (1979). Resistance to cucumber mosaic virus transmission by aphids in Cucumis melo. Phytopathology.

Lecoq, H., Moury, B., Desbiez, C., Palloix, A., and Pitrat, M. (2004). Durable virus resistance in plants through conventional approaches: a challenge. Virus Research, 100(1), 31-39.

Lee, C., Kim, J., Shin, S. G., and Hwang, S. (2006). Absolute and relative QPCR quantification of plasmid copy number in Escherichia coli. Journal Of Biotechnology, 123(3), 273-280.

Lefebvre, D. D. (1990). Expression of mammalian metallothionein suppresses glucosinolate synthesis in Brassica campestris. Plant Physiology, 93(2), 522-524.

Legnani, R., Selassie, K. G., Womdim, R. N., Gognalons, P., Moretti, A., Laterrot, H., and Marchoux, G. (1995). Evaluation and inheritance of the Lycopersicon hirsutum resistance against potato virus Y. Euphytica, 86(3), 219-226.

Lentfer, C. J., and Green, R. C. (2004). Phytoliths and the evidence for banana cultivation at the Lapita Reber-Rakival site on Watom Island, Papua New Guinea. RECORDS-AUSTRALIAN MUSEUM, 75- 88.

Lheureux, F., Carreel, F., Jenny, C., Lockhart, B. E. L., and Iskra-Caruana, M. L. (2003). Identification of genetic markers linked to banana streak disease expression in inter-specific Musa hybrids. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik, 106(4), 594-598.

Liu, J., Yang, J., Bi, H., and Zhang, P. (2014). Why mosaic? Gene expression profiling of African cassava mosaic virus-infected cassava reveals the effect of chlorophyll degradation on symptom development. Journal of Integrative Plant Biology, 56(2), 122-132.

Lockhart, B. E. L. (1986). Purification and serology of a bacilliform virus associated with banana streak disease. Phytopathology, 76(10), 995-999.

Lockhart, B. E. L. (1995). Banana streak badnavirus infection in Musa: epidemiology, diagnosis and control: ASPAC Food & Fertilizer Technology Center.

Lockhart, B. E. L., and Jones, D. R. (2000). Banana streak. Diseases of banana, abaca, and enset. CAB International, Wallingford, United Kingdom, 263-274.

Lockhart, B. E. L., and Olszewski, N. E. (1996). Schefflera ringspot virus, a widely distributed mealybug- transmitted badnavirus occurring in Schefflera and Aralia. In IX International Symposium on Virus Diseases of Ornamental Plants 432 (pp. 196-203).

Mallory, A. C., Parks, G., Endres, M. W., Baulcombe, D., Bowman, L. H., Pruss, G. J., and Vance, V. B. (2002). The amplicon-plus system for high-level expression of transgenes in plants. Nature Biotechnology, 20(6), 622-625.

212

Mason, G., CaciAGL1, P., Accotto, G. P., and Noris, E. (2008). Real-time PCR for the quantitation of Tomato yellow leaf curl Sardinia virus in tomato plants and in Bemisia tabaci. Journal of Virological Methods, 147(2), 282-289.

Medberry, S. L., Lockhart, B. E. L., and Olszewski, N. E. (1990). Properties of Commelina yellow mottle virus's complete DNA sequence, genomic discontinuities and transcript suggest that it is a pararetrovirus. Nucleic Acids Research, 18(18), 5505-5513.

Meister, G., Landthaler, M., Dorsett, Y., and Tuschl, T. (2004). Sequence-specific inhibition of microRNA- and siRNA-induced RNA silencing. Nature, 10(3), 544-550.

Meister, G., and Tuschl, T. (2004). Mechanisms of gene silencing by double-stranded RNA. Nature, 431(7006), 343-349.

Meyer, J. B., Kasdorf, G. G. F., Nel, L. H., and Pietersen, G. (2008). Transmission of activated-episomal banana streak OL (badna) virus (BSOLV) to cultivar Williams banana (Musa sp.) by three mealybug species. Plant Disease, 92(8), 1158-1163.

Mohapatra, D., Mishra, S., and Sutar, N. (2010). Banana and its by-product utilization: an overview. Journal of Scientific & Industrial Research, 69, 323-329.

