Tropane alkaloid biosynthesis in Erythroxylum coca involves an atypical type III polyketide synthase

by

Neill Kim, B.A.

A Dissertation

In

Chemistry

Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of

DOCTOR OF PHILOSOPHY

Approved

Dr. Michael Latham Chair of Committee

Dr. John D’Auria

Dr. Joachim Weber

Mark Sheridan Dean of the Graduate School

May, 2020

Copyright 2020, Neill Kim Texas Tech University, Neill Kim, May 2020

ACKNOWLEDGMENTS I would like to thank Texas Tech University for the resources and support they provided, Dr. John D’Auria for all the guidance and support he has given me, and Dr. Michael Latham. I would also like the thank Dr. Charles Stewart for helping with the crystallography of the enzyme. This research was funded by the National Science Foundation under grant No. NSF-171423326 given to Dr. John D’Auria.

ii Texas Tech University, Neill Kim, May 2020

TABLE OF CONTENTS ACKNOWLEDGMENTS ...... ii ABSTRACT ...... vi LIST OF TABLES ...... vii LIST OF FIGURES ...... viii LIST OF SCHEMES ...... xii LIST OF ABBREVIATIONS ...... xiv INTRODUCTION ...... 1 1.1 TROPANE ALKALOIDS ...... 1 1.2 GRANATANE ALKALOIDS ...... 3 1.3 TYPE III POLYKETIDE SYNTHASES ...... 4 TROPANE AND GRANATANE ALKALOID BIOSYNTHESIS: A SYSTEMATIC ANALYSIS ...... 9 2.1 ABSTRACT: ...... 9 2.2 INTRODUCTION...... 10 2.2.1 SIMILARITIES AND DIFFERENCES IN MEDICINAL PROPERTIES ...... 11 2.2.2 THE SCATTERED DISTRIBUTION OF TROPANES AND GRANATANES AMONGST ANGIOSPERMS ...... 13 2.2.3 BIOSYNTHESIS OF TAS AND GAS ...... 18 2.3 TROPANE ALKALOID BIOSYNTHESIS ...... 18 2.4 GRANATANE ALKALOID BIOSYNTHESIS ...... 29 2.5 METABOLIC ENGINEERING ...... 34 2.6 CONCLUSIONS ...... 40 TROPANE ALKALOIDS: PATHWAY, POTENTIAL AND BIOTECHNOLOGICAL APPLICATIONS ...... 41 3.1 ABSTRACT ...... 41 3.2 INTRODUCTION...... 41 3.3 TROPANE ALKALOID BIOSYNTHESIS ...... 43 3.4 TROPANE ALKALOID SIDE CHAIN MODIFICATIONS ...... 65 3.5 CONCLUSION ...... 68 TROPANE ALKALOID BIOSYNTHESIS IN ERYTHROXYLUM COCA INVOLVES AN ATYPICAL TYPE III POLYKETIDE SYNTHASE ...... 70 4.1 ABSTRACT ...... 70 4.2 INTRODUCTION...... 71 4.3 RESULTS ...... 75 4.3.1 SEQUENCE ANALYSIS OF ECPYKS1, ECPYKS2, AND ECCHS ...... 75 4.3.2 QUANTITATIVE REAL-TIME PCR OF GENE EXPRESSION IN E. COCA .... 78 4.3.3 PRODUCT FORMATION IN THE AERIAL TISSUES OF E. COCA USING CRUDE EXTRACTS ...... 80 iii Texas Tech University, Neill Kim, May 2020

4.3.4 ECPYKS DOES NOT USE THE N-METHYL-∆1-PYRROLINIUM CATION AS A SUBSTRATE ...... 81 4.3.5 ECPYKS1 AND ECPYKS2 ARE ATYPICAL TYPE III PKSS THAT CATALYZE THE FORMATION OF 3-OGA ...... 82 4.3.6 MUTAGENESIS EXPERIMENTS ...... 88 4.3.7 STRUCTURAL DATA BASED ON CRYSTALLOGRAPHY ...... 91 4.3.8 TRANSIENT EXPRESSION SYSTEM IN N. BENTHAMIANA ...... 94 4.4 DISCUSSION ...... 95 4.5 MATERIALS AND METHODS ...... 97 4.5.1 CHEMICAL REAGENTS AND PLANT MATERIAL ...... 97 4.5.2 CLONING, HETEROLOGOUS EXPRESSION AND PURIFICATION OF WILD-TYPE ECPYKS1, ECPYKS2 AND ECCHS ...... 98 4.5.3 SITE DIRECT MUTAGENESIS FOR PYKS MUTANTS ...... 99 4.5.4 CRUDE PROTEIN EXTRACTION FROM E. COCA LEAVES ...... 101 4.5.5 RNA EXTRACTION AND CDNA SYNTHESIS ...... 101 4.5.6 QUANTITATIVE REAL-TIME PCR ...... 101 4.5.7 PREPARATION OF THE 4-(1-METHYL-2-PYRROLIDINYL)-3- OXOBUTANOATE STANDARD ...... 102 4.5.8 KINETIC ANALYSIS OF ENZYMES AND THE DETERMINATION OF PLANT ACTIVITY ...... 103 4.5.9 THROMBIN CLEAVAGE ...... 105 4.5.10 CRYSTALLIZATION OF ABPYKS AND ECPYKS2 ...... 105 4.5.11 TRANSIENT EXPRESSION OF N. BENTHAMIANA ...... 106 PYKS IN P. GRANATUM ...... 107 5.1 INTRODUCTION...... 107 5.2 RESULTS ...... 108 5.2.1 SEQUENCE ANALYSIS OF PUTATIVE P. GRANATUM GENES ...... 108 5.2.2 CLONING, EXPRESSION AND PURIFICATION OF PUTATIVE PGPYKS CANDIDATES ...... 109 5.2.3 KINETIC ANALYSIS OF PYPYKS CANDIDATES ...... 113 5.3 MATERIALS AND METHODS ...... 115 5.3.1 PLANT MATERIALS ...... 115 5.3.2 TOTAL RNA EXTRACTION OF PUNICA GRANATUM ROOT BARK ...... 116 5.3.3 CDNA SYNTHESIS ...... 117 5.3.4 PCR AMPLIFICATION OF CANDIDATE GENES FROM CDNA ...... 117 5.3.5 COLONY PCR OF K. PHAFFII ...... 117 5.3.6 CHEMICAL COMPETENT TRANSFORMATIONS ...... 118 5.3.7 ELECTROCOMPETENT TRANSFORMATIONS OF K. PHAFFII CELLS ...... 118 5.3.8 E. COLI PROTEIN EXPRESSION AND PURIFICATION ...... 118 5.3.9 K. PHAFFII PROTEIN EXPRESSION AND PURIFICATION ...... 120 5.3.10 ENZYME ASSAY CONDITIONS FOR PYKS ASSAY AND KINETIC ANALYSIS ...... 121 5.3.11 ENZYME ASSAY CONDITIONS FOR CHS ASSAY ...... 122 5.4 CONCLUSION ...... 123

iv Texas Tech University, Neill Kim, May 2020

BIBLIOGRAPHY ...... 125

v Texas Tech University, Neill Kim, May 2020

ABSTRACT

Alkaloids represent 20% of all specialized metabolites. These important compounds are produced by plants to protect themselves from biotic or abiotic forces they may encounter. Tropane alkaloids and granatane alkaloids possess a wide array of pharmaceutical properties. Understanding the enzymes involved in the biosynthesis of these compounds will give a better insight on their evolutionary origins. This will aid synthetic biology endeavors to produce high yields of these important specialized metabolites. Although the biosynthesis of tropane alkaloids is well studied in the Solanaceae family, it is still not fully elucidated in the Erythroxylaceae family. Previous studies on these two families hypothesize a polyphyletic origin of enzymes. As more enzymes within the pathway are characterized, endeavors to metabolically engineer these pharmacologically active metabolites will increase. Here, I report a new atypical type III polyketide synthase enzyme from the Erythroxylaceae family involved in tropane alkaloid production. This unique enzyme also differs from that reported in the Solanaceae family. Furthermore, a similar enzyme involved in granatane alkaloid biosynthesis will be investigated.

vi Texas Tech University, Neill Kim, May 2020

LIST OF TABLES

1. Summary of radiolabel feeding studies performed on granatane-producing species...... 30 2. A summary of recent metabolic engineering studies targeting specific genes...... 35 3. A summary of recent metabolic engineering studies using elicitors...... 39 4. Primer efficiency values in E. coca...... 78 5. Inhibition experiments using iodoaceamide (100µM) to demonstrate the involvement of malonyl-CoA (200µM) and N- methyl-∆1-pyrrolinium cation (NMP, 100µM) in the active site...... 82 6. Steady-state kinetic properties of EcPYKS1 and EcPYKS2 for malonyl-CoA. n = 3...... 87 7. Steady-state kinetic properties of EcCHS. n = 3...... 87 8. Steady-state kinetic properties of EcPYKS2 mutants compared to wild-type. n = 3...... 91 9. List of oligonucleotide sequences of the mutagenic primers used for site directed mutagenesis with codons for amino acid changes underlined and bold...... 100 10. List of primer sequences used for cDNA amplification of candidate PgPYKS genes...... 110

vii Texas Tech University, Neill Kim, May 2020

LIST OF FIGURES

1. Common tropane alkaloid natural products found in the Erythroxylaceae or Solanaceae...... 2 2. Developing E. coca seedling with leaf stages labeled. L1: rolled, immature leaves; L2: unrolled, immature leaf; L3: unrolled fully matured leaf...... 3 3. Common granatane alkaloids found in P. granatum...... 4 4. Mechanism of chalcone synthase-like type III PKSs. Resonance forms of decarboxylated malonyl-CoA not shown. Green circles represent CoA-tethered intermediates or enzymes...... 5 5. Spontaneous cyclization of naringenin chalcone to naringenin via chalcone isomerase (CHI) in aqueous solution...... 6 6. Active site of alfalfa CHS with the active site residues shown in ball-and-stick with naringenin indicated by a stick drawing.24 ...... 7 7. (a) The tropane core skeleton; (b) The bicyclic granatane core skeleton. Both structures depict their chemically accepted carbon numbering...... 11 8. Examples of granatane alkaloids and granatane alkaloid derivatives found among several plant species...... 15 9. The diversity and similarities of tropane and granatane producing angiosperms. The orders tropane alkaloids belong to are highlighted in orange. The orders granatane alkaloids belong to are highlighted in blue. Shared orders are represented by both colors. The plant families that are known to produce tropane and granatane alkaloids are branched off from the orders. The scale at the bottom represents millions of years. Modification of the phylogenetic tree published in8, republished with permission with the Botanical Society of America...... 17 10. Tropane alkaloid core bicyclic scaffold...... 42 11. Crystal structure of AaPYKS-COB binding pocket looking down the CoA binding tunnel at 2.0 Å...... 57 12. Sequence alignment of different type III PKSs in angiosperms...... 76 13. Unrooted phylogeny tree of known type III PKSs across different families and species. The sequences were aligned using the CLUSTAL X alignment program with standard protein alignment settings. Visualization was done through FigTree with numbers at each node representing bootstrap values. Scale on the bottom represents the number of amino acid substitutions per site...... 77 viii Texas Tech University, Neill Kim, May 2020

14. 4% acrylamide gels of primer optimization analysis. All tested primers are labeled on top of the corresponding lane. 100 bp ladder is present at the extremities of both gels. Top gel represents primer optimization in E. coca cDNA. Bottom gel represents primer optimization in E. novogranatense cDNA. Non-template controls are denoted as NTC...... 79 15. Relative quantification analysis of EcCHS, EcPYKS1, and EcPYKS2 gene expression in E. coca...... 80 16. Relative quantification analysis of PYKS specific activity in different leaf tissue for the formation of 4-(1-methyl-2- pyrrolidinyl)-3-oxobutanoic acid...... 81 17. SDS-PAGE of EcPYKS1 pEP-Strep before thrombin cleavage ran on a 12% acrylamide gel. Order of lanes: ladder, desalt 1, desalt 2, desalt 3, desalt 4, desalt 5, desalt 6, desalt 7. Molecular weight of protein is ~43 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run that was desalted, ran at 150V...... 83 18. SDS-PAGE of EcPYKS1 pEP-Strep after thrombin cleavage ran on a 12% acrylamide gel. Order of lanes: ladder, 1:25 dilution of thrombin at 4°C with 16 h incubation, 1:25 dilution of thrombin at 20°C with 8 h incubation, 1:25 dilution of thrombin at 20°C with 16 h incubation, 1:100 dilution of thrombin at 4°C with 8 h incubation, 1:100 dilution of thrombin at 4°C with 16 h incubation, 1:100 dilution of thrombin at 20°C with 8 h incubation, 1:100 dilution of thrombin at 20°C with 16 h incubation, no thrombin control. Molecular weight of protein is ~43 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run that was desalted, ran at 150V. Bands above the cleaved protein represents protein that was fully not cleaved...... 83 19. pH optima test for EcPYKS1 using standard assay conditions. Buffers used for pH range were 100mM phosphate citrate (pH 4-7), 100mM Tris-HCl (pH 7-9), or 100mM NaOH-Glycine (pH 9-10.5). EcPYKS2 had similar results...... 85 20. Metal ion tests on EcPYKS2 using monovalent and divalent ions under standard assay conditions. EcPYKS1 had similar results...... 85 21. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS1 for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations...... 86

ix Texas Tech University, Neill Kim, May 2020

22. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS1 for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations...... 86 23. Extracted LC/MS/MS MRM chromatograms in positive mode of 3-oxoglutaric acid formation by EcPYKS1 and EcPYKS2 when compared to the standard. m/z 147 > 129 ...... 87 24. Extracted LC/MS/MS MRM chromatograms in positive mode of naringenin chalcone formation by EcCHS when compared to the naringenin standard. m/z 273 > 153...... 88 25. Extracted LC/MS/MS MRM chromatograms in positive mode of different mutant activity when compared to WT for relative 3-oxoglutaric acid formation. Mutations were generated based on crystal structures of key residues thought to be involved in substrate interactions. Overnight assays were performed under standard assay conditions...... 89 26. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS2 T133A for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations...... 90 27. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS2 T133R for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations...... 91 28. An overlay of the AaPYKS-COB binding pocket with AbPYKS looking down the CoA binding tunnel at 2.0 Å. AaPYKS depicted in blue; AbPYKS depicted in magenta (apo). The COB intermediate is displayed in ball-and-stick representation...... 92 29. An overlay of the AaPYKS-COB binding pocket with EcPYKS2 looking down the CoA binding tunnel. AaPYKS depicted in blue; EcPYKS2 depicted in gold (apo). Circles denote residues known or hypothesized to interact with substrate. The COB intermediate is displayed in ball-and-stick representation...... 93 30. Overview of the reconstruction of tropinone biosynthesis in N. benthamiana. The transient expression system includes enzymes from both A. belladonna and E. coca...... 95 31. Unrooted phylogeny tree of known type III PKSs, including P. granatum, across different families and species. The sequences were aligned using the CLUSTAL X alignment program with standard protein alignment settings. Visualization was done through FigTree with numbers at each node representing x Texas Tech University, Neill Kim, May 2020

bootstrap values. Scale on the bottom represents the number of amino acid substitutions per site...... 109 32. 1% agarose gel of cDNA amplification of putative PgPYKS genes. Order of lanes: ladder, Pg22277, Pg9725, Pg11277, (+) control PgLDC, (-) control water...... 110 33. Overview of the Gateway cloning system and the addition of attB sites (green) with the thrombin cleavage site (yello) upstream of the ORF...... 111 34. SDS-PAGE of PgPKS1 pEP-Strep ran on a 12% acrylamide gel. Order of lanes: crude, flow through, wash, fraction 22, 23, 24, 25, 26, 27. Molecular weight of protein is ~43 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run, not desalted, ran at 150V...... 112 35. SDS-PAGE of PgPYKS2 BL21(DE3) ran on a 12% acrylamide gel. Order of lanes: crude, pellet, flow through, wash, ladder, fractions 12, 13, 14, 15, 16, 17, 18. Molecular weight of protein is ~46 kDa. Gel represents fractions collected from a HisTag affinity chromatography run, not desalted, ran at 150V...... 113 36. Colony PCR of Pg22277 pEP-Strep ran on a 1% agarose gel. Colonies were selected from yeast transformation. Size of gene of interest is 1.4 kb. Order of lanes: ladder, lanes 1-11 are separate Pg22277 colonies, (+) control EcPYKS2, (-) control water...... 113 37. LC/MS-XIC of a CHS enzyme assay using PgPKS1 that generates naringenin chalcone, performed in positive mode, when compared to the standard...... 114 38. SDS-PAGE of PgPYKS2 pEP-Strep K. phaffii ran on a 12% acrylamide gel. Order of lanes: crude, flow through, wash, ladder, fractions 18, 19, 20, 21, 22, pellet. Molecular weight of protein is ~46 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run, not desalted, ran at 150V...... 115

xi Texas Tech University, Neill Kim, May 2020

LIST OF SCHEMES

1. The biosynthetic pathway of cocaine in E. coca. Enzymes in green depict characterized enzymes. Enzymes in red remain hypothetical...... 8 2. Tropane alkaloid biosynthesis up to the formation of the N- methyl-Δ1-pyrrolinium cation. Arginine, ornithine and proline are interconvertable, sharing the pyrroline-5-carboxylate intermediate (highlighted in blue). Putrescine can be formed directly via decarboxylation of ornithine or indirectly through arginine. Methylation of putrescine is followed by oxidation to yield 4-methylamino-butanal, which is then spontaneously cyclized to yield the N-methyl-Δ1-pyrrolinium cation. Enzymes are highlighted in orange and abbreviated as follows: ADC, arginine decarboxylase; AIH, agmatine imino hydrolase; NCPAH, N-carbamoylputrescine amino hydrolase; ODC, ornithine decarboxylase; PMT, putrescine N-methyl transferase; MPO, methyl putrescine oxidase...... 19 3. Tropinone formation from the N-methyl-Δ1-pyrrolinium cation in which there are two possibilities for the condensation of the tropane ring. Acetyl-CoA is utilized via acetoacetate to yield hygrine-1-carboxylic acid. On the other hand, two successive decarboxylative condensations of malonyl-CoA by PKS (polyketide synthase) yields 4-(1-methyl-2-pyrrolidinyl)-3- oxobutanoyl-CoA. Enzymes are highlighted in orange and substrates are highlighted in blue...... 22 4. Tropinone is converted into tropine via TRI, tropinone reductase I. Tropine utilizes phenyllactoyl-CoA to yield littorine, which then uses a cytochrome p450 enzyme to form hyoscyamine. Scopolamine is epoxidized by the enzyme H6H, 6β-hydroxy hyoscyamine epoxidase, in a two-step process. Enzymes are highlighted in orange and substrates are highlighted in blue...... 24 5. Ecgonone-CoA ester undergoes a multi-step process to yield methylecgonone, which is reduced by methylecgonne reductase, MecgoR to produce methylecgonine. Cocaine is then formed by the acylation of methylecgonine with benzoyl-CoA. Enzymes are highlighted in orange and substrates are highlighted in blue...... 26 6. Three proposed hypothetical routes to the production of granatane alkaloids. Hypothesized enzymes are presented in orange and hypothetical cofactors are presented in blue. The abbreviated enzymes and cofactor are as follows: ODC, ornithine decarboxylase; LDC, lysine decarboxylase; CMT, xii Texas Tech University, Neill Kim, May 2020

cadaverine N-methyl transferase; MPO, methyl putrescine oxidase; PKS, polyketide synthase; LMT, lysine N-methyl transferase; MLDC, N-methyllysine decarboxylase; SAM, S- adenosyl-L-methionine...... 32 7. The initial steps of tropane alkaloid biosynthesis in the Solanaceae up to the formation of N-methyl-∆1-pyrrolinium...... 45 8. The biosynthetic pathway of polyamines in plants. Enzymes are depicted in blue and cofactors in orange...... 49 9. Biosynthesis of scopolamine in the Solanaceae family starting from the N-methyl-∆1-pyrrolinium cation...... 53 10. Hypothetical mechanism of AaPYKS for 4-(N-methyl-2- pyrrolidinyl)-3-oxobutanoic acid formation...... 56 11. Proposed mechanism of CYP82M3-catalyzed reaction ...... 59 12. Cocaine biosynthesis in E. coca...... 62 13. Proposed mechanism of EcPYKS based on previous studies of AaPYKS. Arg(134) denotes the residue found in Solanaceae, not Erythroxylaceae. Dashed lines represent salt bridges and dotted lines represent hydrogen bonds...... 74

xiii Texas Tech University, Neill Kim, May 2020

LIST OF ABBREVIATIONS 3-OGA: 3-oxoglutaric acid; β-ketoglutarate

ACP: acyl carrier protein

ADC: arginine decarboxylase

AIH: agmatine imino hydrolase

AKR: aldo-keto reductase

ARM: Anderson rhododendron medium

CGA: chlorogenic acid

CHI: chalcone isomerase

CHS: chalcone synthase

CMT: cadaverine N-methyltransferase

COB: 4-carboxy-3-oxybutanoyl moiety

CS: cocaine synthase

CuAOs: copper-containing amine oxidases

CYP: cytochrome p450 dcSAM: decarboxylated S-adenosylmethionine

GA: granatane alkaloid

GB5: Gamborg B5

H6H: hyoscyamine-6β-hydroxylase

HCDCs: high cell density cultures

JA-Ile: jasmonic acid-isoleucine

KAS: ketoacyl synthase

LC/MS: liquid chromatography/mass spectrometry

LDC: lysine decarboxylase xiv Texas Tech University, Neill Kim, May 2020

LMT: lysine N-methyltransferase

MecgoR: methylecgonone reductase

MLDC: N-methyllysine decarboxylase

MMT: Murashige-Tucker medium

MPO: methylputrescine oxidase

MRM: multiple reaction monitoring

MSO: methylspermidine oxidase

NCPAH: N-carbamoylputrescine

ODC: ornithine decarboxylase

PAOs: FAD-dependent polyamine oxidase

PCR: polymerase chain reaction

PKS: polyketide synthase

PLP: pyridoxal 5’ phosphate

PMT: putrescine methyltransferase

PYKS: atypical polyketide synthase

SA: salicylic acid

SAM: S-adenosylmethionine

SpdMT: spermidine methyltransferase

SPDS: spermidine synthase

TA: tropane alkaloid

TR I: tropinone reductase I

TR II: tropinone reductase II

VIGS: virus induced gene silencing

xv Texas Tech University, Neill Kim, May 2020

CHAPTER 1

INTRODUCTION

1.1 Tropane alkaloids The sessile nature of plants has caused them to develop an enormous variety of specialized metabolites, as a response to biotic or abiotic forces in nature, during hundreds of millions of years of evolution. These natural products are used by the plant as a means of defense, communication, and reproduction.1, 2 Humans had to learn how to endure the toxic properties of plants and overtime, use this knowledge in order to avoid or use the plants as poisons or for medicine. At high concentrations, these natural products serve as defensive “poisons” for the plant, but humans learned that they can be utilized as medicines in lower doses. Many of these specialized metabolites contain one or more heterocyclic rings in their core structures and are often used as pesticides, flavorings, fragrances, and narcotics.3 There are more than 200,000 known natural products with over 20,000 categorized as alkaloids. Alkaloids are specialized metabolites derived from amino acids with vast pharmaceutical properties due to their pharmacologically active nitrogen-containing heterocyclic ring.4 Because of this, alkaloids are commonly used as a starting point for drug development.5 Plant alkaloid research began when morphine was first isolated in 1806.6 Morphine belongs to the benzylisoquinoline alkaloids, who are known to possess potent pharmacological properties such as analgesics (morphine), cough suppressants (codeine), and muscle relaxants (papaverine).7

Tropane alkaloids are a specific type of alkaloid defined by their nitrogen- containing heterocyclic core scaffold, N-methyl-8-azabicyclo[3.2.1]-octane (Figure 1). These alkaloids are found in seven different orders of angiosperms that span over ten different plant families.8 Tropane alkaloids have been studied extensively in the Solanaceae family. Therefore, majority of the biosynthesis of tropane alkaloids have been elucidated in the Solanaceae family. Common tropane alkaloid-producing solanaceous species include Solanum lycopersicum (tomato), S. tuberosum (potato), and Nicotiana tobacum (tobacco). Well-known tropane alkaloids from the Solanaceae 1 Texas Tech University, Neill Kim, May 2020 include atropine, scopolamine and hyoscyamine that are commonly found in the Atropa belladonna, Hyoscyamus niger, and members of the Datura genus.

Figure 1. Common tropane alkaloid natural products found in the Erythroxylaceae or Solanaceae.

The Erythroxylaceae family also produces one of the most famous tropane alkaloids, cocaine. The Erythroxylum coca and E. novogranatense species are the most notable cocaine producing plant species in which the tropane alkaloid is found in the aerial leaves (Figure 2). These species of plants are one of the oldest domesticated medicinal plants that can be dated back at least 8,000 years, when ancient Peruvians would chew on the leaves to increase stamina and stay alert during labor and to deal with the high altitude.3 Cocaine was first isolated as a pure compound in 1806 by Albert Niemann.9 Coca-Cola famously used the E. novogranatense species to flavor their beverages when they first began making the drink, partially due to the minty taste caused by high amounts of methyl salicylate as well as other flavoring properties of the plant.10, 11 To this day, Coca-Cola still uses the plant for flavoring but undergoes a decocainization process so the narcotic properties are removed.12 Although this family has not been studied as extensively as the Solanaceae, enzymes involved in the biosynthesis of cocaine are slowly being characterized.13-15

2 Texas Tech University, Neill Kim, May 2020

Figure 2. Developing E. coca seedling with leaf stages labeled. L1: rolled, immature leaves; L2: unrolled, immature leaf; L3: unrolled fully matured leaf.

The biosynthesis of tropane alkaloids can be classified into three different stages: the first nitrogen-containing heterocyclic ring closure, the second ring closure that forms the bicyclic core scaffold, and finally the modifications to the core scaffold by the addition of functional groups to create these unique molecules. The first ring closure has been elucidated in the Solanaceae. However, the second ring closure remained a mystery until recently when two new studies have emerged regarding the ring closure mechanism. These new studies will be described in depth in later chapters.

1.2 Granatane Alkaloids Structurally similar to tropane alkaloids, granatane alkaloids are defined by their N-methyl-9-azabicyclo[3.3.1]-nonane core scaffold (Figure 3). The difference of the addition of one carbon atom in granatane alkaloids greatly changes their pharmaceutical and chemical properties. These alkaloids are commonly found in the root bark of the species Punica granatum (pomegranate).4 The cultivation of the pomegranate tree dates back at least 10,000 years ago in Egypt.16 Although granatane alkaloids are most prevalent in P. granatum, they have also been found in the Sedum sarmentosum (Crassulaceae family) species and the Withania somnifera species (Solanaceae family).17-19 In 1879, Tanret and Pelletier were the French chemists who first isolated and characterized the salt form from the root bark of P. granatum.18

3 Texas Tech University, Neill Kim, May 2020

Figure 3. Common granatane alkaloids found in P. granatum.

Not much is known about this class of alkaloids. Historically, granatane alkaloids were utilized for its anthelminthic (anti-worm) properties and more recently, have exhibited anti-proliferation effects on hepatoma cells.20 Synthetic derivatives of granatane alkaloids, such as granisetron, have been used to prevent nausea and vomiting in cancer patients undergoing chemotherapy.21 There are also no recent reports of structural genes or enzymes responsible for the biosynthesis of granatane alkaloids. The elucidation of granatane alkaloid biosynthesis will give a better understanding about the enzymes involved and their possible relationship with tropane alkaloids. More information about granatane alkaloids will be presented in later chapters.

1.3 Type III Polyketide Synthases There are three types of polyketide synthase (PKS) enzymes, all possessing a β- keto synthase activity that is responsible for catalyzing the sequential head-to-tail incorporation of acetate units into a growing polyketide chain.22 Type I PKSs are similar to the yeast and animal fatty acid synthases. They are comprised of multi-domain polyproteins that form large multifunctional biosynthetic complexes and appear in either an iterative or modular fashion. Type II PKSs are multienzyme complexes consisting of discrete, separable proteins similar to the fatty acid synthase type II systems found in bacteria and plants. Type III PKSs, also known as chalcone synthase- like (CHS) PKS enzymes, are commonly found in plants and bacteria and are homodimers who emerged by from the homodimeric protein ketoacyl synthase III (KAS III). These enzymes do not use an acyl carrier protein (ACP) domain and catalyze the sequential decarboxylative condensation of two acetate units, derived from malonyl-

4 Texas Tech University, Neill Kim, May 2020

CoA, into a growing polyketide chain (Figure 4).22 They are known as promiscuous enzymes with broad substrate specificity and are capable of catalyzing multiple reactions.23, 24 Type III PKSs have gained multiple activities over time in order to catalyze sequential condensations using a wide range of larger starter molecules and have also developed different polyketide cyclization mechanisms.

Figure 4. Mechanism of chalcone synthase-like type III PKSs. Resonance forms of decarboxylated malonyl-CoA not shown. Green circles represent CoA-tethered intermediates or enzymes.

Chalcone synthase was the first type III PKS to be discovered and is the first committed step in flavonoid biosynthesis. This is not surprising as phytochemists noted the wide distribution of anthocyanin flower pigments along with other flavonoids in higher plants. Furthermore, the incorporation of acetate units into the core skeleton of flavonoids was predicted as far back as the 1950s.25 Flavonoids specialized metabolites used by plants for many different purposes such as absorbing harmful UV-B radiation (280-315nm), pigmentation, antimicrobial defense mechanisms, and pollen fertility to 5 Texas Tech University, Neill Kim, May 2020 name a few.26 When flavonoids are ingested by humans, they display a multitude of health benefits such as having antimicrobial (e.g. antimalarials) and free radical- scavenging antioxidant agents.27, 28 Additionally, they have also been shown to exhibit anticancer, vasodilatory, antimitotic, anti-inflammatory, anti-asthmatic and estrogenic activities.29-34 Kreuzalar and Hahlbrock used isotopic labeling in 1972 to demonstrate the production of naringenin, a flavonone, from malonyl-CoA and p-coumaroyl-CoA, a phenylalanine derivative.35 However, it is important to note that naringenin is formed when the released chalcone product of CHS undergoes an additional rapid stereospecific ring closure in vivo through chalcone isomerase (CHI) (Figure 5). This ring closure occurs spontaneously in aqueous solution within 30 min of chalcone’s release from the CHS active site. Because of this, early researchers mistakenly concluded that CHS catalyzes the formation of naringenin rather than naringenin-chalcone.

Figure 5. Spontaneous cyclization of naringenin chalcone to naringenin via chalcone isomerase (CHI) in aqueous solution.

The chalcone synthase reaction mechanism involves an acyltransferase activity that loads a p-coumaroyl-CoA starter molecule onto the catalytic cysteine in the active site and a decarboxylative condensation activity that involves malonyl-CoA as an extender unit. The catalytic cysteine was discovered through site directed mutagenesis experiments of parsley CHS.36 The first crystal structure was published in 1999 by members of the Noel group from alfalfa CHS in both the complexed and apo forms.37 This led to the discovery of the catalytic triad (Cys164, His303, and Asn336) that is responsible for the core chemical machinery of type III PKS enzymes (Figure 6). Another key residue near the active site is Phe215. This residue, along with Phe265, acts as the gate keepers that blocks the lower portion of the active site and CoA binding

6 Texas Tech University, Neill Kim, May 2020 tunnel. Analogous to saloon doors, these residues facilitate the entry and exit of substrates.

Figure 6. Active site of alfalfa CHS with the active site residues shown in ball-and-stick with naringenin indicated by a stick drawing.24

The malonyl-CoA used by this mechanism in plants is predominantly derived from acetyl-CoA through acetyl-CoA carboxylase.38 Acetyl-CoA is distributed in at least five different subcellular compartments and is a common intermediate in a wide range of metabolic processes.39 For tropane alkaloid biosynthesis, cytosolic acetyl-CoA is utilized and also involved in the biosynthesis of a variety of phytochemicals and other specialized metabolites.

It has been hypothesized that a type III PKS is involved in the polyketide extension, from the first heterocyclic ring, that will subsequently cyclize to form the bicyclic core scaffold of all tropane alkaloids. Although there have been atypical type III PKSs characterized in the Solanaceae, there has yet to be an enzyme that performs a similar function in a different family. It is understood, and explained in depth in later chapters, that enzymes within the Solanaceae family function differently than similar enzymes found Erythroxylaceae family. We propose that an enzyme from the Erythroxylaceae family possesses a similar atypical type III polyketide synthase activity that was found in the Solanaceae family (Scheme 1). Although these enzymes perform similar functions, the mechanism in which they facilitate the reaction differs as well as the key residues involved in the mechanism. These similarities and differences can be 7 Texas Tech University, Neill Kim, May 2020 used as a metabolic engineering advantage in order to create valued compounds with vast pharmaceutical effects. Currently, important compounds such as atropine are being produces solely by the plant then extracted using chemicals. This is due to the high yields the plant is able to produce when compared to synthetic reactions making the same compound. The ability to mix enzymes from different plant families to create pharmaceuticals will add more tools for synthetic biology approaches.

Scheme 1. The biosynthetic pathway of cocaine in E. coca. Enzymes in green depict characterized enzymes. Enzymes in red remain hypothetical.

8 Texas Tech University, Neill Kim, May 2020

CHAPTER 2

TROPANE AND GRANATANE ALKALOID BIOSYNTHESIS: A SYSTEMATIC ANALYSIS This chapter has been previously published in the journal Molecules (an MDPI journal). DOI: 10.3390/molecules21111510. A statement from the journal: For all articles published in MDPI journals, copyright is retained by the authors. Articles are licensed under an open access Creative Commons CC BY 4.0 license, meaning that anyone may download and read the paper for free. In addition, the article may be reused and quoted provided that the original published version is cited. These conditions allow for maximum use and exposure of the work, while ensuring that the authors receive proper credit. TROPANE AND GRANATANE ALKALOID BIOSYNTHESIS: A SYSTEMATIC ANALYSIS Neill Kim 1, †, Olga Estrada 1,†, Benjamin Chavez 1, Charles Stewart Jr. 2 and John C. D’Auria 1,* 1Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, TX 79409-1061, USA; [email protected] (N.K.); [email protected] (O.E.); [email protected] (B.C.) 2Office of Biotechnology, Iowa State University, Ames, IA 50011-1079, USA; [email protected] *Correspondence: [email protected]; Tel.: +1-806-834-7348; †These authors contributed equally to this article.

2.1 Abstract:

The tropane and granatane alkaloids belong to the larger pyrroline and piperidine classes of plant alkaloids, respectively. Their core structures share common moieties and their scattered distribution among angiosperms suggest that their biosynthesis may share common ancestry in some orders, while they may be independently derived in others. Tropane and granatane alkaloid diversity arises from the myriad modifications occurring to their core ring structures. Throughout much of human history, humans have cultivated tropane- and granatane-producing plants for their medicinal properties. This manuscript will discuss the diversity of their biological and ecological roles as well as what is known about the structural genes and enzymes responsible for their biosynthesis.

9 Texas Tech University, Neill Kim, May 2020

In addition, modern approaches to producing some pharmaceutically important tropanes via metabolic engineering endeavors are discussed.

Keywords: tropane alkaloids; granatane alkaloids; secondary metabolism; metabolic engineering

2.2 Introduction

Plants are sessile organisms and thus evolved natural products or “specialized metabolites” as a chemical response to both biotic and abiotic forces. Specialized metabolites are used by plants to defend themselves and communicate with other plants and organisms in their environments. Whilst the chemical diversity of plant specialized metabolites is vast, with total numbers thought to exceed over 200,000 structures, common themes of structure and function are the result of repeated and convergent evolution of both their biosynthesis and biological roles.40 Moreover, the chemical structures and underlying biosynthetic enzymes of specialized metabolites serve as inspiration to medicinal and natural product chemists. Many specialized metabolites are pharmacologically active and have been used by humans for therapeutic and recreational purposes since the beginning of recorded history. In particular alkaloids, pharmacologically active cyclic nitrogen containing metabolites derived from amino acids, are known for their pharmacological effects and frequently serve as the starting point for drug development.5 Some of the oldest domesticated medicinal plants have been those that produce alkaloids. For example, Erythroxylum coca, a species notable for the production of the tropane alkaloid cocaine (1), was used in Peruvian households at least 8000 years ago.3 Similarly, pomegranate (Punica granatum) has a history of cultivation that goes back at least 10,000 years in Egypt and is well-known for the production of granatane alkaloids.16

Tropane (TA) and granatane (GA) alkaloids are structural homologues, sharing similar chemical compositions and core scaffolds. Despite their similarities, TAs and GAs show different distribution patterns across the plant kingdom. The N-methyl-8- azabicyclo[3.2.1]-octane core structure of TAs is found in over 200 alkaloids (Figure

10 Texas Tech University, Neill Kim, May 2020

7).5, 13, 41 In contrast, N-methyl-9-azabicyclo[3.3.1]-nonane, the core scaffold of GAs, appears in considerably fewer alkaloid metabolites (Figure 7). The bicyclic core structures of TAs and GAs differ by only one carbon atom, yet this difference alters the conformational preferences of each of the core skeletons.42 Furthermore, the presence or absence of a single carbon atom in the core rings of TAs and GAs alters their chemical and pharmacological activities.

Figure 7. (a) The tropane core skeleton; (b) The bicyclic granatane core skeleton. Both structures depict their chemically accepted carbon numbering.

