DOCSLIB.ORG

Kim Et Al., Online Supplementary Figure 1 100Bp TSPYL5

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Kim Et Al., Online Supplementary Figure 1 100Bp TSPYL5 100bp CST6 TAC1 BGS BGS -228 +194 -441 -166 LN229 LN229 TACSTD2 BIK BGS BGS -415 -168 -765 -596 LN229 LN229 CDO1 CLIC3 BGS BGS -504 -252 -203 -35 LN229 LN229 Kim et al., Online Supplementary Figure 1 100bp TSPYL5 BGS -353 +130 LN229 Kim et al., Online Supplementary Figure 1 cont. RNASET2 TFDP3 MSP (-677 to -503) MSP (-146 to -28) BGS BGS -380 -45 -146 -28 T98G T98G Normal Normal brain brain CDA* MSP (-99 to +10) BGS -104 +43 T98G Normal brain *not a CpG island Kim et al., Online Supplementary Figure 2 TSPYL5 BGS in Primary Brain Tumors 100bp TSPYL5 BGS MSP -353 (-29 to +77) +130 T9 T29 T34 Kim et al., Online Supplementary Figure 3 Online Supplementary Table 1 - Kim et al. Primer sequences for RT-PCR analysis of all genes described in this paper. Gene name Primer Sequence (5'-3') C1orf34 forward aaggggctgtgggatttagt reverse gggcttgaggtagctgagtg TACSTD2 forward gatttcggtatcgtcccaga reverse ggaccgaaaggggatacatt TSPAN1 forward tcctgacgttgctggtagtg reverse gctgtgttggtgacgttgtc SFN forward ggatcccactcttcttgcag reverse ctgccactgtccagttctca CDA forward ctgaagcctgagtgtgtcca reverse tgagacggccttctggatag FBXO2 forward tccatagcgtcctcaccttc reverse cactttgtggcaagcactgt S100A2 forward atgagtgggaatggcaagag reverse ctgctccagagaactgcaca ATF3 forward gccattggagagctgtcttc reverse gggccatctggaacataaga BIA2 forward tctggtcttcttcggcctta reverse tatccttcaccccactccag FLJ22595 forward caaaccaaacaagcccaagt reverse cagccccaaacagttctcat DKFZP434N1235 forward gtgagcctgcgaaaaagaag reverse gtccaccatgcctttgtacc KIAA0888 forward accagcgaataccagtcac reverse agtgcttgcaaaggcatctt CDO1 forward acctgctgtgagccttcact reverse ggcaaacatacagcgaacct FAM50B forward caccatggagaaggacgagt reverse tgatggggcctagaaatgag RNASET2 forward gaagcatgagtgggaaaagc reverse tactctggcaagggcatctt TAC1 forward tcgcaaaatccaacatgaaa reverse aaagaactgctgaggcttgg LRCH4 forward gctgtgtcacccctcattct reverse ttggacaggtacaggggaac TES forward tgtgtcaaggatgccacaat reverse gccctcctcctaagacatcc CLU forward gtcaacggggtgaaacagat reverse tcaggcagggcttacactct TSPYL5 forward tgggaacagcgggaaccgt reverse ctgcatccctctcttccttc ADFP forward ccgtcgatttctttctccag reverse tgatggtcttcacaccgttc C9orf3 forward cttctgaggccaacttcagg reverse tgctcccagaacagaatgtg CLIC3 forward agctgtttgtcaaggcgagt reverse cgctgtcatagagcaggatg Hrasls3 forward acaaggccatcgtgaagaag reverse actccatagcgcagctcatt CST6 forward ctacttccgagacacgcaca reverse ggaaccacaaggacctcaaa NINJ2 forward ccctcatcagcctctctctg reverse cagccaggaaccctgtttta FGD6 forward ttgtatgccaagcttgttcg reverse ttctgtttcctccctgatgg GCHFR forward ggtgtctgcacaaggagtga reverse gacgcagggtttcagagaag RPP25 forward cgtgcgataattgctgctta reverse tctgaagcaggggaaagaaa SMPD3 forward gagggctgcatctctaccag reverse ccagactctgttgtgcctga SERPINF1 forward ttgagaagaagctgcgcata reverse accgagaaggagaatgctga ARHN forward tgggacacttcaggttcctc reverse cagtccgcatgtccagttta TGM2 forward gccataggcccaggatattt reverse cagctaaggctgttgggaag WISP2 forward ctccctgcctacacacacag reverse aaactccagaaaaggcagca C20orf35 forward tgtcgggagaagaccagact reverse ggcatcttgtccaacctcat BIK forward tgaagaggacctggacccta reverse ccctgatgtcctcagtctgg NXT2 forward cgacactgccagaacacact