Molnár, A., Csorba, T., Lakatos, L., Várallyay, É., Lacomme, C., and Burgyán, J. (2005). Plant virus-derived small interfering RNAs originate predominantly from highly structured single-stranded viral RNAs. Journal of virology, 79(12), 7812-7818.

Murphy, J. F., and Kyle, M. M. (1995). Alleviation of restricted systemic spread of pepper mottle potyvirus in Capsicum annuum cultivar Avelar by coinfection with a cucumovirus. Phytopathology, 85(5), 561-566.

Muturi, S. M., Wachira, F. N., Karanja, L. S., Wambulwa, M. C., and Macharia, E. (2013). Paracoccus burnerae (Homoptera; Planococcidae) as a vector of banana streak virus. Journal of Experimental Biology, 1, 5.

Nagyová, A., and Subr, Z. (2007). Infectious full-length clones of plant viruses and their use for construction of viral vectors. Acta Virologica, 51(4), 223.

Ndowora, T., Dahal, G., LaFleur, D., Harper, G., Hull, R., Olszewski, N. E., and Lockhart, B. (1999). Evidence That Badnavirus Infection in< i> Musa Can Originate from Integrated Pararetroviral Sequences. Virology, 255(2), 214-220.

Ng, J. C. K., and Falk, B. W. (2006). Virus-vector interactions mediating nonpersistent and semipersistent transmission of plant viruses. Annual. Review. Phytopathology., 44, 183-212.

213

Nie, X., and Molen, T. A. (2015). Host recovery and reduced virus level in the upper leaves after Potato virus y infection occur in tobacco and tomato but not in potato plants. Viruses, 7(2), 680-698.

Nsabimana, A., and Van Staden, J. (2007). Assessment of genetic diversity of Highland bananas from the National Banana Germplasm Collection at Rubona, Rwanda using RAPD markers. Scientia Horticulturae, 113(3), 293-299.

Nyaboga, E., Gichangi, A., Karanja, L., and Wasilwa, L. (2008). Establishment of Virus-Free Banana (Musa spp.) Mother Stock for Production of Certified Banana Plants and Banana Streak Virus Tested Tissue Culture Seedlings. In IV International Symposium on Banana: International Conference on Banana and Plantain in Africa: Harnessing International 879 (pp. 661-666).

Ogwok, E., Alicai, T., Rey, M. E. C., Beyene, G., and Taylor, N. J. (2015). Distribution and accumulation of cassava brown streak viruses within infected cassava (Manihot esculenta) plants. Plant Pathology, 64(5), 1235-1246.

Onguso, J. M., Kahangi, E. M., Ndiritu, D. W., and Mizutani, F. (2004). Genetic characterization of cultivated bananas and plantains in Kenya by RAPD markers. Scientia Horticulturae, 99(1), 9-20.

Palmer, K. E., and Gleba, Y. (2013). Plant Viral Vectors: Springer.

Palmer, K. E., and Rybicki, E. P. (2001). Investigation of the potential of maize streak virus to act as an infectious gene vector in maize plants. Archives of Virology, 146(6), 1089-1104.

Palukaitis, P., Groen, S. C., and Carr, J. P. (2013). The Rumsfeld paradox: some of the things we know that we don’t know about plant virus infection. Current Opinion In Plant Biology, 16(4), 513-519.

Paull, R. E., and Duarte, O. (2011). Tropical Fruits (Vol. 1): CABI.

Perrier, X., Bakry, F., Carreel, F., Jenny, C., Horry, J. P., Lebot, V., and Hippolyte, I. (2009). Combining biological approaches to shed light on the evolution of edible bananas. Ethnobotany Research And Applications, 7, 199-216.

Perrier, X., De Langhe, E., Donohue, M., Lentfer, C., Vrydaghs, L., Bakry, F., Carreel, F., Hippolyte, I., Horry, J. P., and Jenny, C. (2011). Multidisciplinary perspectives on banana (Musa spp.) domestication. Proceedings Of The National Academy of Sciences, 108(28), 11311-11318.

Pflieger, S., Blanchet, S., Camborde, L., Drugeon, G., Rousseau, A., Noizet, M., Planchais, S., and Jupin, I. (2008). Efficient virus-induced gene silencing in Arabidopsis using a ‘one-step’TYMV-derived vector. The Plant Journal, 56(4), 678-690.