2.2.1 Similarities and Differences in Medicinal Properties

Despite their structural similarities TAs and GAs have distinct medicinal properties. TAs have been considered panaceas throughout recorded history, especially because of their anticholinergic properties. Anticholinergics are a class of compounds used as drugs to block the action of the acetylcholine neurotransmitter to treat motion sickness and diseases such as Alzheimer’s and Parkinson’s.43 The methylated nitrogen in the core ring of cocaine (1) and other TAs serves as a structural analog of acetylcholine. TAs have been observed to attach to and inhibit muscarinic acetylcholine receptors.44 TAs found in the Solanaceae are well known for both their anticholinergic and antispasmodic properties that affect the parasympathetic nervous system.45-47 These plants have been used for pain relief, anesthesia, and as a treatment for drug addiction.45 Daturae Flos, the dried flowers of Datura metel also known as “yangjinhua” in China, has been utilized and recorded in the Chinese Pharmacopoeia as an anesthetic and was prescribed to treat cough, asthma and convulsions.48 Przewalkia tangutica is a rare medicinal solanaceous plant found in the Tibetan Plateau of China in which the roots, seeds and entire vegetative tissues are utilized.49 P. tangutica contains several 11 Texas Tech University, Neill Kim, May 2020 biologically active TAs including anisodamine (2), scopolamine (3), and atropine (the racemic mixture of hyoscyamine (4)). The TAs present in P. tangutica are associated with many biological activities including analgesic, spasm modulation, pesticidal, and anti-inflammatory effects.49 Hyoscyamus niger, also known as henbane, has been utilized in Chinese traditional therapy as well as in Tibetan medicine.50 H. niger has been used as a sedative and sleep agent.51 Hyoscyamine (4) and scopolamine (3) are the dominant TAs of H. niger and both metabolites can cross the blood-brain barrier to affect the central nervous system.1 Scopolamine (3) has more potent pharmaceutical activity when compared to hyoscyamine (4) and exhibits relatively fewer side effects, however the scopolamine (3) content of solanaceous plants is usually much lower than the hyoscyamine (4) content.46 Because of this, there is an ongoing effort to fully understand the biosynthesis of scopolamine (3) and other TAs within the Solanaceae (see Section 4).

The narcotic properties of cocaine (1), a TA from the non-solanaceous genus Erythroxylum, can be attributed to unique modifications of the TA core scaffold that are not present in TAs from solanaceous plants. The carboxylic acid methyl ester present at the C2 position is responsible for the binding of cocaine (1) to the dopamine transporter.52 Cocaine (1) has also been reported to block the reuptake of nor- epinephrine, serotonin (5-HT receptor) and dopamine (D-A receptor) by the binding of the aromatic ring present at the 3β position of the molecule to specific sites in these receptors, affecting the normal physiology of the central nervous system.53 This stereospecific conformation is dominant in TAs found in the Erythroxylaceae, but is only a minor constituent in solanaceous plants.

While no direct studies regarding the anticholinergic effects of GAs have been reported, a computational and NMR based study comparing the structures of TAs and GAs revealed that GAs adopt an N-axial form that is similar to many known TAs.54 The N-methyl group in the axial conformation is thought to be the pharmacophore for TAs.55 Additionally, the granatane ring system provides the semisynthetic intermediate for the potent antiemetic agents Dolasteron and Granisetron, which are serotonin 5-HT3

12 Texas Tech University, Neill Kim, May 2020 receptor agonists.56, 57 These compounds are used as medicines to prevent acute nausea in patients undergoing chemotherapy and radiotherapy for the treatment of cancer.58

GAs and TAs have different physiological effects beyond the central nervous system. Unlike TAs, GAs exhibit anti-proliferative effects on hepatoma cells.58 Specifically, murine hepatoma (BNL CL.2) and human hepatoma (HepG2) cell lines were cultured with various doses of crude GA- containing alkaloid fraction extracts from Sedum sarmentosum. Inhibition of excessive growth of tumor cells was observed, indicating that these compounds possess anti-cancer properties.20 Other physiological effects that distinguish GAs from TAs include the use of GAs as an anti-worm treatment. Since the isolation of the first GAs, these compounds have been claimed to possess anti-worm (anthelminthic) capabilities, which were then studied in detail by scientists in the University of Amsterdam in 1956. These studies focused on deriving which GAs possessed the highest anthelminthic activity. The anthelminthic activity of synthetic granatane and its derivatives were measured in liver fluke. Their results rendered the highest anthelminthic activity to the compound isopelletierine.59 These findings were later scientifically supported in 1963 with newer and better chemical methods.60 Fascioliasis, a disease caused by liver fluke Fasciola hepatica, is common in cattle. Molluscidal activity in pomegranate bark extracts was effective in killing of Lymnaea acuminata, the vector for F. hepatica.61, 62 Beyond their medicinal properties, GAs also differ from TAs in that GAs have been found to be useful in the prevention of corrosion in the oil, gas and metal industries.63

2.2.2 The Scattered Distribution of Tropanes and Granatanes Amongst Angiosperms

Tropane alkaloids are commonly found in the genus Erythroxylum of the Erythroxylaceae family. The Erythroxylum genus includes at least 230 species that are distributed throughout the tropical regions of South and Central America.3, 64, 65 Erythroxylum coca was one of the first domesticated plant species that provided nutritional, medicinal, and digestive properties to ancient civilizations by chewing the leaves of the plant.66 Most of the cultivated coca used for cocaine (1) production comes

13 Texas Tech University, Neill Kim, May 2020 from this species.12 Albert Neimann first isolated cocaine (1) as a pure substance in 18609 and its use exploded in popularity following an endorsement by Sigmund Freud.67 The leaves of Erythroxylum novogranatense were also chewed by the elite class for their high content of methyl salicylate, which imparts a minty taste.10, 11 This species is known as “Colombian coca” and is found to be cultivated in the mountains of present-day Colombia. “Trujillo coca” (E. novogranatense var. truxillense) is a cultivar that is grown in dry and arid regions. This species is also rich in methyl salicylate and contains other flavoring qualities that are still used in the production of Coca Cola, however today the extracts are decocainized.12

Atropine, scopolamine (3), and hyoscyamine (4) are a few well-known TAs from the Solanaceae family. As discussed above, these compounds are commonly found in species such as Atropa belladonna, H. niger, and many members of the genus Datura. Scopolamine (3) was first isolated in 1888 from Scopolia japonica.68 In medieval Europe, extracts from A. belladonna, were used as poisons, hallucinogens and aphrodisiacs.1 Five to ten berries of A. belladonna could kill a person. The toxicity of the extracts has also been used on arrows to poison victims.69 When extracts of A. belladonna are applied to the eyes, dilation of the pupils occurs.70 For this reason, women used A. belladonna as a cosmetic drug during the Renaissance. Women of the 15th century who were devoted to witchcraft also exploited the psychoactive effects of A. belladonna.51 Mucous membranes, such as those found in the walls of the oral cavity and the vulva, are readily susceptible to drug absorption. It is believed that the application of alkaloid-containing salves to the skin or vulva was achieved by the use of brooms. It gave users the feeling of being able to fly, feeding the folkloric associations of witches with brooms.1 Atropine was first isolated in 1833 from A. belladonna.71, 72 The correct structure of atropine was obtained by Willstätter in 1889 after much deliberation and structural studies.1 Leaves of D. metel from solanaceous plants were used as herbal cigarettes in the 19th and 20th centuries to treat patients with asthma or other respiratory conditions.1

GAs include pelletierine (5), isopelletierine, pseudopelletierine (6), and N- methylpelletierine (7) and their derivatives anabasine (8) and anaferine (9) (Figure 8). 14 Texas Tech University, Neill Kim, May 2020

GAs are predominantly found in P. granatum although they have been characterized in other species such as S. sarmentosum, and Withania somnifera.17-19, 73 The pomegranate tree is native to Iran, Afghanistan, Baluchistan, and Himalayas in Northern India. Pomegranate can also be found in the Mediterranean and Caucasus regions due to its ancient cultivation. Today, pomegranate is cultivated all over India, Southeast Asia, Malaysia, the East Indies, tropical Africa, and the United States.74 In 1879, French chemists Tanret and Pelletier isolated a basic substance from the root bark of the pomegranate tree and characterized the salt.18 As of this review, no studies regarding characterization of any structural genes or the enzymes responsible for the production of GAs has been reported. Interestingly, the isolation of pseudopelletierine (6) has been reported in the species Erythroxylum lucidum75 suggesting that GAs and TAs may use similar biosynthetic machinery.

Figure 8. Examples of granatane alkaloids and granatane alkaloid derivatives found among several plant species.

Scientific reports on the occurrence and distribution of TAs from angiosperm families other than the Solanaceae and Erythoxylaceae are few. When viewed against a 15 Texas Tech University, Neill Kim, May 2020 phylogeny of angiosperms, the results reveal a scattered and non-contiguous distribution (Figure 9).2, 76 For example, TAs have been reported in members of the family Proteaceae. Compounds found in the family Proteaceae include the pyranotropanes, strobamine and bellendine as well as the compounds ferruginine and ferugine.77 In addition, a few members within the families Brassicaceae and Convolvulaceae have been found to produce calystegines, which are heavily hydroxylated forms of TAs.78 The main TA producing species are scattered among four orders, which include the Solanales, Malpighiales, Proteales and Brassicales. In the case of GAs, P. granatum from the family Lythraceae is the main producing species. However, the appearance of GAs has also been reported in members of the Solanaceae, Crassulaceae, and Erythroxylaceae families. These families belong to the orders Myrtales, Solanales, Malpighiales, and Saxifragales. This distribution pattern raises the important question about the biosynthetic origin of the respective GA and TA pathway. Namely, have these biosynthetic pathways arisen from a common ancestor or have they arisen independently in several cases? Recent evidence in TA biosynthesis suggests that certain biosynthetic steps have multiple origins13. By extension, this could also mean that GA biosynthesis has arisen independently more than once.

16 Texas Tech University, Neill Kim, May 2020

Figure 9. The diversity and similarities of tropane and granatane producing angiosperms. The orders tropane alkaloids belong to are highlighted in orange. The orders granatane alkaloids belong to are highlighted in blue. Shared orders are represented by both colors. The plant families that are known to produce tropane and granatane alkaloids are branched off from the orders. The scale at the bottom represents millions of years. Modification of the phylogenetic tree published in8, republished with permission with the Botanical Society of America.

Examples of scattered distributions of alkaloid classes can be observed throughout the plant kingdom. For example, the legumes (Fabaceae) contain several alkaloid secondary metabolites that are not found in all members within the family.79 In 17 Texas Tech University, Neill Kim, May 2020 some cases, de novo evolution of the pathways have been observed. In the case of indolizidine alkaloids, the source of the scattered appearance of alkaloids is theorized to occur due to horizontal gene transfer from alkaloid producing endophytic fungi.

2.2.3 Biosynthesis of TAs and GAs

Diversity among tropane and granatane alkaloids can also be seen at the biochemical level. Most data available regarding enzymes involved in TA biosynthesis comes from species within the Solanaceae family. Despite recent advancements, some critical steps in TA biosynthesis remain ambiguous. Additionally, recent advances in high throughput sequencing technologies, plant genomics, and biochemical methods have aided the progress of elucidating TA biosynthesis in other non-model species, specifically within the Erythroxylaceae. Lastly, even though the biosynthesis of GAs is predicted to be similar to TAs, plausibly a whole new set of enzymes were recruited for the biosynthesis of GAs. This would mean that untapped gene and enzyme diversity is present in the GA and TA biosynthetic pathways. It is therefore important to elucidate the biosynthesis of these alkaloids to help further understand specific parts of their mechanisms and their metabolic processes.

2.3 Tropane Alkaloid Biosynthesis

Overall, the process of producing either TAs or GAs in plants begins with the diversion of specific amino acids from primary metabolism into the formation of an initial nitrogen-containing ringed compound. This heterocycle will in most cases proceed on to form a bicyclic structure in which the core skeletons are created (Figure 7). Further modifications will add diverse functional groups to the core structure yielding the final end product. Ornithine (10) and arginine (11) are the amino acids predicted to be the starting substrates of TA biosynthesis (Scheme 2).80 Feeding studies using 14C-proline into the roots of A. belladonna also suggest that proline (12) may be a starting amino acid for incorporation into the tropane moiety. Other studies using D. metel and D. stramonium have also shown the incorporation of proline (12) into TA compounds, such as scopolamine (3) and tropine (13).81 Biosynthetically each of these three amino acids can generate a pyrroline-5-carboxylate intermediate, which can be 18 Texas Tech University, Neill Kim, May 2020 interconvertible between these amino acids.82 Consequently, feeding studies of labeled amino acids are difficult to interpret without further enzymological data.

Scheme 2. Tropane alkaloid biosynthesis up to the formation of the N-methyl-Δ1-pyrrolinium cation. Arginine, ornithine and proline are interconvertable, sharing the pyrroline-5-carboxylate intermediate (highlighted in blue). Putrescine can be formed directly via decarboxylation of ornithine or indirectly through arginine. Methylation of putrescine is followed by oxidation to yield 4-methylamino-butanal, which is then spontaneously cyclized to yield the N-methyl-Δ1- pyrrolinium cation. Enzymes are highlighted in orange and abbreviated as follows: ADC, arginine decarboxylase; AIH, agmatine imino hydrolase; NCPAH, N-carbamoylputrescine amino hydrolase; ODC, ornithine decarboxylase; PMT, putrescine N-methyl transferase; MPO, methyl putrescine oxidase.

A nonsymmetrical intermediate has been proposed for the production of the pyrrolidine ring, if the amino acid ornithine (10) is first methylated at the γ-N position. A proposed alternative route includes the decarboxylation of ornithine (10) to form the polyamine putrescine (14) as the first step.83, 84 Feeding studies of radioactively labeled ornithine-2-14C have shown that several Datura species incorporate a nonsymmetrical intermediate.83 However, a symmetrical intermediate has been reported for Nicotiana, Erythroxylum, and Hyoscyamus species.85 Symmetrical incorporation showed activity at positions C1 and C5 of the tropane ring and has been reported for Nicotiana, E. coca, 19 Texas Tech University, Neill Kim, May 2020 and Hyoscyamus albus.83, 84 A one-step enzymatic approach is possible to reach a symmetrical intermediate by converting ornithine (10) into putrescine (14) catalyzed by ornithine decarboxylase (ODC).15 Another route to putrescine (14) can be taken by starting with the amino acid arginine (11). The decarboxylation of arginine (11) into agmatine (15) is catalyzed by arginine decarboxylase (ADC). Agmatine (15) can then be converted into N-carbamoyl putrescine (16) via agmatine imino hydrolase (AIH). The enzyme N-carbamoyl putrescine amido hydrolase (NCPAH) then yields putrescine (14). Both the ADC and ODC directed pathways have different and diverse outcomes in regards to primary and secondary metabolism. Putrescine (14) that was produced by ODC is important for the supply of polyamines for primary metabolic processes such as cellular differentiation, development and division.86 On the other hand, putrescine (14) that was produced by ADC in the Solanaceae is thought to be required for environmental stress related responses.

The formation of N-methylputrescine (17) catalyzed by putrescine N- methyltransferase (PMT) is considered the first rate-limiting step in the TA biosynthetic pathway.87 PMT is an S-adenosylmethionine (SAM)-dependent methyltransferase that attaches a methyl group to the nitrogen atom that ultimately appears in the tropane skeleton. The first PMT sequence to be isolated from plants came from tobacco (Nicotiana tabacum).88 Since then, many other PMT related sequences have been isolated and characterized from other pyrrolidine alkaloid producing plant species. PMT belongs to a large family of enzymes that are involved in polyamine production. These primary metabolites play an important role in stress physiology, senescence, and morphogenesis.89 Several lines of evidence suggest that PMT function has evolved from an ancestral spermidine or spermine synthases.90 This would suggest that an enzyme from primary metabolism was recruited for the production of secondary metabolites. Localization of the PMT protein is root specific for both nicotine and tropane producing solanaceous plants.7, 91, 92 While N-methylputrescine (17) is the predominant intermediate for solanaceous TAs, at least one alternative has been suggested. [6-14C]- 1,5,10-triazadecane fed to Nicotiana glutinosa plants revealed that N-methylspermidine can also be incorporated into the pyrrolidine ring of nicotine.93

20 Texas Tech University, Neill Kim, May 2020

The next step in TA biosynthesis is the formation of 4-methylamino-butanal (18) from N-methylputrescine (17) catalyzed by methylputrescine oxidase (MPO). This enzyme coexists with a class of copper-dependent diamine oxidases that uses copper as a cofactor to oxidize a conserved tyrosine residue into a topaquinone, essential for enzyme catalysis.94 MPO was first characterized from the species N. tabacum.95, 96 Although an MPO like gene has yet to be discovered in E. coca, the corresponding activity from intact plants fed 4-monodeuterated N-methylputrescine shows the same enantioselectivity as solanaceous plants that produce either nicotine or TAs.97 Using 13C fractionation techniques, researchers have found that both nicotine and hyoscyamine (4) share the same biosynthetic pathway, at least up to the N-methyl-Δ1-pyrrolinium cation (19).98 Subsequently, a hypothesis has been proposed that a metabolic channel prevails in which a multi-enzyme complex is active. The product of MPO, 4-methylamino- butanal (18), spontaneously cyclizes to form the N-methyl-Δ1-pyrrolinium cation (19).83 Feeding studies using ornithine-2-14C detected labeled 4-methylamino-butanal in D. stramonium plants.83 The N-methyl-Δ1-pyrrolinium cation (19) serves as the first ring in the bicyclic tropane skeleton.

While the biochemical role of PMTs and MPOs are generally accepted steps leading to the first ring closure of tropane intermediates in the Solanaceae, the enzymatic basis of the second ring closure is controversial. For many years, the compound hygrine (20), (R)-1-(1-methylpyrrolidin-2-yl)-propan-2-one was thought to be a direct intermediate based on feeding studies, however more recent studies have demonstrated that previous results are likely experimental artifacts.99-101 In solanaceous plants the best 13 incorporation into the second ring was achieved from racemic ethyl [2,3- C2]-4-(N- methyl-2-pyrrolidinyl)-3-oxobutanoate99, 102, a polyketide based molecule (Scheme 3). Further evidence for the involvement of a polyketide was demonstrated by the feeding 13 14 of methyl (RS)-[1,2- C2,1- C]-4-(1-methyl-2-pyrrolidinyl)-3-oxobutanoate to the leaves of E. coca.103 This strongly implicates the involvement of acetate-derived metabolites (e.g., polyketides) during the formation of the second ring in TAs. There are limited types of enzymes capable of catalyzing this type of condensation reaction. In the case of benzylisoquinoline alkaloid biosynthesis a Pictet–Spenglerase enzyme

21 Texas Tech University, Neill Kim, May 2020 was shown to condense dopamine with 3,4-dihydroxyphenylacetaldehyde.6 However, based on more recent isotope and radiolabeled feeding studies it is hypothesized that a type III polyketide synthase (PKS) reaction is involved in condensing acetate units onto the N-methyl-Δ1-pyrrolinium cation (19) leading to the second ring closure of TA biosynthesis.99, 102, 104 Type III PKSs are a family of enzymes known to catalyze the iterative decarboxylative condensation of malonyl-CoA onto CoA-tethered substrates. Type III PKSs are promiscuous enzymes that have a broad tolerance for diverse substrates and are able to catalyze multiple reactions.22, 23 Type III PKSs that use cyclic nitrogen-containing substrates have been previously characterized for their roles in alkaloid production.105-107 However, unlike these previous studies the predicted substrate in TA metabolism, N-methyl-Δ1-pyrrolinium cation (19) is charged and lacks a CoA thioester.

Scheme 3. Tropinone formation from the N-methyl-Δ1-pyrrolinium cation in which there are two possibilities for the condensation of the tropane ring. Acetyl-CoA is utilized via acetoacetate to yield hygrine-1-carboxylic acid. On the other hand, two successive decarboxylative condensations of malonyl-CoA by PKS (polyketide synthase) yields 4-(1-methyl-2- pyrrolidinyl)-3-oxobutanoyl-CoA. Enzymes are highlighted in orange and substrates are highlighted in blue.

Spontaneous decarboxylation at the C2 position following ring closure can be prevented by the formation of the methyl ester. This would explain the presence of the carbomethoxy group found in cocaine (1) as well as other tropane alkaloids produced by plants found in the Erythroxylaceae. The resulting compound methylecgonone (21),

22 Texas Tech University, Neill Kim, May 2020 contains a keto function at the C3 position and a carbomethoxy group at the C2 position.13 Reduction at C3 is necessary for ester formation to occur.

For the members of the Solanaceae, tropinone reductase (TR) enzymes catalyze the reduction of keto groups in the tropane ring. These enzymes are part of the short chain dehydrogenase/reductase (SDR) family that catalyzes NAD(P)(H)-dependent monomeric oxidoreductase reactions.108 Its activity controls the metabolic flux towards TA biosynthesis downstream.109 In solanaceous plants, two types of tropinone reductases exist, tropinone reductase I (TR I) and tropinone reductase II (TR II). They share a common tertiary “Rossman” fold structure, a conserved motif that consists of two pairs of α-helices and six parallel β-sheets, a catalytic active site with the motif YxxxK, and a dinucleotide cofactor-binding motif.110 These enzymes share more than 50% of amino acid sequence similarity and are also assumed to have evolved from a common ancestor.109 As little as five amino acid differences are needed to change the stereochemistry of the product.111 TR I only converts the 3-keto function to a product that has a 3α-configuration (Scheme 4). This produces tropine (13) (3α-tropanol), which serves as a precursor for a wide range of esterified TAs.13 On the contrary, TR II produces an alcohol solely with a 3β-configuration called pseudotropine (3β-tropanol). This is then converted to different nonesterified TAs called calystegines. A gene duplication event is attributed to these two different TRs in the Solanaceae family.112

23 Texas Tech University, Neill Kim, May 2020

Scheme 4. Tropinone is converted into tropine via TRI, tropinone reductase I. Tropine utilizes phenyllactoyl-CoA to yield littorine, which then uses a cytochrome p450 enzyme to form hyoscyamine. Scopolamine is epoxidized by the enzyme H6H, 6β-hydroxy hyoscyamine epoxidase, in a two-step process. Enzymes are highlighted in orange and substrates are highlighted in blue.

However in E. coca, a very different type of reductase enzyme was found for the reduction of the 3-keto function of methylecgonone (21) (Scheme 5). This is the first evidence of a polyphyletic origin for TA biosynthesis in plants. Methylecgonone reductase (MecgoR) was purified from crude protein extracts from coca leaves using classical biochemical techniques.13 This enzyme was found to be very different than the TR enzymes that catalyzed the reduction reaction of the 3-keto function in solanaceous plants. MecgoR shares an overall identity of less than 10% at the amino acid level when compared to any TRs. MecgoR belongs to an aldo-keto reductase (AKR) superfamily of enzymes. AKRs that have been characterized so far share a common α/β-barrel motif, using either NADH or NADPH as a cofactor.113 The MecgoR protein is localized in the palisade parenchyma of young developing leaves. This is in contrast to the localization of roots in TRs of solanaceous plants. This enzyme is also similar to other enzymes of alkaloid metabolism such as codeinone reductase and an enzyme of flavonoid biosynthesis, chalcone reductase. The stereospecific enzyme MecgoR catalyzes the conversion of methylecgonone (21) to the 3β-hydroxy-containing compound 24 Texas Tech University, Neill Kim, May 2020 methylecgonine (22). MecgoR can also use tropinone (23) as a substrate but this only produces pseudotropine, which is consistent in E. coca with the presence of only 3β- hydroxy esters. Common TAs are esterified with aromatic or aliphatic acids, with the stereochemistry of the hydroxyl group dependent on the reductase used.

25 Texas Tech University, Neill Kim, May 2020

Scheme 5. Ecgonone-CoA ester undergoes a multi-step process to yield methylecgonone, which is reduced by methylecgonne reductase, MecgoR to produce methylecgonine. Cocaine is then formed by the acylation of methylecgonine with benzoyl-CoA. Enzymes are highlighted in orange and substrates are highlighted in blue.

The benzoic ester of methylecgonine (22) is cocaine (1). Methylecgonine (22) is a molecule that has little physiological activity until it is converted into cocaine (1).114 26 Texas Tech University, Neill Kim, May 2020

There has been a prediction that an acyltransferase in E. coca utilizes benzoyl-CoA as the activated acid. This prediction was based on feeding studies using trans-[3-13C,14C]- cinnamic acid and the N-acetylcysteamine thioester of [3-13C,14C]-trans-cinnamic acid.115 Methylecgonine (22) undergoes esterification with a benzoyl moiety that was predicted to utilize benzoyl-CoA as the activated acyl donor.116 It was not determined if it arises from benzoyl-CoA or benzaldehyde, but the moiety was found to be derived from cinnamic acid.115, 116 Acylation reactions of secondary metabolites in plants are catalyzed by several acyltransferase families, however only the BAHD acyltransferase is known to utilize the activated acyl-CoA thioesters.117 TAs are modified through the esterification of the hydroxyl function at the C3 position in the tropane ring. It has been established that in E. coca, the cocaine synthase reaction uses benzoyl-CoA and methylecgonine (22) as substrates. With the CoA-dependent nature of this enzyme along with the reported properties for the tigloyl-CoA:pseudotropine acyltransferase from D. stramonium, it was hypothesized that cocaine synthase is a member of the BAHD acyltransferase superfamily.118 This superfamily of enzymes is well known to participate in secondary metabolite modification of esters and amides.117 Cocaine synthase was found to be capable of producing both cocaine (1) via activated benzoyl- CoA thioester and cinnamoylcocaine via activated cinnamoyl-CoA thioesters.14 It has been determined that the acylation of the 3β-hydroxyl function of methylecgonine (22), catalyzed by cocaine synthase, forms cocaine (1) and other TAs in E. coca. The accumulation and biosynthesis of TAs in E. coca occur within the same tissue. Cocaine synthase is found localized in the parenchyma and spongy mesophyll of the leaves. These tissues are both responsible for the biosynthesis and storage of TAs in this species. 4-coumaroylquinate has been reported to assist in the storage of cocaine (1) and cinnamoylcocaine in E. coca.119 This is in contrast to TAs produced in the Solanaceae family where the core biosynthetic pathway is in the roots, while the metabolites accumulate in the aboveground portions of the plants.7

The rearrangement of the hydroxyl group of the phenyllactic acid moiety of littorine (24) in TA side chain biosynthesis has drawn interest. The phenomenon occurs in both atropine and scopolamine (3) biosynthesis. A branched-chain residue, tropic

27 Texas Tech University, Neill Kim, May 2020 acid, is formed from the linear chain phenyllactic acid. To better understand this process, feeding studies of radiolabeled compounds have tried to elucidate the mechanism of this reaction.120-124 Feeding studies and quantum chemistry calculations by Sandala et al. have led to the hypothesis that a cytochrome p450 coupled with an alcohol dehydrogenase is involved in the conversion of the littorine (24) precursor into hyoscyamine (4).125 Li et al. were able to suppress cytochrome p450 CYP80F1 expression by using virus-induced gene silencing techniques that caused reduced levels of hyoscyamine (4) and promoted the accumulation of littorine (24).126 Using arylfluorinated analogues of (R)- and (S)-littorine, Nasomajai et al. were able to determine that the CYP80F1 catalyzed hydroxylation occurs via a benzylic carbocation intermediate.127 Reversible 3′-acetoxylation of hyoscyamine (4) is thought to control the flux from hyoscyamine (4) to scopolamine (3).128

Hyoscyamine (4) is converted into the epoxide scopolamine (3) via hyoscyamine 6β-hydroxylase (H6H). This enzyme was shown to be a 2-oxoglutarate- dependent dioxygenase from purified H. niger.129, 130 Hydroxylation at the C6 position of hyoscyamine (4) followed by the epoxidation of anisodamine (2) (6β-hydroxy hyoscyamus) is catalyzed by H6H. The localization of this enzyme was also determined to be exclusively in the pericycle of roots.131 Some solanaceous species contain acylations at the C6, C7 and C3 positions.128 In a recent networking analysis study of the tropane biosynthetic pathway in D. innoxia, an enzyme activity was theorized in which acylation at the C3 position with a tiglic acid occurs using a C6 acylated tropane as the substrate.128 By extension, Nguyen et al. have suggested that there are alternate C6-hydroxylating enzymes present with specificities different from H6H that could use tropinone (23) as a substrate instead of the reduced tropine (13) derivative. The same networking study revealed that high variability exists for the acylated tropanes which directly contributes to their chemical diversity.128 Interestingly, some of the 3-hydroxyl acylating enzymes appear to not be stereospecific. Such enzymes could be useful for expanding the biocatalytic tools available to those interested in metabolic engineering or synthetic biology of tropane derivatives.

28 Texas Tech University, Neill Kim, May 2020

2.4 Granatane Alkaloid Biosynthesis

In this review, our definition of GAs includes piperideine derived compounds that incorporate a pelletierine (5) or N-methylpelletierine (7) core structure. There has been some confusion among scientists regarding the naming and configuration of pelletierine (5). Older reports sometimes use the name isopelletierine incorrectly to refer to the compound [R-1-(2-piperidyl) propan-2-one], which in reality corresponds to pelletierine (5). The name isopelletierine is the optically inactive racemate of pelletierine (5).132 The correct chemical name for the compound N-methylpelletierine (7) is 1-[(2R)-1-methyl-2piperdinyl]-2-propanone. Pseudopelletierine (6), also referred to as granatanone, contains a bicyclic core and can be referred to as [9-methyl-9- azabicyclo [3,3,1] nonan-3-one]. Additionally, the presence of anabasine (8), in Nicotiana species would by extension mean that selected members of the Solanaceae can be classified as granatane producing members. Furthermore, the solanaceous species W. somifera produces anabasine (8), which could also be classified as a GA. In addition, several Sedum species (family Crassulaceae) produce the compounds pelletierine (5), N-methylpelletierine (7), and pseudopelletierine (6). All of the species discussed above are members of the order Solanales and are more closely related to one another than they are to other granatane producing angiosperms (Figure 9). This may suggest that, at least within this order of angiosperms, the biosynthetic pathways leading to either tropanes or granatanes are commonly derived. The last time members of the Solanales shared a common ancestor with granatane producing lines in the Myrtales is approximately 120 million years ago. This is similar to the distance between the tropane producing Erythroxylaceae and Solanaceae.

The only research studies performed with the aim to demonstrate the biochemical precursors of GAs have been performed by feeding plants radiolabeled precursors. Table 1 provides a comprehensive summary of feeding studies performed in granatane-producing species as of this review. The labeled products were then subjected to analysis via chemical breakdown and modification. While these studies were informative, they can also be misleading when attempting to interpret them through the viewpoint of biochemical enzymes and mechanisms. The general consensus 29 Texas Tech University, Neill Kim, May 2020 is that lysine (25) is the starting substrate for the entry into granatane biosynthesis. In several cases, different forms of labeled lysine were found incorporated into the core granatane structure.133-138

Table 1. Summary of radiolabel feeding studies performed on granatane-producing species.

Species Radiolabeled Where Label Was Found Reference Studied Compound Punica 1-14C-acetate N-methyl isopelletierine 137 granatum Punica 2-14C-lysine N-methyl isopelletierine 137 granatum Withania 2-14C-lysine anaferine 137 somnifera Punica [1-14C] acetate Isopelletierine, N-methylisopelletierine, 136 granatum and pseudopelletierine Withania [1-14C] acetate anaferine 136 somnifera Punica DL-[2-14C] lysine N-methylisopelletierine asymmetrically 136 granatum Withania DL-[2-14C] lysine Anaferine asymmetrically 136 somnifera Punica [N-methyl-14C, 814C] pseudopelletierine 136 granatum methylisopelletierine Withania [8-14C] isopelletierine anaferine 136 somnifera Punica [1,515C] cadaverine and N-methylisopelletierine and 139 granatum [3H] cadaverine pseudopelletierine nonrandomly Punica [14C] methionine N-methylisopelletierine and 139 granatum pseudopelletierine 13 134 Sedum Sodium [1,2,3,4- C4] N-methylpelletierine sarmentosum acetate and sodium [1,2- 13 C2] acetate Sedum acre and DL-[6-14C] lysine, L-[4,5- Only L enantiomer of lysine was 133 8 Sedum H2] lysine, and D-[6- incorporated into N-methylpelletierine. sarmentosum 14C] lysine Nicotiana DL-[6-14C] lysine, L-[4,5- Only L enantiomer of lysine was 133 8 glauca H2] lysine, and D-[6- incorporated into anabasine. 14C] lysine Sedum [6-14C] lysine N-methylisopelletierine 138 sarmentosum Sedum 6-14C-DL-lysine N-methylpelletierine asymmetrically 135 sarmentosum 3 14 135 Sedum 4,5- H2,6- C-DL-lysine N-methylpelletierine sarmentosum

Over the course of studies regarding granatane and piperideine alkaloid biosynthesis, there has been some controversy over the origin of the intermediates in the biosynthetic pathway. One of the main questions that has repeatedly been tested is 30 Texas Tech University, Neill Kim, May 2020 whether or not cadaverine (26) is present in the pathway to form pelletierine (5) and other granatane derivatives. Several contradictory observations have been made depending on the type of label of the compound fed to plants as well as which species was used. The majority of the debate regarding the beginning intermediates arises when older radiolabel feeding studies in the Sedum species are used as a reference. These studies report the asymmetrical incorporation of the starting precursors into their respective alkaloids. However, other studies performed on pomegranate report that a symmetrical intermediate (such as cadaverine (26)) must exist.140 Possible explanations for this problem could be that the members of the family Crassulaceae (e.g., Sedum species) do not utilize the same enzymatic steps as other granatane producing members such as those found in the family Lythraceae.

The three hypothesized biosynthetic pathways for the production of GAs will be referred to as Hypothesis I, Hypothesis II, and Hypothesis III; their schematic representation is shown in Scheme 6. Hypothesis I is based on the observation that P. 14 14 3 granatum plants fed [1.5- C] and [1.5- C H2] cadaverine yields incorporation of the labels into N-methylpelletierine (7) and pseudopelletierine (6).139 In this pathway, lysine (25) is first decarboxylated to form cadaverine (26) which would subsequently be methylated to form N-methylcadaverine (27).137 N-methylcadaverine (27) would then be oxidized to form 5-methylaminopentanal (28) promoting a spontaneous cyclization to form the N-methyl-∆1-piperidinium cation (29). This product would then ultimately form N-methylpelletierine (7) or be converted to the corresponding oxobutanoate by the decarboxylative condensation of two malonyl-CoA which would then cyclize to form pseudopelletierine (6). Feeding studies performed in Sedum species report that cadaverine (26) is not present as an intermediate, giving rise to Hypothesis II. By feeding [1-14C] cadaverine, Leistner et al. (1990) have predicted that there should be a lysine decarboxylase enzyme that also contains oxidase activity such that the only cadaverine (26) intermediate that exists is always enzyme bound.140 Therefore, according to this hypothesis, lysine (25) is catalyzed in one enzyme or enzyme complex to produce 5-aminopentanal (30). The 5-aminopentanal intermediate (30) would cyclize to form a ∆1-piperidinium cation (31), which can then be methylated at the nitrogen

31 Texas Tech University, Neill Kim, May 2020 atom to form the N-methyl-∆1-piperidinium cation (29) or remain unmethylated and ultimately go on to form pelletierine (5).

Scheme 6. Three proposed hypothetical routes to the production of granatane alkaloids. Hypothesized enzymes are presented in orange and hypothetical cofactors are presented in blue. The abbreviated enzymes and cofactor are as follows: ODC, ornithine decarboxylase; LDC, lysine decarboxylase; CMT, cadaverine N-methyl transferase; MPO, methyl putrescine oxidase; PKS, polyketide synthase; LMT, lysine N-methyl transferase; MLDC, N-methyllysine decarboxylase; SAM, S-adenosyl-L-methionine.

In all three hypotheses the origin of the N-methyl group is via labeled methionine.139 The biochemical methyl donor for this incorporation would be S- adenosylmethionine (SAM). Hypothesis III also involves an early asymmetrical intermediate. In this hypothesis, the first biosynthetic step is the methylation of lysine (25) which occurs at the ε-N position producing ε-N-methyl-lysine (32). This compound would then be decarboxylated to form N-methylcadaverine (27) which would undergo oxidation to form 5-methylaminopentanal (28), promoting a spontaneous cyclization to form the N-methyl-∆1-piperidinium cation (29). As described in Hypothesis I, the N- methyl-∆1-piperidinium cation (29) would ultimately form N-methylpelletierine (7) and pseudopelletierine (6).