reverse ccctgaaacagcatttccat TFDP3 forward tcagggaacttttggaggtg reverse tctcactgaggtcgtcatcg TSPYL1 forward tgaccaagtcccgagcgacc reverse ggccttcggcgggaggctgg TSPYL3 forward ccacggcgactactccgagc reverse tcccactggatggcctccag TSPYL4 forward cctggctgctcccgaccatg reverse ccacggggctctccaagctg TSPYL6 forward cttgggcaacagcattaggt reverse cattcgcttcgcttagaagg β-actin forward aaaagccaccccacttctct reverse ctcaagttgggggacaaaaa Online Supplementary Table 2 - Kim et al. Primer sequences for methylation specific PCR (MSP) and bisulfite genomic sequencing (BGS) used in this study. TACSTD2 MSP Primer Sequence (5'-3') M F TATATTTTATTCGATTTGTTCGG R AACCGACTTAACCTTCCGTA U F TTTTATATTTTATTTGATTTGTTTGG R CAAAACCAACTTAACCTTCCATA BGS F TTATTGGTATTTGGGTGATATATTT R ACAATAAAACTCTTTAAACTTTCTACC CDA MSP M F ATATTTAAGGGGAGGAGTTGTAATC R TTCTAAACCATATTAATACCCCGAA U F TATTTAAGGGGAGGAGTTGTAATTGT R TTCTAAACCATATTAATACCCCAAA BGS F AGTGTGTTTATTAGTGAGAGTGG R ACACACTCAAACTTCAAAATACAAAC CDO1 MSP M F TTAGATTTGTGGGGTTTATTTTTTC R CCACCTTTCTTAAATAACTCTCCG U F TAGATTTGTGGGGTTTATTTTTTTG R CACCTTTCTTAAATAACTCTCCACC BGS F GTTAAAGTGGGGGAGAGATTG R TTCAAATCTATAAAATTCATCCTC RNASET2 MSP M F AGAGGTCGAGGTAGGAGTAGTTTC R CCCACTTACTAACGAAAAATAACG U F GAGAGGTTGAGGTAGGAGTAGTTTT R CCACTTACTAACAAAAAATAACACA BGS F GTTTTGGGTTGGGAGTAA R CCCACTTCCCACCTACTACC TAC1 MSP M F TTAGATTTGTAGACGGAAGTAGGTC R GTAATTAAAAATTTCCGAAACGAT U F AGATTTGTAGATGGAAGTAGGTTGT R CATAATTAAAAATTTCCAAAACAAT BGS F GGTTTAAGGAGGTTGGGATAAATAT R TTAAAAAACCAATCTCCCCACTAT TSPYL5 MSP M F GTGTTTTTGAAGTTGTTTTCGTC R CGAACTCGAACTTTAACGCG U F TGTGTTTTTGAAGTTGTTTTTGTT R AAAACAAACTCAAACTTTAACACA BGS F ATAGGTGGTGATGGTTTTTAG R AAACTCTAATACTATAAAAAATC CLIC3 MSP M F TTTTTTAAGTTTTTTTGTGCGTTTC R TTACTCAAACAACTAATTCTACGCG U F TTTTAAGTTTTTTTGTGTGTTTTGT R ACTCAAACAACTAATTCTACACACT BGS F TTTGGGGAGTTTTTTAAGTTTTTTT R CTAAAATCACACCCTCAAACTCAA CST6 MSP M F GATTTGTCGTTCGACGATTC R CGACCACCAACTAACTCTACG U F GGGATTTGTTGTTTGATGATTT R TACCAACCACCAACTAACTCTACAC BGS F GGTGTGTTTTGGAGGGTAGGGAAG R CTATTACTACCCATATTATAACTAACC BIK MSP M F GTTTTTTGATTTTTTTGTTCGTTTC R AAACTACCCCTCCACTACCG U F TTTTTGATTTTTTTGTTTGTTTTGT R AACTACCCCTCCACTACCAC BGS F GTTTGGAAGTTTTTTGATTTTTTTG R TCCAACTACATAACACACCCACTAC TFDP3 MSP M F GATATTGGATTGTTTAAAGGTTTTC R ATATCAATCTCACTAAAACTAACGAA U F ATTGGATTGTTTAAAGGTTTTTGG R TATCAATCTCACTAAAACTAACAAA BGS F GATATTGGATTGTTTAAAGGTTTT R CAAAATATATCAATCTCACTAAAACTAAC Online Supplementary Table 3 - Kim et al. Genes up- and down-regulated in 3 out of 4 glioma cell lines after treatment with 5-azadC and TSA by SAM analysis (FDR</=10%). 160 Positive Significant Genes (Up-regulated Genes) Gene ID Gene Title Ave. Fold Change 205700_at 3-hydroxysteroid epimerase 4.51723 206588_at deleted in azoospermia-like 11.70766 218966_at myosin 5C 2.44777 207180_s_at HIV-1 Tat interactive protein 2, 30kDa 3.79867 206218_at melanoma antigen, family B, 2 9.30517 210652_s_at chromosome 1 open reading frame 34 5.18257 219928_s_at calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2) 2.83923 205627_at cytidine deaminase 22.97368 205775_at DNA segment on chromosome 6(unique) 2654 expressed sequence 3.78819 215881_x_at synovial sarcoma, X breakpoint 3 2.97778 218094_s_at chromosome 20 open reading frame 35 2.84382 219529_at chloride intracellular channel 3 12.93814 203571_s_at adipose