Pickersgill, B. (1986). Evolution of hierarchical variation patterns under domestication and their taxonomic treatment. Infraspecific classification of wild and cultivated plants/edited by BT Styles.

214

Pilartz, M., and Jeske, H. (2003). Mapping of Abutilon mosaic geminivirus minichromosomes. Journal Of Virology, 77(20), 10808-10818.

Pillay, M., Ogundiwin, E., Nwakanma, D. C., Ude, G., and Tenkouano, A. (2001). Analysis of genetic diversity and relationships in East African banana germplasm. Theoretical And Applied Genetics, 102(6-7), 965-970.

Ploetz, R. C. (2005). Panama disease, an old nemesis rears its ugly head: part 1, the beginnings of the banana export trades. Plant Health Progress(December), 1-10.

Purkayastha, A., and Dasgupta, I. (2009). Virus-induced gene silencing: a versatile tool for discovery of gene functions in plants. Plant Physiology And Biochemistry, 47(11), 967-976.

Purkayastha, A., Mathur, S., Verma, V., Sharma, S., and Dasgupta, I. (2010). Virus-induced gene silencing in rice using a vector derived from a DNA virus. Planta, 232(6), 1531-1540.

Pursglove, J. W. (Singer-songwriter). (1972). Tropical crops: monocotyledons. On: Longman Scientific and Technical, New York.

Raboin, L. M., Carreel, F., Noyer, J. L., Baurens, F. C., Horry, J. P., Bakry, F., Montcel, H. T. D., Ganry, J., Lanaud, C., and Lagoda, P. J. L. (2005). Diploid ancestors of triploid export banana cultivars: molecular identification of 2 n restitution gamete donors and n gamete donors. Molecular Breeding, 16(4), 333-341.

Rajeswaran, R., Seguin, J., Chabannes, M., Duroy, P.-O., Laboureau, N., Farinelli, L., Iskra-Caruana, M., and Pooggin, M. M. (2014). Evasion of short interfering RNA-directed antiviral silencing in Musa acuminata persistently infected with six distinct banana streak pararetroviruses. Journal of Virology, 88(19), 11516-11528.

Ravi, I., Uma, S., Vaganan, M. M., and Mustaffa, M. M. (2013). Phenotyping bananas for drought resistance. [Methods]. Frontiers In Physiology, 4.

Ravichandra, N. G. (2013). Fundamentals of plant pathology: PHI Learning Pvt. Ltd.

Rector, A., Tachezy, R., and Van Ranst, M. (2004). A sequence-independent strategy for detection and cloning of circular DNA virus genomes by using multiply primed rolling-circle amplification. Journal of Virology, 78(10), 4993-4998.

Richert-Pöggeler, K. R., and Shepherd, R. J. (1997). Petunia vein-clearing virus: a plant pararetrovirus with the core sequences for an integrase function. Virology, 236(1), 137-146.

Robinson, J. C. (1996). Bananas and plantains, crop production science in horticulture 5. CAB International, Wallingford.

215

Rodoni, B. C., Dale, J., and Harding, R. M. (1999). Characterization and expression of the coat protein- coding region of banana bract mosaic potyvirus, development of diagnostic assays and detection of the virus in banana plants from five countries in southeast Asia. Archives of Virology, 144(9), 1725-1737.

Rodrigo, G., Carrera, J., Jaramillo, A., and Elena, S. F. (2011). Optimal viral strategies for bypassing RNA silencing. Journal Of The Royal Society Interface, 8(55), 257-268.

Rothnie, H. M., Chapdelaine, Y., and Hohn, T. (1994). Pararetroviruses and retroviruses: a comparative review of viral structure and gene expression strategies. Advances In Virus Research, 44, 1-68.

Roux, N., Remy, S., Souza, M. T., Lagoda, P., Baurens, F. C., Dolezel, J., Hribova, E., Heslop-Harrison, P., Town, C., Sasaki, T., Matsumoto, T., and Aert, R. (2008). Genomics of Banana and Plantain (Musa spp.), Major Staple Crops in the Tropics. In: Springer.