32 Texas Tech University, Neill Kim, May 2020

Radioactive acetate is incorporated into GAs regardless of which species is fed.134-137 As is the case with tropane alkaloid biosynthesis, the enzymes involved in the extension and cyclization reactions of granatanes includes a putative polyketide synthase. Plants readily convert acetate into malonyl-CoA via the enzyme acetyl-CoA carboxylase.141 A type III polyketide synthase utilizing 2 units of malonyl-CoA and the N-methyl-∆1-piperidinium cation (29) would produce 4-(1-methyl-2-piperinidyl)-3- oxobutanoyl-CoA (33). The prediction of the presence of a type III polyketide synthase in GA biosynthesis is supported by radiolabeling studies which fed ethyl (R,S)-[2,3- 13 14 99, 102, C2,3- C-]-4-(l-methyl-2-pyrrolidinyl)-3-oxobutanoate to D. stramonium plants. 104 The oxobutanoyl compound may then have several fates; its conversion to pseudopelletierine (6) by intermolecular interaction of the positively charged nitrogen and the carboxyl CoA, or its conversion to N-methylpelletierine (7) or pelletierine (5) by losing the carboxyl as CO2. Bicyclic GA producing species are similar to solanaceous plants producing tropanes, namely the loss of the carboxyl group due to a lack of methyl ester protection. As mentioned earlier in this review, the protection of the carboxyl group of oxobutanoate by methylation gives rise to the moiety responsible for the narcotic effects of cocaine (1), which would explain why GAs do not exhibit narcotic effects.52

The enzymes responsible for carrying out the biochemical reactions described above are based on an extension of similar reactions carried out in tropane producing species. The decarboxylation of lysine (25) described in Hypothesis I would be performed by a P. granatum lysine decarboxylase (LDC). The presence of a lysine decarboxylase in the synthesis of anabasine (8) in Nicotiana species has been studied by the incorporation of [15N]-lysine into anabasine (8).142 The methylation of cadaverine (26) would be achieved with the help of a P. granatum cadaverine N-methyltransferase (CMT). CMTs have not been isolated and characterized in other species, but this enzyme is predicted to be related to putrescine N-methyltransferases (PMT) and spermidine synthases (SPDS). PMT cDNA sequences have been found in Nicotiana species by the sequencing of large genomic libraries.143, 144 The enzymes SPDS and PMT have been found to share substrate specificity, but PMT is dependent of the

33 Texas Tech University, Neill Kim, May 2020 decarboxylated S-adenosylmethionine (dcSAM) as a co-substrate. The oxidation of N- methylcadaverine (27) in P. granatum and Sedum species could be performed with the aid of an enzyme similar to the methylputrescine oxygenase (MPO) present in the biosynthesis of nicotine in N. tabacum. While a copper dependent oxidase is used for tropane alkaloid biosynthesis, it is not possible to rule out alternative enzymes such as polyamine oxidases that require FAD as a cofactor.145 The methylation of lysine (25) described in Hypothesis III would be performed by a lysine methyltransferase (LMT). The responsible enzyme may be related to the lysine methyltransferases ubiquitously present in eukaryotic primary metabolism for gene access regulation to chromatin.146

In both granatane and tropane alkaloid producing species, dimerized versions of intermediates within their respective pathways have been found. For example, cuscohygrine is the dimerized form of hygrine (20).147 Originally it was believed that hygrine (20) was a true intermediate of the biosynthesis of TAs. However, it is most likely that cuscohygrine is a dimerized product of hygrine (20) which in turn is a breakdown product of 4-(1-methyl-2-pyrrolidinyl)-3-oxobutanoyl-CoA (34). If this compound is present as a free acid under physiological conditions a β-ketoester is formed, β-ketoesters very often spontaneously decarboxylate.148 In the case of GA biosynthesis, anaferine (9) is the dimerization product of pelletierine (5). This also supports the presence of an oxobutanoate intermediate.

2.5 Metabolic Engineering

There has been an increasing interest in the biosynthesis of tropane alkaloids (TAs), especially to up-regulate the production of valued compounds, such as atropine and scopolamine (3). The World Health Organization (WHO) includes these important pharmaceutical compounds on their list of essential drugs.149 In normal plant biosynthesis, the yields of the final compounds are in low quantities. Synthesizing TAs chemically in the lab has also been difficult and costly because of their stereochemical nature. Nocquet et al. attempted a total synthesis approach to produce the compound scopolamine (3), however their low yield of 16% does not make this method economically feasible.5 A major problem for the commercial production of scopolamine

34 Texas Tech University, Neill Kim, May 2020

(3) in hairy root cultures is achieving industrial level yields.150 Researchers are now focused on metabolic engineering plants that produce these important compounds to increase final yields, or engineering microorganisms that will be able to produce the compounds from simple sugars or common precursors. A comprehensive table of the most recent metabolic engineering studies targeting specific genes can be seen on Table 2.

Table 2. A summary of recent metabolic engineering studies targeting specific genes.

Species Target Gene/Genes Effect Referenc Compound Modified e Atropa Scopolamine NtPMT & Increased scopolamine content 46 belladonn HnH6H a Atropa Hyoscyamin rolC, pmt, & Increased hyoscyamine content & 151 belladonn e & h6h increased scopolamine content a scopolamine Escherichi Putrescine Multiple Increased putrescine production 152 a coli Brugmansi Polyamines rolC Polyamine accumulation, improve 153 a condida (putrescine) hairy root growth Atropa Pseudotropin tr-1/tr-2 Higher enzyme activity & increase 154 belladonn e/Tropine in pseudotropine/tropine a Anisodus TAs pmt & tr-1 Increased TA levels with 155 acutangul hyoscyamine being major alkaloid us

Due to its high demand in medicine, scopolamine (3) is the most popular choice for increasing yields via metabolic engineering. Past methods such as genetic breeding, polyploid breeding and radiation breeding have failed to yield a higher content of scopolamine (3) in A. belladonna.156 Researchers are now focused on the genes encoding rate-limiting enzymes in TA biosynthesis that can be genetically modified in planta. A common focal point centers on what is considered the first and last rate- limiting enzymes in the TA pathway, putrescine N-methyltransferase (PMT) and hyoscyamine 6β-hydroxylase (H6H). The overexpression of only one PMT gene in transgenic hairy root cultures of A. belladonna did not change the total TA content.157 If the same PMT gene in D. metel was overexpressed, the TA content was significantly increased by almost four times that of the control.158 H6H has a high catalytic efficiency for converting hyoscyamine (4) to scopolamine (3).159 The overexpression of the H6H 35 Texas Tech University, Neill Kim, May 2020 gene resulted in an increase in the biosynthesis of scopolamine (3) in the transformed TA producing plant, A. belladonna. Another successful use of H6H was in transgenic Hyoscyamus muticus hairy root cultures, where scopolamine (3) levels increased to over 100 times that of the controls.160 Furthermore, overexpression of H6H in transgenic A. belladonna plants resulted in the leaf and stem alkaloid contents to be exclusively scopolamine (3).159

Metabolic engineering endeavors are becoming more complex and are moving away from only modifying one gene at a time. When both PMT and H6H were overexpressed simultaneously in transgenic H. niger root cultures, scopolamine (3) biosynthesis increased to levels over nine times more than the wild type.161 In an important experiment testing whether metabolic engineering can occur between genes isolated from different species, overexpression of NtPMT and HnH6H in A. belladonna significantly increased scopolamine (3) content of secondary roots when compared to wild-type plants.46 More studies are needed to understand flux through the tropane biosynthetic pathway in order to increase the overproduction of alkaloids.

D. metel produces important medicinal tropanes and is used by researchers because of its tractable hairy root culture system. Agrobacterium rhizogenes can transform plant roots to hairy roots by utilizing the Ri T-DNA plasmid it carries. Hairy roots that have been induced by A. rhizogenes have high growth rates, are genetically stable, and produce copious amounts of lateral roots.162 Increased TA biosynthesis correlated with an increase in root biomass. Biotic elicitors, such as yeast extract, bacteria, fungi and viruses, as well as abiotic elicitors, such as metal ions or inorganic components, are used and studied to increase the productivity of hairy roots. These elicitors can trigger different defense responses and phytoalexins in plants as well as improve the release of metabolites into the medium.45 Shakeran et al. focused on using Staphylococcus aureus and Bacillus cereus as biotic elicitors and silver nitrate and nanosilver as abiotic elicitors on the hairy root cultures of D. metel to see their effects on biomass and atropine production. When live bacteria are present in transformed root cultures, there is a considerable influence on secondary metabolite accumulation.163 Contrary to this, atropine content in the hairy roots of D. metel infected by B. cereus 36 Texas Tech University, Neill Kim, May 2020 and S. aureus was reduced more than half when compared to the control. The authors hypothesize that this may be a cause of atropine secretion into the culture medium that was then converted into scopolamine (3).45 However, scopolamine (3) was not analyzed in the spent media. The living bacteria can cause various influences on roots, affecting enzymes in the TA pathway to produce alkaloids in D. metel roots.163 Although atropine accumulation decreased with these biotic elicitors, the biomass of the roots slightly increased approximately 15% when compared to the control.45

Other attempts to engineer higher TA contents in plants include those that use abiotic elicitors. A summary of recent metabolic engineering studies using elicitors can be seen on Table 3. Silver nitrate can increase anisodamine (2) content in Anisodus acutangulus hairy root cultures.164 In addition, calcium and nitrate can increase hyoscyamine (4) content in D. stramonium hairy root cultures.165 Silver nitrate can inhibit the activation of ethylene and in doing so, promotes polyamine synthesis.166, 167 As a consequence, the overall effect of silver nitrate treatment can be seen in the increase of root biomass.166-168 Furthermore, silver nitrate has been demonstrated to elicit the production of phytoalexins which in turn increases TA levels in the root.169

Shakeran et al. (2015) used silver nitrate as an abiotic elicitor in D. metel and observed an increase in the transformed hairy root biomass of approximately 16%. However, only half of the expected atropine accumulation was observed in these treatments. Although secretion of atropine was not measured in this study, subsequent reports corroborated this hypothesis by finding a three-fold increase in alkaloids in the spent culture media following silver nitrate treatment.170 Still, further attempts at increasing alkaloid levels include the treatment using nanosilver particles. These differ from silver nitrate in their physicochemical properties.171, 172 Nanosilver particles adhere strongly to plant tissues and cause an increase in the activation of enzymes involved in secondary metabolite production. This treatment was used successfully in Artemisia annua and D. metel hairy roots increasing tropanes by at least 2.4 fold.45 Initial polyamine substrates such as putrescine (14) must be present in abundance during TA production for a high yield of the final alkaloid. Currently there are only a few studies attempting to engineer the TA pathway in microorganisms. Qian et al. engineered a 37 Texas Tech University, Neill Kim, May 2020 strain of Escherichia coli capable of efficiently producing putrescine (14).152 However, it was first necessary to reduce the flux of polyamine precursors through a competing pathway. Metabolic pathways for putrescine (14) degradation, uptake and utilization were also deleted. Stress to cells by the overproduction of putrescine (14) was handled by the deletion of RpoS, a stress responsive RNA polymerase sigma factor. To increase the conversion of ornithine (10) to putrescine (14), overexpression of ornithine biosynthetic enzymes and ornithine decarboxylase (ODC) was also necessary. The final metabolically engineered E. coli strain produced 1.68 g/L of putrescine (14) and high cell density cultures (HCDCs) produced 24.2 g/L of putrescine (14). This would be the first step for engineering alkaloid biosynthesis that relies on putrescine (14) in microorganisms. In a follow-up study, Qian et al. (2011) performed similar manipulations to produce a strain of E. coli capable of producing the polyamine cadaverine (26). Introduction of an L-lysine decarboxylase in addition to overexpressing dapA, the gene encoding the enzyme dihydrodipicolinate synthase successfully resulted in the new strain producing as much as 9.61 g/L cadaverine (26) from renewable resources.173 If metabolic engineers in the future wish to engineer these pathways in other organisms, such as bacteria or yeast, it will be necessary to up-regulate the beginning precursor pathways such that pools of these primary metabolites do not get depleted. Depletion of these essential metabolites would result in the death of the organism during the biosynthesis of these compounds.

38 Texas Tech University, Neill Kim, May 2020

Table 3. A summary of recent metabolic engineering studies using elicitors.

Species Target Elicitor Effect Reference Compound Anisodus luridus Scopolamine Acetylsalicylic Increased scopolamine 174 acid (ASA) content Anisodus luridus Scopolamine Ultraviolet ray-B Increased scopolamine 174 (UV-B) content Datura metel Atropine Staphylococcus Decreased atropine content, 45 aureus increased root biomass Datura metel Atropine Bacillus cereus Decreased atropine content, 45 increased root biomass Datura metel Atropine Silver nitrate Decreased atropine content, 45 increased root biomass Datura metel Atropine Nanosilver Increased atropine content, 45 increased root biomass Datura innoxia Hyoscyamine Agrobacterium Increased hyoscyamine 128 rhizogenes content, increased root biomass Erythroxylum Cocaine Anderson Increased cocaine content in 175 coca rhododendron calli medium (ARM) Erythroxylum Chlorogenic Salicylic acid Decreased CGA content 175 coca acid (CGA)

Using plant in vitro cell culture or tissue culture is an important tool when studying the regulation and biosynthesis of secondary metabolites. Large quantities of plant material can be produced under controlled and sterile conditions. In tissue cultures of solanaceous plant species, using elicitors mimicking stress hormones can increase important secondary metabolite production.176 Recently, cell cultures of E. coca in the Erythroxylaceae were used to study TA biosynthesis.175 Various culture media were tested on their ability to support callus formation as well as cocaine (1) production. The jasmonic acid-isoleucine (JA-Ile) analogue coronalon and salicylic acid (SA) were also used as elicitors to observed their effects on calli metabolism. All three culture media growing calli accumulated cocaine (1). The medium used to grow calli also significantly affected natural product metabolism. The only treatments that yielded higher amounts of cocaine (1) were dependent upon culture media, not upon elicitor treatment. For example, Anderson rhododendron medium (ARM) produced cocaine (1) an order of a magnitude greater than both Gamborg B5 (GB5) and modified Murashige-Tucker medium (MMT), but lower levels of hydroxycinnamate-quinate esters such as chlorogenic acid (CGA) were detected. Interestingly the elicitors coronalon and 39 Texas Tech University, Neill Kim, May 2020 salicylic acid did not yield any increase in TA production suggesting that TAs, at least in E. coca, may not be regulated by common plant defense hormones.

2.6 Conclusions

Recent advances in genomics, transcriptomic and metabolomic technologies are poised to illuminate the biosynthetic foundations of TAs and GAs. Future research on the biosynthesis of TAs and GAs will affect multiple fields of research. First, enzymes involved in TA and GA biosynthesis will expand our fundamental knowledge of chemistry and enzymology. Second, elucidation of the genes and enzymes underlying TA and GA biosynthesis will expand the molecular tools available to synthetic biologists. With these additional tools, scientists can look to not only produce TAs and GAs in heterologous hosts but also to engineer novel molecules.26 Lastly, future discoveries of the function and structure of genes and enzymes in TA and GA biosynthesis will strengthen our understanding of the evolution of plant metabolism. Plant metabolism, especially specialized metabolites such as TAs and GAs, evolved in response to dynamic environments. Detailed knowledge of the catalytic properties of TA and GA biosynthetic enzymes as well as their biophysical properties are critical to our knowledge of the evolution of biochemical activities and the chemical diversity of these metabolic pathways. This fundamental knowledge will be useful in predicting and engineering plants to withstand ongoing changes in the environment.

Acknowledgements: This research was supported by faculty startup funds to JCD from Texas Tech University. BC received support through the Center for Active Learning and Undergraduate Engagement at Texas Tech University.

40 Texas Tech University, Neill Kim, May 2020

CHAPTER 3

TROPANE ALKALOIDS: PATHWAY, POTENTIAL AND BIOTECHNOLOGICAL APPLICATIONS Book chapter review submission in progress Structure and Function of Enzymes Involved in the Biosynthesis of Tropane Alkaloids Neill Kim, Benjamin Chavez, Charles Stewart Jr., and John C. D’Auria

3.1 Abstract

Tropane alkaloids are found in a scattered distribution among the angiosperm families including members within the Solanaceae, Erythroxylaceae, Convolvulaceae, and Brassicaceae. Recent studies regarding the origins of tropane production provide strong evidence for a polyphyletic origin, suggesting that novel enzymes from different gene families have been recruited during the course of flowering plant evolution. Tropane alkaloid biosynthesis is best documented on the molecular genetic and biochemical level from solanaceous species. Regardless of the system chosen, there are currently gaps in the knowledge of enzyme structure-function relationships and how they influence tropane alkaloid biosynthesis. Obtaining insights on structure-function relationships of tropane biosynthetic enzymes is critical to understanding regulation, turnover and flux of metabolites through the pathway. In this review we discuss the current state of knowledge regarding structure-function relationships of the known steps involved in tropane biosynthesis.

3.2 Introduction

Tropane alkaloids (TA) are plant specialized metabolites that have evolved as a response to nature’s biotic and abiotic forces. Defined by their N-methyl-8- azabicyclo[3.2.1]-octane core structure, tropane alkaloid biosynthesis has been the subject of study for over a century due to their potent pharmacological activities (Figure 10). There have been over 200 unique structures reported in the literature. These structures appear within seven different orders among angiosperms, which includes ten different plant families. The families contributing the largest diversity of structures are

41 Texas Tech University, Neill Kim, May 2020 the Solanaceae, Erythroxylaceae, Convolvulaceae, and Brassicaceae.4, 7, 41, 177 The noncontiguous scattered distribution of tropane alkaloid producing plant families gives rise to the question of whether or not tropane alkaloid biosynthesis is monophyletic or polyphyletic. The molecular data for the genes and enzymes responsible for tropane alkaloid biosynthesis was only available for members within the Solanaceae, until recently. Current data from the species Erythroxylum coca suggests that tropane alkaloid biosynthesis has arisen at least twice during the evolution of angiosperms.13

Figure 10. Tropane alkaloid core bicyclic scaffold.

Erythroxylum coca is one of the first domesticated plant species that was used for medicinal purposes, with evidence of its cultivation dating back at least 8000 years.3 The common occurrence of the carboxylic acid methyl ester located at the C2 position of cocaine is one of the most distinguishing characteristics of tropane alkaloids found in the Erythroxylaceae family. By binding the 3β benzoic ring present in cocaine to specific receptor sites, the reuptake of norepinephrine, serotonin, and dopamine are blocked and disrupts the normal physiology of the central nervous system. The 3β stereospecific conformation of tropane alkaloids is dominant in the Erythroxylaceae family but only makes up a small component of tropane alkaloids found in members of the Solanaceae. The methylated nitrogen in the bicyclic core scaffold of cocaine and other tropane alkaloids serves as a structural analog of acetylcholine.43 Anticholinergics are a class of drugs used to block the action of the acetylcholine neurotransmitter in order to treat diseases such as Alzheimer’s and Parkinson’s and to alleviate motion sickness. Tropane alkaloids have been detected to attach and inhibit the muscarinic acetylcholine receptors.44

42 Texas Tech University, Neill Kim, May 2020

Solanaceous tropane alkaloids are also known for their anticholinergic and antispasmodic properties that affect the parasympathetic nervous system and have also been used for the treatment of anesthesia, pain relief, and for drug addiction mediation.45-47 The Solanaceae is the largest family known to produce tropane alkaloids, with 29 genera able to produce these metabolites. Atropine and scopolamine are well- known tropane alkaloids found in this family. In 1833, atropine was first isolated from Atropa belladonna.71, 72 After much deliberation and structural studies, the correct structure of atropine was obtained in 1889.1 Scopolamine is commonly found in the plant Hyoscyamus niger plant species and capable of crossing the blood-brain barrier to affect the central nervous system. However due to the low metabolite levels found in plants, there is an ongoing effort to thoroughly understand the biosynthesis of scopolamine and similar metabolites.

With the current knowledge gained regarding these valued pharmaceutical compounds, there is an increasing interest in the elucidation of their biosynthetic pathways in order to up-regulate TA production. Moreover, the World Health Organization (WHO) continues to include these pharmaceutically important tropane alkaloid metabolites on their list of essential drugs.178 Tropane alkaloid levels in plants are generally present in low quantities during normal plant biosynthesis. Chemically synthesizing these alkaloids in the laboratory has also demonstrated to be laborious and costly due to their important stereochemical nature. There have been attempts at a total synthesis approach to synthesize scopolamine, but low yields of only 16% did not make this method economically or environmentally practical.5 The leading complication for the commercial production of scopolamine in hairy root cultures is attaining industrial level yields.150 For this reason, researchers are focusing their efforts on elucidating and understanding tropane alkaloid biosynthesis in all known plant families for future metabolic engineering efforts.

3.3 Tropane alkaloid biosynthesis

The elucidation of structures and potential biosynthetic steps in the tropane alkaloid pathway have predominantly used methods such as radioisotope labeled

43 Texas Tech University, Neill Kim, May 2020 feeding studies that are followed by chemical degradation analysis. Primarily, tropane alkaloid biosynthesis begins with the recruitment of amino acids from primary metabolism into a nitrogen containing heterocyclic ring intermediate (Scheme 7). This heterocycle will then continue to form the second ring in the tropane alkaloid bicyclic scaffold, which is finally followed by modifications through the addition of diverse functional groups yielding the final compound. The starting substrates for tropane alkaloid biosynthesis were predicted to be ornithine and arginine as early as 1954.80 Feeding studies performed on the roots of Atropa belladonna using 14C-proline proposes the possible incorporation of the amino acid proline into the tropane ring.179 Furthermore, studies using Datura stramonium and Datura metel have also reported the incorporation of proline into the tropane alkaloid compounds tropine and scopolamine.81 The commonly shared intermediate, pyrroline-5-carboxylate, links arginine, ornithine, and proline together. These three amino acids are readily interconvertible making radiolabeled amino acid feeding studies challenging to interpret without further enzymological data.82

44 Texas Tech University, Neill Kim, May 2020

Scheme 7. The initial steps of tropane alkaloid biosynthesis in the Solanaceae up to the formation of N-methyl-∆1-pyrrolinium.

It has been hypothesized that a nonsymmetrical intermediate is involved in the production of the pyrrolidine ring if ornithine is first methylated at the γ-N position. An alternative route proposes that ornithine undergoes a decarboxylation to form the polyamine putrescine as the first biosynthetic step.83, 84 Radiolabeled ornithine-2-14C was fed to several different Datura plant species and showed the incorporation of a nonsymmetrical intermediate. In contrast, the Nicotiana, Erythroxylum, and Hyoscyamus plant species have reported a symmetrical intermediate whose incorporation showed activity at positions C1 and C5 of the tropane ring.85 Ornithine can be converted into the symmetrical intermediate putrescine through a one-step enzymatic reaction facilitated by ornithine decarboxylase (ODC, EC 4.1.1.17), an enzyme that has been isolated in several tropane alkaloid producing plant species and is a pyridoxal phosphate-dependent decarboxylase.15, 180, 181 ODC has been predicted to be a cytosolic enzyme but seems to accumulate in the nucleus.182, 183 Malmberg et al. reveal that putrescine produced by ODC is important for metabolic processes such as cellular differentiation, development and division.86 To date, the only enzymatically characterized ornithine decarboxylase enzymes from plants are from N. glutinosa (NgODC), E. coca (EcODC), and H. niger (HnODC).184 Currently there are no crystal structures of a plant ODC. However, in 2001 Lee & Cho created the first model of a plant ornithine decarboxylase from N. glutinosa.185 The three-dimensional model of NgODC is based on the tertiary crystal structure of both a mouse ODC and an ODC from Trypanosoma brucei. This model predicts NgODC to be a symmetrical homodimer. Most ODCs have a (PFYAVKCN) and a (GPTCD) binding motif for the pyridoxal 5’-phosphate (PLP) cofactor.184, 186 PLP-dependent decarboxylases require a conserved lysine residue in order to form a Schiff base and to stabilize the binding of the PLP to the active site. The PLP binding site of NgODC is located on the C-terminal end of the α/ß barrel. The active site contains Lys95, Cys96, Cys338, and Cys377 as key amino acid residues and mutagenesis experiments on the Lys95 residue to alanine in NgODC showed a significant decrease in the catalytic efficiency. The Cys377 residue

45 Texas Tech University, Neill Kim, May 2020 has also been implicated as the key residue for the covalent binding of the DL-α- difluoromethylornithine (DFMO) suicide inhibitor.185, 186

There is also a more indirect route to putrescine that begins with the amino acid arginine. This three-step pathway to putrescine begins with the decarboxylation of arginine, via arginine decarboxylase (ADC; EC 4.1.1.19) using PLP as the cofactor, to form agmatine.15 ADC is typically localized in the chloroplasts of plants but has also been found in other regions such as the mitochondria and the cytosol.187-189 Putrescine derived from ADC is thought to be associated with non-dividing tissues or tissues responding to environmental stresses.15 Little structural data of ADC exists and there are no crystal structures of a plant arginine decarboxylase. ADC is suggested to be a trimer in soybeans and oats.190, 191 E. coca ADC (EcADC) contains a PLP binding site and a decarboxylase binding motif.15 Much like ODC, ADC requires a conserved lysine residue for PLP-binding. Docimo et al. reported on the characterization of ADC and ODC in E. coca but could not determine which enzyme is primarily involved in tropane alkaloid biosynthesis.

The decarboxylated product of ADC, agmatine, is then converted into N- carbamoylputrescine via agmatine imino hydrolase (AIH; EC 3.5.3.12). AIH belongs to the porphyromonas-type peptidylarginine deiminase family which is part of the penteins superfamily.192 A notable characteristic of the penteins superfamily includes a propeller- shaped protein fold which forms a narrow channel in the core where substrate binding occurs. Currently, there are no characterized AIH enzymes in the tropane producing members of the Solanaceae or Erythroxylaceae family. Putrescine production within solanaceous plants predominantly relies on the decarboxylation of ornithine as the primary source of putrescine for tropane alkaloid metabolism. However, feeding studies using radiolabeled agmatine were shown to be incorporated into hyoscyamine, providing evidence that hyoscyamine may be derived from arginine instead of ornithine in H. niger root cultures.193 The active site of AIH was speculated to use a cysteine residue to form a thioester with the agmatine substrate but mutagenesis experiments of AIH (At5g0817) cloned from A. thaliana revealed two conserved cysteine residues that are important but not essential for enzymatic activity.194 Although there are no crystal 46 Texas Tech University, Neill Kim, May 2020 structures of AIH in members of the Solanaceae or Erythroxylaceae, AIH is reported to be homodimer in Z. mays, A. thaliana, and O. sativa.194-196 Recently, a crystal structure of AIH has been reported for Medicago truncatula (MtAIH).197 The crystal structure of MtAIH portrays a symmetrical homodimer with two subunits arranged in a propeller fold geometry with five αββαβ repeated units.

Finally, N-carbamoylputrescine is then converted into putrescine via N- carbamoylputrescine amido hydrolase (NCPAH; EC 3.5.1.53) to complete the alternative three-step pathway to putrescine. An NCPAH enzyme was found in A. thaliana with kinetic data that reveals a sigmoidal curve, indicating positive cooperativity.198 Investigations into this cooperativity revealed an accelerating mechanism, activated by saturating amounts of N-carbamoylputrescine, and determined that AtNCPAH is not a rate-limiting step in putrescine biosynthesis. Much like AIH, NCPAH has not been well characterized in tropane alkaloid biosynthesis. This lack of characterization limits current knowledge on the structure-function relationship within tropane alkaloid producing plants. However, a recent report on the crystal structure of NCPAH in M. truncatula (MtNCPAH) show helical octamers with a funnel-shaped active site containing glutamate as a proton acceptor, lysine as a proton donor, and cysteine as a nucleophile.199 The catalytic residues of MtNCPAH are located deep within the narrow section of the active site. MtNCPAH is notably substrate specific for N-carbamoylputrescine due to a negatively charged glutamate residue located at the entrance of the active site. This glutamate residue determines the size and length of substrates allowed to bind within the active site. It could not be ascertained if allosteric regulation plays a role in MtNCPAH as previously shown in A. thaliana. Molecular docking experiments of MtNCPAH suggests that a secondary binding site allows for an additional N-carbamoylputrescine to be bound before entering the active site. This would allow for an increase in the enzyme turnover rate due to a decrease in time needed for the substrate to diffuse into the active site, however, this hypothesis has yet to be experimentally confirmed.

In primary metabolism, the polyamine serves as a precursor for other polyamines such as spermidine and spermine (Scheme 8). These compounds are 47 Texas Tech University, Neill Kim, May 2020 involved in both primary and secondary metabolism in plants. The most common polyamines are putrescine, spermidine, spermine, and cadaverine which are derived from amino acids such as arginine, ornithine, and lysine.200 Polyamines are a vital class of nitrogen-rich molecules that are found in all kingdoms of life and participate in a wide variety of biochemical functions. The small size of these compounds and their cationic nature allows for multiple interactions with cellular components such as DNA, RNA, phospholipids, proteins, and chromatin.201 Due to these broad cellular interactions, polyamines are implicated in a wide array of essential cellular processes such as gene expression, translation, signaling, and membrane stability.202 Polyamine deficient Escherichia coli shows increased toxicity to oxygen and increased hypersensitivity to hydrogen peroxide implying that these metabolites play a role in buffering reactive oxygen species.203 In plants, polyamines are accumulated due to biotic and abiotic stresses. Exogenously added polyamines to salt stressed Oryza sativa plants gave indications of polyamine’s protective role for abiotic stress responses.204

48 Texas Tech University, Neill Kim, May 2020

Scheme 8. The biosynthetic pathway of polyamines in plants. Enzymes are depicted in blue and cofactors in orange.

Putrescine N-methyltransferase (PMT) catalyzes the committed step toward tropane alkaloid biosynthesis, the generation of N-methylputrescine.205 N- methylputrescine is formed from the transfer of a methyl group from S- adenosylmethionine (SAM, AdoMet) onto an amino group of putrescine. As described above, putrescine is a central metabolite for the production of spermidine and other polyamines. The species distribution of PMT appears to be taxonomically restricted to nicotine and tropane alkaloid producing plant species (e.g. Solanaceae, Convulvaceae).205 PMT is biochemically similar to spermidine synthase (SPDS), a ubiquitous enzyme in plants, animals and bacteria involved in polyamine biosynthesis.

49 Texas Tech University, Neill Kim, May 2020

While both SPDS and PMT use putrescine as a substrate, SPDS does not accept AdoMet as a methyl donor. Rather, SPDSs use decarboxylated SAM (dcAdoMet) to transfer an aminopropyl group onto putrescine. The biochemical similarities and mutational studies discussed above are consistent with phylogenetic analyses indicating PMTs evolved from SPDSs via a gene duplication event.206, 207

The binding pockets of PMTs appear to be similar to SPDSs. Unfortunately, X- ray diffraction studies of PMT crystals have been unsuccessful to date.205 However, crystal structures of SPDSs, including the recently published structures of two SPDS isoforms from Arabidopsis have provided structural insights into the function of PMTs.208 Homology models indicate that the overall structure of PMT is similar to SPDS.206, 209 Similar to most SPDSs, PMTs appear to be dimeric with each monomeric subunit containing an independent active site.208, 210 The active site of PMT/SPDS is formed via a cleft between the N-terminal domain and the C-terminal domain of each monomer. Some PMTs (i.e. PMTs from Datura spp. and Nicotiana spp.) contain an 11 amino acid tandem repeat on their N-terminus experimentally observed to affect protein solubility but not catalytic activity.205, 211 However, chimeras generated from swapping N- and C-terminal portions of PMT and SPDS from D. stramonium, revealed reaction specificity was largely determined by the residues in the N-terminal portion of the molecules.210 The C-terminal portion of SPDS contains a Rossmann-like fold which may be involved in substrate binding.206, 208

The divergence of PMT from SPDS likely required changes in the conformation of the methionine moiety of SAM relative to the aminopropyl group of dcSAM. The SN2 reaction catalyzed by PMT and SPDS requires a short distance between the donor group, either methyl or aminopropyl, respectively, and a correctly oriented amino group of the acceptor molecule, putrescine. In 2009, Biastoff et al. initially hypothesized that PMT and SPDS had different binding locations for putrescine.210 Junker et al. discussed other possibilities including inversion of the sulfur chirality of SAM as well as conformational changes of the methionine moiety of SAM.206 Ab initio calculations of the inversion barrier led this group to dismiss the possibility of a switch of the sulfur chirality of SAM (S-SAM to R-SAM). Comparative structural analyses of a PMT 50 Texas Tech University, Neill Kim, May 2020 homology model with apo and ligand-complexed SPDS crystal structures indicated that residues binding the adenosyl moiety of SAM/dcSAM are highly conserved. However, Junker and co-worker’s comparative analysis identified several mutations that putatively alter the conformation of the (decarboxy)methionine moieties of SAM/dcSAM. Results from mutagenesis experiments by Junker et al. support that only a few mutations, likely affecting the conformation of the methionine moiety of SAM, were necessary for PMTs to diverge from SPDSs.

N-methylputrescine must then undergo an oxidative deamination reaction in order to form the cyclic pyrrolidine ring. 4-methylaminobutanal is the resulting product that undergoes spontaneous cyclization to yield the N-methyl-∆1-pyrrolinium cation.83 Amine oxidases catalyze the oxidative deamination of various amines into aminoaldehydes and H2O2, and are classified into the FAD-dependent polyamine oxidases (PAOs) and the copper-containing amine oxidases (CuAOs).212 These enzymes have many differences to each other such as substrate specificity, catalytic mechanism, subcellular localization, and functional diversity.213 The PAOs in plants have a non-covalently bound FAD molecule as a cofactor and are known to oxidize the secondary amino group of polyamines, with the reaction products dependent on the catalytic mechanism and substrate specificity. All intracellular PAOs oxidize the carbon located at the exo-side of the N4 atom of spermine or spermidine to produce 3- 214-221 aminopropanal, H2O2, and spermidine or putrescine, respectively. Conversely, the apoplastic PAOs are known to oxidize the carbon located at the endo-side of the N4 atom of spermine and spermidine to produce an aminoaldehyde, H2O2, and 1,3- diaminopropane.222-224 The CuAOs predominantly oxidize the aliphatic diamines putrescine and cadaverine to produce an aminoaldehyde, ammonia, and H2O2 and are considered to be involved in polyamine terminal catabolism.213 They are also capable of oxidizing the primary amino groups of spermine and spermidine but less efficiently. Plant CuAOs are homodimeric enzymes where each subunit contains a copper ion to oxidize the conserved tyrosine residue located in the catalytic site into the cofactor 2,4,5-trihydroxyphenylalanine quinone, also known as topoquinone.212 CuAOs also

51 Texas Tech University, Neill Kim, May 2020 appear at high levels in dicots, especially in pea, chickpea, lentil, and soybean seedlings while PAOs are highly expressed, particularly in monocots.145, 225

In solanaceous plants, methylputrescine oxidase (MPO) catalyzes the next step in tropane alkaloid biosynthesis through oxidative deamination by taking N- methylputrescine and converting it into 4-methylaminobutanal. The first MPO to be characterized was from the species Nicotiana tabacum and belongs to the CuAO class of diamine oxidases.94-96 In D. stramonium, labeled 4-methylaminobutanal were detected in plants that were fed [2-14C]-ornithine.83 Several other tropane alkaloid producing members in the Solanaceae have reported enzyme activities containing this type of oxidation reaction.226-228 In nicotine biosynthesis, evidence suggests MPO affiliates with other important enzymes leading to the hypothesis that a metabolic channel exists in which a multi-enzyme complex is active. Currently there are no MPO- like genes to be discovered in the Erythroxylaceae family. However the same enantioselectivity found in solanaceous plants that produce either tropane alkaloids or nicotine were shown to have analogous activity when intact plants were fed 4- monodeuterated N-methylputrescine.97 Through 13C fractionation techniques, researchers were able to establish that both nicotine and hyoscyamine share the same biosynthetic pathway up to the N-methyl-∆1-pyrrolinium cation.98 These data strongly suggest that there is an MPO homolog in the Erythroxylaceae family.229 4- methyaminobutanal then spontaneously cyclizes to form the N-methyl-∆1-pyrrolinium cation which serves as the first ring in the bicyclic tropane core scaffold.83 In E. coca, feeding studies using [2-13C, 15N]-N-methylpyrrolinium chloride into coca leaves demonstrated the incorporation of the N-methyl-∆1-pyrrolinium cation into methylecgonine, a precursor to the tropane alkaloid cocaine.103, 230 This is also the first occurrence of a spontaneous reaction in the tropane alkaloid pathway.

Since the chemical synthesis of tropinone and the earliest investigations of tropane biosynthesis nearly a century ago, the second ring formation in tropane alkaloids has been a mystery (Scheme 9). Isotope labeling studies indicated that the second ring appeared to form via the condensation of acetate units onto the N-methyl-∆1- pyrrolinium cation.100, 101, 231 One molecule that received a lot of attention as a potential 52 Texas Tech University, Neill Kim, May 2020 intermediate of the second ring formation was hygrine, (R)-1-(1-methylpyrrolidin-2-yl)- propan-2-one. Early isotope labelling studies indicated that hygrine was likely formed from the spontaneous decarboxylation of a β-keto acid produced from the enzymatic condensation of acetoacetic acid or acetoacetyl-CoA onto the N-methyl-∆1-pyrrolinium cation. Hygrine as an intermediate lost favor when it was found that the condensation between N-methyl-∆1-pyrrolinium cation and acetoacetyl-CoA can occur non- enzymatically.232 Additionally, other studies have demonstrated that hygrine is an experimental artifact of another compound.99-101 However, other labelling studies 13 using Datura spp. (Solanaceae) showed the incorporation of racemic ethyl [2,3- C2]- 4-(N-methyl-2-pyrrolidinyl)-3-oxobutanoate, a polyketide-derived compound, into the 99, 102 13 second ring structure. Additionally, feeding studies of methyl (RS)-[1,2- C2,1- 14C]-4-(N-methyl-2-pyrrolidinyl)-3-oxobutanoate to the leaves of E. coca further demonstrated the involvement of a polyketide molecule.103

Scheme 9. Biosynthesis of scopolamine in the Solanaceae family starting from the N-methyl- ∆1-pyrrolinium cation.