specific 2 27.17740 203786_s_at tumor protein D52-like 1 4.66233 209628_at hypothetical protein P15-2 3.02915 202286_s_at tumor-associated calcium signal transducer 2 9.94012 202719_s_at testis derived transcript (3 LIM domains) 7.48516 210233_at interleukin 1 receptor accessory protein 2.11739 221577_x_at prostate differentiation factor 5.75178 202704_at transducer of ERBB2, 1 2.00639 204268_at S100 calcium binding protein A2 7.21552 208792_s_at clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone 2.62200 217755_at hematological and neurological expressed 1 2.03761 209122_at adipose differentiation-related protein 6.86038 209270_at laminin, beta 3 3.30863 212848_s_at chromosome 9 open reading frame 3 2.20694 210437_at melanoma antigen, family A, 9 5.37259 201650_at keratin 19 44.71695 33322_i_at stratifin 9.56412 209260_at stratifin 15.92832 210619_s_at hyaluronoglucosaminidase 1 5.33884 216471_x_at synovial sarcoma, X breakpoint 2 8.79754 204134_at phosphodiesterase 2A, cGMP-stimulated 4.88273 208981_at platelet/endothelial cell adhesion molecule (CD31 antigen) 3.36022 220057_at G antigen, family D, 2 5.52070 218451_at hypothetical protein FLJ22969 3.29663 203917_at coxsackie virus and adenovirus receptor 4.89969 221805_at neurofilament, light polypeptide 68kDa 3.90021 209448_at HIV-1 Tat interactive protein 2, 30kDa 5.94066 211670_x_at 4.91805 214262_at complement component 1, q subcomponent binding protein 3.23270 33304_at interferon stimulated gene 20kDa 2.17032 203951_at calponin 1, basic, smooth muscle 5.29412 203407_at periplakin 3.96497 213467_at ras homolog gene family, member N 3.23985 210253_at HIV-1 Tat interactive protein 2, 30kDa 3.39439 206595_at cystatin E/M 3.49210 211003_x_at transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 3.22455 211731_x_at synovial sarcoma, X breakpoint 3 3.49418 219695_at hypothetical protein FLJ22593 3.17405 215734_at hypothetical protein IMAGE:4215339 6.63789 202957_at hematopoietic cell-specific Lyn substrate 1 2.21941 219305_x_at F-box only protein 2 4.15068 217984_at ribonuclease 6 precursor 2.11442 202411_at interferon, alpha-inducible protein 27 5.47341 206626_x_at synovial sarcoma, X breakpoint 1 5.19851 205245_at par-6 partitioning defective 6 homolog alpha (C.elegans) 2.05304 213620_s_at intercellular adhesion molecule 2 6.30709 202283_at serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithe 21.25825 210130_s_at transmembrane 7 superfamily member 2 2.25644 205780_at BCL2-interacting killer (apoptosis-inducing) 6.28840 219045_at ras homolog gene family, member F (in filopodia) 3.13501 219143_s_at hypothetical protein FLJ20374 4.25421 216462_at synovial sarcoma, X breakpoint 2 3.01995 208791_at clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone 2.43340 219901_at hypothetical protein FLJ11183 3.23623 204867_at GTP cyclohydrolase I feedback regulatory protein 3.15974 206552_s_at tachykinin, precursor 1 (substance K, substance P, neurokinin 1, neurokinin 2, neuro 7.14508 213506_at coagulation factor II (thrombin)
Load more

Recommended publications
  • Identification of Trichoplein, a Novel Keratin Filament- Binding Protein