Ruiz-Ruiz, S., Moreno, P., Guerri, J., and Ambrós, S. (2007). A real-time RT-PCR assay for detection and absolute quantitation of Citrus tristeza virus in different plant tissues. Journal of Virological Methods, 145(2), 96-105.

Rybicki, E. P., and Martin, D. P. (2014). Virus-derived ssDNA vectors for the expression of foreign proteins in plants. In Plant Viral Vectors (pp. 19-45): Springer.

Sambrook, J., and Russell, D. W. (2001). In vitro mutagenesis using double-stranded DNA templates: selection of mutants with DpnI. Molecular Cloning, 2, 13.19-13.25.

Schffer, R., Miller, C. G., and Petty, I. T. D. (1995). Virus and Host-Specific Adaptations in the< i> BL1 and< i> BR1 Genes of Bipartite Geminiviruses. Virology, 214(2), 330-338.

Scholthof, H. B., Scholthof, K. G., and Jackson, A. O. (1996). Plant virus gene vectors for transient expression of foreign proteins in plants. Annual Review of Phytopathology, 34(1), 299-323.

Senthil-Kumar, M., and Mysore, K. S. (2011). New dimensions for VIGS in plant functional genomics. Trends In Plant Science, 16(12), 656-665.

Sharma, S. K., Vignesh K., P., Geetanjali, A. S., P., K. B., and B., V. K. (2015). Subpopulation level variation of banana streak viruses in India and common evolution of banana and sugarcane badnaviruses. Virus Genes, 50(3), 450-465.

Sharrock, S., and Lusty, C. (2000). Nutritive value of banana. INIPAB Annual Report. INIPAB, Montpellier, 28-31.

Simmonds, N. W. (1953a). The development of the banana fruit. Journal of Experimental Botany, 4(1), 87- 105.

216

Simmonds, N. W. (1953b). Segregations in some diploid bananas. J. Genetics, 51, 458-469.

Simmonds, N. W., and Shepherd, K. (1955). The taxonomy and origins of the cultivated bananas. Journal Of The Linnean Society of London, Botany, 55(359), 302-312.

Simmonds, N. W., and Weatherup, S. T. C. (1990). Numerical taxonomy of the wild bananas (Musa). New Phytologist, 115(3), 567-571.

Simmonds N.W. (1966). Bananas. Longman, London, 512 pp.

Staginnus, C., Iskra-Caruana, M. L., Lockhart, B., Hohn, T., and Richert-Pöggeler, K. R. (2009). Suggestions for a nomenclature of endogenous pararetroviral sequences in plants. Archives of Virology, 154(7), 1189-1193.

Stainton, D., Collings, D. A., and Varsani, A. (2015). Genome sequence of banana streak MY virus from the Pacific Ocean island of Tonga. Genome Announcements, 3(3), e00543-00515.

Stace, C.A (l989) Plant Taxonomy and Biosystematics. Edward Arnold, London.

Stanley, J. (1983). Infectivity of the cloned geminivirus genome requires sequences from both DNAs.

Stover, R. H., and Simmonds, N. W. (1987). Bananas: Longman Scientific & Technical.

Susi, P., Hohkuri, M., Wahlroos, T., and Kilby, N. J. (2004). Characteristics of RNA silencing in plants: similarities and differences across kingdoms. Plant Molecular Biology, 54(2), 157-174.

Takamatsu, N., Ishikawa, M., Meshi, T., and Okada, Y. (1987). Expression of bacterial chloramphenicol acetyltransferase gene in tobacco plants mediated by TMV-RNA. The EMBO Journal, 6(2), 307.

Tatineni, S., and French, R. (2014). The C-terminus of Wheat streak mosaic virus coat protein is involved in differential infection of wheat and maize through host-specific long-distance transport. Molecular Plant-Microbe Interactions, 27(2), 150-162.

Teycheney, P. Y., and Tepfer, M. (2007). Possible roles of endogenous plant viral sequences and transgenes containing viral sequences in both virus resistance and virus emergence. Environmental Biosafety Research, 6(04), 219-221.

Tézenas du Montcel, H. De Langhe and E. Swennen, R. (1983) Essai de classification des bananiers plantains (AAB) 38: 461-474.