Based on the feeding studies described above, the second ring formation in tropane alkaloid biosynthesis has been hypothesized to arise via the activity of a type III polyketide synthase (PKS) catalyzing the condensation of acetate units onto the N-

53 Texas Tech University, Neill Kim, May 2020 methyl-Δ1-pyrrolinium cation.4, 99, 102, 104 Type III PKSs are promiscuous enzymes that have an extensive tolerance for diverse substrates while being able to catalyze multiple reactions.22, 23 The type III polyketide synthase family of enzymes are homodimeric proteins containing a Cys-His-Asn catalytic triad typically known to catalyze the binding of a CoA-tethered starter substrate, less frequently ACP-tethered, onto the catalytic cysteine, as reviewed in Austin and Noel.22 Once covalently attached to the active site cysteine, the starter substrate undergoes multiple rounds of decarboxylative Claisen condensation, typically using malonyl-CoA as the second/extending substrate, to build a polyketide chain. Hydrolysis and/or cyclization of the elongated polyketide intermediate ends the chain-elongation process.

Recently, a major breakthrough in understanding the formation of the second ring occurred when two type III PKSs were independently isolated and experimentally confirmed to be involved in tropane alkaloid biosynthesis. First, Bedewitz et al. (2018) isolated a type III PKS from the transcriptome of Atropa belladonna roots (AbPYKS), that accepted the N-methyl-∆1-pyrrolinium cation as a starter substrate and catalyzed two rounds of decarboxylative Claisen condensations with malonyl-CoA to form the 4- (N-methyl-2-pyrrolidinyl)-3-oxobutanoic acid intermediate using in vitro assays.233 Additional Virus-induced gene-silencing (VIGS) experiments confirmed that AbPYKS played a critical role in tropane alkaloid biosynthesis. Bedewitz and co-workers postulated that AbPYKS catalyzed the formation of a CoA-tethered intermediate via the decarboxylate condensation of malonyl-CoA onto the N-methyl-∆1-pyrrolinium cation. This CoA-tethered intermediate, a monoketide, would then proceed through another round of chain-elongation before terminating with the release of 4-(N-methyl-2- pyrrolidinyl)-3-oxobutanoic acid, a diketide. Second, Huang et al. (2019) isolated a type III PKS from the transcriptomes of Anisodus acutangulus hairy root cultures (AaPYKS) whose initial in vitro activity also suggested that it directly produced 4-(N-methyl-2- pyrrolidinyl)-3-oxobutanoic acid (Scheme 10).234 During their efforts to solve the crystal structure of AaPYKS, Huang et al. serendipitously trapped an acyl-enzyme intermediate (PDB ID: 6J1M) and a CoA-tethered intermediate (PDB ID: 6J1N) of AaPYKS. The acyl enzyme intermediate consists of 4-carboxy-3-oxobutanoyl (COB)

54 Texas Tech University, Neill Kim, May 2020 covalently bonded via a thioester linkage to the catalytic cysteine of AaPYKS. Critically, the carboxylic acid functional group of COB was prevented from spontaneously decarboxylating via a salt bridge and hydrogen bond with nearby arginine and serine side chains, respectively. Interestingly, when crystals of the acyl- enzyme intermediate (AaPYKS-COB) were soaked with malonyl-CoA, Huang and co- workers generated a non-covalent intermediate complex of AaPYKS with 4-carboxy-3- oxobutanoyl-CoA (Figure 11). Further in vitro assays revealed that in the absence of N-methyl-∆1-pyrrolinium cations, AaPYKS generated 3-oxoglutaric acid (β- ketoglutarate) using malonyl-CoA as both a starter and extending substrate. Additionally, 3-oxoglutaric acid was observed by Huang et al. to spontaneously react with N-methyl-∆1-pyrrolinium cations to yield 4-(N-methyl-2-pyrrolidinyl)-3- oxobutanoic acid. Lastly, the stereochemistry of the enzymatically produced 4-(N- methyl-2-pyrrolidinyl)-3-oxobutanoic acid was determined to be a racemic mixture, consistent with the product of the spontaneous reaction of 3-oxoglutaric acid with the N-methyl-∆1-pyrrolinium cation.234 Collectively, the results of their structural and biochemical analysis allowed Huang et al. to deduce that AaPYKS, and likely AbPYKS, catalyze the formation of 3-oxoglutaric acid from two malonyl-CoA molecules. 3- oxoglutaic acid subsequently reacts spontaneously with the N-methyl-∆1-pyrrolinium cation to yield 4-(N-methyl-2-pyrrolidinyl)-3-oxobutanoic acid which is ultimately cyclized by a cytochrome p450 (see below) to generate the second ring of the tropane scaffold.

55 Texas Tech University, Neill Kim, May 2020

Scheme 10. Hypothetical mechanism of AaPYKS for 4-(N-methyl-2-pyrrolidinyl)-3- oxobutanoic acid formation.

56 Texas Tech University, Neill Kim, May 2020

Figure 11. Crystal structure of AaPYKS-COB binding pocket looking down the CoA binding tunnel at 2.0 Å.

Both PYKS mechanisms postulated by Bedewitz et al. (2018) and Huang et al. (2019) rely on a novel type III PKS activity. The amino acid sequences of AbPYKS and AaPYKS are 85% identical (92% similar), have conserved the catalytic triad found in all type III PKSs and have conserved key amino acids observed by Huang et al. that interacts with intermediates. In their discussion of AbPYKS activity, Bedewitz et al. postulated that N-methyl-∆1-pyrrolinium cations are directly used as a substrate by PYKSs. A charged and non-CoA/ACP tethered substrate such as the N-methyl-∆1- pyrrolinium cation has never been reported as a natural starter substrate for type III PKSs, to the best of our knowledge. Conversely, the mechanism presented by Huang and co-workers involved PYKSs using an intact malonyl-CoA as a starter substrate. Given the pKa of malonyl-CoA (~ 5.0), this starter malonyl-CoA likely binds to PYKS as its conjugate base, a carboxylate anion. As mentioned above, a charged substrate has not been previously reported as a natural starter substrate for PKSs; neither has the biosynthesis of 3-oxoglutaric acid via a type III PKS. Several key questions about the PYKSs remain to be clarified. Given that AbPYKS and AaPYKS come from closely related species within the Solanaceae, will PYKSs from other tropane alkaloid

57 Texas Tech University, Neill Kim, May 2020 producing plants show similar biochemical function? Additionally, 3-oxoglutaric acid and 4-(N-methyl-2-pyrrolidinyl)-3-oxobutanoic acid are β-keto acids. A mechanism by which PYKS prevent undesirable spontaneous decarboxylation is unclear. O- methylation of 4-(N-methyl-2-pyrrolidinyl)-3-oxobutanoic acid would prevent decarboxylation (see below) but an O-methyltransferase for such a reaction has not been definitively characterized and the sequence of events involving the activities of PYKS, O-methyltransferase and the cytochrome p450 responsible for the second ring cyclization is unclear. Lastly, the PYKS reaction scheme presented by Huang et al. juxtaposes a second spontaneous reaction in the tropane alkaloid biosynthesis. First, 4- methylaminobutanal spontaneously cyclized to form the N-methyl-∆1-pyrrolinium cation (see MPO section above) then the N-methyl-∆1-pyrrolinium cation is a substrate for a spontaneous condensation reaction with 3-oxoglutaric acid. Such a sequence of event warrants a close examination of the thermodynamic properties of tropane alkaloid biosynthesis.

The enzyme responsible for the cyclization of the 4-(N-methyl-2-pyrrolidinyl)- 3-oxobutanoic acid intermediate to form the second ring structure of the tropane alkaloid core scaffold was determined to be a cytochrome p450 (AbCYP82M3) found in solanaceous plants, yielding tropinone (Scheme 11).233 The cytochrome p450 subfamily CYP82 are known to catalyze diverse reactions in plant specialized metabolism such as CYP82Y1 which catalyzes the first committed step in noscapine biosynthesis in opium poppy that takes N-methylcanadine to form 1-hydroxy-N-methylcanadine.235 AbCYP82M3 is closely related to several CPY82s found in tobacco that encode nicotine N-demethylases. These enzymes catalyze the formation of nornicotine from nicotine through a demethylation reaction on the pyrrolidine ring of nicotine.236, 237 The pyrrolidine ring is structurally similar to the ring found in the 4-(N-methyl-2- pyrrolidinyl)-3-oxobutanoic acid intermediate of AbCYP82M3, suggesting that these enzymes could share similar substrate binding domains and could possibly have evolved from a common ancestor. The structure-function analysis of the catalytic mechanism for this enzyme was not investigated in this study, but they do report a hypothetical mechanism that involves the restoration of an electrophilic iminium cation. It is a similar 58 Texas Tech University, Neill Kim, May 2020 mechanism proposed for the formation of quinine from strictosidine, where iminium and aldehyde are intermediates for the quinidine and quinolone moieties.238 The same group hypothesized that AbCYP82M3 catalyzes the hydroxylation of the pyrrolidine ring at the C-5 position to form a hydroxyl that would then undergo a dehydration reaction to produce a second iminium intermediate. The ketone in the 3-oxobutanoic acid moiety would undergo keto-enol tautomerization to yield a nucleophilic enol that allows for an intramolecular condensation reaction between the C-3’ and C-5 positions producing 2-carboxytropinone, also known as ecgonone. Finally, decarboxylation of the β-ketoacid would lead to tropinone. Although this is a conceivable model, other plausible models should not be ruled out. As stated earlier, methyl ester formation at the C-2 position of 4-(N-methyl-2-pyrrolidinyl)-3-oxobutanoic acid intermediate can prevent spontaneous decarboxylation. This would also support the presence of a carbomethoxy group found in cocaine and other tropane alkaloids found the Erythroxylaceae such as methylecgonone which contains a keto function at the C-3 position and a carbomethoxy group at the C-2 position.13 A reduction at the C-3 position would need to occur for ester formation. The C-2 carboxylic acid methyl ester is the moiety responsible for the binding of cocaine onto the dopamine transporter.52

Scheme 11. Proposed mechanism of CYP82M3-catalyzed reaction

59 Texas Tech University, Neill Kim, May 2020

The next step in tropane alkaloid biosynthesis is the reduction of the keto group found in both tropinone (Solanaceae) and methylecgonone (Eythroxylaceae). An enzyme specific for the reduction of tropinone to tropine was discovered and purified from the roots of D. stramonium and determined to require the cofactor NADPH.239 Another enzyme that also reduces tropinone but produces pseudotropine was purified from the roots of H. niger.240 Concurrently, it was determined that pseudotropine does not spontaneously isomerize into tropine. These enzymes are known as tropinone reductase (TR) enzymes, for members of the Solanaceae family, and are a part of the short-chain dehydrogenase/reductase (SDR) family that catalyze NAD(P)(H)- dependent monomeric oxidoreductase reactions whose activity controls the metabolic flux towards tropane alkaloid biosynthesis downstream.108, 109 The SDR family of enzymes share a conserved active site with a catalytical residue motif YxxxK, have a common tertiary ‘Rossmann-fold’ structure, a conserved motif that consists of two pairs of α-helices and six pairs of β-sheets, and a dinucleotide cofactor-binding motif.108, 110 There are two distinct types of NADPH-dependent tropinone reductases in the Solanaceae family, tropinone reductase I (TRI, EC 1.1.1.206) and tropinone reductase II (TRII, EC 1.1.1.236). Many genes from different solanaceous species encoding TRI and TRII have been isolated since their initial discovery.241-245 TRI and TRII share more than 50% amino acid sequence similarity and are presumed to have evolved from a common ancestor.109 Additionally, a change of as small as five amino acids is required to change the stereospecificity of the reaction product.111 TRI catalyzes the reduction of the 3-keto functional group in tropinone into the 3α-hydroxyl configuration forming tropine, while TRII catalyzes a similar reduction but into the 3β-hydroxyl configuration forming pseudotropine which is then converted into calystegines. These two distinct tropinone reductases are attributed to a gene duplication event in the Solanaceae family.112 To the best of our knowledge there is no evidence of interconversion between tropine and pseudotropine which suggests a branching of tropane alkaloid metabolism.109, 246 In potato, these enzymes are localized in the tuber and roots based on immunolocalization experiments.247 Tropinone reductase was first reported in D.

60 Texas Tech University, Neill Kim, May 2020 stramonium root cultures and reported to only catalyze the 3α-configuration in tropine.239

Crystal structures of TRI and TRII from D. stramonium reveal that the overall fold between the two enzymes are almost identical.245 The two enzymes share 64% of the same amino acid residues and are thought to have diverged relatively recently from a common ancestral protein. These crystal structures confirm that the stereospecificity of TRI and TRII is due to the orientation of tropinone inside the enzyme. The selective stereochemistry of TRI is facilitated by a positive charge generated by a histidine residue that repels tropinone’s positively charged nitrogen atom, therefore, altering the orientation of tropinone within the active site. In TRII, this histidine residue is substituted with a tyrosine residue and the active site of TRII is negatively charged due to a glutamate residue. The glutamate residue is substituted with a valine residue in TRI. This charge difference within the active site helps explain the stereospecificity of products between these two reductases and the binding orientation of tropinone. In H. niger, it was revealed that TRI is capable of catalyzing a reversible reaction however TRII can only catalyze the reaction in one direction.248

In 2008 Dräger et al. found a tropinone reductase-like gene in the transcriptome of Cochlearia officinalis of the Brassicaceae family, which also reduces tropinone. However this reductase is capable of producing both tropine and pseudotropine in equal ratios using NADPH + H+ as a co-substrate, in contrast to the stereospecific tropinone reductases found in the Solanaceae.249 This reductase (CoTR) is also more promiscuous than other tropinone reductases, accepting a broader range of substrates such as several synthetic ketones that had higher affinity and faster turnover than observed for tropinone. Moreover, CoTR is closely related to other members of the SDR family of enzymes in the Brassicaceae than it is to either tropinone reductases found in the Solanaceae, based on phylogenetic analysis.

Cocaine is one of the most well-known tropane alkaloid metabolites and can be found in multiple species within the Erythroxylaceae.10 The biosynthesis of cocaine requires a similar reductase enzyme for the reduction of the 3-keto function of methylecgonone (2β-carbomethoxy-3-tropinone) into methylecgonine (2β- 61 Texas Tech University, Neill Kim, May 2020 carbomethoxy-3β-tropine). Using a homology-based approach of tropinone reductase sequences from the Solanaceae, several tropinone reductase homologs were found within the E. coca transcriptome. Unfortunately, these candidates failed to yield reduction activity in methylecgonone when heterologously expressed in E. coli.13 Using crude extracts from coca leaves, Jirschitzka et al. were able to purify methylecgonone reductase (MecgoR, EC 1.1.1.334) and discovered that this enzyme was far different from the tropinone reductase enzymes responsible for the reduction of the 3-keto function in the Solanaceae (Scheme 12). When analyzed next to any tropinone reductases, MecgoR shares an overall identity of less than 10% at the amino acid level. It was found that MecgoR belongs to the aldo-keto reductase (AKR) superfamily whose enzymes are involved in a variety of metabolic pathways such as cocaine, codeine, and chalcone biosynthesis.250, 251 MecgoR shares 50% to 70% identity to the AKRs such as; codeinone reductase (COR), chalcone reductase (CHR), and 1,2-dehydroreticuline reductase (DRR) despite using completely different substrates involved in different biochemical pathways.252 AKRs display a TIM-barrel motif containing an 8-strand β- barrel surrounded by α-helices with the cofactor binding site located at the C-terminus of the β-barrel.250, 253 AKRs use NADP or NADPH as a cofactor and those that have been characterized so far all share the common α/β-barrel motif.113

Scheme 12. Cocaine biosynthesis in E. coca.

62 Texas Tech University, Neill Kim, May 2020

While the conversion of tropinone to pseudotropinone by TRII in solanaceous plants is non-reversible, MecgoR found in E. coca is able to catalyze the reaction in both the reduction of methylecgonone and oxidation of methylecgonine. It should be noted that the oxidation of methylecgonine occurs only at its pH optimum of 9.8, which is unlikely to occur for a cytosolic enzyme.13 The preferred cofactor of MecgoR is NADPH but can successfully use NADH as a cofactor with only a 14% decrease in activity when compared to NADPH. MecgoR is a stereospecific enzyme responsible for the conversion of methylecgonone to the 3β-hydroxy-containing molecule methylecgonine. It can also use tropinone as a substrate but only yields pseudotropine exclusively. This stereospecificity corresponds with previous research regarding tropane alkaloid metabolites in the Erythroxylum family which predominantly consists of alkaloids with a β-configuration at the C3 position on the tropane core scaffold.254, 255 Interestingly, the MecgoR protein is localized in the palisade parenchyma and has the highest activity in young developing leaves in contrast to the tropinone reductase proteins of the Solanaceae which are localized in the roots.13, 92, 248 All of the evidence above provides strong indications that tropane alkaloid biosynthesis has independently evolved more than once in different plant lineages.13

Although there are no characterized crystal structures of MecgoR, a homology model using condeinone reductase was made.250 The model revealed an Ala25 residue predicted to be involved in the orientation and stabilization of the nicotinamide ring of NADPH in the cofactor binding site. MecgoR and chalcone reductase also share this conserved Ala25 residue. The NADPH orientation facilitates the hydride transfer from NADPH to the carbonyl group of the substrate. AKRs are known to catalyze a sequential bi-bi reaction mechanism in which the cofactor is the first to bind to the enzyme and last to leave. The reaction mechanism of AKRs shows that the pro-(R) hydride is transferred from NADPH instead of the pro-(S) hydride which is observed in the mechanism of tropinone reductase and other SDRs due to the orientation difference of NADPH relative to the substrate. Further modeling or crystallization of the MecgoR enzyme is required for further structure-function analysis.

63 Texas Tech University, Neill Kim, May 2020

Methylecgonine has little physiological activity until it is converted to the benzoic ester of methylecgonine, cocaine.114 Based on feeding studies using trans-[3- 13C,14C]-cinnamic acid and the N-acetylcysteamine thioester of [3-13C,14C]-trans- cinnamic acid, it was hypothesized that an acyltransferase in E. coca employs benzoyl- CoA as the activated acid.115 Leete et al. first proposed that the esterification of tropane alkaloids in E. coca would utilize CoA-activated thioesters.116 It was predicted that methylecgonine undergoes esterification with a benzoyl moiety that uses benzoyl-CoA as the activated acyl-donor. However it was unclear whether it was derived from benzoyl-CoA or benzaldehyde, but it is clear that the moiety was found to originate from cinnamic acid.115, 116 The acylation of secondary metabolites in plants has been depicted in three families of acyltransferases, but only BAHD acyltransferases have been reported to use activated acyl-CoA thioesters.117 Based on reported properties for the tigloyl-CoA:pseudotropine acyltransferase in D. stramonium and the CoA- dependent nature of this enzyme, it was hypothesized that the enzyme involved in facilitating this type of reaction is a member of the BAHD acyltransferase superfamily who are well-known to engage in secondary metabolite modifications of amides and esters.118 Schmidt et al. identified a BAHD enzyme from E. coca capable of catalyzing the acylation of 3β-hydroxyl function of methylecgonine using a benzoyl-CoA thioester as the acyl donor and was named cocaine synthase (EcCS), the last step in cocaine biosynthesis.14 This enzyme can use benzoyl-CoA and cinnamoyl-CoA thioesters to produce cocaine and cinnamoylcocaine, respectively. Ester formation using pseudotropine (3β-OH, no C2 carbomethoxy function) and benzoyl-CoA as a substrate for EcCS is possible, retaining 80% of its activity when compared to methylecgonine and benzoyl-CoA. However, ester formation was not achieved when using tropine (3α- OH) or nortropine (3α-OH, no N-methyl group) as substrates in this report. Interestingly, a recent report from Srinivasan et al. demonstrated that EcCS can catalyze the formation of cinnamoyltropine using tropine and cinnamoyl-CoA as substrates.256 This report contradicts previous experiments that demonstrated substrate specificity of EcCS for the 3β-hydroxyl function of methylecgonine and pseudotropine rather than the 3α-hydroxyl function of tropine for ester formation.14 This unusual promiscuity of

64 Texas Tech University, Neill Kim, May 2020 cocaine synthase can be used to produce novel tropane alkaloid derivatives for both medical and biotechnological applications.

The biosynthesis and accumulation of tropane alkaloids in E. coca occur in the same tissue. Immunolocalization experiments show the accumulation of EcCS in the palisade layer and in the spongy mesophyll. This is opposed to solanaceous plants where the biosynthetic pathway of tropane alkaloids occur in the roots while metabolites are accumulated in the shoots, or above ground portion.7

Currently there are no crystal structure or modeling data on EcCS, however there is data on the BAHD superfamily of enzymes. The first BAHD crystal structure was that of a vinorine synthase and can be used to help model other novel BAHD acyltransferases.257 EcCS, like other characterized BAHDs, is monomeric in structure and a member of clade III of the BAHD superfamily who can use a wide variety of alcohol substrates with CoA being the major acyl donor in most of these reactions.14, 117 There are two conserved motifs that are present in all characterized BAHD acyltransferases. The first motif is the DFGWG motif which is located on the C- terminus and appears to have no role in the catalytic activity of the enzyme but appears to be a structural domain involved in maintaining the CoA binding pocket for BAHD acyltransferases.257 The second motif is the HXXXD motif and is important for the catalytic activity of BAHD acyltransferases. The histidine residue on the HXXXD motif acts as a general base to deprotonate a nitrogen or oxygen atom on a substrate facilitating a nucleophilic attack on the carbonyl atom of the CoA thioester forming a tetrahedral intermediate. This intermediate then becomes protonated again producing a free CoA and an acylated substrate.

3.4 Tropane alkaloid side chain modifications

The hydroxyl group rearrangement of the phenyllactic acid moiety of littorine in tropane alkaloid side chain biosynthesis is poorly understood and a point of interest. Littorine is an important intermediate in solanaceous plants, occurring in atropine and scopolamine biosynthesis.130 There had been discussion regarding the acylation of secondary metabolites that can be catalyzed by Serine CarboxyPeptidase Like (SCPL)

65 Texas Tech University, Neill Kim, May 2020 acyltransferases which use 1‐O‐β‐glucose esters as the acyl donor instead of activated CoA thioesters.258 It was postulated that an enzyme analogous to cocaine synthase was utilizing an activated phenyllactoyl-CoA thioester for littorine biosynthesis but a recent report casts doubts on this hypothesis.259-261 The new study on littorine biosynthesis discovered that a phenyllactate UDP-glycosyltransferase (UGT1) and littorine synthase (LS) are involved in tropane alkaloid biosynthesis in A. belladonna.260 UGT1 is responsible for the conversion of phenyllactate into phenyllactylglucose that is subsequently used as a substrate by LS. Suppression of either gene showed an increase in tropine levels and a subsequent decrease in the levels of hyoscyamine and scopolamine in A. belladonna root cultures. qPCR analysis of both genes shows high expression levels in the secondary roots with lower levels detected in the primary roots. Functional identification of UGT1 and LS genes were mediated through agrobacterium transformation coupled with tropine feeding. The production and accumulation of littorine in N. benthamiana, a plant species that does not produce any tropane alkaloids, was detected. Littorine has been detected in the roots of D. myoporoides through MALDI-MSI and quantification in roots was done using HPLC-MS to reveal constant levels of littorine, regardless of growth stage of the plant.262

Early feeding studies of radiolabeled compounds have attempted the elucidation of the hyoscyamine.120-124 The leading hypothesis for the last steps of hyoscyamine biosynthesis involved a cytochrome p450 coupled with an alcohol dehydrogenase, based on quantum chemistry calculations and feeding studies.125 The discovery of the cytochrome p450 oxidoreductase, littorine mutase/monooxygenase (CYP80F1, EC 1.6.2.4), demonstrated that the 5’-deoxyadenosyl radical reaction mechanism was unlikely to play a direct role in the conversion of littorine to hyoscyamine.122, 124 The conversion of littorine into hyoscyamine is a two-step process in which (R)-littorine must first undergo an oxidation-reduction reaction catalyzed by littorine mutase/monooxygenase (CYP80F1) to yield the intermediate hyoscyamine aldehyde. The second part of this reaction is thought to involve an NADPH dependent alcohol dehydrogenase to finish the conversion of hyoscyamine aldehyde to (S)-hyoscyamine, but this enzyme has yet to be identified. Virus-induced gene silencing (VIGS)

66 Texas Tech University, Neill Kim, May 2020 techniques were used to suppress the expression of CYP80F1 that resulted in the lower levels of hyoscyamine and promoted littorine accumulation.126 Additionally, CYP80F1 expression in tobacco roots supplemented with (R)-littorine resulted in hyoscyamine accumulation further supporting the role of CYP80F1 in the conversion of litterine to hyoscyamine. RT-PCR revealed that CYP80F1 is only expressed in the root tissues of H. niger. Through the use of arylfluorinated analogues of (R)-littorine (natural isomer) and (S)-littorine (unnatural isomer) as substrates for CYP80F1, it was determined that the enzyme catalyzed hydroxylation occurs via a benzylic carbocation intermediate.127

The formation of scopolamine from hyoscyamine is carried out by hyoscyamine-6β-hydroxylase (H6H; EC 1.14.11.11 & EC 1.14.20.13). The purified H6H enzyme from H. niger was demonstrated to be a 2-oxoglutarate-dependent dioxygenase, a bifunctional dioxygenase containing both hydroxylase and epoxidase activity.129, 130 Past studies have suggested that the amount of H6H enzyme in plants may be rate-limiting for the accumulation of scopolamine.130 Fe2+ and L-ascorbate are essential cofactors for the dioxygenase activity of H6H.131, 263 Hyoscyamine 6β- hydroxylase contains two iron binding motifs as well as an α-ketoglutarate binding motif.264 The H6H enzyme first catalyzes the 6β-hydroxylation of L-hyoscyamine’s tropane ring into anisodamine (6β-hydroxyhyoscyamine).263 An intramolecular epoxidation formation then takes place through the removal of the 6β-hydrogen that directly results in scopolamine. Even though both reactions are catalyzed by the same enzyme, different EC numbers are given for each step. The H6H enzyme has been discovered in several members of the Solanaceae including A. belladonna, H. niger, and A. acutangulus.

Localization of H6H was found exclusively in the pericycle of roots.131 Similar to other solanaceous molecules, scopolamine is primarily synthesized in the roots then stored in the leaves.129, 131, 265, 266 The exact transport mechanisms of how scopolamine and other tropane alkaloids are shuttled from the roots to the leaves are fully understood. One proposal suggests scopolamine glucoside is involved in the transport of scopolamine to the leaves. However due to the low abundance of scopolamine glucoside found, this hypothesis was excluded from being the specific transport system of 67 Texas Tech University, Neill Kim, May 2020 scopolamine. Simple diffusion of tropane alkaloids through the xylem is deemed unlikely due to the fact that tropane alkaloids are found in higher concentrations in the leaf blades rather than in the vascular tissue.262 An intriguing observation of the H6H enzyme is its localization in the pericycle, a location absent of TRI.131 It has been noted that endodermal cells contain a Casparian strip that blocks metabolite transport in plants, suggesting only tropane intermediates produced on the inner side of root endodermal cells can participate in scopolamine biosynthesis.92, 267

Stereospecificity studies of H6H reveal that C7 hydroxylation of hyoscyamine is possible but not as favorable as C6 hydroxylation.268, 269 Recently, a SUMO-tagged BsH6H from Brugmansia sanguinea was reported to have approximately 10 times greater epoxidase activity than any other previously characterized H6H homologs. The 3D structure of BsH6H was modeled to the closest PDB hit of A. thaliana anthocyanidin synthase which only shares a 28% sequence identity with BsH6H.264 Comparisons with other H6H homologs and structural overlay reveals an overall Rossmann fold with a flexible loop between Lys91-Asp130. Additionally, 30 amino acids of the N-terminal region of all H6H homologs suggests high flexibility with no clear secondary structural elements. Therefore, when a truncated version of H6H from A. belladonna with thirty amino acids missing on the N-terminus was made, there was no significant change in enzyme activity and was predicted to have a higher crystallization potential. This potential could be useful for ascertaining a crystal structure of H6H to which there are currently none.

3.5 Conclusion

Research on tropane alkaloid biosynthesis in the last decade has taken a pathway that had many open questions regarding enzymes and substrates and has begun to fill in those gaps. It is clear that the entire pathway, at least for the main solanaceous species is nearly completed. As with all scientific endeavors, the discovery and initial characterization of the structure-function relationships of these enzymes only reveals more questions and a need for continuing tropane research into the future. Increasing amounts of evidence suggest that the tropane biosynthetic pathway in polyphyletic.

68 Texas Tech University, Neill Kim, May 2020

This then begs the question, what biological pressures were there in the different lineages that yielded a common structure? What are the real biological functions of tropanes in an ecological context? Clearly, several studies already exist, suggesting that tropanes serve as defensive compounds against herbivores.270, 271 However, there are many open questions regarding the diversity of structures within the family and the interactions they are mediating.

Of the enzymes identified and characterized to date, many structure-function relationships remain unclear. It is now a task for structural studies to elucidate dynamics of folding and the identification of residues important not only for catalysis, but for regulation as well. It is interesting that at least half of the enzymes in the tropane biosynthetic pathway exist as dimers. New studies will be necessary to identify allosteric regulators of these enzymes and this in turn will give rise to the need for flux analysis and experiments involving cross-talk and inhibition. Lastly, these subjects also relate to storage and turnover of tropanes within the plant, a key area of study in which there is little to no data available.

The lesser studied families containing members with the ability to produce tropanes are now ripe for discovery of even more novel enzymes. With the increase in sequencing capabilities and the accompanying reduction in costs, more genetic resources will be available for gene discovery studies in families such as the Brassicaceae, Convolvulaceae, and Proteaceae. Regardless if new enzymes are identified in the core metabolic pathway, it is inevitable that the diversity of enzymes involved in decorating the core structures will be discovered. Alongside these discoveries, the fields of synthetic biology and computational enzyme design will benefit and assist in addressing issues regarding the production of pharmaceuticals and bioactive tropanes for pharmaceutical purposes in a ‘green chemistry’ context. It is clear that the future of tropane research moving forward into the next decade, will focus on novel tropanes and metabolic engineering utilizing our new gains in structure- function relationships.

69 Texas Tech University, Neill Kim, May 2020

CHAPTER 4

TROPANE ALKALOID BIOSYNTHESIS IN ERYTHROXYLUM COCA INVOLVES AN ATYPICAL TYPE III POLYKETIDE SYNTHASE Manuscript in progress

Neill Kim1, Jan Jirschitzka, Olga Peregrino1, Charles Stewart Jr.3, Cornelius S. Barry4 and John C. D’Auria1,2 From the 1Department of Chemistry and Biochemistry, Texas Tech University; 2Liebniz Institute of Plant Genetics and Crop Plant Research, IPK Gatersleben; 3Macromolecular X-ray Crystallography Facility, Iowa State University; 4Department of Horticulture, Michigan State University. Keywords: Tropane alkaloid, type III polyketide synthase, biosynthesis, crystallography, enzyme kinetic, mutagenesis, plant biochemistry, plant molecular biology, synthetic biology, systems biology

4.1 Abstract

The endeavors to metabolically engineer important tropane alkaloids that are pharmacologically active specialized metabolites are hampered by the lack of data in regard to the genes and enzymes responsible for their production. The production of the second ring structure of tropane alkaloids has been a mystery since its discovery until recent years. It has been hypothesized that an atypical type III polyketide synthase enzyme is involved in the extension that will subsequently lead to the cyclization of the second ring forming bicyclic tropane core scaffold. Putative type III polyketide synthase enzymes were found in an Erythroxylum coca cDNA transcriptome database. LC/MS/MS analysis of enzyme assays reveals the formation of a 3-oxoglutaric acid (also known as β-ketoglutarate) intermediate. This intermediate then undergoes a spontaneous non-enzymatic reaction with the N-methyl-∆1-pyrrolinium cation, the first ring structure formed in tropane alkaloid biosynthesis, to yield a 4-(1-methyl-2- pyrrolidinyl)-3-oxobutanoate intermediate. This intermediate then undergoes cyclization via an enzyme such as a cytochrome p450, as was the case for solanaceous plants. Mutagenesis experiments on key residues thought to be involved in substrate interactions were carried out to give a better understanding of the structure-function relationship of this unique class of enzymes. Understanding how similar biochemical 70 Texas Tech University, Neill Kim, May 2020 pathways function when derived from evolutionary diverse plant families is crucial and will facilitate in the production of these small molecules through synthetic biology.

4.2 Introduction

Tropane alkaloids (TAs) are an important and diverse class of plant specialized metabolites.272 These heterocyclic nitrogenous compounds are identified by their N- methyl-8-azabicyclo[3.2.1]-octane core structure that is found in more than 200 unique alkaloids.5, 13, 41 Tropane alkaloids have been reported to be found in seven different orders of plants with a scattered distribution among angiosperms including Malpighiales (Erythroxylaceae) and Solanales (Solanaceae).4, 273 TAs have many pharmaceutical properties and are often used as a starting point for drug development.41 The methylated nitrogen in its core structure is analogous to acetylcholine, therefore, leading to the inhibition of the muscarinic acetylcholine receptors when bound.44 One of the most infamous TAs is cocaine, exclusively found in the leaves Erythroxylum coca and E. novogranatense plant species.10, 12, 66 The binding of the aromatic ring at the 3β position to specific receptor sites blocks the reuptake of nor-epinephrine, serotonin (5-HT receptor), and dopamine (D-A receptor) explaining the anesthetic and euphorigenic properties of cocaine.52, 53, 274 This 3β stereospecific conformation is prevailing to TAs found in the Erythroxylaceae but rarely found in the Solanaceae. Common TAs found in the Solanaceae family with valued pharmaceutical properties are atropine and scopolamine which are biosynthesized in the roots of plants such as Atropa belladonna, Hyoscyamus niger, and members of the Datura genus.275 These valued alkaloids continue to be listed by the World Health Organization (WHO) as important pharmaceutical compounds of essential drugs.178

The biosynthesis of TAs has predominantly been studied in the Solanaceae family, however recent studies suggest other plant species have evolved independently overtime using similar tropane metabolism.13 Furthermore, phylogenetic studies of TAs reveal a scattered distribution among angiosperms with multiple origins.4 There are three main stages of TA biosynthesis which consists of: the first nitrogen-containing heterocyclic ring closure, the second ring closure forming the bicyclic TA core scaffold,

71 Texas Tech University, Neill Kim, May 2020 then final modifications by the addition of functional groups to the bicyclic structure. The formation and closure of the first ring structure has been elucidated in the Solanaceae, however, the second ring formation has been a mystery until recent discoveries. There have been many attempts at its elucidation and several hypotheses about its bicyclic formation but no enzymes were characterized.102 In 2018, a non- canonical type III polyketide synthase (PKS) was discovered in the solanaceous plant A. belladonna (AbPYKS).233 Typically, type III PKSs catalyze the sequential decarboxylative condensations of malonyl-CoA onto a CoA-tethered starter molecule.22 The first type III PKS to be discovered was chalcone synthase (CHS), the first committed step in flavonoid biosynthesis.37 This enzyme catalyzes the iterative sequential decarboxylative addition of three acetate units derived from malonyl-CoA onto its p-coumaroyl-CoA starter molecule to form naringenin chalcone.23, 24 However, Bedewitz et al. report that their AbPYKS enzyme utilizes the N-methyl-∆1-pyrrolinium cation as the starter substrate and malonyl-CoA as the extender unit to create the 4-(1- methyl-2-pyrrolidinyl)-3-oxobutanoic acid.233 With the aid of a cytochrome p450 enzyme (AbCYP82M3) to facilitate ring closure of the polyketide chain, the biosynthesis of the second ring closure is finally elucidated. To the best of our knowledge, there has never been reports of a type III PKS utilizing a non-CoA-tethered starter molecule that is also charged.

Interestingly in 2019, Huang et al. also reported a non-canonical type III PKS found in the solanaceous species Anisodus acutangulus (AaPYKS) that utilizes a complete different mechanism than what was previously reported.234 This group report that AaPYKS only utilizes malonyl-CoA as both the starter and extender unit to form 3-oxoglutaric acid (3-OGA). This molecule then condenses with the N-methyl-∆1- pyrrolinium cation non-enzymatically to form the 4-(1-methyl-2-pyrrolidinyl)-3- oxobutanic acid intermediate. This mechanism is drastically different than what was previously reported and is the second non-enzymatic reaction in tropane alkaloid biosynthesis. The same group also reports key amino acid residues thought to be involved in the binding and stabilization of malonyl-CoA within the active site. The residues Arg134 and Ser340 of AaPYKS are reported to stabilize the bound 4-carboxy-

72 Texas Tech University, Neill Kim, May 2020

3-oxobutanoyl (COB) moiety via salt bridges and hydrogen bond interactions with the carboxy group (Scheme 13). However in the E. coca PYKS enzyme, a threonine residue exists instead of the arginine residue. This gives rise to the question of the importance of the arginine residue reported previously. A threonine residue does not contain the same properties as a charged arginine residue. Is the arginine residue a key component of substrate stabilization for solanaceous plants only? There are increasing amounts of evidence that suggests that the tropane alkaloid biosynthetic pathway is polyphyletic.13, 14 The specific details regarding the reaction mechanism of these enzymes are still unknown.

73 Texas Tech University, Neill Kim, May 2020

Scheme 13. Proposed mechanism of EcPYKS based on previous studies of AaPYKS. Arg(134) denotes the residue found in Solanaceae, not Erythroxylaceae. Dashed lines represent salt bridges and dotted lines represent hydrogen bonds.