    Research Article 1081 Identification of trichoplein, a novel keratin filament- binding protein Miwako Nishizawa1,*, Ichiro Izawa1,*, Akihito Inoko1,*, Yuko Hayashi1, Koh-ichi Nagata1, Tomoya Yokoyama1,2, Jiro Usukura3 and Masaki Inagaki1,‡ 1Division of Biochemistry, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan 2Department of Dermatology, Mie University Faculty of Medicine, 2-174 Edobashi, Tsu 514-8507, Japan 3Department of Anatomy and Cell Biology, Nagoya University School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-8550, Japan *These authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Accepted 29 November 2004 Journal of Cell Science 118, 1081-1090 Published by The Company of Biologists 2005 doi:10.1242/jcs.01667 Summary Keratins 8 and 18 (K8/18) are major components of the antibody in a complex with K8/18 and immunostaining intermediate filaments (IFs) of simple epithelia. We report revealed that trichoplein colocalized with K8/18 filaments here the identification of a novel protein termed in HeLa cells. In polarized Caco-2 cells, trichoplein trichoplein. This protein shows a low degree of sequence colocalized not only with K8/18 filaments in the apical similarity to trichohyalin, plectin and myosin heavy chain, region but also with desmoplakin, a constituent of and is a K8/18-binding protein. Among interactions desmosomes. In the absorptive cells of the small intestine, between trichoplein and various IF proteins that we trichoplein colocalized with K8/18 filaments at the apical tested using two-hybrid methods, trichoplein interacted cortical region, and was also concentrated at desmosomes.
    [Show full text]
  • Proteomic Expression Profile in Human Temporomandibular Joint
    diagnostics Article Proteomic Expression Profile in Human Temporomandibular Joint Dysfunction Andrea Duarte Doetzer 1,*, Roberto Hirochi Herai 1 , Marília Afonso Rabelo Buzalaf 2 and Paula Cristina Trevilatto 1 1 Graduate Program in Health Sciences, School of Medicine, Pontifícia Universidade Católica do Paraná (PUCPR), Curitiba 80215-901, Brazil; [email protected] (R.H.H.); [email protected] (P.C.T.) 2 Department of Biological Sciences, Bauru School of Dentistry, University of São Paulo, Bauru 17012-901, Brazil; [email protected] * Correspondence: [email protected]; Tel.: +55-41-991-864-747 Abstract: Temporomandibular joint dysfunction (TMD) is a multifactorial condition that impairs human’s health and quality of life. Its etiology is still a challenge due to its complex development and the great number of different conditions it comprises. One of the most common forms of TMD is anterior disc displacement without reduction (DDWoR) and other TMDs with distinct origins are condylar hyperplasia (CH) and mandibular dislocation (MD). Thus, the aim of this study is to identify the protein expression profile of synovial fluid and the temporomandibular joint disc of patients diagnosed with DDWoR, CH and MD. Synovial fluid and a fraction of the temporomandibular joint disc were collected from nine patients diagnosed with DDWoR (n = 3), CH (n = 4) and MD (n = 2). Samples were subjected to label-free nLC-MS/MS for proteomic data extraction, and then bioinformatics analysis were conducted for protein identification and functional annotation. The three Citation: Doetzer, A.D.; Herai, R.H.; TMD conditions showed different protein expression profiles, and novel proteins were identified Buzalaf, M.A.R.; Trevilatto, P.C.