217

Thomas, C. L., Jones, L., Baulcombe, D. C., and Maule, A. J. (2001). Size constraints for targeting post- transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. The Plant Journal, 25(4), 417-425.

Toth, R. L., Pogue, G. P., and Chapman, S. (2002). Improvement of the movement and host range properties of a plant virus vector through DNA shuffling. The Plant Journal, 30(5), 593-600.

Trehane, P., Brickell, C. D., Baum, B. R., Hetterscheid, W. L. A., Leslie, A. C., McNeill, J., Spongberg, S. A., and Vrugtman, F. (1995). International Code Of Nomenclature For Cultivated Plants-1995 (ICNCP or Cultivated plant code): Quarterjack Publishing.

Ude, G., Pillay, M., Nwakanma, D., and Tenkouano, A. (2002). Genetic diversity in Musa acuminata Colla and Musa balbisiana Colla and some of their natural hybrids using AFLP markers. TAG Theoretical And Applied Genetics, 104(8), 1246-1252.

Umber, M., Pichaut, J.-P., Farinas, B., Laboureau, N., Janzac, B., Plaisir-Pineau, K., Pressat, G., Baurens, F.- C., Chabannes, M., and Duroy, P.-O. (2016). Marker-assisted breeding of Musa balbisiana genitors devoid of infectious endogenous Banana streak virus sequences. Molecular Breeding, 36(6), 1-11.

Vakili, N. G. (1967). The experimental formation of polyploidy and its effect in the genus Musa. American Journal of Botany, 24-36.

Valmayor, R.V., Silayoi, B., Jamaluddin, S.H., Kusumo, S., Espino, R.R.C., Pascua,O.C. (1991) Banana classification and commercial cultivars in South East Asia.Information Bulletin 24.

Valmayor, R. V., Jamaluddin, S. H., Silayoi, B., Kusumo, S., Danh, L. D., Pascua, O. C., and Espino, R. R. C. (1999). Banana cultivar. names and synonyms in Southeast Asia. Advancing Banana And Plantain R & D In Asia And The Pacific.

Van Wert, S. L., and Saunders, J. A. (1992). Electrofusion and electroporation of plants. Plant Physiology, 99(2), 365-367.

Voinnet, O., Pinto, Y. M., and Baulcombe, D. C. (1999). Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proceedings of The National Academy of Sciences, 96(24), 14147-14152.

Vuylsteke, D., Ortiz, R., Ferris, R. S. B., and Crouch, J. H. (1997). Plantain improvement. Plant Breeding Reviews, 14, 267-320.

Wairegi, L. W. I., van Asten, P. J. A., Tenywa, M. M., and Bekunda, M. A. (2010). Abiotic constraints override biotic constraints in East African highland banana systems. Field Crops Research, 117(1), 146-153.

218

Walton, V. M., and Pringle, K. L. (2004). Vine mealybug, Planococcus ficus (Signoret)(Hemiptera: Pseudococcidae), a key pest in South African vineyards. A Review. South Africa Journal. Enology And Viticulture, 25(2), 54-62.

Wang, J., Tang, Y., Yang, Y., Ma, N., Ling, X., Kan, J., He, Z., and Zhang, B. (2016). Cotton Leaf Curl Multan Virus-Derived Viral Small RNAs Can Target Cotton Genes to Promote Viral Infection. Frontiers In Plant Science, 7.

Wang, X. B., Wu, Q., Ito, T., Cillo, F., Li, W. X., Chen, X., Yu, J. L., and Ding, S. W. (2010). RNAi-mediated viral immunity requires amplification of virus-derived siRNAs in Arabidopsis thaliana. Proceedings Of The National Academy of Sciences, 107(1), 484-489.

Williams, D. J. (1996). A brief account of the hibiscus mealybug Maconellicoccus hirsutus (Hemiptera: Pseudococcidae), a pest of agriculture and horticulture, with descriptions of two related species from southern Asia. Bulletin of Entomological Research, 86(05), 617-628.

Wong, C., Kiew, R., Loh, J. P., Gan, L. H., Set, O., Lee, S. K., Lum, S., and Gan, Y. Y. (2001). Genetic diversity of the wild banana Musa acuminata Colla in Malaysia as evidenced by AFLP. Annals of Botany, 88(6), 1017-1025.