This study aims to give a better understanding of the type III PYKS mechanism involved in TA biosynthesis that leads to the second ring closure. Two non-canonical type III PKSs have been identified and characterized in E. coca (EcPYKS1 and EcPYKS2) as well as the canonical chalcone synthase enzyme (EcCHS). Mutagenesis experiments were performed to obtain a better comprehension on the structure-function relationship of key amino acid residues involved in catalysis. Moreover, this study aims 74 Texas Tech University, Neill Kim, May 2020 to take a closer look at the divergence of tropane alkaloid biosynthesis between two families who have evolved independently over millennia. With the combined efforts using biochemical, structural, and kinetic approaches via LC/MS/MS, we demonstrate that a non-canonical type III PYKS from E. coca is involved in tropane alkaloid biosynthesis.

4.3 Results

4.3.1 Sequence analysis of EcPYKS1, EcPYKS2, and EcCHS

The full-length open reading frames (ORFs) of three different type III PKS genes were cloned from the cDNA of E. coca young leaves generated by RT-PCR. The ORF of EcPYKS1, EcPYKS2, and EcCHS are 1173 bp, 1182 bp, and 1176 bp, respectively. EcPYKS1 and EcPYKS2 share a 92% amino acid sequence identity with each other and 61-64% amino acid sequence identity with E. coca chalcone synthase (EcCHS), which produces naringenin chalcone (Figure 12). Interestingly, EcPYKS1 and EcPYKS2 share 56-57% amino acid sequence identity with AbPYKS and 54-56% amino acid sequence identity with AaPYKS while AbPYKS and AaPYKS share an 85% amino acid sequence identity to each other. EcPYKS1 and EcPYKS2 share the conserved catalytic triad Cys165, His304, and Asp337 while EcCHS’s residues are Cys164, His303, and Asn336.

75 Texas Tech University, Neill Kim, May 2020

Figure 12. Sequence alignment of different type III PKSs in angiosperms. 76 Texas Tech University, Neill Kim, May 2020

Phylogenetic analysis reveals that EcPYKS1 and EcPYKS2 does not group with other CHS enzymes (Figure 13). Although EcPYKS1 and EcPYKS2 group with AbPYKS and AaPYKS, the low bootstrap values make it difficult to assert definite conclusions. Interestingly, the sequence alignment of EcPYKS1, EcPYKS2, and EcCHS when aligned to other type III PKS enzymes show a conserved threonine residue at position 133. Only AbPYKS shows the conserved arginine residue as was seen in AaPYKS. Moreover, the Ser340 residue responsible for hydrogen bonding is not conserved in EcPYKS2. The other type III PKS enzymes conserve this amino acid residue but EcPYKS2 interestingly contains a glycine instead.

Figure 13. Unrooted phylogeny tree of known type III PKSs across different families and species. The sequences were aligned using the CLUSTAL X alignment program with standard protein alignment settings. Visualization was done through FigTree with numbers at each node representing bootstrap values. Scale on the bottom represents the number of amino acid substitutions per site.

77 Texas Tech University, Neill Kim, May 2020

4.3.2 Quantitative real-time PCR of gene expression in E. coca

*Performed by Olga Peregrino

Two putative type III PKS sequences from the E. coca young leaf λZAPII cDNA library15 were identified and denoted as EcPYKS1 and EcCHS, named based on activity assays. A third putative type III PKS was identified from the young leaf E. coca 454 library and denoted as EcPYKS2, named based on activity assays. qPCR-grade primers were designed for each gene of interest and tested for efficiency (Table 4). Bands corresponding to the correct size of amplicons were detected on a 4% agarose gel electrophoresis (Figure 14).

Table 4. Primer efficiency values in E. coca.

78 Texas Tech University, Neill Kim, May 2020

Figure 14. 4% acrylamide gels of primer optimization analysis. All tested primers are labeled on top of the corresponding lane. 100 bp ladder is present at the extremities of both gels. Top gel represents primer optimization in E. coca cDNA. Bottom gel represents primer optimization in E. novogranatense cDNA. Non-template controls are denoted as NTC.

Significance among Ct values obtained from qPCR analysis were determined via t-tests for all comparisons. P values greater than 0.05 were determined to have no significance. For E. coca EcPYKS1, significant differences were determined in all three of the tissues tested. In E. coca experiments, the relative expression levels were about 90 times greater for EcPYKS1 in L1 tissues relative to L2 and L3 tissues (Figure 15). Significant differences were observed in EcPYKS2 expression levels with L1 leaves being five times higher than when compared with L2 and L3, however there was no significant differences between L2 and L3 leaves. Significant differences were also 79 Texas Tech University, Neill Kim, May 2020 detected in EcCHS between all tissue types however the fold relative expression difference between the different tissue types in less than one.

Figure 15. Relative quantification analysis of EcCHS, EcPYKS1, and EcPYKS2 gene expression in E. coca.

4.3.3 Product formation in the aerial tissues of E. coca using crude extracts

To investigate the reaction formation of the 4-(1-methyl-2-pyrrolidinyl)-3- oxobutanoic acid intermediate in different leaf tissues, enzyme assays were performed on crude plant E. coca extracts Because plants produce malonyl-CoA endogenously, 3- oxoglutaric acid formation could not be accurately measured. Instead, 4-(1-methyl-2- pyrrolidinyl)-3-oxobutanoic acid formation assays were performed using malonyl-CoA and N-methyl-∆1-pyrrolinium cation as substrates and detected product formation in all aerial tissues excluding the stem. The highest enzyme activities were found in the developing leaf tissues (L1, rolled young leaves) with a specific activity of about 15 pkat mg-1 fresh weight (Figure 16). The enzyme activities for L2 (unrolled young leaves) and L3 (mature leaves) were similar and significantly lower by more than 10- fold when compared to the L1 leaves. This correlates with previous studies that cocaine biosynthesis in E. coca predominantly occurs in the L1 young leaf tissue.13, 14

80 Texas Tech University, Neill Kim, May 2020

Figure 16. Relative quantification analysis of PYKS specific activity in different leaf tissue for the formation of 4-(1-methyl-2-pyrrolidinyl)-3-oxobutanoic acid.

4.3.4 EcPYKS does not use the N-methyl-∆1-pyrrolinium cation as a substrate

To confirm previous reports on the substrates involved in the synthesis of the 4- (1-methyl-2-pyrrolidinyl)-3-oxobutanoic acid intermediate, inhibition experiments using iodoacetamide were performed. Iodoacetamide is a known suicide inhibitor for type III PKSs which covalently bonds to the catalytic cysteine in the active site.24, 276 To test whether or not the N-methyl-∆1-pyrrolinium cation is used as a substrate by the EcPYKS enzymes, incubation experiments were performed using iodoacetamide, the N-methyl-∆1-pyrrolinium cation, and malonyl-CoA (Table 5). When first incubating the enzyme with iodoacetamide followed by the N-methyl-∆1-pyrrolinium cation and malonyl-CoA, there was a significant reduction in 4-(1-methyl-2-pyrrolidinyl)-3- oxobutanoic acid formation. When the N-methyl-∆1-pyrrolinium cation was first incubated with the enzyme followed by iodoacetamide then malonyl-CoA, a similar reduction in product formation occurred.

However, when incubating the enzyme with malonyl-CoA first then iodoacetamide and finally the N-methyl-∆1-pyrrolinium cation, there was not a significant drop in product formation when compared to the controls. This experiment displayed the importance of malonyl-CoA and its role in the reaction mechanism. These results support the hypothesis that only malonyl-CoA is used by the enzyme with no

81 Texas Tech University, Neill Kim, May 2020 significant difference in activity when the N-methyl-∆1-pyrrolinium cation is added to the assay.

Table 5. Inhibition experiments using iodoaceamide (100µM) to demonstrate the involvement of malonyl-CoA (200µM) and N-methyl-∆1-pyrrolinium cation (NMP, 100µM) in the active site.

1st incubation 2nd incubation 3rd incubation 4-(1-methyl-2- (15 min) (15 min) (15min) pyrrolidinyl)-3- oxobutanoic acid formation (%) Control - NMP Malonyl-CoA 100 % Experiment 1 Iodoacetamide NMP Malonyl-CoA 7.45 % Experiment 2 NMP Iodoacetamide Malonyl-CoA 10.37 % Experiment 3 Malonyl-CoA Iodoacetamide NMP 76.51%

4.3.5 EcPYKS1 and EcPYKS2 are atypical type III PKSs that catalyze the formation of 3-OGA

Three soluble Strep-Tagged PKSs from E. coca were heterologously expressed in Komagataella phaffii and purified via Strep-Tactin affinity chromatography. Protein expression was verified for all three PKSs by western blot analysis using anti-Strep antibodies. The native EcPYKS1, EcPYKS2, and EcCHS proteins with the addition of the StrepTagII (10 amino acids) were analyzed via SDS-PAGE and yielded bands corresponding to the sizes of 42.8 kDa, 43.1 kDa, and 42.7 kDa respectively (Figure 17) (Figure 18). Like other type III PKSs, these enzymes are homodimers with each subunit approximating at 43 kDa.22

82 Texas Tech University, Neill Kim, May 2020

Figure 17. SDS-PAGE of EcPYKS1 pEP-Strep before thrombin cleavage ran on a 12% acrylamide gel. Order of lanes: ladder, desalt 1, desalt 2, desalt 3, desalt 4, desalt 5, desalt 6, desalt 7. Molecular weight of protein is ~43 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run that was desalted, ran at 150V.

Figure 18. SDS-PAGE of EcPYKS1 pEP-Strep after thrombin cleavage ran on a 12% acrylamide gel. Order of lanes: ladder, 1:25 dilution of thrombin at 4°C with 16 h incubation, 1:25 dilution of thrombin at 20°C with 8 h incubation, 1:25 dilution of thrombin at 20°C with 16 h incubation, 1:100 dilution of thrombin at 4°C with 8 h incubation, 1:100 dilution of thrombin at 4°C with 16 h incubation, 1:100 dilution of thrombin at 20°C with 8 h incubation, 1:100 dilution of thrombin at 20°C with 16 h incubation, no thrombin control. Molecular weight of protein is ~43 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run that was desalted, ran at 150V. Bands above the cleaved protein represents protein that was fully not cleaved.

The purified recombinant proteins were then tested for 3-oxoglutaric acid formation using only malonyl-CoA as the substrate as well as naringenin chalcone 83 Texas Tech University, Neill Kim, May 2020 formation using p-coumaroyl-CoA and malonyl-CoA as the substrates to test for CHS activity. Initial assays using EcPYKS1 and EcPYKS2 confirmed the atypical type III PKS activity by forming 3-oxoglutaric acid, whereas EcCHS displayed typical CHS activity by forming naringenin chalcone. EcPYKS1 and EcPYKS2 did not display any chalcone synthase activity when a CHS assay was performed. Similarly, EcCHS did not display any 3-oxoglutaric acid formation when only using malonyl-CoA as the substrates.

For biochemical characterization, the heterologous expression of EcPYKS, EcPYKS2, and EcCHS was carried out in K. phaffii due to higher enzymatic activity when compared to E. coli. The pH optimum of the heterologously expressed EcPYKS1 proteins were determined to be 8.4 when catalyzing the formation of 3-oxoglutaric acid (Figure 19). Enzyme activity decreased 29% and 31% of maximum activity at a pH of 7.3 and 9.2 respectively. Similar pH optima were also achieved for EcPYKS2. Metal ion tests were carried out with standard assay conditions. The PYKS activity was not significantly stimulated with the addition of monovalent or divalent metal cations. Mn2+, Co2+, Ni2+, Cu2+, and Fe2+ showed strong inhibitory effects on enzyme performance when using concentrations of only 5mM, significantly reducing activity to 8% or less (Figure 20). When the enzymes were preincubated at 4, 25, 37, 50 and 65°C for 45 min, PYKS activity was increased 50% at 37°C and decreased 30% at 50°C when compared to the 4°C sample. Activity was completely lost at 65°C.

84 Texas Tech University, Neill Kim, May 2020

4.00E+07

3.50E+07

3.00E+07

2.50E+07

2.00E+07

1.50E+07

1.00E+07

5.00E+06 Relative intensity, cps intensity, Relative 0.00E+00 4 5 6 7 8 9 10 11 pH

Figure 19. pH optima test for EcPYKS1 using standard assay conditions. Buffers used for pH range were 100mM phosphate citrate (pH 4-7), 100mM Tris-HCl (pH 7-9), or 100mM NaOH- Glycine (pH 9-10.5). EcPYKS2 had similar results.

Relative intensity, cps 3000.0 2500.0 2000.0 1500.0 1000.0 500.0 0.0 -500.0 MgCl2 MnCl2 CaCl2 ZnCl2 NaCl KCl CoCl2 NiCl2 CuCl CuCl2 FeCl2 EDTA No metal

Figure 20. Metal ion tests on EcPYKS2 using monovalent and divalent ions under standard assay conditions. EcPYKS1 had similar results.

Analysis of the kinetic properties of EcPYKS1 reveals a KM of ~19 uM for malonyl-CoA with a catalytic efficiency of 1.07 × 105 s-1 M-1 (Figure 21). EcPYKS2

5 -1 -1 has a KM of ~26 uM for malonyl-CoA with a catalytic efficiency of 1.52 × 10 s M (Figure 22). Although EcPYKS1 has a better binding affinity, EcPYKS2 is the more efficient enzyme at producing 3-oxoglutaric acid (Table 6) (Figure 23). EcCHS has a 5 -1 -1 KM for p-coumaroyl-CoA of ~0.97 uM and a catalytic efficiency of 9.03 × 10 s M

6 as well as a KM for malonyl-CoA of ~1.92 uM and a catalytic efficiency of 1.43 × 10 85 Texas Tech University, Neill Kim, May 2020 s-1 M-1 (Table 7) (Figure 24). Further analysis of EcCHS also revealed the formation of 4-coumaroyltriacetic acid lactone (CTAL).

Figure 21. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS1 for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations.

Figure 22. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS1 for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations.

86 Texas Tech University, Neill Kim, May 2020

Table 6. Steady-state kinetic properties of EcPYKS1 and EcPYKS2 for malonyl-CoA. n = 3.

kcat KM Vmax kcat/KM

(s-1) (µM) (nmol sec-1) (nM-1 s-1) EcPYKS1 2.1 ± 0.1 19.8 ± 2.2 48.3 107.5

EcPYKS2 4.0 ± 0.2 26.2 ± 4.7 92.1 151.7

Figure 23. Extracted LC/MS/MS MRM chromatograms in positive mode of 3-oxoglutaric acid formation by EcPYKS1 and EcPYKS2 when compared to the standard. m/z 147 > 129

Table 7. Steady-state kinetic properties of EcCHS. n = 3.

Variable kcat KM Vmax kcat/KM Co-substrate substrate (s-1) (µM) (nmol sec-1) (nM-1 s-1) p-coumaroyl- Malonyl-CoA CoA (0.5- 0.9 ± 0.0 1.0 ± 0.2 20.5 907.2 (250µM) 180µM) p-coumaroyl- Malonyl-CoA CoA 2.8 ± 0.4 1.9 ± 1.0 64.3 1432.3 (2-250µM) (180µM)

87 Texas Tech University, Neill Kim, May 2020

Figure 24. Extracted LC/MS/MS MRM chromatograms in positive mode of naringenin chalcone formation by EcCHS when compared to the naringenin standard. m/z 273 > 153.

4.3.6 Mutagenesis experiments

In order to test the hypothesized mechanism of Huang and coworkers, single point mutants were generated to assess the role of catalytically important residues in the reaction mechanism. Wild type and mutant PYKS enzymes were expressed in either E. coli or K. phaffii as His-Tagged or Strep-Tagged proteins, respectively, and purified to homogeneity using Ni2+-affinity or Strep-tactin affinity chromatography. The molecular weight of each protein was confirmed via SDS-PAGE with each monomer at approximately 43 kDa. Concentrations of proteins were determined via Bradford assay (BioRad) according to manufacturer’s protocol.

First, basic mutations were made within the catalytic triad. Cys165 was first mutated into an alanine and showed no enzyme activity, as was predicted.24, 276 Interestingly, the H304Q mutation had very low product formation when compared to previous mutagenesis experiments performed. The final mutations that were made regarding the active site was N337, responsible for the stabilization of malonyl-CoA. As was expected, changing this amino acid to either an aspartic acid or alanine showed very little to none enzymatic activity. The next set of mutations were made in order to

88 Texas Tech University, Neill Kim, May 2020 see how many amino acids it would take to convert a PYKS enzyme into a CHS enzyme. Unfortunately, these attempts were unsuccessful (Figure 25).

Figure 25. Extracted LC/MS/MS MRM chromatograms in positive mode of different mutant activity when compared to WT for relative 3-oxoglutaric acid formation. Mutations were generated based on crystal structures of key residues thought to be involved in substrate interactions. Overnight assays were performed under standard assay conditions.

The final mutations that were made were based on key residues reported by Huang et al. involved in the stabilization of malonyl-CoA onto the active site. They reported that an R134 residue in A. acutangulus is responsible for creating a salt bridge with the carboxy group of the COB moiety. Interestingly in the E. coca PYKS enzyme, the R134 residue is actually a threonine residue at position 133. This brings the question of importance of this residue and if it is indeed involved in the mechanistic machinery of this enzyme. In EcPYKS2, T133A and T133R point mutations were made independently to determine the importance of this residue. Interestingly, both mutants retained activity. The EcPYKS2 T133A mutant had a KM of ~35 uM for malonyl-CoA with a catalytic efficiency of 1.13 × 105 s-1 M-1 (Figure 26). These kinetic values are not far off from the wild-type EcPYKS2 enzyme. Furthermore, the EcPYKS T133R mutant displayed a significantly lower catalytic efficiency when compared to the wild- 89 Texas Tech University, Neill Kim, May 2020

4 -1 -1 type at 2.61 × 10 s M and a KM of ~25 uM (Figure 27). This contrasts previous reports on the significance and importance of the arginine residue in the stabilization of malonyl-CoA within the active site (Table 8).

Figure 26. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS2 T133A for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations.

90 Texas Tech University, Neill Kim, May 2020

Figure 27. Determination of Michaelis-Menten enzyme kinetic parameters of EcPYKS2 T133R for malonyl-CoA. Each data point was done in n = 3 technical replicates. Missing error bars means small standard deviations.

Table 8. Steady-state kinetic properties of EcPYKS2 mutants compared to wild-type. n = 3.

kcat KM Vmax kcat/KM

(s-1) (µM) (nmol sec-1) (nM-1 s-1) WT 4.0 ± 0.2 26.2 ± 4.7 92.1 151.7 EcPYKS2 4.0 ± 0.1 35.6 ± 3.7 93.2 113.1 T133A EcPYKS2 0.7 ± 0.0 25.6 ± 3.6 15.5 26.1 T133R

4.3.7 Structural data based on crystallography

*Performed by Dr. Charles Stewart, Iowa State University

In order to understand the structural basis of the catalytic mechanism of these enzymes, a crystal structure of AbPYKS and EcPYKS2 was determined. The crystal structure of AaPYKS-COB was determined previously by Huang et al.234 The overall dimeric structure of AbPYKS is consistent with previously reported type III PKS 91 Texas Tech University, Neill Kim, May 2020 enzymes.277 An overlay of the AaPYKS-COB binding pocket with AbPYKS was visualized in the perspective of looking down the CoA binding tunnel (Figure 28). The conserved catalytic triad Cys-His-Asn is present in both enzymes, as is expected. Additionally, there are conservations of amino acid residues between the two solanaceous enzymes, specifically the R134/137 residue that is responsible for forming a salt-bridge with the COB moiety. It is possible that this residue is a specific characteristic of the Solanaceae family.

Figure 28. An overlay of the AaPYKS-COB binding pocket with AbPYKS looking down the CoA binding tunnel at 2.0 Å. AaPYKS depicted in blue; AbPYKS depicted in magenta (apo). The COB intermediate is displayed in ball-and-stick representation.

A crystal structure of EcPYKS2 was also determined to obtain a better understanding of its catalytic mechanism when compared to the solanaceous enzymes. An overlay image of AaPYKS-COB with EcPYKS2 was generated in the perspective looking down the CoA binding tunnel (Figure 29). Although the conserved catalytic triad Cys-His-Asn is present in EcPYKS2, there are clearly non-conserved residues in

92 Texas Tech University, Neill Kim, May 2020 the binding pocket that were conserved in AbPYKS. Residues that are circled represent differences between the two enzymes involved in substrate interactions. It is obvious that the R134 residue present in AaPYKS is substituted with a T133 residue in EcPYKS2. Based on mutagenesis experiments performed on EcPYKS2 T133A/R it is apparent that this residue is not involved in substrate interaction, at least in the Erythroxylaceae type III PYKS enzyme. Interestingly an EcPYKS2 K138M mutation was generated that cause inactivation of the enzyme. It remains unclear the role this residue plays within the active site and how it may interact with malonyl-CoA or the COB intermediate.

Figure 29. An overlay of the AaPYKS-COB binding pocket with EcPYKS2 looking down the CoA binding tunnel. AaPYKS depicted in blue; EcPYKS2 depicted in gold (apo). Circles denote residues known or hypothesized to interact with substrate. The COB intermediate is displayed in ball-and-stick representation.

93 Texas Tech University, Neill Kim, May 2020

Furthermore Huang et al. reported that the other stabilization residue for the COB intermediate was Ser340, responsible for hydrogen bonding with the carboxy end of the intermediate. EcPYKS2 does not contain a serine at this position but instead exists Gly339. Most other type III PKS enzyme including CHS enzymes and the two solanaceous enzymes, AaPYKS and AbPYKS, along with EcPYKS1 all possess a serine residue at this position. It appears that at least in the Erythroxylaceae family, different amino acids are involved in the stabilization and reaction mechanism of malonyl-CoA into the 3-oxoglutaric product. This may be a result of convergent evolution where these two families have evolved and adapted to create tropane alkaloids with similar enzymes but through different mechanisms of action.

4.3.8 Transient expression system in N. benthamiana

*Performed by Dr. Cornelius Barry, Michigan State University

A transient expression system was incorporated into the leaves of N. benthamiana in order demonstrate the involvement of the EcPYKS enzymes in tropane alkaloid formation (Figure 30). Traditionally, N. benthamiana is a solanaceous species that does not produce any tropane alkaloids. A pEAQ vector system was used, that allows for high level expression of recombinant proteins, in a gene stacking approach. When either of the EcPYKS1 or EcPYKS2 enzymes were combined with enzymes from A. belladonna (AbPMT, AbMPO, and AbTS), tropinone formation was detected. When the EcPYKS enzymes were excluded from the system, tropinone formation was not observed. This experiment demonstrates the involvement of the EcPYKS enzymes in tropane alkaloid formation.

94 Texas Tech University, Neill Kim, May 2020

Figure 30. Overview of the reconstruction of tropinone biosynthesis in N. benthamiana. The transient expression system includes enzymes from both A. belladonna and E. coca.

4.4 Discussion

Tropane alkaloids are an important class of compounds that have been utilized by humans for centuries. Their pharmaceutical properties make these metabolites highly valuable but the mechanism in which they are biosynthesized have been elusive. The second ring closure of the bicyclic compound was not fully understood but in recent years, two hypotheses regarding this mechanism have been presented. Both hypotheses revolve around an atypical type III polyketide synthase enzyme that is responsible for creating a polyketide chain that will subsequently lead to cyclization. Type III PKSs typically catalyze the iterative decarboxylative condensations of malonyl-CoA onto a CoA-linked starter substrate. We report that there are two separate atypical type III

95 Texas Tech University, Neill Kim, May 2020

PKSs from E. coca involved in the biosynthesis of tropane alkaloids as well as a canonical chalcone synthase like enzyme. The biochemical characterization of EcPYKS1 and EcPYKS2 reveals that only malonyl-CoA is utilized by the enzyme as the only substrate in order to generate 3-oxoglutaric acid. Inhibition experiments using iodoacetamide further support this data. CHS assays on these enzymes also show that they are not naringenin chalcone producing enzyme but instead their own unique class. The biochemical characterization of EcCHS was also performed and resulted in typical kinetic parameters for reported CHS-like enzymes.

Crystal structures of EcPYKS2 were generated for structural analysis. The crystal structure of AbPYKS was also generated as a comparison, along with the previously characterized AaPYKS enzyme. An overlay of the AaPYKS and the EcPYKS2 active site reveals significant differences of amino acid residues. One major difference is the Arg134 residue in AaPYKS being replaced by a threonine residue in EcPYKS2. Furthermore, the Ser340 residue in AaPYKS is also a glycine residue in EcPYKS2. These two residues are the reported stabilization residues of the COB intermediate via salt bridges and hydrogen bonds. Interestingly, these residues are conserved in the solanaceous AbPYKS enzyme and overlaying crystal structures of AaPYKS and AbPYKS reveals no significant changes in amino acid residues.

Based on crystal structures, site directed mutagenesis experiments were performed on residues thought to interact with the substrate. The role and importance of Cys165 as the attachment site for the polyketide intermediate was confirmed by the lack of activity in the C165A mutant. The H304Q, N337D, and N337A mutants showed inactive or impaired enzymes with drastic reductions in product formation and activity. There were also mutations made to Thr133, to test its stabilization role during 3- oxoglutaric acid formation. The first mutant generated was the T133A mutant. Surprisingly, this mutant had no significant difference of kinetic parameters when compared to the wild-type. Because this change yielded no significant effects, a T133R mutant was generated to see if a more efficient enzyme would result, due to the stabilization role arginine played in AaPYKS. However, in contrast to what was seen in

AaPYKS, a T133R mutation yielded 5-fold reductions in kcat as well as 5-fold reductions 96 Texas Tech University, Neill Kim, May 2020 in catalytic efficiency for malonyl-CoA. These results demonstrate that the key amino acids involved in catalysis are different between the Solanaceae and Erythroxylaceae.

As of this study, there are only two other reported and characterized type III PYKS enzymes in the literature. Two of these enzymes, AaPYKS and AbPYKS, originate from the Solanaceae family while EcPYKS1 and EcPYKS2 originate from the Erythroxylaceae family. The enzymatic structural differences within the active site between these two families are important in terms of origin of evolution. As stated previously, there is significant evidence of a polyphyletic origin in tropane alkaloid biosynthesis. The data presented in this study further supports these claims. A polyphyletic origin of enzymes in tropane alkaloid biosynthesis can aid in the production of these important compounds through a systems biology approach. As was seen in the N. benthamiana experiments, we are able to combine enzymes from different families to produce tropane alkaloids. The next step is to increase the scale of production by mix and matching enzymes from different families to yield the highest amount of product. Pharmaceutically important metabolites, such as atropine and scopolamine, current sole means of production is through growing and harvesting the alkaloids from the plant. This laborious process can be made easy through synthetic biology.

4.5 Materials and methods

4.5.1 Chemical reagents and plant material

Malonyl-CoA, iodoacetamide, and 3-oxoglutaric acid were bought through Sigma. N-methyl-∆1-pyrrolinium chloride was synthesized as previously described.233 233. p-coumaroyl-CoA was purchased through MicroCombiChem GmbH in Germany. Water was supplied through a Milli-Q Synthesis System (Millipore). Cultivation of E. coca plants and use of Schedule II standards were permitted via DEA license RD0449795 to JDC. The cultivation E. coca and E. novogranatense has been previously described.14 Seeds and seedlings were obtained through the USDA. The pulp surrounding the seed was removed and germinated in Perlite. Plants were grown under a 12-h-light/12-h-dark photoperiod at 22°C with humidity at 65% and 70% respectively. Soil acidity of plants were maintained via Soil Acidifier (Ferti-lome) at pH 6. 97 Texas Tech University, Neill Kim, May 2020

4.5.2 Cloning, heterologous expression and purification of wild-type EcPYKS1, EcPYKS2 and EcCHS

Putative type III polyketide synthases were identified from an E. coca young leaf λZAPII cDNA library and a BLAST search was performed on an in-house 454 cDNA sequencing database of E. coca young leaf tissue yielding two candidates. The open reading frames of EcPYKS1 and EcPYKS2 were amplified from L2 E. coca cDNA using their respective primers and gateway cloned into the modified expression vector pEP-Strep. This expression vector was modified from the pPICHOLI Shuttle Vector System designed for heterologous expression in K. phaffii as well as in E. coli and contains Strep-tag located on the N-terminus of the gene sequence. The pEP-Strep vector contains a yeast inducible alcohol oxidase (AOX) promoter and an E. coli T7 promoter. The expression vector was then introduced into K. phaffii KM71 and a starter culture was grown overnight in YPD (Yeast Extract Peptone Dextrose Medium) medium supplemented with 100 µg mL-1 of Zeocin (InvivoGen) at 28°C with shaking at 250 rpm. Fresh BMMY (Buffered Methanol-complex Medium) medium supplemented with 100 µg mL-1 of Zeocin (InvivoGen) was then inoculated with the overnight culture (10% final concentration of cell suspension) and grown at 28°C with shaking at 250 rpm to and OD600 of 1.0. Protein expression was then induced with the addition of 1% methanol (v/v) twice a day (morning and evening) and grown at 28°C with shaking at 250 rpm for 2-3 days. The cells were then harvested at 2000 g at 4°C for 10 min then stored at -20°C until ready for purification.

For protein purification, cells were resuspended in 100mM Tris-HCl buffer, pH

8, supplemented with 150mM NaCl, 1mM EDTA, and 5mM dithiothreitol then lysed using a pressure cell homogenizer (Avestin EmulsiFlex-C3). The lysate was then centrifuged at 15,000g at 4°C for 15 min. The soluble protein was then loaded onto a Strep-Tactin superflow column (IBA Lifesciences) using an FPLC (Äkta) machine. The recombinant protein was eluted using 100 mM Tris-HCl, pH 8, supplemented with 150 mM NaCl, 1 mM EDTA, and 2.5 mM desthiobiotin. Fractions containing the protein of interest was then loaded onto a HiTrap Desalting column and eluted using 100mM Tris-

98 Texas Tech University, Neill Kim, May 2020

HCl pH 8.4 containing 15% glycerol and 5mM dithiothreitol. Concentration of total protein was measured using the Bradford protein assay (Bio-Rad) according to manufacturer’s protocol. The putative size and purity of the protein was determined via SDS-PAGE. Approximately 100 ng of total protein was loaded into each well and stained with Colloidal Coomassie staining solution.

4.5.3 Site direct mutagenesis for PYKS mutants

Point mutations were generated using the QuickChange site-directed mutagenesis protocol (Stratagene). Mutations were performed on the pEP-Strep vector as well as the pH9GW vector according to manufacturer’s protocol. The oligonucleotide sequences of the mutagenic primers are as listed in Table 9.

99 Texas Tech University, Neill Kim, May 2020

Table 9. List of oligonucleotide sequences of the mutagenic primers used for site directed mutagenesis with codons for amino acid changes underlined and bold.

Gene of interest Primer sequence 5‘3‘ EcPYKS2 T133A CCTCATCTTCTCTTCAGCTTCAGGCATAGAAAAAC FWD EcPYKS2 T133A GTTTTTCTATGCCTGAAGCTGAAGAGAAGATGAGG REV EcPYKS2 T133R CCTCATCTTCTCTTCACGTTCAGGCATAGAAAAAC FWD EcPYKS2 T133R GTTTTTCTATGCCTGAACGTGAAGAGAAGATGAGG REV EcPYKS2 C165A CTACACTATTGGCGCTCATGCAGGTGGCACTG FWD EcPYKS2 C165A CAGTGCCACCTGCATGAGCGCCAATAGTGTAG REV EcPYKS2 H304Q CAATATTCTGGATACCAGAACCTGGAGGGCCTGCG FWD EcPYKS2 H304Q CGCAGGCCCTCCAGGTTCTGGTATCCAGAATATTG REV EcPYKS2 N337D CTCAGCGAGTACGGCGACATGTCAGGTGCGAC FWD EcPYKS2 N337D GTCGCACCTGACATGTCGCCGTACTCGCTGAG REV EcPYKS2 N337A CTCAGCGAGTACGGCGCTATGTCAGGTGCGAC FWD EcPYKS2 N337A GTCGCACCTGACATAGCGCCGTACTCGCTGAG REV EcPYKS2 K138M CTTCAGGCATAGAAATGCCTGGCGTGGACTG FWD EcPYKS2 K138M CAGTCCACGCCAGGCATTTCTATGCCTGAAG REV EcPYKS2 K138M + CTTGGCTAATCTTATAGGTATGGGTATTTTCGG R212G FWD EcPYKS2 K138M + CCGAAAATACCCATACCTATAAGATTAGCCAAG R212G REV CTTCCGGTGTTGACAAGCCTGGTGCAGATTATC EcCHS M137K FWD

GATAATCTGCACCAGGCTTGTCAACACCGGAAG EcCHS M137K REV

EcCHS M137K + GATTCCATGGTCCGTCAAGCCCTCTTC G211R FWD EcCHS M137K + GAAGAGGGCTTGACGGACCATGGAATC G211R REV

The pH9GW expression vector containing the mutated plasmid was then transformed into the E. coli BL21(DE3) (Invitrogen) cell line and bacteria cultures were 100 Texas Tech University, Neill Kim, May 2020 grown using Fernbachs in Luria-Bertani medium supplemented with 50 µg mL-1 of kanamycin at 37°C with shaking at 200 rpm until an OD600 of 0.5 was reached. The addition of 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) to the cells induced protein expression and further cultivation was performed at 18°C with shaking at 200 rpm overnight. The cells were then harvested at 2000 g at 4°C for 10 min then stored at -20°C until ready for purification via Ni2+ affinity chromatography.

4.5.4 Crude protein extraction from E. coca leaves

Fresh E. coca leaves were ground in liquid nitrogen using a precooled mortar and pestle. A 1:3 ratio was used to mix plant powder with 100mM Tris-HCl, pH 8.4, supplemented with 10% glycerol, 2% (w/v) polyvinylpolypyrrolidone, 50mM Na2S2O5,

5mM dithiothreitol, and 1mM PMSF. The emulsion was then mixed and incubated on ice for 10 min followed by centrifugation for 10 min at 14,800 g at 4°C. Crude protein extract is found in the supernatant and was used for kinetic analysis. Concentration of total protein was measured using the Bradford protein assay (Bio-Rad) according to manufacturer’s protocol. Desalting the crude protein extract was not needed when using deuterated substrates for plant activity assays.

4.5.5 RNA extraction and cDNA synthesis

About 100 mg of fresh E. coca tissue was used to extract total RNA using a Qiagen plant RNA extraction kit and genomic DNA was degraded via an in-column RNase-free DNase I treatment (Qiagen, Germany). Quality and quantity of RNA was determined using reading from a micro-volume spectrophotometer DeNovix DS-11 (DeNovix, Wilmington, USA). cDNA was synthesized with 2 µg of total RNA using a SuperScript II First Strand Kit (Invitrogen, Germany) according to manufacturer protocol.

4.5.6 Quantitative real-time PCR

The primers designed for each gene of interest were synthesized and purified by Integrated DNA Technologies (IDT, USA). To identify single amplicon products,

101 Texas Tech University, Neill Kim, May 2020 legacy PCR was performed on all primer sets with each reaction consisting of 2 µl Taq polymerase, 10 µl 5X GoTaq buffer (Promega, USA), 1 µl of 1mM dNTP mix, 1 µl of each primer and 1 µl cDNA with the reaction volume brought up to 50 µl using sterile DDI water. Machine parameters for the PCR are as follows: 94°C for 45 sec, 30 cycles of denaturation at 94°C for 45 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, and a final extension at 72°C for 7 min. Amplified products were run on a 4% agarose gel and visualized through a white/dual UV Transilluminator photoimager (VWR, US). Reference genes, Ec6409 and Ec10131, were selected based on experimental evidence from previous studies.278

All qPCR experiments were performed on a QuantStudio3 instrument (Thermo Fisher Scientific, USA) with each reaction consisting of 5 μl PowerUp SYBR green Master Mix (Thermo Fisher Scientific, USA), 0.5 μl of each primer and 2 μl of cDNA brought up to a final volume of 10 μl. The thermocycling conditions are as follows: denaturation at 95°C for 10 min, 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min. Samples were all ran in three biological replicates as well as three technical replicates. Primer efficiencies were determined by a standard curve based on seven different two-fold dilutions of cDNA cloned amplicon for each primer set. At the end of each run, melting curve analysis were performed to rule out the presence of primer dimers or non-specific amplicons. RNA only controls and non-template controls were included for each primer set to ensure the absence of contamination. The raw qPCR data was exported to Microsoft Excel using the qBase v1.3.5 macro.279 Primer efficiencies were analyzed by linear regression within the qBase software. All relative quantities we calculated in the qBase software accounting for each primer efficiency and normalizing to reference genes Ec10131 and Ec6409.

4.5.7 Preparation of the 4-(1-methyl-2-pyrrolidinyl)-3-oxobutanoate standard

The 4-(1-methyl-2-pyrrolidinyl)-3-oxobutanoic acid standard was prepared through the hydrolysis of (S)-4-(1-methylpyrrolidin-2-yl)-3-oxobutanoic acid. A mixture of 138µl of tetrahydrofuran and 150µl of 0.33M ammonium hydroxide was prepared followed by the addition of 12µl of 25mM methyl ester was added in

102 Texas Tech University, Neill Kim, May 2020 tetrahydrofuran. The reaction mixture was then shaken at 37°C for 4 h and quenched with 300µl of 0.26M ammonium formate containing 5% (v/v) formic acid. Dilutions of the quenched reaction with solvent containing 100mM ammonium formate, 1% (v/v) formic acid, and 0.1ng/ml of atropine were prepared to generate a standard curve. Reactions were made such that the standard was available to run with samples within an hour of synthesis. Quantification was performed by running independent standard curves for the unreacted methyl ester compound.

Standards were also prepared through non-enzymatic reaction between 3- oxoglutaric acid with the N-methyl-∆1-pyrrolinium cation to form the 4-(1-methyl-2- pyrrolidinyl)-3-oxobutanoic acid standard. This method was simpler and requires less harsh chemicals and steps that may interfere with product formation.