    [Show full text]
  • Chemical Agent and Antibodies B-Raf Inhibitor RAF265
    Supplemental Materials and Methods: Chemical agent and antibodies B-Raf inhibitor RAF265 [5-(2-(5-(trifluromethyl)-1H-imidazol-2-yl)pyridin-4-yloxy)-N-(4-trifluoromethyl)phenyl-1-methyl-1H-benzp{D, }imidazol-2- amine] was kindly provided by Novartis Pharma AG and dissolved in solvent ethanol:propylene glycol:2.5% tween-80 (percentage 6:23:71) for oral delivery to mice by gavage. Antibodies to phospho-ERK1/2 Thr202/Tyr204(4370), phosphoMEK1/2(2338 and 9121)), phospho-cyclin D1(3300), cyclin D1 (2978), PLK1 (4513) BIM (2933), BAX (2772), BCL2 (2876) were from Cell Signaling Technology. Additional antibodies for phospho-ERK1,2 detection for western blot were from Promega (V803A), and Santa Cruz (E-Y, SC7383). Total ERK antibody for western blot analysis was K-23 from Santa Cruz (SC-94). Ki67 antibody (ab833) was from ABCAM, Mcl1 antibody (559027) was from BD Biosciences, Factor VIII antibody was from Dako (A082), CD31 antibody was from Dianova, (DIA310), and Cot antibody was from Santa Cruz Biotechnology (sc-373677). For the cyclin D1 second antibody staining was with an Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) (1:200 dilution). The pMEK1 fluorescence was developed using the Alexa Fluor 488 chicken anti-rabbit IgG second antibody (1:200 dilution).TUNEL staining kits were from Promega (G2350). Mouse Implant Studies: Biopsy tissues were delivered to research laboratory in ice-cold Dulbecco's Modified Eagle Medium (DMEM) buffer solution. As the tissue mass available from each biopsy was limited, we first passaged the biopsy tissue in Balb/c nu/Foxn1 athymic nude mice (6-8 weeks of age and weighing 22-25g, purchased from Harlan Sprague Dawley, USA) to increase the volume of tumor for further implantation.
    [Show full text]
  • Pflugers Final
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Serveur académique lausannois A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Sylvain Pradervand2, Annie Mercier Zuber1, Gabriel Centeno1, Olivier Bonny1,3,4 and Dmitri Firsov1,4 1 - Department of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland 2 - DNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland 3 - Service of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland 4 – these two authors have equally contributed to the study to whom correspondence should be addressed: Dmitri FIRSOV Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925406 Fax: ++ 41-216925355 e-mail: [email protected] and Olivier BONNY Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925417 Fax: ++ 41-216925355 e-mail: [email protected] 1 Abstract The distal parts of the renal tubule play a critical role in maintaining homeostasis of extracellular fluids. In this review, we present an in-depth analysis of microarray-based gene expression profiles available for microdissected mouse distal nephron segments, i.e., the distal convoluted tubule (DCT) and the connecting tubule (CNT), and for the cortical portion of the collecting duct (CCD) (Zuber et al., 2009). Classification of expressed transcripts in 14 major functional gene categories demonstrated that all principal proteins involved in maintaining of salt and water balance are represented by highly abundant transcripts. However, a significant number of transcripts belonging, for instance, to categories of G protein-coupled receptors (GPCR) or serine-threonine kinases exhibit high expression levels but remain unassigned to a specific renal function.
    [Show full text]
  • 1 Novel Expression Signatures Identified by Transcriptional Analysis
    ARD Online First, published on October 7, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on September 29, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009.
    [Show full text]
  • Human Epithelial Cell Intermediate Filaments: Isolation, Purification, and Characterization
    Human Epithelial Cell Intermediate Filaments: Isolation, Purification, and Characterization MARTHA WHITMAN AYNARDI, PETER M. STEINERT, and ROBERT D. GOLDMAN Department of Biological Sciences, Carnegie-Mellon University, Pittsburgh, Pennsylvania 15213; Dermatology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20205; and Department of Cell Biology and Anatomy, Northwestern University Medical School, Chicago, Illinois 60611 ABSTRACT Intermediate filaments (IF) isolated from human epithelial cells (HeLa) can be disassembled in 8 M urea and reassembled in phosphate-buffered solutions containing >0.1 mg/ml IF protein. Eight proteins were associated with HeLa IF after several disassembly- reassembly cycles as determined by sodium dodecyl sulfate gel electrophoresis (SDS PAGE). A rabbit antiserum directed against HeLa IF contained antibodies to most of these proteins. The immunofluorescence pattern that was seen in HeLa cells with this antiserum is complex. It consisted of a juxtanuclear accumulation of IF protein and a weblike array of cytoplasmic fibers extending to the cell border. Following preadsorption with individual HeLa IF proteins, the immunofluorescence pattern in HeLa cells was altered to suggest the presence of at least two distinct IF networks. The amino acid composition and a-helix content (-38%) of HeLa IF proteins was similar to the values obtained for other IF proteins. One-dimensional peptide maps show extensive homology between the major HeLa IF protein of 55,000-mol-wt and a similar 55,000-mol-wt protein obtained from hamster fibroblasts (BHK-21) . HeLa 55,000-mol- wt homopolymer IF assembled under conditions similar to those required for BHK-21 55,000- mol-wt homopolymers. Several other proteins present in HeLa IF preparations may be keratin- like structural proteins.