Xia, Z., Peng, J., Li, Y., Chen, L., Li, S., Zhou, T., and Fan, Z. (2014). Characterization of Small Interfering RNAs Derived from Sugarcane Mosaic Virus in Infected Maize Plants by Deep Sequencing. PloS One, 9(5), e97013.

Yang, I. C., Hafner, G. J., Dale, J. L., and Harding, R. M. (2003). Genomic characterisation of taro bacilliform virus. Archives of Virology, 148(5), 937-949.

Zhang, X., Dong, S., Xiang, H., Chen, X., Li, D., Yu, J., and Han, C. (2015). Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for Agrobacterium-mediated inoculation. Virus Research, 197, 13-16.

Zhang, Y., Lubberstedt, T., and Xu, M. (2013). The genetic and molecular basis of plant resistance to pathogens. Journal of Genetics And Genomics, 40(1), 23-35.

Zheng, H., Xiao, C., Han, K., Peng, J., Lin, L., Lu, Y., Xie, L., Wu, X., Xu, P., and Li, G. (2015). Development of an agroinoculation system for full-length and GFP-tagged cDNA clones of cucumber green mottle mosaic virus. Archives Of Virology, 160(11), 2867-2872.

Zhou, H., Hu, H., and Lai, M. (2010). Non-coding RNAs and their epigenetic regulatory mechanisms. Biology of The Cell, 102(12), 645-655.

219

Appendices

Appendix 1 Viral DNA copy number accumulated in leaves of the genotypes in experiment2, 4/5 and 6

Appendix 1.1. Viral DNA copy number accumulated in leaves of the genotypes in experiment 2. A) Viral load accumulation in leaves of Khae Phrae B) Viral load accumulation in leaves of Ma. ssp. zebrina plants; c) Viral load accumulation in leaves of Pisang Bangkahulu plants; D) Viral load accumulation in leaves of Mal-R plants; E) Viral load accumulation in leaves of Mal-S plants; F) Viral load accumulation in leaves of Gros Michel plants; G) Viral load accumulation in leaves of Williams plants

250000

200000 Plant-1 150000 Plant-2 100000 Plant-4 Plant-5 50000

Average viral DNA copy number leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7 leaf 8

250000

200000 Plant-1 150000 Plant-2 Plant-3 100000 Plant-4

50000 Plant-5 Average viral DNA copy number 0 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7 leaf 8

220

C 300000

250000

200000 Plant-1 150000 Plant-2 100000 Plant-3

50000 Average viral DNA copy number 0 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6

700000

600000

500000 Plant 1 400000 Plant 2

300000 Plant 3 Plant 4 200000 Plant 5 100000 Average viral DNA copy number 0 leaf 1 leaf 2 Leaf 3 leaf 4 leaf 5 leaf 6 leaf 7

E 900000 800000 700000 Plant 1 600000 500000 Plant 2 400000 Plant 3 300000 Plant 4 200000 Plant 5 100000 Average viral DNA copy number 0 leaf 1 leaf 2 Leaf 3 leaf 4 leaf 5 leaf 6 leaf 7 leaf 8

221

F 500000 450000 400000 350000 Plant 1 300000 Plant 2 250000 Plant 3 200000 Plant 4 150000 100000 Plant 5 50000 Average viral DNA copy number 0 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7

G 120000

100000

Plant-1 80000 Plat-2 60000 Plant-3 40000 Plant-4 Plant-5 20000 Average viral DNA copy number 0 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7

222

Appendix 1.2. Viral DNA copy number accumulated in leaves of the genotypes in experiment 4/5. A) Viral load accumulation in leaves of Calcutta 4; B) Viral load accumulation in leaves of Khae Phrae plants; c) Viral load accumulation in leaves of Ma. ssp banksii plants; D) Viral load accumulation in leaves of Truncata plants; E) Viral load accumulation in leaves of Akondro Mainty plants; F) Viral load accumulation in leaves of Paka plants; G) Viral load accumulation in leaves of Pisang Madu plants; H) Viral load accumulation in leaves of Pacific Plantain plants; I) Viral load accumulation in leaves of Yesing plants.