4.5.8 Kinetic analysis of enzymes and the determination of plant activity

The concentration of protein and the incubation parameters were selected in which the reaction velocity was linear with respect to enzyme concentration and incubation time for all enzyme assays performed. Standard PYKS activity assays were performed in 50µl reactions consisting of 100mM Tris-HCl (pH 8.4) 200µM malonyl- CoA, 10mg/mL bovine serum albumin (BSA), 1µg/mL atropine as the internal standard, and enzyme. All reactions were incubated at standard room temperature for 15 min and quenched with 2M HCl (1:10 v/v). To determine the pH optimum, each reaction contained 100mM phosphate citrate (pH 4-7), 100mM Tris-HCl (pH 7-9), or 100mM NaOH-Glycine (pH 9-10.5) supplemented with 200µM malonyl-CoA, and 1ng of purified enzyme in 50µl. The kinetic parameters for EcPYKS1 and EcPYKS2 were determined using standard assay conditions containing varying amounts malonyl-CoA (20-200µM) in a 50µl reaction. Reactions were performed at standard room temperature using 1ng of recombinant enzyme and quenched with 2M HCl (1:10 v/v) after 15 min.

Standard CHS activity assays were performed in 50µl reactions consisting of 100mM potassium phosphate (pH 7.1), 180µM p-coumaroyl-CoA, 200µM malonyl- CoA, 10mg/mL bovine serum albumin (BSA), 1µg/mL atropine as the internal standard,

103 Texas Tech University, Neill Kim, May 2020 and enzyme. All reactions were incubated at standard room temperature for 15 min and quenched with 2M HCl (1:10 v/v). The kinetic parameters for EcCHS was determined using standard assay conditions with either 250µM malonyl-CoA and varied p- coumaroyl-CoA concentrations (0.5-180µM) or 180µM p-coumaroyl-CoA and varied malonyl-CoA concentrations (2-250µM).

Enzyme assays were analyzed by liquid chromatography-ion trap MS using a 1200 series HPLC device (Agilent Technologies) coupled to a 4000 QTRAP® (AB SCIEX) ESI-Ion Trap mass spectrometer equipped a turbo ion source using a Nucleodur Sphinx RP column (250 X 4.6mm, 5 µm; Macherey-Nagel). 3-oxoglutaric acid elution was achieved in 15 min at 25°C with a flow rate of 0.8 mL min-1 using 0.2% (v/v) formic acid in water (solvent A) and 0.5% (v/v) formic acid in acetonitrile (solvent B) as the mobile phase with the following gradient: 98% A (3 min), 50% A (7 min), 10% A (7.1 min), 10% A (10 min), 90% A (10.1 min), 98% A (13 min), 98% A (15 min). The flow coming from the column was split in a 4:1 ratio before reaching the source unit. The mass spectrometer was operated in positive ionization mode with the following parameters: injection volume of 5µl, curtain gas flow at 50 psi, turbo heater temperature at 450°C, nebulizing gas at 50 psi, heating gas at 50 psi, and ion spray voltage at 5500 eV. Quantification of analytes were monitored in MRM mode as follows: 3-oxoglutaric acid m/z 147 > 129 (CE, 9V and DP, 26V), atropine (internal standard) m/z 290 > 124 (CE, 35 V and DP, 51 V), 4-(1-methyl-2-pyrrolidinyl)-3-oxobutanoate m/z 186.1 > 84 (CE, 29 V and DP, 51 V). Quantifications were carried out based on a standard curve as previous described. The Q1 and Q3 quadrupoles were maintained at unit resolution.

Naringenin chalcone elution was achieved in 13 min at 30°C with a flow rate of 0.8 mL min-1 using 0.2% (v/v) formic acid in water (solvent A) and 0.5% (v/v) formic acid in acetonitrile (solvent B) as the mobile phase with the following gradient: 90% A (1 min), 20% A (4 min), 90% A (10 min), 90% A (13 min). The flow coming from the column was split in a 4:1 ratio before reaching the source unit. The mass spectrometer was operated in positive ionization mode with the following parameters: injection volume of 5µl, curtain gas flow at 40 psi, turbo heater temperature at 400°C, nebulizing

104 Texas Tech University, Neill Kim, May 2020 gas at 45 psi, heating gas at 45 psi, and ion spray voltage at 5500 eV. Quantification of analytes were monitored in MRM mode as follows: naringenin chalcone m/z 273 > 153 (CE, 37 V and DP, 66 V), m/z 273 > 147 (CE, 29 V and DP, 66 V), m/z 273 > 119 (CE, 61 V and DP, 66 V), atropine internal standard m/z 290 > 124 (CE, 35 V and DP, 51 V). Quantifications were carried out based on a standard curve as previous described. The Q1 and Q3 quadrupoles were maintained at unit resolution.

4.5.9 Thrombin cleavage

A Thrombin kit (Novagen) was used to cleave the affinity tag used during purification, according to manufacturer’s protocol. Serial dilutions of 1:25 and 1:100 of thrombin were made containing approximately 0.04 and 0.01 U enzyme per µl. In a sterile Eppendorf tube was combined 5µl of 10X Thrombin Cleavage/Capture Buffer, 10µg of target protein, 1µl of diluted thrombin, and DI water brought up to 50µl. The different reactions were incubated at 4°C and 20°C for 8h or 16h. The extent of cleavage was determined via SDS-PAGE analysis on a 12% acrylamide gel.

4.5.10 Crystallization of AbPYKS and EcPYKS2

Crystals of AbPYKS grew in well D3 of the Morpheus crystallization screen (Molecular Dimensions) using a 96-well hanging-drop vapor diffusion plate setup with 100 microliter reservoirs, 210 nanoliter drop volumes, 1:1 ratio of protein to reservoir solutions and incubated at 4°C. The well solution consisted of 0.12 M alcohol mix (0.2M 1,6-Hexanediol; 0.2M 1-Butanol 0.2M 1,2-Propanediol; 0.2M 2-Propanol; 0.2M 1,4-Butanediol; 0.2M 1,3-Propanediol ), 0.1 M Buffer System 1 (Imidazole - MES monohydrate (acid), pH 6.5) and 30% v/v Precipitant Mix 3 (40% v/v Glycerol; 20% w/v PEG 4000 ).

Crystals of EcPYKS2 grew in well B12 of the JCSG-plus Eco crystallization screen (Molecular Dimensions) using a 96-well hanging-drop vapor diffusion plate setup with 100 microliter reservoirs, 210 nanoliter drop volumes, 1:1 ratio of protein to reservoir solutions and incubated at 4°C. The well solution consisted of 0.2M Potassium citrate tribasic monohydrate and 20 % w/V PEG 3350. Prior to flash-freezing in liquid

105 Texas Tech University, Neill Kim, May 2020 nitrogen, were cryoprotected using mother liquor plus 15% glycerol. An additional cryoprotection step was not used on AbPYKS crystals.

X-ray diffraction data for AbPYKS crystals were collected at 100 K on Beamline 4.2.2 of the Advanced Photon Source, processed with iMOSFLM280 and scaled with AIMLESS281 within theCCP4 software suite. X-ray diffraction data for EcPYKS2 crystals were collected at 100 K on Beamline 4.2.2 of the Advanced Light Source. Datasets were processed with XDS282 and scaled with AIMLESS within the/or CCP4 software suite. The crystal structures of AbPYKS and EcPYKS2 were solved by molecular replacement with the alfalfa CHS crystal structure (PBD ID code 1BI5)37 using the program Phaser.283 Model building and refinement were carried out using PHENIX autobuild284 and phenix.refine.285 Coot286 was used for graphical map inspection and manual refinement of coordinates. MolProbity was used for structural validation.287

4.5.11 Transient expression of N. benthamiana

The transient expression experiments were performed at Michigan State University by the Barry Lab as previously reported.233

106 Texas Tech University, Neill Kim, May 2020

CHAPTER 5

PYKS IN P. GRANATUM

5.1 Introduction

As stated above, the biosynthesis of granatane alkaloids has not been fully elucidated. There are three hypothetical pathways that lead to the formation of the N- methyl-9-azabicyclo[3.3.1]-nonane core scaffold (Scheme 6). The similar structures between tropane and granatane alkaloids gives rise to these hypothetical pathways. The difference of one carbon atom in the bicyclic scaffold separates these natural products. In tropane alkaloid biosynthesis, a non-canonical type III polyketide synthase (PYKS) is involved in a polyketide formation that will subsequently be combined with the five- membered N-methyl-∆1-pyrrolinium cation to form a polyketide intermediate. Because of this, it is hypothesized that a similar non-canonical type III polyketide synthase enzyme is also involved in the polyketide formation that undergoes a similar reaction to the tropane alkaloids PYKS. This polyketide intermediate will then go on to cyclize with the aid of another cyclization enzyme. Putative type III PYKS enzymes were selected from an in-house database.

It remains unknown which hypothetical pathway is correct. However, it is plausible for a type III PKS to be involved in each of the hypotheses. The formation of the first six-membered ring is unclear. Specifically, whether or not the nitrogen is methylated before or after the PYKS enzyme is involved. In tropane alkaloid biosynthesis the nitrogen atom is methylated in the first ring structure, before the PYKS enzyme is involved. It is plausible that this is the also case for granatane alkaloids. However there have been reports of both cases, unmethylated and methylated nitrogen atoms, found through radiolabeled feeding studies.134-140 What is known is that in all three hypotheses the N-methyl groups origin is via labeled methionine.139 The methyl donor for this incorporation biochemically would be S-adenosylmethionine (SAM). Additionally, radioactive acetate was found to be incorporated into granatane alkaloids regardless of which species was fed. This provides further evidence about the possible involvement of a type III PKS enzyme in granatane alkaloid biosynthesis.

107 Texas Tech University, Neill Kim, May 2020

5.2 Results

5.2.1 Sequence analysis of putative P. granatum genes

The full-length open reading frames (ORFs) of five different type III PKS genes were cloned from the from the cDNA of P. granatum seedling root tissue. The ORF of the putative genes are ~ 1.2 kb. Interestingly, PgPKS1 shares a 92% amino acid sequence identity with EcCHS and an 88% amino acid sequence identity with AbCHS (A. belladonna). This grouping gives a strong indication that PgPKS1 may in fact be a chalcone synthase enzyme, producing naringenin chalcone, instead of the atypical type III PKS predicted. In order to verify this, activity assays will need to be conducted (Figure 31). Additionally, PgPKS2 (also labeled or seen as Pg5181) shares an 86% amino acid sequence identity with EcCHS and an 89% amino acid sequence identity with AbCHS. Furthermore, PgPKS2 shares an 88% amino acid sequence identity with PgPKS1. This also suggests that PgPKS2 may be another chalcone synthase enzyme. Pg9725 and Pg11277 share a 62% amino acid sequence identity to one another but less than 41% identity with all other genes. Pg22277 shares ~55-60% identity with all other genes. This gives a better understanding about the relationship these genes have with one another as well as with other type III PKS genes. Pg22277 appears to be the best candidate out of the five genes.

108 Texas Tech University, Neill Kim, May 2020

Figure 31. Unrooted phylogeny tree of known type III PKSs, including P. granatum, across different families and species. The sequences were aligned using the CLUSTAL X alignment program with standard protein alignment settings. Visualization was done through FigTree with numbers at each node representing bootstrap values. Scale on the bottom represents the number of amino acid substitutions per site.

5.2.2 Cloning, expression and purification of putative PgPYKS candidates

Biochemically characterized type III polyketide synthase sequences were used as the query during a tBLASTn search on an in-house transcriptome database. The results generated a list of six possible candidate genes. Of those six, one gene was too short to be a typically PYKS by over one hundred amino acids. This left five other putative genes that encode for the enzyme of interest. The total RNA of P. granatum root bark was then extracted following the protocol reported by Ono et al.288 The mRNA was then transcribed into cDNA through RT-PCR (SuperScript II, Invitrogen) and

109 Texas Tech University, Neill Kim, May 2020 candidate genes were amplified from this cDNA using gene specific primers designed through VectorNTI and visualized on a 1% agarose gel (Figure 32) (Table 10).

Figure 32. 1% agarose gel of cDNA amplification of putative PgPYKS genes. Order of lanes: ladder, Pg22277, Pg9725, Pg11277, (+) control PgLDC, (-) control water.

Table 10. List of primer sequences used for cDNA amplification of candidate PgPYKS genes.

PgPYKS Primer sequence 5‘3‘ candiate genes Pg22277 FWD ATGGAGATCAAAATCCAGGAAGGG Pg22277 REV CTAGTTAGGAATTGGATCAGTGGGGA Pg11277 FWD ATGGCTCCTCCTCGCGGCGA Pg11277 REV TCAGACGGTGAGGTTTCTTGCAAGAATACC Pg9725 FWD ATGTCGGCAAACGGGAGCAAT Pg9725 REV TCAGTAGAGGCTTCGCATGAGGATG

PgPYKS candidates were then cloned into maintenance and expression vectors though the Gateway cloning system (Figure 33). This method allows for easy cloning, combining, and transferring of DNA segments between different expression systems while maintaining the ORF and orientation of fragments.289 First, the attB sites are added to the 5’ and 3’ end of the gene. Along with the attB sites, a thrombin cleavage tag (L-V-P-R-G-S) is also added to the 5’ end of the ORF and can be used later to remove any affinity purification tags of expressed protein. Due to the long sequence of

110 Texas Tech University, Neill Kim, May 2020 the attB sites and the thrombin cleavage tag two rounds of PCR are needed, with the second-round primers overlapping the first round. After the addition of the attB sites for the gateway system, the gene of interest can now be inserted into the pDONR207 donor vector via the Gateway BP Clonase II enzyme (Invitrogen) in a BP reaction. What was once attB sites flanking the gene of interest now becomes attL sites. The gene can now be placed into a pH9GW or pEP-Strep expression vector via the Gateway LR Clonase II enzyme (Invitrogen) in an LR reaction. These attL sites finally become the attR sites to generate the expression vector. PgPKS1 and PgPKS2 were purchased from GenScript and sent in a pUC57 vector that was then transformed into the pEP- Strep vector for heterologous expression.

Figure 33. Overview of the Gateway cloning system and the addition of attB sites (green) with the thrombin cleavage site (yello) upstream of the ORF.

Genes in the pH9GW vector were then heterologously expressed in E. coli BL21(DE3) cells and genes in the pEP-Strep vector were heterologously expressed in K. phaffii (formerly Pichia pastoris) KM71 cells. Proteins expressed in E. coli were purified via HisTag affinity chromatography and proteins expressed in K. phaffii were purified via StrepTag affinity chromatography. Eluted fractions containing the protein of interest were then desalted using a HiTrap desalting column. The concentrations of the desalted enzyme were then determined by Bradford assay.290 Proteins were then analyzed via SDS-PAGE and yielded bands corresponding to the correct size of ~43 kDa (Figure 34).

111 Texas Tech University, Neill Kim, May 2020

Figure 34. SDS-PAGE of PgPKS1 pEP-Strep ran on a 12% acrylamide gel. Order of lanes: crude, flow through, wash, fraction 22, 23, 24, 25, 26, 27. Molecular weight of protein is ~43 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run, not desalted, ran at 150V.

Unfortunately, not all candidate PgPYKS proteins were soluble. Of all the candidates, only PgPKS1 was soluble and capable of being purified. The other candidates were only observed in the pellet of the lysate (Figure 35). There are multiple reasons this may happen. One plausible reason is that the protein grew too quickly and was not able to fold properly thus forming aggregating inclusion bodies. One way to solve this was using Arctic Express (DE3) cells in which the temperature is reduced to slow the growth rate. Along with this, the IPTG concentration was also decreased to as low as 0.1mM. However, none of this had an effect on the inclusion bodies. Another possibility is codon bias between prokaryotes and eukaryotes. Because the expressed protein originates from a eukaryote, the prokaryote “host” that is expressing the protein may not possess the necessary codons. To solve this issue, Rosetta (DE3) cells were used enhance the expression of eukaryotic proteins that contain codons rarely used in E. coli. Unfortunately, this method of expression was also unsuccessful. Candidates were also unsuccessfully grown in K. phaffii, even when multiple transformations were tested via colony PCR and expressed separately (Figure 36).

112 Texas Tech University, Neill Kim, May 2020

Figure 35. SDS-PAGE of PgPYKS2 BL21(DE3) ran on a 12% acrylamide gel. Order of lanes: crude, pellet, flow through, wash, ladder, fractions 12, 13, 14, 15, 16, 17, 18. Molecular weight of protein is ~46 kDa. Gel represents fractions collected from a HisTag affinity chromatography run, not desalted, ran at 150V.

Figure 36. Colony PCR of Pg22277 pEP-Strep ran on a 1% agarose gel. Colonies were selected from yeast transformation. Size of gene of interest is 1.4 kb. Order of lanes: ladder, lanes 1-11 are separate Pg22277 colonies, (+) control EcPYKS2, (-) control water.

5.2.3 Kinetic analysis of PyPYKS candidates

The first candidate to be tested for PYKS activity was PgPKS1. This was the only candidate that was soluble and purified without any issues. PgPKS1 was subjected to standard PYKS assay conditions consisting of 100mM Tris-HCl buffer (pH 8.0), 200µM malonyl-CoA, BSA, an atropine internal standard, and 1ng of total enzyme in a

113 Texas Tech University, Neill Kim, May 2020

50µl reaction volume. However, when PYKS assays were carried out and analyzed via LC/MS/MS there was no 3-oxoglutaric acid formation. These unusual results along with phylogeny tree analysis (Figure 31) prompted the set-up of a CHS assay. The standard CHS assay consists of 100mM potassium phosphate buffer (pH 8.0), 100µM p- coumaroyl-CoA, 200µM malonyl-CoA, BSA, an atropine internal standard, and 1ng of total enzyme in a 50µl reaction volume. The reaction mixture was then subjected to LS/MS analysis. Interestingly, naringenin chalcone was detected when a CHS assay was performed on the PgPKS1 enzyme (Figure 37). Therefore, this enzyme is not the non- canonical type III PKS previously hypothesized but, in fact, a typical CHS enzyme used by the plant for flavonoid biosynthesis. Due to limited time, this enzyme was not fully biochemically characterized as it was not the enzyme of interest.

Figure 37. LC/MS-XIC of a CHS enzyme assay using PgPKS1 that generates naringenin chalcone, performed in positive mode, when compared to the standard.

Although the other candidate enzymes were not entirely soluble, partial purification of proteins was achieved (Figure 38). PgPYKS2 pEP-Strep that was in the K. phaffii expression cell line was partially soluble therefore able to purify. Bradford assays could not be conducted accurately due to low protein concentrations of the samples. SDS-PAGE electrophoresis was performed on select samples and showed

114 Texas Tech University, Neill Kim, May 2020 light-faint bands when stained with Colloidal Coomassie staining solution, which has a detection limit of ~10ng of total protein. Enzyme assays were then carried out using the maximum amount of enzyme possible without exceeding the reaction volume. Standard PYKS assays and CHS assays were set up simultaneously and left at room temperature to incubate overnight. The reactions were then subjected to LC/MS/MS analysis. Unfortunately, there was no activity detected for either assay. It is unclear whether no product was detected due to low protein concentration, inactive enzyme caused during purification or expression, or if this candidate is simply not a type III polyketide synthase enzyme involved in this type of reaction.

Figure 38. SDS-PAGE of PgPYKS2 pEP-Strep K. phaffii ran on a 12% acrylamide gel. Order of lanes: crude, flow through, wash, ladder, fractions 18, 19, 20, 21, 22, pellet. Molecular weight of protein is ~46 kDa. Gel represents fractions collected from a StrepTag affinity chromatography run, not desalted, ran at 150V.

5.3 Materials and methods

5.3.1 Plant materials

Plants were grown under a 12-h-light/12-h-dark photoperiod at 22°C with humidity at 65% and 70% respectively. Seeds and seedlings were obtained through the USDA. The pulp surrounding the seed was removed and germinated in Perlite. Seedlings were approximately two months old and mature root samples were taken from a one-year old P. granatum plant grown in a hydroponic system.

115 Texas Tech University, Neill Kim, May 2020

5.3.2 Total RNA extraction of Punica granatum root bark

Extraction was performed according to the protocol of Jaakola et al.288, 291 Root bark was harvested and placed immediately in liquid nitrogen to grind plant material into a fine powder using a mortar and pestle. Heat 7.5 ml of extraction buffer (2% hexadecyltrimethylammonium bromide (CTAB), 2% polyvinylpyrrolidone (PVP, Mol WT 360,000), 100mM Tris-HCl (pH 8.0), 25mM EDTA, 2M NaCl, 0.5g/L spermidine; autoclaved buffer and add 2% β-mercaptoethanol before use) to 65°C. Transfer 100- 120mg of powdered plant material into cold 1.5ml Eppendorf tubes and keep on ice (10 tubes total). Add 750µl of heated extraction buffer to tubes and mix by inverting. Incubate tubes at 65°C for 10 min while vortexing briefly throughout incubation process. Centrifuge tubes for 10 min at 10,000 g at 4°C. Decant supernatant into fresh tube. Perform two extractions using chloroform and isoamyl alcohol (IAA) at a ratio of 24:1 and centrifuge at 13,000 rpm at room temperature. Add one-fourth the volume of 10M LiCl (autoclaved) to supernatant and gently mix. Rest tubes on ice at 4°C overnight to precipitate RNA.

Centrifuge tubes at 18,000 g for 20 mins at 4°C the next day. Decant supernatant into waste and remove as much supernatant from pellet as possible. Wash pellet with 500µl of 70% cold ethanol, centrifuge tubes and decant supernatant. Repeat the washing steps until the dark supernatant becomes clear. Dissolve pellets in 100µl of SSTE buffer (1.0M NaCl, 0.5% SDS, 10mM Tris-HCl (pH 8.0), 1mM EDTA (pH 8.0); autoclave before use) and combine all RNA samples into two fresh tubes. Pellets may be heated to 65°C to help it dissolve. Extract contents of tubes with equal volume of a mixture of phenol, chloroform, IAA mixture at a ratio of 25:24:1. Then extract once again with an equal volume using the chloroform and IAA mixture used earlier. Add two volumes of 100% cold ethanol to the supernatant and precipitate at -20°C for 2 hours or -70°C for 30 min. Centrifuge tubes at 18,000 g for 20 min at 4°C. Wash pellet with 70% cold ethanol and dry in speed vac for 30-60 s. Resuspend final RNA pellet in DEPC-treated water or autoclaved DI water

116 Texas Tech University, Neill Kim, May 2020

5.3.3 cDNA synthesis

In a sterile PCR tube was added the following: 1µl 50uM Oligo dT, 1µl 10mM dNTP mix, up to 11µl RNA (2ng-5µg total RNA) and filled to the total volume of 13µl using autoclaved DI water. Heat contents at 65°C for 5 min followed by chilling on ice for 1 min. Ensure that the 5X SSII (SuperScript II, Invitrogen) buffer is thoroughly mixed. In a separate PCR tube, add the following: 4µl 5X SSII buffer, 1µl 100mM DTT, 1µl of SSII RT, and 1µl of RNaseOUT (Invitrogen). Mix by centrifugation. Add the RT reaction mixture to the annealed RNA and incubate combined tubes for 10 min at 55°C. Inactivate the reaction by incubating at 80°C for 10 min. cDNA is stored at - 20°C until ready for use.

5.3.4 PCR amplification of candidate genes from cDNA

Using the first strand cDNA and gene specific primers, PCR amplifications of candidate genes were performed. Gene specific primers were designed through VectorNTI with primer annealing temperatures at around 55°C. PCR tubes contain: 1µl template cDNA, 1µl 10mM forward primer, 1µl 10mM reverse primer, 1µl 10mM dNTP mix, 5µl 10X PCR buffer (200mM Tris-HCl (pH 8.0), 100mM KCl, 100mM

(NH4)SO4, 1mg/ml nuclease free BSA, 1% Triton X-100, 20mM MgSO4), 3µl PFU polymerase, 37µl PCR water. The thermocycler conditions were set as follows: 96°C for 2 min; 30 cycles of 96°C for 30 s, 55°C for 30 s, 72°C for 2 min; 72°C for 7 min. PCR products may be stored at 4°C until ready for use.

5.3.5 Colony PCR of K. phaffii

Colony PCR was performed on transformed K. phaffii colonies. Isolated colonies were resuspended PCR tubes containing 10µl of 0.02M NaOH and boiled at 96°C for 10 min and centrifuged until a pellet is visible. 1µl of the supernatant was used as the template for PCR. For PCR, each tube contains 1µl of template, 0.5µl of 10mM forward primer, 0.5µl of 10mM reverse primer, 0.5ul of 10mM dNTP mix, 1µl Taq polymerase (added last), 4µl GoTaq buffer (Promega), and 12.5µl DI water.

117 Texas Tech University, Neill Kim, May 2020

Thermocycler setting was as follows: 96°C for 2 min, 30 cycles of (96°C for 30 sec, 55°C for 30 sec, 72°C for 2 min), and 72°C for 7 min. 10µl of PCR product was loaded directly onto a 1% agarose gel and ran at 100V for ~ 45 min. Gels were then visualized through a white/dual UV Transilluminator photoimager (VWR, US) set at 302 nm. The size of all putative PYKS enzymes are ~ 1.5 kb.

5.3.6 Chemical competent transformations

E. coli TOP10 chemically competent cells were placed on ice to thaw. Approximately 100ng of the plasmid of interest was added to thawed cells and gently stirred using the pipette. Cells were then left on ice to incubate for 10 min then subjected to heat shock via a water bath at 42°C for 30-45 s. Cells were then placed back on ice to incubate and after 2 min, 250µl of cold SOC media was added. The transformed cells were then placed in a 37°C incubator to shake for 1 h then plated on LB agar plates with their respective antibiotics.

5.3.7 Electrocompetent transformations of K. phaffii cells

K. phaffii electrocompetent cells were placed on ice to thaw. 5µl of a plasmid (approximately 100 ng/µl) in the pEP-Strep vector was added to 38µl of the thawed cells and gently mixed using the pipette. The mixture was then incubated on ice for 5 min then transferred to a chilled 1mm gap electroporation cuvette. The cells were then pulsed on a MicroPulser Electroporator (Bio-Rad) at 1.5 kV, 200 Ω, 2 µF ensuring no “popping” or “arcing” occurred. Immediately afterwards, 1ml of cold 1M sorbitol was added to the cells and transferred into a fresh 2ml Eppendorf tube. The cells were then regenerated by incubating at 30°C for 2 h. The transformed cells were then plated on YPD agar (yeast, peptone, dextrose) plates, supplemented with 100 µg/ml Zeocin (InvivoGen), and incubated for 2-3 days at 30°C.

5.3.8 E. coli protein expression and purification

Plasmids in the pH9GW vector were expressed in BL21(DE3) (Invitrogen) cells. Appropriate plasmids were transformed into chemically competent BL21(DE3)

118 Texas Tech University, Neill Kim, May 2020 cells and a starter culture was made in a culture tube consisting of 5ml of LB media, 5µl of 50mg/ml kanamycin antibiotic (selection marker for the pH9GW vector), and a single isolated colony. The starter culture was then placed in a 37°C incubator with shaking at 250 rpm to grow overnight. A 2.8-liter Fernbach was used for the bacterial expression and consists of 500ml LB media, 500µl kanamycin, and 5ml of the starter culture. The

Fernbach was placed in a 37°C incubator with shaking at 200 rpm until an OD600 of 0.4- 0.6 was reached. Once the OD was reached, the flask was set on the benchtop to rest for 20 min before IPTG was added at a final concentration of 0.5mM. The cells were then grown further overnight at 18°C with shaking at 200 rpm and pellets were harvested by centrifugation at 4,700 g for 15 min at 4°C. Pellets can be stored at -20°C for several months or purified immediately.

For protein purification, cells were resuspended in loading buffer (50mM potassium phosphate (pH 7.4), 500mM NaCl, 5mM imidazole, 10% glycerol) then lysed using a pressure cell homogenizer (Avestin EmulsiFlex-C3). The lysate was then centrifuged at 15,000 g for 15 min at 4°C and the soluble protein was loaded onto a HisTrap FF crude 1ml nickel column using an FPLC system (Äkta pure). The flow rate was set at 1 ml/min and equilibration of column was carried out with 5 column volumes of loading buffer. The protein was the loaded onto the column then washed with 10 column volumes of loading buffer. The recombinant protein was first eluted with 5 column volumes of 5% elution buffer (50mM potassium phosphate (pH 7.4), 500mM NaCl, 500mM imidazole, 10% glycerol), then eluted with 5 column volumes of 100% elution buffer. Fractions containing the protein of interest was determined through the absorbance seen at 280nm. The purified protein is then loaded onto a 5ml HiTrap

Desalting column (GE Life Sciences) and eluted using 100mM Tris-HCl pH 8 containing 15% glycerol and 5mM DTT. Proteins can be stored at -20°C for up to six months without noticeable degradation in enzyme activity.

The total protein concentration was determined via Bradford assay (Bio-Rad) according to manufacturer’s protocol.290 Proteins were then visually analyzed through SDS-PAGE electrophoresis on a 12% acrylamide gel ran at 150 V with approximately

119 Texas Tech University, Neill Kim, May 2020

100ng of total protein loaded onto each lane. The protein gels were then stained with Colloidal Coomassie staining solution overnight with gentle shaking. The gels were then triple rinsed with DI water before adding the Destaining solution and shaking gently for 1 h.

5.3.9 K. phaffii protein expression and purification

Plasmids in the pEP-Strep vector were transformed into the K. phaffii (formerly Pichia pastoris) KM71 cell line. A pre-starter culture was made from transformed cells by combining 2ml of YPD media, 2µl of 100 µg/ml Zeocin (InvivoGen), and an isolated colony in a sterile culture tube. The pre-starter culture was then placed in a 30°C incubator to shake at 250 rpm overnight. A 50ml starter culture is then made in a 250ml baffled flask by combining 50ml of YPD media, 50µl of 100 µg/ml Zeocin (InvivoGen), and the 2ml overnight culture and placed in a 30°C incubator to shake at 250 rpm overnight. The next day in a 2.8L Fernbach, 500ml of BMMY media (5g yeast extract, 10g peptone, 50ml 1M potassium phosphate (pH 6.0), 50ml 10X Yeast Nitrogen Base with ammonium sulfate and without amino acids, 1ml 500X biotin, 5ml 100% methanol) was inoculated with 50ml of the starter culture supplemented with 100 µg/ml Zeocin (InvivoGen) and placed in a 30°C incubator to shake at 200 rpm for 2-3 days. Methanol was added twice a day to a final concentration of 1% (v/v) to induce protein expression. The cells were then harvested by centrifugation at 4,700 g for 10 min at 4°C and pellets were stored in -20°C until ready for purification.

For protein purification, cells were resuspended in a buffer containing 100mM Tris-HCl (pH 8.0), 150mM NaCl, 1mM EDTA (pH 8.0), and 5mM DTT then lysed using a pressure cell homogenizer (Avestin EmulsiFlex-C3). The lysate was then centrifuged at 15,000 g for 15 min at 4°C and the soluble protein was loaded onto a Strep-Tactin superflow column (IBA Lifesciences) using an FPLC (Äkta pure) system. The rate of the system was set to 5ml/min and equilibration of the column was carried out using 5 column volumes of the resuspension buffer. The sample was loaded onto the column after equilibration and washed with 10 column volumes of the resuspension

120 Texas Tech University, Neill Kim, May 2020 buffer. The recombinant protein was eluted using 100mM Tris-HCl (pH 8.0) supplemented with 150mM NaCl, 1mM EDTA, and 2.5mM desthiobiotin. Fractions containing the protein of interest was determined through the absorbance seen at 280nm. The purified protein is then loaded onto a 5ml HiTrap Desalting column (GE Life

Sciences) and eluted using 100mM Tris-HCl pH 8 containing 15% glycerol and 5mM DTT. Proteins can be stored at -20°C for up to six months without noticeable degradation in enzyme activity.

The total protein concentration and SDS-PAGE electrophoresis protocols were carried out as mentioned above.

5.3.10 Enzyme assay conditions for PYKS assay and kinetic analysis

The assay parameters were selected in which the reaction velocity is linear with respect to enzyme concentration and incubation time for all enzyme assays performed. Standard PYKS activity assays were performed in 50µl reaction volumes consisting of 100mM Tris-HCl (pH 8.4), 200µM malonyl-CoA, 10mg/ml bovine serum albumin (BSA), 1µg/ml atropine as the internal standard, and 1ng of total enzyme. All enzyme assays were incubated at standard room temperature for 15 min and quenched with 2M HCl (1:10 v/v). In order to determine the pH optimum, standard PYKS activity assay conditions were used with the exception of buffer; 100mM phosphate citrate for pH 4.0- 7.0, 100mM Tris-HCl for pH 7.1-9.0, or 100mM NaOH-glycine for pH 9.1-10.5. The kinetic parameters were determined using standard assay conditions with varying amounts of malonyl-CoA (20µM-200µM) in a 50µl reaction volume. Assays were incubated at standard room temperature for 15 min using 1ng of recombinant enzyme and quenched with 2M HCl (1:10 v/v). The assays were then subjected to LC/MS/MS analysis 10 min after quench.

Enzyme assays were analyzed by liquid chromatography-ion trap MS using a 1200 series HPLC device (Agilent Technologies) coupled to a 4000 QTRAP® (AB SCIEX) ESI-Ion Trap mass spectrometer equipped a turbo ion source using a Nucleodur Sphinx RP column (250 X 4.6mm, 5 µm; Macherey-Nagel). Elution was achieved in 15 121 Texas Tech University, Neill Kim, May 2020 min at 25°C with a flow rate of 0.8ml/min using 0.2% (v/v) formic acid in water (solvent A) and 0.5% (v/v) formic acid in acetonitrile (solvent B) as the mobile phase with the following gradient: 98% A (3 min), 50% A (7 min), 10% A (7.1 min), 10% A (10 min), 90% A (10.1 min), 98% A (13 min), 98% A (15 min). The flow coming from the column was split in a 4:1 ratio before reaching the ion source. The mass spectrometer was operated in positive mode with the following parameters: injection volume of 5µl, curtain gas flow at 50 psi, turbo heater temperature at 450°C, nebulizing gas at 50 psi, heating gas at 50 psi, and ion spray voltage at 5500 eV. Quantification of analytes were monitored in MRM mode as follows: 3-oxoglutaric acid m/z 147 > 129 (CE, 9V and DP, 26V), atropine (internal standard) m/z 290 > 124 (CE, 35V and DP, 51V), and 4- (1-methyl-2-pyrrolidinyl)-3-oxobutanoate m/z 186.1 > 84 (CE, 29 V and DP, 51 V). Quantifications were carried out based on a standard curve as previously described233, replacing their internal standard with atropine. The Q1 and Q3 quadrupoles were maintained at unit resolution and the DAD (diode array detector) was not used.

5.3.11 Enzyme assay conditions for CHS assay

The assay parameters were selected in which the reaction velocity is linear with respect to enzyme concentration and incubation time for all enzyme assays performed. Standard CHS activity assays were performed in 50µl reaction volumes consisting 100mM potassium phosphate buffer (pH 8.0), 100µM p-coumaroyl-CoA, 200µM malonyl-CoA, 10mg/ml bovine serum albumin (BSA), 1µg/ml atropine as the internal standard, and 1ng of total enzyme. All enzyme assays were incubated at standard room temperature for 15 min and quenched with 2M HCl (1:10 v/v). In order to determine the pH optimum, standard PYKS activity assay conditions were used with the exception of buffer; 100mM phosphate citrate for pH 4.0-7.0, 100mM Tris-HCl for pH 7.1-9.0, or 100mM NaOH-glycine for pH 9.1-10.5. The pseudo-first order kinetic parameters were determined using standard assay conditions in a 50µl reaction volume with varying amounts of malonyl-CoA (20µM-200µM) while p-coumaroyl-CoA concentration was held at 180µM and vice versa. Assays were incubated at standard room temperature for

122 Texas Tech University, Neill Kim, May 2020

15 min using 1ng of recombinant enzyme and quenched with 2M HCl (1:10 v/v). The assays were then subjected to LC/MS/MS analysis 10 min after quench.

Enzyme assays were analyzed by liquid chromatography-ion trap MS using a 1200 series HPLC device (Agilent Technologies) coupled to a 4000 QTRAP® (AB SCIEX) ESI-Ion Trap mass spectrometer equipped a turbo ion source using a Nucleodur Sphinx RP column (250 X 4.6mm, 5 µm; Macherey-Nagel). Elution was achieved in 12 min at 30°C with a flow rate of 1.0ml/min using 0.2% (v/v) formic acid in water (solvent A) and 0.5% (v/v) formic acid in acetonitrile (solvent B) as the mobile phase with the following gradient: 90% A (3 min), 20% A (6 min), 90% A (12 min). The flow coming from the column was split in a 4:1 ratio before reaching the ion source. The mass spectrometer was operated in positive mode with the following parameters: injection volume of 5µl, curtain gas flow at 40 psi, turbo heater temperature at 400°C, nebulizing gas at 45 psi, heating gas at 45 psi, and ion spray voltage at 5500 eV. Quantification of analytes were monitored in MRM mode as follows: naringenin chalcone m/z 273 > 153 (CE, 37V and DP, 66V) and atropine (internal standard) m/z 290 > 124 (CE, 35V and DP, 51V). Quantification were carried out based on a standard curve using manual integration within the Analyst Software (AB Sciex). The Q1 and Q3 quadrupoles were maintained at unit resolution and the DAD (diode array detector) was set at 288nm to measure for naringenin chalcone.