    [Show full text]
  • Keratin 7 Promoter Selectively Targets Transgene Expression to Normal and Neoplastic Pancreatic Ductal Cells in Vitro and in Vivo
    The FASEB Journal • Research Communication Keratin 7 promoter selectively targets transgene expression to normal and neoplastic pancreatic ductal cells in vitro and in vivo Judit Pujal,*,1 Meritxell Huch,†,§,1 Anabel Jose´,† Ibane Abasolo,* Annie Rodolosse,*,‡ ʈ ʈ Alba Duch,*,‡ Luis Sa´nchez-Palazo´n,† Frances J. D. Smith, W. H. Irwin McLean, Cristina Fillat,†,§,2 and Francisco X. Real*,‡,¶,2 *Unitat de Biologia Cel.lular i Molecular, Institut Municipal d’Investigacio´Me`dica, Parc de Recerca Biome`dica de Barcelona, Barcelona, Spain; †Centre de Regulacio´ Geno`mica and ‡Departament de Cie`ncies Experimentals i de la Salut, Universitat Pompeu Fabra, Barcelona, Spain; §Centro de ʈ Investigacio´n Biome´dica en Red de Enfermedades Raras, Barcelona, Spain; Epithelial Genetics Group, Division of Molecular Medicine, Colleges of Life Sciences and Medicine, Dentistry, and Nursing, University of Dundee, Dundee, UK; and ¶Programa de Patología Molecular, Centro Nacional de Investigaciones Oncolo´gicas, Madrid, Spain ABSTRACT Keratin 7 is expressed in simple epithelia homodimers result from the tissue-specific expression but is expressed at low or undetectable levels in gastroin- of each family member, for example, K8/K18 in simple testinal epithelial cells. In the pancreas, it is present in epithelia (1, 2). Much evidence on keratin function has ductal but not in acinar cells. K7 mRNA is overexpressed come from the analysis of genetically modified mice (3, in pancreatic cancers. Here we use luciferase reporter 4) and from the study of mutations in human keratin assays to analyze the tissue-specific regulatory elements of genes, which are associated with inherited diseases, murine keratin 7 (Krt7) promoter in vitro and in vivo.
    [Show full text]
  • Filaments and Phenotypes
    F1000Research 2019, 8(F1000 Faculty Rev):1703 Last updated: 30 SEP 2019 REVIEW Filaments and phenotypes: cellular roles and orphan effects associated with mutations in cytoplasmic intermediate filament proteins [version 1; peer review: 2 approved] Michael W. Klymkowsky Molecular, Cellular & Developmental Biology, University of Colorado, Boulder, Boulder, CO, 80303, USA First published: 30 Sep 2019, 8(F1000 Faculty Rev):1703 ( Open Peer Review v1 https://doi.org/10.12688/f1000research.19950.1) Latest published: 30 Sep 2019, 8(F1000 Faculty Rev):1703 ( https://doi.org/10.12688/f1000research.19950.1) Reviewer Status Abstract Invited Reviewers Cytoplasmic intermediate filaments (IFs) surround the nucleus and are 1 2 often anchored at membrane sites to form effectively transcellular networks. Mutations in IF proteins (IFps) have revealed mechanical roles in epidermis, version 1 muscle, liver, and neurons. At the same time, there have been phenotypic published surprises, illustrated by the ability to generate viable and fertile mice null for 30 Sep 2019 a number of IFp-encoding genes, including vimentin. Yet in humans, the vimentin (VIM) gene displays a high probability of intolerance to loss-of-function mutations, indicating an essential role. A number of subtle F1000 Faculty Reviews are written by members of and not so subtle IF-associated phenotypes have been identified, often the prestigious F1000 Faculty. They are linked to mechanical or metabolic stresses, some of which have been found commissioned and are peer reviewed before to be ameliorated by the over-expression of molecular chaperones, publication to ensure that the final, published version suggesting that such phenotypes arise from what might be termed “orphan” effects as opposed to the absence of the IF network per se, an idea is comprehensive and accessible.