800000 Plant 1 700000 Plant 2 600000 500000 Plant 3 400000 Plant 4 300000 Plant 5 200000 Plant 6 100000 Plant 8 0 Plant 9 Average viral DNA copy number leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6

600000 Plant 1 500000 Plant 2 Plant 3 400000 Plant 4 300000 Plant 5 200000 Plant 6 Plant 7 100000 Plant 8 Average viral DNA copy number 0 Plant 9 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6

223

140000 Plant 1 120000 Plant 2 100000 Plant 3 80000 Plant 4

60000 Plant 5 Plant 6 40000 Plant 7 20000 Plant 8 Average viral DNA copy number 0 Plant 9 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7 leaf 8

D 70000

60000 Plant 1 Plant 2 50000 Plant 3 40000 Plant 4 30000 Plant 5 20000 Plant 6

10000 Plant 7 Average viral DNA copy number 0 Plant 9 leaf 1leaf 2leaf 3leaf 4leaf 5

600000 Plant 1 500000 Plant 2 400000 plant 3

300000 Plant 4 Plant 5 200000 Plant 6 100000 Plant 7 0 Plant 8 Average viral DNA copy number leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7

224

3500000 Plant 1 3000000 Plant 2 2500000 Plant 3 2000000 Plant 4

1500000 Plant 5 Plant 6 1000000 Plant 7 500000 Plant 8 Average viral DNA copy number 0 Plant 9 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5

G 350000

300000 Plant 1 250000 Plant 5 200000 Plant 6

150000 Plant 7 Plant 8 100000 Plant 9 50000 Plant 10 Average viral DNA copy number 0 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7

450000 Plant 1 400000 Plant 2 350000 Plant 3 300000 250000 Plant 4 200000 Plant 5 150000 Plant 6 100000 Plant 8 50000 Plant 9 Average viral DNA copy number 0 Plant 10 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6 Leaf 7

225

180000 Plant 1 160000 Plant 2 140000 Plant 3 120000 100000 Plant 4 80000 Plant 5 60000 Plant 7 40000 Plant 8 20000 Plant 9 Average viral DNA copy number 0 Plant 10 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6

226

Appendix 1.3. Viral DNA copy number accumulated in leaves of the genotypes in experiment 6. A) Viral load accumulation in leaves of Pahang B) Viral load accumulation in leaves of Ma. ssp. zebrina plants; c) Viral load accumulation in leaves of Pisang Bangkahulu plants; D) Viral load accumulation in leaves of Yesing plants;

A 300000 Plant 1 250000 Plant 2 Plant 3 200000 Plant 4 150000 Plant 5 100000 Plant 6 Plant 7 50000 Plant 8 Average viral DNA copy number 0 Plant 9 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7 leaf 8

B 250000 Plant 1

200000 Plant 2 Plant 4 150000 Plant 5 Plant 6 100000 Plant 7

50000 Plant 8 Plant 9 Average viral DNA copy number 0 Plant 10 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6

227

C 250000

200000 Plant 2 Plant 3 150000 Plant 4 Plant 6 100000 Plant 7

50000 Plant 8 Plant 10 Average viral DNA copy number 0 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7

D 300000 Plant 1 250000 Plant 2 Plant 3 200000 Plant 4 150000 Plant 5 100000 Plant 6 Plant 7 50000 Plant 8 Average viral DNA copy number 0 Plant 9 leaf 1 leaf 2 leaf 3 leaf 4 leaf 5

228

Appendix 2 Comparison between severity scores and viral load for genotypes in experiments, 4/5

Appendix 2.1 leaves of plant 1 (Exp1) of genotype Calcutta 4 and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 200000 180000 2.5 160000 2 140000 120000 1.5 100000 80000 1 Severity score 60000 0.5 40000 20000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6

Viral load SS

229

Appendix 2.2 leaves of plant 2 (Exp4) of genotype Calcutta 4 and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

B 3 200000 180000 2.5 160000 2 140000 120000 1.5 100000 80000 1 severity score 60000 0.5 40000 20000

0 0 Average viral DNA copy nymber Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5

Viral load SS

230

Appendix 2.3 leaves of plant 3(Exp4) of genotype Khae Phrae and the corresponding viral DNA copy number. A) Leaves 1 to 4 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