5.4 Conclusion

The elucidation of granatane alkaloid biosynthesis remains puzzling. While there are many putative genes to test, we have yet to characterize an enzyme involved in the pathway. One main issue is the expression and solubility of these enzymes. Others in the D’Auria lab have attempted to characterize other enzymes involved in the pathway but have run into similar issues. Enzymes that were able to undergo purification did not yield substantial concentrations or did not produce the correct activity. Understanding the pathway and taking a deeper look into the different enzymes involved will be a collective effort. Starting the elucidation at the beginning of the pathway will give us a better understanding of how the first heterocyclic ring is formed and whether 123 Texas Tech University, Neill Kim, May 2020 or not the N-methylation takes place before or after the involvement of a type III PKS enzyme. Additionally, granatane alkaloid biosynthesis is slowly being unraveled and candidate genes have been selected. These putative genes takes us one step closure into the elucidation of this pathway.

124 Texas Tech University, Neill Kim, May 2020

BIBLIOGRAPHY

1. Wink, M., A short history of alkaloids. In Alkaloids, Roberts, M. F.; Wink, M., Eds. Plenum Press: New York, 1998; pp 11-44. 2. Wink, M., Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective. Phytochemistry 2003, 64 (1), 3-19. 3. Dillehay, T. D.; Rossen, J.; Ugent, D.; Karathanasis, A.; Vasquez, V.; Netherly, P. J., Early Holocene coca chewing in northern Peru. Antiquity 2010, 84 (326), 939-953. 4. Kim, N.; Estrada, O.; Chavez, B.; Stewart, C.; D'Auria, J. C., Tropane and Granatane Alkaloid Biosynthesis: A Systematic Analysis. Molecules 2016, 21 (11). 5. Nocquet, P. A.; Opatz, T., Total Synthesis of (+/-)-Scopolamine: Challenges of the Tropane Ring. European Journal of Organic Chemistry 2016, 2016 (6), 1156-1164. 6. Hagel, J. M.; Facchini, P. J., Benzylisoquinoline alkaloid metabolism: a century of discovery and a brave new world. Plant Cell Physiol 2013, 54 (5), 647-72. 7. Ziegler, J.; Facchini, P. J., Alkaloid biosynthesis: metabolism and trafficking. Annual review of plant biology 2008, 59, 735-69. 8. Magallon, S.; Castillo, A., Angiosperm diversification through time. Am J Bot 2009, 96 (1), 349-65. 9. Niemann, A., Ueber eine neue organische Base in den Cocablättern. Archiv der Pharmazie 1860, 153 (3), 291-308. 10. Plowman, T.; Rivier, L., Cocaine and Cinnamoylcocaine Content of Erythroxylum Species. Ann Bot-London 1983, 51 (5), 641-659. 11. Naranjo, P., Social Function of Coca in Pre-Columbian America. Journal of Ethnopharmacology 1981, 3 (2-3), 161-172. 12. Plowman, T., Amazonian coca. J Ethnopharmacol 1981, 3 (2-3), 195-225. 13. Jirschitzka, J.; Schmidt, G. W.; Reichelt, M.; Schneider, B.; Gershenzon, J.; D'Auria, J. C., Plant tropane alkaloid biosynthesis evolved independently in the Solanaceae and Erythroxylaceae. Proceedings of the National Academy of Sciences of the United States of America 2012, 109 (26), 10304-9. 14. Schmidt, G. W.; Jirschitzka, J.; Porta, T.; Reichelt, M.; Luck, K.; Torre, J. C.; Dolke, F.; Varesio, E.; Hopfgartner, G.; Gershenzon, J.; D'Auria, J. C., The last step in cocaine biosynthesis is catalyzed by a BAHD acyltransferase. Plant Physiol 2015, 167 (1), 89-101. 15. Docimo, T.; Reichelt, M.; Schneider, B.; Kai, M.; Kunert, G.; Gershenzon, J.; D'Auria, J. C., The first step in the biosynthesis of cocaine in Erythroxylum coca: the characterization of arginine and ornithine decarboxylases. Plant Mol Biol 2012, 78 (6), 599-615. 16. Oberlies, N. H.; Paine, M. F., Pomegranates: Ancient Roots to Modern Medicine Edited by N. P. Seeram (University of California at Los Angeles), R. N. Schulman (Schulman Scientific Consulting), and D. Heber (University of California at Los Angeles). CRC Press/Taylor & Francis, Boca Raton. 2006. xv + 244 pp. 16 × 24 cm. $129.95. ISBN 0-8493-9812-4. American Chemical Society: 2007; Vol. 70, p 1222- 1222. 17. Chilton, J.; Partridge, M. W., The partition chromatography of alkaloids. Part III.--The alkaloids of Punica granatum. J Pharm Pharmacol 1950, 2 (11), 784-95. 125 Texas Tech University, Neill Kim, May 2020

18. Heß, G.; Haiss, P.; Wistuba, D.; Siehl, H.-U.; Berger, S.; Sicker, D.; Zeller, K.-P., Vom Granatapfelbaum zum Cyclooctatetraen. Chemie in unserer Zeit 2016, 50 (1), 34-43. 19. Khanna, K. L.; Schwarting, A. E.; Bobbitt, J. M., The occurrence of isopelletierine in Withania somnifera. J Pharm Sci 1962, 51, 1194. 20. Kang, T. H.; Pae, H. O.; Yoo, J. C.; Kim, N. Y.; Kim, Y. C.; Ko, G. I.; Chung, H. T., Antiproliferative effects of alkaloids from Sedum sarmentosum on murine and human hepatoma cell lines. J Ethnopharmacol 2000, 70 (2), 177-82. 21. Keating, G. M.; Duggan, S. T.; Curran, M. P., Transdermal Granisetron: A Guide to Its Use in Preventing Nausea and Vomiting Induced by Chemotherapy. Cns Drugs 2012, 26 (9), 787-790. 22. Austin, M. B.; Noel, J. P., The chalcone synthase superfamily of type III polyketide synthases. Nat Prod Rep 2003, 20 (1), 79-110. 23. Stewart, C., Jr.; Vickery, C. R.; Burkart, M. D.; Noel, J. P., Confluence of structural and chemical biology: plant polyketide synthases as biocatalysts for a bio-based future. Current opinion in plant biology 2013, 16 (3), 365-72. 24. Jez, J. M.; Ferrer, J. L.; Bowman, M. E.; Dixon, R. A.; Noel, J. P., Dissection of malonyl-coenzyme A decarboxylation from polyketide formation in the reaction mechanism of a plant polyketide synthase. Biochemistry 2000, 39 (5), 890-902. 25. Ebel, J.; Hahlbrock, K., Biosynthesis. In The Flavonoids, Harborne, J. B.; Mabry, T. J., Eds. Springer US: Boston, MA, 1982; pp 641-679. 26. Wurtzel, E. T.; Kutchan, T. M., Plant metabolism, the diverse chemistry set of the future. Science 2016, 353 (6305), 1232-6. 27. Ramirez-Tortosa, C.; Andersen, Ø. M.; Gardner, P. T.; Morrice, P. C.; Wood, S. G.; Duthie, S. J.; Collins, A. R.; Duthie, G. G., Anthocyanin-rich extract decreases indices of lipid peroxidation and DNA damage in vitamin E-depleted rats. Free Radical Biology and Medicine 2001, 31 (9), 1033-1037. 28. Li, R.; Kenyon, G. L.; Cohen, F. E.; Chen, X.; Gong, B.; Dominguez, J. N.; Davidson, E.; Kurzban, G.; Miller, R. E.; Nuzum, E. O.; et al., In vitro antimalarial activity of chalcones and their derivatives. J Med Chem 1995, 38 (26), 5031-7. 29. Yamaguchi, K.; Honda, H.; Wakisaka, C.; Tohei, A.; Kogo, H., Effects of phytoestrogens on acetylcholine- and isoprenaline-induced vasodilation in rat aorta. Jpn J Pharmacol 2001, 87 (1), 67-73. 30. Iwase, Y.; Takemura, Y.; Ju-ichi, M.; Mukainaka, T.; Ichiishi, E.; Ito, C.; Furukawa, H.; Yano, M.; Tokuda, H.; Nishino, H., Inhibitory effect of flavonoid derivatives on Epstein–Barr virus activation and two-stage carcinogenesis of skin tumors. Cancer Letters 2001, 173 (2), 105-109. 31. Edwards, M. L.; Stemerick, D. M.; Sunkara, P. S., Chalcones: a new class of antimitotic agents. J Med Chem 1990, 33 (7), 1948-54. 32. Herencia, F.; Ferrándiz, M. L.; Ubeda, A.; Guillén, I.; Dominguez, J. N.; Charris, J. E.; Lobo, G. M.; Alcaraz, M. J., Novel anti-inflammatory chalcone derivatives inhibit the induction of nitric oxide synthase and cyclooxygenase-2 in mouse peritoneal macrophages. FEBS Letters 1999, 453 (1-2), 129-134. 33. Zwaagstra, M. E.; Timmerman, H.; van de Stolpe, A. C.; de Kanter, F. J.; Tamura, M.; Wada, Y.; Zhang, M. Q., Synthesis and structure-activity relationships of

126 Texas Tech University, Neill Kim, May 2020

carboxyflavones as structurally rigid CysLT1 (LTD4) receptor antagonists. J Med Chem 1998, 41 (9), 1428-38. 34. Zwaagstra, M. E.; Timmerman, H.; Tamura, M.; Tohma, T.; Wada, Y.; Onogi, K.; Zhang, M. Q., Synthesis and structure-activity relationships of carboxylated chalcones: a novel series of CysLT1 (LTD4) receptor antagonists. J Med Chem 1997, 40 (7), 1075-89. 35. Kreuzaler, F.; Hahlbrock, K., Enzymatic synthesis of aromatic compounds in higher plants: Formation of naringenin (5,7,4′-trihydroxyflavanone) from p-coumaroyl coenzyme A and malonyl coenzyme A. FEBS Letters 1972, 28 (1), 69-72. 36. Lanz, T.; Tropf, S.; Marner, F. J.; Schroder, J.; Schroder, G., The role of cysteines in polyketide synthases. Site-directed mutagenesis of resveratrol and chalcone synthases, two key enzymes in different plant-specific pathways. J Biol Chem 1991, 266 (15), 9971-6. 37. Ferrer, J. L.; Jez, J. M.; Bowman, M. E.; Dixon, R. A.; Noel, J. P., Structure of chalcone synthase and the molecular basis of plant polyketide biosynthesis. Nat Struct Biol 1999, 6 (8), 775-84. 38. Chen, H.; Kim, H. U.; Weng, H.; Browse, J., Malonyl-CoA synthetase, encoded by ACYL ACTIVATING ENZYME13, is essential for growth and development of Arabidopsis. Plant Cell 2011, 23 (6), 2247-62. 39. Fatland, B. L.; Nikolau, B. J.; Wurtele, E. S., Reverse genetic characterization of cytosolic acetyl-CoA generation by ATP-citrate lyase in Arabidopsis. Plant Cell 2005, 17 (1), 182-203. 40. Pichersky, E.; Lewinsohn, E., Convergent evolution in plant specialized metabolism. Annual review of plant biology 2011, 62, 549-66. 41. Lounasmaa, M.; Tamminen, T., The tropane alkaloids. In The Alkaloids, Cordell, G. A., Ed. Academic Press: New York, 1993; Vol. 44, pp 1-114. 42. Lazny, R.; Ratkiewicz, A.; Nodzewska, A.; Wynimko, A.; Siergiejczyk, L., Determination of the N-methyl stereochemistry in tropane and granatane derivatives in solution: a computational and NMR spectroscopic study. Tetrahedron 2012, 68 (31), 6158-6163. 43. Wink, M., Modes of actions of alkaloids. In Alkaloids, Roberts, M. F.; Wink, M., Eds. Plenum Press: New York, 1998; pp 301-326. 44. Schmeller, T.; Sporer, F.; Sauerwein, M.; Wink, M., Binding of tropane alkaloids to nicotinic and muscarinic acetylcholine receptors. Pharmazie 1995, 50 (7), 493-5. 45. Shakeran, Z.; Keyhanfar, M.; Asghari, G.; Ghanadian, M., Improvement of atropine production by different biotic and abiotic elicitors in hairy root cultures of Datura metel. Turk J Biol 2015, 39 (1), 111-118. 46. Xia, K.; Liu, X. Q.; Zhang, Q. Z.; Qiang, W.; Guo, J. J.; Lan, X. Z.; Chen, M.; Liao, Z. H., Promoting scopolamine biosynthesis in transgenic Atropa belladonna plants with pmt and h6h overexpression under field conditions. Plant Physiology and Biochemistry 2016, 106, 46-53. 47. Qiang, W.; Xia, K.; Zhang, Q.; Zeng, J.; Huang, Y.; Yang, C.; Chen, M.; Liu, X.; Lan, X.; Liao, Z., Functional characterisation of a tropine-forming reductase gene from Brugmansia arborea, a woody plant species producing tropane alkaloids. Phytochemistry 2016, 127, 12-22.

127 Texas Tech University, Neill Kim, May 2020

48. Zhou, J. L.; Liu, W.; Guo, Z. X.; Chen, B. L., Fingerprint Analysis of Daturae Flos Using Rapid Resolution Liquid Chromatography-Electrospray Ionization Mass Spectrometry Combined with Stoichiometry. J Liq Chromatogr R T 2015, 38 (1), 137- 142. 49. Zeng, S. M.; She, Y. X.; Jiao, B. N.; Liu, G. Y.; Wang, J.; Su, X. S.; Ma, X. B.; Jin, M. J.; Jin, F.; Wang, S. S., Molecularly imprinted polymer for selective extraction and simultaneous determination of four tropane alkaloids from Przewalskia tangutica Maxim. fruit extracts using LC-MS/MS. Rsc Advances 2015, 5 (115), 94997-95006. 50. Zhang, P.; Li, Y.; Liu, G.; Sun, X.; Zhou, Y.; Deng, X.; Liao, Q.; Xie, Z., Simultaneous determination of atropine, scopolamine, and anisodamine from Hyoscyamus niger L. in rat plasma by high-performance liquid chromatography with tandem mass spectrometry and its application to a pharmacokinetics study. J Sep Sci 2014, 37 (19), 2664-74. 51. Mann, J., Murder, magic, and medicine. Oxford University Press: New York, 1992; p 232. 52. Carroll, F. I.; Gao, Y.; Abraham, P.; Lewin, A. H.; Lew, R.; Patel, A.; Boja, J. W.; Kuhar, M. J., Probes for the cocaine receptor. Potentially irreversible ligands for the dopamine transporter. J Med Chem 1992, 35 (10), 1813-7. 53. Carroll, F. I.; Lewin, A. H.; Boja, J. W.; Kuhar, M. J., Cocaine receptor: biochemical characterization and structure-activity relationships of cocaine analogues at the dopamine transporter. J Med Chem 1992, 35 (6), 969-81. 54. Sidorowicz, K.; Lazny, R., Structural studies of cyclic β-amino ketons using computational and NMR methods. CHEMIK 2015, 69 (7), 401-410. 55. Krunic, A.; Pan, D.; Dunn, W. J., 3rd; Mariappan, S. V., The stereochemistry of N- methyl and aryl substituents determine the biological activities of 3-aryl-8-methyl-8- azabicyclo[3.2.1]oct-2,3-enes. Bioorganic & medicinal chemistry 2009, 17 (2), 811-9. 56. Fozard, J., The peripheral actions of 5-hydroxytryptamine. Oxford University Press: Oxford, New York, 1989; p 410. 57. Aapro, M., Granisetron: an update on its clinical use in the management of nausea and vomiting. The oncologist 2004, 9 (6), 673-86. 58. Balfour, J. A.; Goa, K. L., Dolasetron. A review of its pharmacology and therapeutic potential in the management of nausea and vomiting induced by chemotherapy, radiotherapy or surgery. Drugs 1997, 54 (2), 273-98. 59. Van, N. J.; Hollstein, U., The anthelminthic activity of pelletierine and isopelletierine. Acta Physiol Pharmacol Neerl 1956, 5 (2), 212-3. 60. Van Noordwijk, J.; Mellink, J. J.; Visser, B. J.; Wisse, J. H., Synthesis and anthelmintic activity of isopelletierine and a series of side-chain homologues. Recueil des Travaux Chimiques des Pays-Bas 2010, 82 (8), 763-772. 61. Tripathi, S. M.; Singh, D. K., Molluscicidal activity of Punica granatum bark and Canna indica root. Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas / Sociedade Brasileira de Biofisica ... [et al.] 2000, 33 (11), 1351-5. 62. Tripathi, S. M.; Singh, V. K.; Singh, S.; Singh, D. K., Enzyme inhibition by the molluscicidal agent Punica granatum Linn. bark and Canna indica Linn. root. Phytother Res 2004, 18 (7), 501-6.

128 Texas Tech University, Neill Kim, May 2020

63. Chidiebere, M. A.; Ogukwe, C. E.; Oguzie, K. L.; Eneh, C. N.; Oguzie, E. E., Corrosion Inhibition and Adsorption Behavior of Punica granatum Extract on Mild Steel in Acidic Environments: Experimental and Theoretical Studies. Industrial & Engineering Chemistry Research 2012, 51 (2), 668-677. 64. Plowman, T., Botanical perspectives on coca. J Psychedelic Drugs 1979, 11 (1-2), 103-17. 65. Plowman, T.; Hensold, N., Names, types, and distribution of neotropical species of Erythroxylum (Erythroxylaceae). Brittonia 2004, 56 (1), 1-53. 66. Plowman, T., The ethnobotany of Coca (Erythroxylum spp., Erythroxylaceae). In Ethnobotany in the Neotropics, Prance, G. T.; Kallunki, J. A., Eds. New York Botanical Garden: New York, 1984; pp 62-111. 67. Freud, S., Ueber Coca. ZentrBl. Therapie 1884, 2, 289-314. 68. Schmidt, E.; Henschke, H., Über die Alkaloide der Wurzel von Scopolia japonica. Archiv der Pharmazie 1888, 226 (5), 185-203. 69. Bisset, N. G., Arrow and dart poisons. J Ethnopharmacol 1989, 25 (1), 1-41. 70. Schultes, R. E., Hallucinogenic plants – a golden guide. Golden Press: New York, 1976. 71. Geiger; Hesse, Darstellung des Atropins. Annalen der Pharmacie 1833, 5 (1), 43-81. 72. Mein, Darstellung des Atropins in weissen Krystallen. Annalen der Pharmacie 1833, 6 (1), 67-72. 73. Kim, J. H.; THart, H.; Stevens, J. F., Alkaloids of some Asian Sedum species. Phytochemistry 1996, 41 (5), 1319-1324. 74. Chauhan, R. D.; Kanwar, K., Biotechnological advances in pomegranate (Punica granatum L.). In Vitro Cell Dev-Pl 2012, 48 (6), 579-594. 75. Brachet, A.; Munoz, O.; Gupta, M.; Veuthey, J. L.; Christen, P., Alkaloids of Erythroxylum lucidum stem-bark. Phytochemistry 1997, 46 (8), 1439-1442. 76. Wink, M.; Botschen, F.; Gosmann, C.; Schfer, H.; Waterman, P. G., Chemotaxonomy Seen from a Phylogenetic Perspective and Evolution of Secondary Metabolism. In Biochemistry of Plant Secondary Metabolism, Wiley-Blackwell: 2010; pp 364-433. 77. Lazny, R.; Sienkiewicz, M.; Olenski, T.; Urbanczyk-Lipkowska, Z.; Kalicki, P., Approaches to the enantioselective synthesis of ferrugine and its analogues. Tetrahedron 2012, 68 (39), 8236-8244. 78. Brock, A.; Herzfeld, T.; Paschke, R.; Koch, M.; Drager, B., Brassicaceae contain nortropane alkaloids. Phytochemistry 2006, 67 (18), 2050-7. 79. Wink, M., Evolution of secondary metabolites in legumes (Fabaceae). South African Journal of Botany 2013, 89, 164-175. 80. Leete, E.; Marion, L.; Spenser, I. D., The Biogenesis of Alkaloids .12. The Mode of Formation of the Tropine Base of Hyoscyamine. Can. J. Chem.-Rev. Can. Chim. 1954, 32 (12), 1116-1123. 81. Liebisch, H. W.; Schütte, H. R., Zur Biosynthese der Tropanalkaloide .VIII. Vorstufen des Pyrrolidinringes. Zeitschrift für Pflanzenphysiologie 1967, 57 (5), 434-439. 82. Delauney, A. J.; Verma, D. P. S., Proline Biosynthesis and Osmoregulation in Plants. Plant J. 1993, 4 (2), 215-223.

129 Texas Tech University, Neill Kim, May 2020

83. Leete, E., Recent developments in the biosynthesis of the tropane alkaloids. Planta Med 1990, 56 (4), 339-52. 84. Leete, E., Stereospecific Incorporation of Ornithine into Tropine Moiety of Hyoscyamine. J Am Chem Soc 1962, 84 (1), 55-&. 85. Leete, E., Biosynthesis of the pyrrolidine rings of cocaine and cuscohygrine from [5- 14C]-labeled ornithine via a symmetrical intermediate. J Am Chem Soc 1982, 104 (5), 1403-1408. 86. Malmberg, R. L.; Watson, M. B.; Galloway, G. L.; Yu, W., Molecular genetic analyses of plant polyamines. Critical Reviews in Plant Sciences 1998, 17 (2), 199- 224. 87. Zhang, L.; Yang, B.; Lu, B.; Kai, G.; Wang, Z.; Xia, Y.; Ding, R.; Zhang, H.; Sun, X.; Chen, W.; Tang, K., Tropane alkaloids production in transgenic Hyoscyamus niger hairy root cultures over-expressing putrescine N-methyltransferase is methyl jasmonate-dependent. Planta 2007, 225 (4), 887-96. 88. Hibi, N.; Higashiguchi, S.; Hashimoto, T.; Yamada, Y., Gene expression in tobacco low-nicotine mutants. Plant Cell 1994, 6 (5), 723-35. 89. Galston, A. W.; Sawhney, R. K., Polyamines in plant physiology. Plant Physiol 1990, 94 (2), 406-10. 90. Hashimoto, T.; Tamaki, K.; Suzuki, K.; Yamada, Y., Molecular cloning of plant spermidine synthases. Plant Cell Physiol 1998, 39 (1), 73-9. 91. Suzuki, K.; Yamada, Y.; Hashimoto, T., Expression of Atropa belladonna putrescine N-methyltransferase gene in root pericycle. Plant Cell Physiol 1999, 40 (3), 289-97. 92. Nakajima, K.; Hashimoto, T., Two tropinone reductases, that catalyze opposite stereospecific reductions in tropane alkaloid biosynthesis, are localized in plant root with different cell-specific patterns. Plant and Cell Physiology 1999, 40 (11), 1099- 1107. 93. Leete, E., Spermidine - an Indirect Precursor of the Pyrrolidine Rings of Nicotine and Nornicotine in Nicotiana-Glutinosa. Phytochemistry 1985, 24 (5), 957-960. 94. Matsuzaki, R.; Fukui, T.; Sato, H.; Ozaki, Y.; Tanizawa, K., Generation of the topa quinone cofactor in bacterial monoamine oxidase by cupric ion-dependent autooxidation of a specific tyrosyl residue. FEBS Lett 1994, 351 (3), 360-4. 95. Heim, W. G.; Sykes, K. A.; Hildreth, S. B.; Sun, J.; Lu, R. H.; Jelesko, J. G., Cloning and characterization of a Nicotiana tabacum methylputrescine oxidase transcript. Phytochemistry 2007, 68 (4), 454-63. 96. Katoh, A.; Shoji, T.; Hashimoto, T., Molecular cloning of N-methylputrescine oxidase from tobacco. Plant Cell Physiol 2007, 48 (3), 550-4. 97. Hoye, T. R.; Bjorklund, J. A.; Koltun, D. O.; Renner, M. K., N-methylputrescine oxidation during cocaine biosynthesis: study of prochiral methylene hydrogen discrimination using the remote isotope method. Org Lett 2000, 2 (1), 3-5. 98. Romek, K. M.; Remaud, G. S.; Silvestre, V.; Paneth, P.; Robins, R. J., Non- statistical 13C Fractionation Distinguishes Co-incident and Divergent Steps in the Biosynthesis of the Alkaloids Nicotine and Tropine. J Biol Chem 2016, 291 (32), 16620-9. 99. Abraham, T. W.; Leete, E., New Intermediate in the Biosynthesis of the Tropane Alkaloids in Datura-Innoxia. J Am Chem Soc 1995, 117 (31), 8100-8105.

130 Texas Tech University, Neill Kim, May 2020

100. Kaczkowski, J.; Mothes, K.; Schutte, H. R., Die Rolle Des Acetats in Der Biosynthese Der Tropanalkaloide. Biochimica Et Biophysica Acta 1961, 46 (3), 588- &. 101. Liebisch, H. W.; Peisker, K.; Radwan, A. S.; Schütte, H. R., Zur Biosynthese der Tropanalkaloide .XI. Die Bildung der C3-Brücke des Tropins. Zeitschrift für Pflanzenphysiologie 1972, 67 (1), 1-9. 102. Robins, R. J.; Abraham, T. W.; Parr, A. J.; Eagles, J.; Walton, N. J., The biosynthesis of tropane alkaloids in Datura stramonium: The identity of the intermediates between N-methylpyrrolinium salt and tropinone. J Am Chem Soc 1997, 119 (45), 10929-10934. 103. Leete, E.; Bjorklund, J. A.; Couladis, M. M.; Kim, S. H., Late Intermediates in the Biosynthesis of Cocaine - 4-(1-Methyl-2-Pyrrolidinyl)-3-Oxobutanoate and Methyl Ecgonine. J Am Chem Soc 1991, 113 (24), 9286-9292. 104. Humphrey, A. J.; O'Hagan, D., Tropane alkaloid biosynthesis. A century old problem unresolved. Nat Prod Rep 2001, 18 (5), 494-502. 105. Jez, J. M.; Bowman, M. E.; Noel, J. P., Expanding the biosynthetic repertoire of plant type III polyketide synthases by altering starter molecule specificity. Proceedings of the National Academy of Sciences of the United States of America 2002, 99 (8), 5319- 24. 106. Mori, T.; Shimokawa, Y.; Matsui, T.; Kinjo, K.; Kato, R.; Noguchi, H.; Sugio, S.; Morita, H.; Abe, I., Cloning and structure-function analyses of quinolone- and acridone-producing novel type III polyketide synthases from Citrus microcarpa. J Biol Chem 2013, 288 (40), 28845-58. 107. Resmi, M. S.; Verma, P.; Gokhale, R. S.; Soniya, E. V., Identification and characterization of a type III polyketide synthase involved in quinolone alkaloid biosynthesis from Aegle marmelos Correa. J Biol Chem 2013, 288 (10), 7271-81. 108. Kavanagh, K. L.; Jornvall, H.; Persson, B.; Oppermann, U., Medium- and short-chain dehydrogenase/reductase gene and protein families : the SDR superfamily: functional and structural diversity within a family of metabolic and regulatory enzymes. Cell Mol Life Sci 2008, 65 (24), 3895-906. 109. Drager, B., Tropinone reductases, enzymes at the branch point of tropane alkaloid metabolism. Phytochemistry 2006, 67 (4), 327-37. 110. Moummou, H.; Kallberg, Y.; Tonfack, L. B.; Persson, B.; van der Rest, B., The plant short-chain dehydrogenase (SDR) superfamily: genome-wide inventory and diversification patterns. BMC Plant Biol 2012, 12, 219. 111. Nakajima, K.; Kato, H.; Oda, J.; Yamada, Y.; Hashimoto, T., Site-directed mutagenesis of putative substrate-binding residues reveals a mechanism controlling the different stereospecificities of two tropinone reductases. J Biol Chem 1999, 274 (23), 16563-8. 112. Nakajima, K.; Hashimoto, T.; Yamada, Y., Two tropinone reductases with different stereospecificities are short-chain dehydrogenases evolved from a common ancestor. Proceedings of the National Academy of Sciences of the United States of America 1993, 90 (20), 9591-5.

131 Texas Tech University, Neill Kim, May 2020

113. Jez, J. M.; Bennett, M. J.; Schlegel, B. P.; Lewis, M.; Penning, T. M., Comparative anatomy of the aldo-keto reductase superfamily. Biochem J 1997, 326 ( Pt 3) (3), 625- 36. 114. Williams, N.; Clouet, D. H.; Misra, A. L.; Mule, S., Cocaine and Metabolites - Relationship between Pharmacological Activity and Inhibitory Action on Dopamine Uptake into Striatal Synaptosomes. Prog Neuro-Psychopha 1977, 1 (3-4), 265-269. 115. Bjorklund, J. A.; Leete, E., Biosynthesis of the Tropane Alkaloids and Related- Compounds .49. Biosynthesis of the Benzoyl Moiety of Cocaine from Cinnamic Acid Via (R)-(+)-3-Hydroxy-3-Phenylpropanoic Acid. Phytochemistry 1992, 31 (11), 3883- 3887. 116. Leete, E.; Bjorklund, J. A.; Kim, S. H., Chemistry of the Tropane Alkaloids and Related-Compounds .40. The Biosynthesis of the Benzoyl Moiety of Cocaine. Phytochemistry 1988, 27 (8), 2553-2556. 117. D'Auria, J. C., Acyltransferases in plants: a good time to be BAHD. Current opinion in plant biology 2006, 9 (3), 331-40. 118. Rabot, S.; Peerless, A. C. J.; Robins, R. J., Tigloyl-Coa - Pseudotropine Acyl Transferase - an Enzyme of Tropane Alkaloid Biosynthesis. Phytochemistry 1995, 39 (2), 315-322. 119. Torre, J. C.; Schmidt, G. W.; Paetz, C.; Reichelt, M.; Schneider, B.; Gershenzon, J.; D'Auria, J. C., The biosynthesis of hydroxycinnamoyl quinate esters and their role in the storage of cocaine in Erythroxylum coca. Phytochemistry 2013, 91 (0), 177-86. 120. Leete, E.; Kowanko, N.; Newmark, R. A., Use of carbon-13 nuclear magnetic resonance to establish that the biosynthesis of tropic acid involves an intramolecular rearrangement of phenylalanine. J Am Chem Soc 1975, 97 (23), 6826-30. 121. Ansarin, M.; Woolley, J. G., The Biosynthesis of Tropic Acid .5. The Rearrangement of Phenyllactate in the Biosynthesis of Tropic Acid. Phytochemistry 1994, 35 (4), 935- 939. 122. Robins, R. J.; Bachmann, P.; Woolley, J. G., Biosynthesis of Hyoscyamine Involves an Intramolecular Rearrangement of Littorine. Journal of the Chemical Society-Perkin Transactions 1 1994, (6), 615-619. 123. Chesters, N. C. J. E.; Ohagan, D.; Robins, R. J., The Biosynthesis of Tropic Acid - the (R)-D-Phenyllactyl Moiety Is Processed by the Mutase Involved in Hyoscyamine Biosynthesis in Datura-Stramonium. Journal of the Chemical Society-Chemical Communications 1995, (2), 127-128. 124. Robins, R. J.; Chesters, N. C. J. E.; Ohagan, D.; Parr, A. J.; Walton, N. J.; Woolley, J. G., The Biosynthesis of Hyoscyamine - the Process by Which Littorine Rearranges to Hyoscyamine. Journal of the Chemical Society-Perkin Transactions 1 1995, (4), 481-485. 125. Sandala, G. M.; Smith, D. M.; Radom, L., The carbon-skeleton rearrangement in tropane alkaloid biosynthesis. J Am Chem Soc 2008, 130 (32), 10684-90. 126. Li, R.; Reed, D. W.; Liu, E.; Nowak, J.; Pelcher, L. E.; Page, J. E.; Covello, P. S., Functional genomic analysis of alkaloid biosynthesis in Hyoscyamus niger reveals a cytochrome P450 involved in littorine rearrangement. Chem Biol 2006, 13 (5), 513-20. 127. Nasomjai, P.; Reed, D. W.; Tozer, D. J.; Peach, M. J.; Slawin, A. M.; Covello, P. S.; O'Hagan, D., Mechanistic insights into the cytochrome P450-mediated oxidation

132 Texas Tech University, Neill Kim, May 2020

and rearrangement of littorine in tropane alkaloid biosynthesis. ChemBioChem 2009, 10 (14), 2382-93. 128. Nguyen, T. K.; Jamali, A.; Lanoue, A.; Gontier, E.; Dauwe, R., Unravelling the architecture and dynamics of tropane alkaloid biosynthesis pathways using metabolite correlation networks. Phytochemistry 2015, 116, 94-103. 129. Hashimoto, T.; Yamada, Y., Hyoscyamine 6beta-hydroxylase, a 2-oxoglutarate- dependent dioxygenase, in alkaloid-producing root cultures. Plant Physiol 1986, 81 (2), 619-25. 130. Hashimoto, T.; Matsuda, J.; Yamada, Y., Two-step epoxidation of hyoscyamine to scopolamine is catalyzed by bifunctional hyoscyamine 6β-hydroxylase. FEBS Letters 1993, 329 (1-2), 35-39. 131. Hashimoto, T.; Hayashi, A.; Amano, Y.; Kohno, J.; Iwanari, H.; Usuda, S.; Yamada, Y., Hyoscyamine 6b-hydroxylase, an enzyme involved in tropane alkaloid biosynthesis, is localized at the pericycle of the root. J. Biol. Chem. 1991, 266 (7), 4648-4653. 132. Beyerman, H. C.; Maat, L., Resolution of isopelletierine: A second synthesis of pelletierine. Recueil des Travaux Chimiques des Pays-Bas 2010, 84 (3), 385-388. 133. Leistner, E.; Gupta, R. N.; Spenser, I. D., A general method for the determination of precursor configuration in biosynthetic precursor-product relationships. Derivation of pipecolic acid from D-lysine, and of piperidine alkaloids from L-lysine. J Am Chem Soc 1973, 95 (12), 4040-7. 134. Hemscheidt, T.; Spenser, I. D., Biosynthesis of N-Methylpelletierine - Vindication of a Classical Biogenetic Concept. J Am Chem Soc 1990, 112 (17), 6360-6363. 135. Gupta, R. N.; Spenser, I. D., Biosynthesis of N-Methylpelletierine. Phytochemistry 1969, 8 (10), 1937-+. 136. Keogh, M. F.; Odonovan, D. G., Biosynthesis of Some Alkaloids of Punica-Granatum and Withania-Somnifera. Journal of the Chemical Society C-Organic 1970, (13), 1792-+. 137. O'Donovan, D. G.; Keogh, M. F., Biosynthesis of piperidine alkaloids. Tetrahedron Lett 1968, 3 (3), 265-7. 138. Gupta, R. N.; Spenser, I. D., Biosynthesis of the piperidine alkaloids: origin of the piperidine nucleus of N-methylisopelletierine. Chemical Communications (London) 1968, (2), 85-6. 139. Liebisch, H. W.; Marekov, N.; Schutte, H. R., [Biosynthesis of alkaloids from Punica granatum]. Z Naturforsch B 1968, 23 (8), 1116-7. 140. Leistner, E.; Spenser, I. D., Biosynthesis of the piperidine nucleus. Incorporation of chirally labeled (1-3H)cadaverine. J Am Chem Soc 1973, 95 (14), 4715-25. 141. Shorrosh, B. S.; Dixon, R. A.; Ohlrogge, J. B., Molecular cloning, characterization, and elicitation of acetyl-CoA carboxylase from alfalfa. Proceedings of the National Academy of Sciences of the United States of America 1994, 91 (10), 4323-7. 142. Bunsupa, S.; Komastsu, K.; Nakabayashi, R.; Saito, K.; Yamasaki, M., Revisiting anabasine biosynthesis in tobacco hairy roots expressing plant lysine decarboxylase gene by using 15N-labeled lysine. Phytochemistry 2014.