B 3 450000 400000 2.5 350000 2 300000 250000 1.5 200000 1 150000 Sevrity score 100000 0.5 50000 0 0 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Average viral DNA copy number Axis Title

Viral load SS

231

Appendix 2.4 leaves of plant 3 (Exp5) of genotype Khae Phrae and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 600000

2.5 500000

2 400000

1.5 300000

1 200000 sevrity score 0.5 100000

0 0 Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Average viral DNA copy number Axis Title

Viral load SS

232

Appendix 2.5 leaves of plant 3(Exp4) of genotype Ma spp. banksii 4 and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 60000

2.5 50000

2 40000

1.5 30000

1 20000 severity score

0.5 10000

0 0 Average viral number load copy Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5

Viral load SS

233

Appendix 2.6 leaves of plant 5 (Exp4) of genotype Ma spp. banksii and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

B 3 90000 80000 2.5 70000 2 60000 50000 1.5 40000 1 30000 Severity score 20000 0.5 10000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5

Viral load SS

234

Appendix 2.7 leaves of plant 2(Exp5) of genotype Truncata and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

B 3 70000

2.5 60000 50000 2 40000 1.5 30000 1 Severity score 20000

0.5 10000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 leaf 6

Viral load SS

235

Appendix 2.8 leaves of plant 5 (Exp5) of genotype Truncata and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

B 3 1400000

2.5 1200000 1000000 2 800000 1.5 600000

Severity score 1 400000

0.5 200000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5

Viral load SS

236

Appendix 2.9 leaves of plant 1 (Exp4) of genotype Akondro Mainty and the corresponding viral DNA copy number. A) Leaves 1 to 7 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 100000 90000 2.5 80000 2 70000 60000 1.5 50000 40000 1 Severity score 30000 0.5 20000 10000

0 0 Average viral DNA copy number leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6 leaf 7

Viral load SS

237

Appendix 2.10 leaves of plant 4 (Exp5) of genotype Akondro Mainty and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

B 3 600000

2.5 500000

2 400000

1.5 300000

Sevrity score 1 200000

0.5 100000

0 0 Average viral DNA copy number leaf 1 leaf 2 leaf 3 leaf 4 leaf 5

Viral load SS

238

Appendix 2.11 leaves of plant 2 (Exp4) of genotype Paka and the corresponding viral DNA copy number. A) Leaves 1 to 4 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 250000

2.5 200000 2 150000 1.5 100000 1 Severity score

0.5 50000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4

Viral load SS

239

Appendix 2.12 leaves of plant 4 (Exp4) of genotype Paka and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 700000

2.5 600000 500000 2 400000 1.5 300000 1 Severity score 200000

0.5 100000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5

Viral load SS

240

Appendix 2.13 leaves of plant 3 (Exp4) of genotype Pisang Madu and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 4000000 3500000 2.5 3000000 2 2500000 1.5 2000000 1500000 1 Severity score 1000000 0.5 500000

0 0 Average viral DNA copy number leaf 1 leaf 2 leaf 3 leaf 4 leaf 5 leaf 6

Viral load SS

241

Appendix 2.14 leaves of plant 2 (Exp5) of genotype Pisang Madu and the corresponding viral DNA copy number. A) Leaves 1 to 5 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 300000

2.5 250000

2 200000

1.5 150000

1 100000 Severity score

0.5 50000

0 0 Average viral DNA copy number leaf 1 leaf 2 leaf 3 leaf 4 leaf 5

Viral load SS

242

Appendix 2.15 leaves of plant 4 (Exp4) of genotype Pacific Plantain and the corresponding viral DNA copy number. A) Leaves 1 to 6 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

B 3 80000 70000 2.5 60000 2 50000 1.5 40000 30000 1 Severity score 20000 0.5 10000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4 Leaf 5 Leaf 6

Viral load SS

243

Appendix 2.16 leaves of plant 3 (Exp5) of genotype Pacific Plantain and the corresponding viral DNA copy number. A) Leaves 1 to 4 with varying severity scores; B) Viral DNA copy numbers compared with the corresponding severity scores

3 35000

2.5 30000 25000 2 20000 1.5 15000 1 Severity score 10000

0.5 5000

0 0 Average viral DNA copy number Leaf 1 Leaf 2 Leaf 3 Leaf 4

Viral load SS

244