133 Texas Tech University, Neill Kim, May 2020

143. Riechers, D. E.; Timko, M. P., Structure and expression of the gene family encoding putrescine N-methyltransferase in Nicotiana tabacum: new clues to the evolutionary origin of cultivated tobacco. Plant Mol Biol 1999, 41 (3), 387-401. 144. Winz, R. A.; Baldwin, I. T., Molecular interactions between the specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host Nicotiana attenuata. IV. Insect-Induced ethylene reduces jasmonate-induced nicotine accumulation by regulating putrescine N-methyltransferase transcripts. Plant Physiol 2001, 125 (4), 2189-202. 145. Cona, A.; Rea, G.; Angelini, R.; Federico, R.; Tavladoraki, P., Functions of amine oxidases in plant development and defence. Trends Plant Sci 2006, 11 (2), 80-8. 146. Pontvianne, F.; Blevins, T.; Pikaard, C. S., Arabidopsis Histone Lysine Methyltransferases. Adv Bot Res 2010, 53 (0065-2296 (Print)), 1-22. 147. Leete, E., Biosynthesis of Cocaine and Cuscohygrine in Erythroxylon-Coca. Journal of the Chemical Society-Chemical Communications 1980, (23), 1170-1171. 148. Yu, G.; Nguyen, T. T.; Guo, Y.; Schauvinhold, I.; Auldridge, M. E.; Bhuiyan, N.; Ben-Israel, I.; Iijima, Y.; Fridman, E.; Noel, J. P.; Pichersky, E., Enzymatic functions of wild tomato methylketone synthases 1 and 2. Plant Physiol 2010, 154 (1), 67-77. 149. WHO, WHO model list of essential medicines, 17th list (March 2011). World Health Organization: Geneva, 2011; p 41. 150. Ullrich, S. F.; Hagels, H.; Kayser, O., Scopolamine: a journey from the field to clinics. Phytochemistry Reviews 2016, 16 (2), 333-353. 151. Wang, X.; Chen, M.; Yang, C.; Liu, X.; Zhang, L.; Lan, X.; Tang, K.; Liao, Z., Enhancing the scopolamine production in transgenic plants of Atropa belladonna by overexpressing pmt and h6h genes. Physiol Plant 2011, 143 (4), 309-15. 152. Qian, Z. G.; Xia, X. X.; Lee, S. Y., Metabolic engineering of Escherichia coli for the production of putrescine: a four carbon diamine. Biotechnol Bioeng 2009, 104 (4), 651-62. 153. Cardillo, A. B.; Giulietti, A. M.; Palazon, J.; Bonfill, M., Influence of hairy root ecotypes on production of tropane alkaloids in Brugmansia candida. Plant Cell Tissue and Organ Culture 2013, 114 (3), 305-312. 154. Richter, U.; Rothe, G.; Fabian, A. K.; Rahfeld, B.; Drager, B., Overexpression of tropinone reductases alters alkaloid composition in Atropa belladonna root cultures. J Exp Bot 2005, 56 (412), 645-52. 155. Kai, G.; Yang, S.; Luo, X.; Zhou, W.; Fu, X.; Zhang, A.; Zhang, Y.; Xiao, J., Co- expression of AaPMT and AaTRI effectively enhances the yields of tropane alkaloids in Anisodus acutangulus hairy roots. BMC Biotechnol 2011, 11, 43. 156. Yan, Z.-h. P., Xi-chun; Qiang, Wei; Liao, Zhi-hua, Improvement of biosynthesis of tropane alkaloids in Anisodus acutangulus by Co-transformed PMT and H6H. Plant Omics Journal 2014, 36 (2), 21-27. 157. Rothe, G.; Hachiya, A.; Yamada, Y.; Hashimoto, T.; Drager, B., Alkaloids in plants and root cultures of Atropa belladonna overexpressing putrescine N-methyltransferase. J Exp Bot 2003, 54 (390), 2065-70. 158. Moyano, E.; Jouhikainen, K.; Tammela, P.; Palazon, J.; Cusido, R. M.; Pinol, M. T.; Teeri, T. H.; Oksman-Caldentey, K. M., Effect of pmt gene overexpression on

134 Texas Tech University, Neill Kim, May 2020

tropane alkaloid production in transformed root cultures of Datura metel and Hyoscyamus muticus. J Exp Bot 2003, 54 (381), 203-11. 159. Yun, D. J.; Hashimoto, T.; Yamada, Y., Metabolic engineering of medicinal plants: transgenic Atropa belladonna with an improved alkaloid composition. Proceedings of the National Academy of Sciences of the United States of America 1992, 89 (24), 11799-803. 160. Jouhikainen, K.; Lindgren, L.; Jokelainen, T.; Hiltunen, R.; Teeri, T. H.; Oksman- Caldentey, K. M., Enhancement of scopolamine production in Hyoscyamus muticus L. hairy root cultures by genetic engineering. Planta 1999, 208 (4), 545-551. 161. Zhang, L.; Ding, R.; Chai, Y.; Bonfill, M.; Moyano, E.; Oksman-Caldentey, K. M.; Xu, T.; Pi, Y.; Wang, Z.; Zhang, H.; Kai, G.; Liao, Z.; Sun, X.; Tang, K., Engineering tropane biosynthetic pathway in Hyoscyamus niger hairy root cultures. Proceedings of the National Academy of Sciences of the United States of America 2004, 101 (17), 6786-91. 162. Archana, G.; Lakshmi, N., Transgenic hairy roots: recent trends and applications. Biotechnology Advances 2000, 18 (1), 1-22. 163. Wu, J. Y.; Ng, J.; Shi, M.; Wu, S. J., Enhanced secondary metabolite (tanshinone) production of Salvia miltiorrhiza hairy roots in a novel root-bacteria coculture process. Appl Microbiol Biotechnol 2007, 77 (3), 543-50. 164. Kai, G.; Yang, S.; Zhang, Y.; Luo, X.; Fu, X.; Zhang, A.; Xiao, J., Effects of different elicitors on yield of tropane alkaloids in hairy roots of Anisodus acutangulus. Mol Biol Rep 2012, 39 (2), 1721-9. 165. Amdoun, R.; Khelifi, L.; Khelifi-Slaoui, M.; Amroune, S.; Benyoussef, E. H.; Thi, D. V.; Assaf-Ducrocq, C.; Gontier, E., Influence of minerals and elicitation on Datura stramonium L. tropane alkaloid production: Modelization of the in vitro biochemical response. Plant Sci. 2009, 177 (2), 81-87. 166. Zhao, X. C.; Qu, X.; Mathews, D. E.; Schaller, G. E., Effect of ethylene pathway mutations upon expression of the ethylene receptor ETR1 from Arabidopsis. Plant Physiol 2002, 130 (4), 1983-91. 167. Kumar, V.; Parvatam, G.; Ravishankar, G. A., AgNO3 - a potential regulator of ethylene activity and plant growth modulator. Electronic Journal of Biotechnology 2009, 12 (2), 1-15. 168. Anantasaran, J.; Kanchanapoom, K., Influence of medium formula and silver nitrate on in vitro plantregeneration of Zinnia cultivars. Songklanakarin J. Sci. Technol. 2008, 30 (1), 1-6. 169. Angelova, Z.; Georgiev, S.; Roos, W., Elicitation of Plants. Biotechnology & Biotechnological Equipment 2014, 20 (2), 72-83. 170. Pitta-Alvarez, S. I.; Spollansky, T. C.; Giulietti, A. M., The influence of different biotic and abiotic elicitors on the production and profile of tropane alkaloids in hairy root cultures of Brugmansia candida. Enzyme Microb Technol 2000, 26 (2-4), 252- 258. 171. Sahandi, S. M.; Sorooshzadeh, A.; Rezazadeh, H. S.; Naghdibadi, H. A., Effect of nano silver and silver nitrate on seed yield of borage. J Med Plant Res 2011, 5 (5), 706-710.

135 Texas Tech University, Neill Kim, May 2020

172. Lee, W. M.; Kwak, J. I.; An, Y. J., Effect of silver nanoparticles in crop plants Phaseolus radiatus and Sorghum bicolor: media effect on phytotoxicity. Chemosphere 2012, 86 (5), 491-9. 173. Qian, Z. G.; Xia, X. X.; Lee, S. Y., Metabolic engineering of Escherichia coli for the production of cadaverine: a five carbon diamine. Biotechnol Bioeng 2011, 108 (1), 93- 103. 174. Qin, B. F.; Ma, L. L.; Wang, Y. X.; Chen, M.; Lan, X. Z.; Wu, N. B.; Liao, Z. H., Effects of acetylsalicylic acid and UV-B on gene expression and tropane alkaloid biosynthesis in hairy root cultures of Anisodus luridus. Plant Cell Tissue and Organ Culture 2014, 117 (3), 483-490. 175. Docimo, T.; Davis, A. J.; Luck, K.; Fellenberg, C.; Reichelt, M.; Phillips, M.; Gershenzon, J.; D’Auria, J. C., Influence of medium and elicitors on the production of cocaine, amino acids and phytohormones by Erythroxylum coca calli. Plant Cell, Tissue and Organ Culture (PCTOC) 2014, 120 (3), 1061-1075. 176. Coste, A.; Vlase, L.; Halmagyi, A.; Deliu, C.; Coldea, G., Effects of plant growth regulators and elicitors on production of secondary metabolites in shoot cultures of Hypericum hirsutum and Hypericum maculatum. Plant Cell Tissue and Organ Culture 2011, 106 (2), 279-288. 177. Drager, B., Chemistry and biology of calystegines. Nat Prod Rep 2004, 21 (2), 211- 23. 178. WHO, World Health Organization model list of essential medicines: 21st list 2019. World Health Organization Geneva, 2019. 179. Soeren, J. H. v., Bijdrage tot het onderzoek naar de biosynthese van de tropa- alkaloiden. Pharmaceutisch weekblad 1962, 97, 721-731. 180. Imanishi, S.; Hashizume, K.; Nakakita, M.; Kojima, H.; Matsubayashi, Y.; Hashimoto, T.; Sakagami, Y.; Yamada, Y.; Nakamura, K., Differential induction by methyl jasmonate of genes encoding ornithine decarboxylase and other enzymes involved in nicotine biosynthesis in tobacco cell cultures. Plant Mol Biol 1998, 38 (6), 1101-11. 181. Michael, A. J.; Furze, J. M.; Rhodes, M. J.; Burtin, D., Molecular cloning and functional identification of a plant ornithine decarboxylase cDNA. Biochem J 1996, 314 ( Pt 1), 241-8. 182. Sandmeier, E.; Hale, T. I.; Christen, P., Multiple evolutionary origin of pyridoxal-5'- phosphate-dependent amino acid decarboxylases. Eur. J. Biochem. 1994, 221 (3), 997- 1002. 183. Schipper, R. G.; Cuijpers, V. M.; De Groot, L. H.; Thio, M.; Verhofstad, A. A., Intracellular localization of ornithine decarboxylase and its regulatory protein, antizyme-1. J. Histochem. Cytochem. 2004, 52 (10), 1259-66. 184. Zhao, T.; Wang, C.; Bai, F.; Li, S.; Yang, C.; Zhang, F.; Bai, G.; Chen, M.; Lan, X.; Liao, Z., Metabolic Characterization of Hyoscyamus niger Ornithine Decarboxylase. Front Plant Sci 2019, 10, 229. 185. Lee, Y. S.; Cho, Y. D., Identification of essential active-site residues in ornithine decarboxylase of Nicotiana glutinosa decarboxylating both L-ornithine and L-lysine. Biochem J 2001, 360 (Pt 3), 657-65.

136 Texas Tech University, Neill Kim, May 2020

186. Coleman, C. S.; Stanley, B. A.; Pegg, A. E., Effect of Mutations at Active-Site Residues on the Activity of Ornithine Decarboxylase and Its Inhibition by Active-Site- Directed Irreversible Inhibitors. J. Biol. Chem. 1993, 268 (33), 24572-24579. 187. Bortolotti, C.; Cordeiro, A.; Alcazar, R.; Borrell, A.; Culianez-Macia, F. A.; Tiburcio, A. F.; Altabella, T., Localization of arginine decarboxylase in tobacco plants. Physiol Plant 2004, 120 (1), 84-92. 188. Slocum, R. D.; Kaur-Sawhney, R.; Galston, A. W., The physiology and biochemistry of polyamines in plants. Archives of Biochemistry and Biophysics 1984, 235 (2), 283- 303. 189. Borrell, A.; Culianez-Macia, F. A.; Altabella, T.; Besford, R. T.; Flores, D.; Tiburcio, A. F., Arginine Decarboxylase Is Localized in Chloroplasts. Plant Physiol 1995, 109 (3), 771-776. 190. Nam, K. H.; Lee, S. H.; Lee, J., Purification and characterization of arginine decarboxylase from soybean (Glycine max) hypocotyls. Plant Cell Physiol 1997, 38 (10), 1150-5. 191. Malmberg, R. L.; Smith, K. E.; Bell, E.; Cellino, M. L., Arginine decarboxylase of oats is clipped from a precursor into two polypeptides found in the soluble enzyme. Plant Physiol 1992, 100 (1), 146-52. 192. Hartzoulakis, B.; Rossiter, S.; Gill, H.; O'Hara, B.; Steinke, E.; Gane, P. J.; Hurtado-Guerrero, R.; Leiper, J. M.; Vallance, P.; Rust, J. M.; Selwood, D. L., Discovery of inhibitors of the pentein superfamily protein dimethylarginine dimethylaminohydrolase (DDAH), by virtual screening and hit analysis. Bioorg Med Chem Lett 2007, 17 (14), 3953-6. 193. Walton, N. J.; Robins, R. J.; Peerless, A. C., Enzymes of N-methylputrescine biosynthesis in relation to hyoscyamine formation in transformed root cultures of Datura stramonium and Atropa belladonna. Planta 1990, 182 (1), 136-41. 194. Janowitz, T.; Kneifel, H.; Piotrowski, M., Identification and characterization of plant agmatine iminohydrolase, the last missing link in polyamine biosynthesis of plants. FEBS Lett 2003, 544 (1-3), 258-61. 195. Yanagisawa, H.; Suzuki, Y., Corn Agmatine Iminohydrolase: PURIFICATION AND PROPERTIES. Plant Physiol 1981, 67 (4), 697-700. 196. Chaudhuri, M. M.; Ghosh, B., Agmatine Deiminase in Rice Seedlings. Phytochemistry 1985, 24 (10), 2433-2435. 197. Sekula, B.; Dauter, Z., Structural Study of Agmatine Iminohydrolase From Medicago truncatula, the Second Enzyme of the Agmatine Route of Putrescine Biosynthesis in Plants. Front Plant Sci 2019, 10, 320. 198. Piotrowski, M.; Janowitz, T.; Kneifel, H., Plant C-N hydrolases and the identification of a plant N-carbamoylputrescine amidohydrolase involved in polyamine biosynthesis. J Biol Chem 2003, 278 (3), 1708-12. 199. Sekula, B.; Ruszkowski, M.; Malinska, M.; Dauter, Z., Structural Investigations of N-carbamoylputrescine Amidohydrolase from Medicago truncatula: Insights into the Ultimate Step of Putrescine Biosynthesis in Plants. Front Plant Sci 2016, 7, 350. 200. Miller-Fleming, L.; Olin-Sandoval, V.; Campbell, K.; Ralser, M., Remaining Mysteries of Molecular Biology: The Role of Polyamines in the Cell. J Mol Biol 2015, 427 (21), 3389-406.

137 Texas Tech University, Neill Kim, May 2020

201. Kusano, T.; Berberich, T.; Tateda, C.; Takahashi, Y., Polyamines: essential factors for growth and survival. Planta 2008, 228 (3), 367-81. 202. Tabor, C. W.; Tabor, H., Polyamines. Annu Rev Biochem 1984, 53, 749-90. 203. Chattopadhyay, M. K.; Tabor, C. W.; Tabor, H., Polyamines protect Escherichia coli cells from the toxic effect of oxygen. Proceedings of the National Academy of Sciences of the United States of America 2003, 100 (5), 2261-5. 204. Chattopadhayay, M. K.; Tiwari, B. S.; Chattopadhyay, G.; Bose, A.; Sengupta, D. N.; Ghosh, B., Protective role of exogenous polyamines on salinity-stressed rice (Oryza sativa) plants. Physiol Plant 2002, 116 (2), 192-199. 205. Biastoff, S.; Brandt, W.; Drager, B., Putrescine N-methyltransferase--the start for alkaloids. Phytochemistry 2009, 70 (15-16), 1708-18. 206. Junker, A.; Fischer, J.; Sichhart, Y.; Brandt, W.; Drager, B., Evolution of the key alkaloid enzyme putrescine N-methyltransferase from spermidine synthase. Front Plant Sci 2013, 4, 260. 207. Minguet, E. G.; Vera-Sirera, F.; Marina, A.; Carbonell, J.; Blazquez, M. A., Evolutionary diversification in polyamine biosynthesis. Mol Biol Evol 2008, 25 (10), 2119-28. 208. Sekula, B.; Dauter, Z., Spermidine Synthase (SPDS) Undergoes Concerted Structural Rearrangements Upon Ligand Binding - A Case Study of the Two SPDS Isoforms From Arabidopsis thaliana. Front Plant Sci 2019, 10, 555. 209. Teuber, M.; Azemi, M. E.; Namjoyan, F.; Meier, A. C.; Wodak, A.; Brandt, W.; Drager, B., Putrescine N-methyltransferases--a structure-function analysis. Plant Mol Biol 2007, 63 (6), 787-801. 210. Biastoff, S.; Reinhardt, N.; Reva, V.; Brandt, W.; Drager, B., Evolution of putrescine N-methyltransferase from spermidine synthase demanded alterations in substrate binding. FEBS Lett 2009, 583 (20), 3367-74. 211. Hashimoto, T.; Shoji, T.; Mihara, T.; Oguri, H.; Tamaki, K.; Suzuki, K.; Yamada, Y., Intraspecific variability of the tandem repeats in Nicotiana putrescine N- methyltransferases. Plant Mol Biol 1998, 37 (1), 25-37. 212. Naconsie, M.; Kato, K.; Shoji, T.; Hashimoto, T., Molecular evolution of N- methylputrescine oxidase in tobacco. Plant Cell Physiol 2014, 55 (2), 436-44. 213. Tavladoraki, P.; Cona, A.; Angelini, R., Copper-Containing Amine Oxidases and FAD-Dependent Polyamine Oxidases Are Key Players in Plant Tissue Differentiation and Organ Development. Front Plant Sci 2016, 7, 824. 214. Tavladoraki, P.; Rossi, M. N.; Saccuti, G.; Perez-Amador, M. A.; Polticelli, F.; Angelini, R.; Federico, R., Heterologous expression and biochemical characterization of a polyamine oxidase from Arabidopsis involved in polyamine back conversion. Plant Physiol 2006, 141 (4), 1519-32. 215. Kamada-Nobusada, T.; Hayashi, M.; Fukazawa, M.; Sakakibara, H.; Nishimura, M., A putative peroxisomal polyamine oxidase, AtPAO4, is involved in polyamine catabolism in Arabidopsis thaliana. Plant Cell Physiol 2008, 49 (9), 1272-82. 216. Moschou, P. N.; Sanmartin, M.; Andriopoulou, A. H.; Rojo, E.; Sanchez-Serrano, J. J.; Roubelakis-Angelakis, K. A., Bridging the gap between plant and mammalian polyamine catabolism: a novel peroxisomal polyamine oxidase responsible for a full back-conversion pathway in Arabidopsis. Plant Physiol 2008, 147 (4), 1845-57.

138 Texas Tech University, Neill Kim, May 2020

217. Fincato, P.; Moschou, P. N.; Spedaletti, V.; Tavazza, R.; Angelini, R.; Federico, R.; Roubelakis-Angelakis, K. A.; Tavladoraki, P., Functional diversity inside the Arabidopsis polyamine oxidase gene family. J Exp Bot 2011, 62 (3), 1155-68. 218. Ahou, A.; Martignago, D.; Alabdallah, O.; Tavazza, R.; Stano, P.; Macone, A.; Pivato, M.; Masi, A.; Rambla, J. L.; Vera-Sirera, F.; Angelini, R.; Federico, R.; Tavladoraki, P., A plant spermine oxidase/dehydrogenase regulated by the proteasome and polyamines. J Exp Bot 2014, 65 (6), 1585-603. 219. Kim, D. W.; Watanabe, K.; Murayama, C.; Izawa, S.; Niitsu, M.; Michael, A. J.; Berberich, T.; Kusano, T., Polyamine Oxidase5 Regulates Arabidopsis Growth through Thermospermine Oxidase Activity. Plant Physiol 2014, 165 (4), 1575-1590. 220. Liu, T.; Kim, D. W.; Niitsu, M.; Berberich, T.; Kusano, T., Oryza sativa polyamine oxidase 1 back-converts tetraamines, spermine and thermospermine, to spermidine. Plant Cell Rep 2014, 33 (1), 143-51. 221. Mo, H.; Wang, X.; Zhang, Y.; Zhang, G.; Zhang, J.; Ma, Z., Cotton polyamine oxidase is required for spermine and camalexin signalling in the defence response to Verticillium dahliae. Plant J 2015, 83 (6), 962-75. 222. Tavladoraki, P.; Schinina, M. E.; Cecconi, F.; Di Agostino, S.; Manera, F.; Rea, G.; Mariottini, P.; Federico, R.; Angelini, R., Maize polyamine oxidase: primary structure from protein and cDNA sequencing. FEBS Lett 1998, 426 (1), 62-6. 223. Cervelli, M.; Cona, A.; Angelini, R.; Polticelli, F.; Federico, R.; Mariottini, P., A barley polyamine oxidase isoform with distinct structural features and subcellular localization. Eur. J. Biochem. 2001, 268 (13), 3816-30. 224. Liu, T.; Kim, D. W.; Niitsu, M.; Maeda, S.; Watanabe, M.; Kamio, Y.; Berberich, T.; Kusano, T., Polyamine oxidase 7 is a terminal catabolism-type enzyme in Oryza sativa and is specifically expressed in anthers. Plant Cell Physiol 2014, 55 (6), 1110- 22. 225. Sebela, M.; Radova, A.; Angelini, R.; Tavladoraki, P.; Frebort, I. I.; Pec, P., FAD- containing polyamine oxidases: a timely challenge for researchers in biochemistry and physiology of plants. Plant Sci 2001, 160 (2), 197-207. 226. Feth, F.; Wray, V.; Wagner, K. G., Determination of Methylputrescine Oxidase by High-Performance Liquid-Chromatography. Phytochemistry 1985, 24 (8), 1653-1655. 227. Hashimoto, T.; Mitani, A.; Yamada, Y., Diamine Oxidase from Cultured Roots of Hyoscyamus niger: Its Function in Tropane Alkaloid Biosynthesis. Plant Physiol 1990, 93 (1), 216-21. 228. Mizusaki, S.; Tanabe, Y.; Noguchi, M.; Tamaki, E., Phytochemical Studies on Tobacco Alkaloids .16. Changes in Activities of Ornithine Decarboxylase, Putrescine N-Methyltransferase and N-Methyl-Putrescine Oxidase in Tobacco Roots in Relation to Nicotine Biosynthesis. Plant and Cell Physiology 1973, 14 (1), 103-110. 229. Wigle, I. D.; Mestichelli, L. J. J.; Spenser, I. D., 2H n.m.r. spectroscopy as a probe of the stereochemistry of biosynthetic reactions. The biosynthesis of nicotine. Journal of the Chemical Society, Chemical Communications 1982, (12), 662-664. 230. Leete, E.; Kim, S. H.; Rana, J., Chemistry of the tropane alkaloids and related- compounds .38. the incorporation of [2-13C,14C,15N]-1-methyl-D1-pyrrolinium chloride into cuscohygrine in Erythroxylum coca. Phytochemistry 1988, 27 (2), 401- 406.

139 Texas Tech University, Neill Kim, May 2020

231. Leete, E., Chemistry of the tropane alkaloids .31. biosynthesis of cocaine and cuscohygrine from [1-14C]-labeled acetate and [4-3H]-labeled phenylalanine in Erythroxylon-Coca. Phytochemistry 1983, 22 (3), 699-704. 232. Endo, T.; Hamaguchi, N.; Hashimoto, T.; Yamada, Y., Non-Enzymatic Synthesis of Hygrine from Acetoacetic Acid and from Acetonedicarboxylic Acid. Febs Letters 1988, 234 (1), 86-90. 233. Bedewitz, M. A.; Jones, A. D.; D'Auria, J. C.; Barry, C. S., Tropinone synthesis via an atypical polyketide synthase and P450-mediated cyclization. Nat Commun 2018, 9 (1), 5281. 234. Huang, J. P.; Fang, C.; Ma, X.; Wang, L.; Yang, J.; Luo, J.; Yan, Y.; Zhang, Y.; Huang, S. X., Tropane alkaloids biosynthesis involves an unusual type III polyketide synthase and non-enzymatic condensation. Nat Commun 2019, 10 (1), 4036. 235. Dang, T. T.; Facchini, P. J., CYP82Y1 is N-methylcanadine 1-hydroxylase, a key noscapine biosynthetic enzyme in opium poppy. J Biol Chem 2014, 289 (4), 2013-26. 236. Siminszky, B.; Gavilano, L.; Bowen, S. W.; Dewey, R. E., Conversion of nicotine to nornicotine in Nicotiana tabacum is mediated by CYP82E4, a cytochrome P450 monooxygenase. Proceedings of the National Academy of Sciences of the United States of America 2005, 102 (41), 14919-24. 237. Lewis, R. S.; Bowen, S. W.; Keogh, M. R.; Dewey, R. E., Three nicotine demethylase genes mediate nornicotine biosynthesis in Nicotiana tabacum L.: functional characterization of the CYP82E10 gene. Phytochemistry 2010, 71 (17-18), 1988-98. 238. Kacprzak, K. M., Chemistry and biology of cinchona alkaloids. In Natural Products: Phytochemistry, Botany and Metabolism of Alkaloids, Phenolics and Terpenes, Ramawat, K. G.; Mérillon, J.-M., Eds. Springer: Berlin Heidelberg, 2013; Vol. 1, pp 605–641. 239. Koelen, K. J.; Gross, G. G., Partial purification and properties of tropine dehydrogenase from root cultures of Datura stramonium. Planta Med 1982, 44 (4), 227-30. 240. Dräger, B.; Hashimoto, T.; Yamada, Y., Purification and characterization of pseudotropine forming tropinone reductase from Hyoscyamus niger root cultures. Agricultural and Biological Chemistry 1988, 52 (10), 2663-2667. 241. Dräger, B.; Schaal, A., Tropinone reduction in Atropa belladonna root cultures. Phytochemistry 1994, 35 (6), 1441-1447. 242. Kai, G.; Li, L.; Jiang, Y.; Yan, X.; Zhang, Y.; Lu, X.; Liao, P.; Chen, J., Molecular cloning and characterization of two tropinone reductases in Anisodus acutangulus and enhancement of tropane alkaloid production in AaTRI-transformed hairy roots. Biotechnol. Appl. Biochem. 2009, 54 (3), 177-86. 243. Keiner, R.; Kaiser, H.; Nakajima, K.; Hashimoto, T.; Drager, B., Molecular cloning, expression and characterization of tropinone reductase II, an enzyme of the SDR family in Solanum tuberosum (L.). Plant Mol Biol 2002, 48 (3), 299-308. 244. Portsteffen, A.; Drager, B.; Nahrstedt, A., The reduction of tropinone in Datura stramonium root cultures by two specific reductases. Phytochemistry 1994, 37 (2), 391-400.

140 Texas Tech University, Neill Kim, May 2020

245. Nakajima, K.; Yamashita, A.; Akama, H.; Nakatsu, T.; Kato, H.; Hashimoto, T.; Oda, J.; Yamada, Y., Crystal structures of two tropinone reductases: different reaction stereospecificities in the same protein fold. Proceedings of the National Academy of Sciences of the United States of America 1998, 95 (9), 4876-81. 246. Yamada, Y.; Hashimoto, T.; Endo, T.; Yukimune, Y.; Kohno, J.; Hamaguchni, N.; Dräger, B., Biochemistry of alkaloid production in vitro. In Secondary products from plant tissue culture, 30 ed.; Charlwood, B. V.; Rhodes, M. J. C., Eds. Oxford Science Publications: Oxford, 1990; pp 227-242. 247. Kaiser, H.; Richter, U.; Keiner, R.; Brabant, A.; Hause, B.; Drager, B., Immunolocalisation of two tropinone reductases in potato (Solanum tuberosum L.) root, stolon, and tuber sprouts. Planta 2006, 225 (1), 127-37. 248. Hashimoto, T.; Nakajima, K.; Ongena, G.; Yamada, Y., Two Tropinone Reductases with Distinct Stereospecificities from Cultured Roots of Hyoscyamus niger. Plant Physiol 1992, 100 (2), 836-45. 249. Brock, A.; Brandt, W.; Drager, B., The functional divergence of short-chain dehydrogenases involved in tropinone reduction. Plant J 2008, 54 (3), 388-401. 250. Torres, M. Structure and Function of Enzymes Involved With the Biosynthesis of Benzylisoquinoline Alkaloids. University of Calgary, Calgary 2018. 251. Barski, O. A.; Tipparaju, S. M.; Bhatnagar, A., The aldo-keto reductase superfamily and its role in drug metabolism and detoxification. Drug Metab Rev 2008, 40 (4), 553- 624. 252. Dastmalchi, M.; Chang, L.; Torres, M. A.; Ng, K. K. S.; Facchini, P. J., Codeinone reductase isoforms with differential stability, efficiency and product selectivity in opium poppy. Plant J 2018. 253. Penning, T. M., The aldo-keto reductases (AKRs): Overview. Chem Biol Interact 2015, 234, 236-46. 254. Johnson, E. L., Content and Distribution of Erythroxylum-Coca Leaf Alkaloids. Ann Bot-London 1995, 76 (4), 331-335. 255. Johnson, E. L., Alkaloid content in Erythroxylum coca tissue during reproductive development. Phytochemistry 1996, 42 (1), 35-38. 256. Srinivasan, P.; Smolke, C. D., Engineering a microbial biosynthesis platform for de novo production of tropane alkaloids. Nat Commun 2019, 10 (1), 3634. 257. Ma, X.; Koepke, J.; Panjikar, S.; Fritzsch, G.; Stockigt, J., Crystal structure of vinorine synthase, the first representative of the BAHD superfamily. J Biol Chem 2005, 280 (14), 13576-83. 258. Bontpart, T.; Cheynier, V.; Ageorges, A.; Terrier, N., BAHD or SCPL acyltransferase? What a dilemma for acylation in the world of plant phenolic compounds. New Phytol 2015, 208 (3), 695-707. 259. Robins, R.; Woolley, J.; Ansarin, M.; Eagles, J.; Goodfellow, B., Phenyllactic acid but not tropic acid is an intermediate in the biosynthesis of tropane alkaloids in Datura and Brugmansia transformed root cultures. Planta 1994, 194 (1), 86-94. 260. Qiu, F.; Zeng, J.; Wang, J.; Huang, J. P.; Zhou, W.; Yang, C.; Lan, X.; Chen, M.; Huang, S. X.; Kai, G.; Liao, Z., Functional genomics analysis reveals two novel genes required for littorine biosynthesis. New Phytol 2020, 225 (5), 1906-1914.

141 Texas Tech University, Neill Kim, May 2020

261. Kohnen-Johannsen, K. L.; Kayser, O., Tropane Alkaloids: Chemistry, Pharmacology, Biosynthesis and Production. Molecules 2019, 24 (4). 262. Kohnen, K. L.; Sezgin, S.; Spiteller, M.; Hagels, H.; Kayser, O., Localization and Organization of Scopolamine Biosynthesis in Duboisia myoporoides R. Br. Plant Cell Physiol 2018, 59 (1), 107-118. 263. Averesch, N. J. H.; Kayser, O., Assessing Heterologous Expression of Hyoscyamine 6β-Hydroxylase – A Feasibility Study. Procedia Chemistry 2014, 13, 69-78. 264. Fischer, C.; Kwon, M.; Ro, D. K.; van Belkum, M. J.; Vederas, J. C., Isolation, expression and biochemical characterization of recombinant hyoscyamine-6beta- hydroxylase from Brugmansia sanguinea - tuning the scopolamine production. Medchemcomm 2018, 9 (5), 888-892. 265. Zhao, K.; Zeng, J.; Zhao, T.; Zhang, H.; Qiu, F.; Yang, C.; Zeng, L.; Liu, X.; Chen, M.; Lan, X.; Liao, Z., Enhancing Tropane Alkaloid Production Based on the Functional Identification of Tropine-Forming Reductase in Scopolia lurida, a Tibetan Medicinal Plant. Front Plant Sci 2017, 8, 1745. 266. Suzuki, K.; Yun, D. J.; Chen, X. Y.; Yamada, Y.; Hashimoto, T., An Atropa belladonna hyoscyamine 6beta-hydroxylase gene is differentially expressed in the root pericycle and anthers. Plant Mol Biol 1999, 40 (1), 141-52. 267. Esau, K., Anatomy of the Seed Plants. 2nd Edition ed.; John Wiley & Sons Ltd: New York, 1977; p 576. 268. Ushimaru, R.; Ruszczycky, M. W.; Liu, H. W., Changes in Regioselectivity of H Atom Abstraction during the Hydroxylation and Cyclization Reactions Catalyzed by Hyoscyamine 6beta-Hydroxylase. J Am Chem Soc 2019, 141 (2), 1062-1066. 269. Ushimaru, R.; Ruszczycky, M. W.; Chang, W. C.; Yan, F.; Liu, Y. N.; Liu, H. W., Substrate Conformation Correlates with the Outcome of Hyoscyamine 6beta- Hydroxylase Catalyzed Oxidation Reactions. J Am Chem Soc 2018, 140 (24), 7433- 7436. 270. Shonle, I.; Bergelson, J., Evolutionary ecology of the tropane alkaloids of Datura stramonium L. (Solanaceae). Evolution 2000, 54 (3), 778-88. 271. Wilson, J. K.; Tseng, A. S.; Potter, K. A.; Davidowitz, G.; Hildebrand, J. G., The Effects of the Alkaloid Scopolamine on the Performance and Behavior of Two Caterpillar Species. Arthropod Plant Interact 2018, 12 (1), 21-29. 272. Facchini, P. J., Alkaloid biosynthesis in plants: Biochemistry, cell biology, molecular regulation, and metabolic engineering applications. Annu. Rev. Plant Physiol. Plant Molec. Biol. 2001, 52, 29-66. 273. Meltzer, P. C.; Liang, A. Y.; Madras, B. K., The Discovery of an Unusually Selective and Novel Cocaine Analog: Difluoropine. Synthesis and Inhibition of Binding at Cocaine Recognition Sites. Journal of Medicinal Chemistry 1994, 37 (13), 2001-2010. 274. Kelkar, S. V.; Izenwasser, S.; Katz, J. L.; Klein, C. L.; Zhu, N.; Trudell, M. L., Synthesis, cocaine receptor affinity, and dopamine uptake inhibition of several new 2 beta-substituted 3 beta-phenyltropanes. J Med Chem 1994, 37 (23), 3875-7. 275. Bai, F.; Li, S. Q.; Yang, C. X.; Zhao, T. F.; Zhang, T. X.; Lan, X. Z.; Chen, M.; Liao, Z. H., Overexpression of the AbSAUR1 gene enhanced biomass production and alkaloid yield in Atropa belladonna. Ind Crop Prod 2019, 140.

142 Texas Tech University, Neill Kim, May 2020

276. Jez, J. M.; Noel, J. P., Mechanism of chalcone synthase. pKa of the catalytic cysteine and the role of the conserved histidine in a plant polyketide synthase. J Biol Chem 2000, 275 (50), 39640-6. 277. Abe, I.; Morita, H., Structure and function of the chalcone synthase superfamily of plant type III polyketide synthases. Nat Prod Rep 2010, 27 (6), 809-38. 278. Docimo, T.; Schmidt, G. W.; Luck, K.; Delaney, S. K.; D'Auria, J. C., Selection and validation of reference genes for quantitative gene expression studies in Erythroxylum coca. F1000Res 2013, 2, 37. 279. Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J., qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol 2007, 8 (2), R19. 280. Battye, T. G.; Kontogiannis, L.; Johnson, O.; Powell, H. R.; Leslie, A. G., iMOSFLM: a new graphical interface for diffraction-image processing with MOSFLM. Acta Crystallogr D Biol Crystallogr 2011, 67 (Pt 4), 271-81. 281. Evans, P. R., An introduction to data reduction: space-group determination, scaling and intensity statistics. Acta Crystallogr D Biol Crystallogr 2011, 67 (Pt 4), 282-92. 282. Kabsch, W., Xds. Acta Crystallogr D Biol Crystallogr 2010, 66 (Pt 2), 125-32. 283. McCoy, A. J.; Grosse-Kunstleve, R. W.; Adams, P. D.; Winn, M. D.; Storoni, L. C.; Read, R. J., Phaser crystallographic software. J Appl Crystallogr 2007, 40 (Pt 4), 658- 674. 284. Terwilliger, T. C.; Grosse-Kunstleve, R. W.; Afonine, P. V.; Moriarty, N. W.; Zwart, P. H.; Hung, L. W.; Read, R. J.; Adams, P. D., Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallogr D Biol Crystallogr 2008, 64 (Pt 1), 61-9. 285. Liebschner, D.; Afonine, P. V.; Baker, M. L.; Bunkoczi, G.; Chen, V. B.; Croll, T. I.; Hintze, B.; Hung, L. W.; Jain, S.; McCoy, A. J.; Moriarty, N. W.; Oeffner, R. D.; Poon, B. K.; Prisant, M. G.; Read, R. J.; Richardson, J. S.; Richardson, D. C.; Sammito, M. D.; Sobolev, O. V.; Stockwell, D. H.; Terwilliger, T. C.; Urzhumtsev, A. G.; Videau, L. L.; Williams, C. J.; Adams, P. D., Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr D Struct Biol 2019, 75 (Pt 10), 861-877. 286. Emsley, P.; Cowtan, K., Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 2004, 60 (Pt 12 Pt 1), 2126-32. 287. Chen, V. B.; Arendall, W. B., 3rd; Headd, J. J.; Keedy, D. A.; Immormino, R. M.; Kapral, G. J.; Murray, L. W.; Richardson, J. S.; Richardson, D. C., MolProbity: all- atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr 2010, 66 (Pt 1), 12-21. 288. Ono, N. N.; Bandaranayake, P. C.; Tian, L., Establishment of pomegranate (Punica granatum) hairy root cultures for genetic interrogation of the hydrolyzable tannin biosynthetic pathway. Planta 2012, 236 (3), 931-41. 289. Katzen, F., Gateway((R)) recombinational cloning: a biological operating system. Expert Opin Drug Discov 2007, 2 (4), 571-89. 290. Bradford, M. M., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 1976, 72 (1-2), 248-254.

143 Texas Tech University, Neill Kim, May 2020

291. Jaakola, L.; Pirttilä, A. M.; Halonen, M.; Hohtola, A., Isolation of High Quality RNA from Bilberry (Vaccinium myrtillus L.) Fruit. Molecular Biotechnology 2001, 19 (2), 201-204.

144