    [Show full text]
  • In Silico Analysis of Gene Expression Data from Bald Frontal and Haired Occipital Scalp to Identify Candidate Genes in Male Androgenetic Alopecia
    Archives of Dermatological Research (2019) 311:815–824 https://doi.org/10.1007/s00403-019-01973-2 ORIGINAL PAPER In silico analysis of gene expression data from bald frontal and haired occipital scalp to identify candidate genes in male androgenetic alopecia A. Premanand1 · B. Reena Rajkumari1 Received: 5 September 2018 / Revised: 6 July 2019 / Accepted: 30 August 2019 / Published online: 11 September 2019 © Springer-Verlag GmbH Germany, part of Springer Nature 2019 Abstract Androgenetic alopecia (AGA) is a progressive dermatological disorder of frontal and vertex scalp hair loss leading to bald- ness in men. This study aimed to identify candidate genes involved in AGA through an in silico search strategy. The gene expression profle GS36169, which contains microarray gene expression data from bald frontal and haired occipital scalps of fve men with AGA, was downloaded from the Gene Expression Omnibus (GEO) database. The diferential gene expression analysis for all fve subjects was carried out separately by PUMA package in R and identifed 32 diferentially expressed genes (DEGs) common to all fve subjects. Gene ontology (GO) biological process and pathway- enrichment analyses of the DEGs were conducted separately for the up-regulated and down-regulated genes. ReactomeFIViz app was utilized to construct the protein functional interaction network for the DEGs. Through GO biological process and pathway analysis on the clusters of the Reactome FI network, we found that the down-regulated DEGs participate in Wnt signaling, TGF-beta signaling,
    [Show full text]
  • Keratin 7, Clone RCK105
    Keratin 7, 54 kD, clone RCK105 Monoclonal Antibody Catalog No.: MON3007 Quantity: 1 ml Specificity The monoclonal antibody RCK 105 is specifically reactive with keratin 7. In immunoblots, it reacts specifically with the 54 kD keratin protein (keratin 7). It shows cross reactivity with keratin 7 from human, hamster, mouse and potaroo kangaroo. Immunogen: cell line T24. Immunoglobulin type Murine IgG1 Use The antibody is useful for staining of Cytokeratin 7 in frozen sections. Cytokeratin 7 was found to occur in the columnar and glandular epithelium of the lung, cervix, breast, bile ducts, larger collecting ducts of the kidney and in mesothelium, but is absent from gastro-intestinal epithelium, hepatocytes, proximal and distal tubules of the kidney and myoepithelium. Keratin 7 could not be detected in the stratified epithelia of the skin, tongue, oesophagus or cervix but strongly stained urinary bladder transitional epithelium. The chain specific antibody to keratin 18 (M9) is able to distinguish between squamous cell carcinomas (M9 negative) on one hand, and adeno-carcinomas and mesotheliomas (M9 positive) on the other hand. The antibody to keratin 7 makes a subdivision within this latter group of tumors possible. Several types of adenocarcinomas of the gastro-intestinal tract and of the urinary tract are negative with RCK 105, while adenocarcinomas of the mammary gland, ovary and lung are positive. Instructions for use For immunohistochemistry on frozen sections fixation with acetone for 2 min. at -20°C is recommended. Working dilution: 1:5-1:10. Optimal dilution should be tested by serial dilutions. This antibody is also useful for Western blotting when applied undiluted although lesser amount of antibody could be sufficient therefore we recommend that each customer determines the optimal working dilution.
    [Show full text]
  • Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network
    The Journal of Immunology Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network Kai H. Ha¨nel,*,†,1,2 Carolina M. Pfaff,*,†,1 Christian Cornelissen,*,†,3 Philipp M. Amann,*,4 Yvonne Marquardt,* Katharina Czaja,* Arianna Kim,‡ Bernhard Luscher,€ †,5 and Jens M. Baron*,5 Atopic dermatitis, a chronic inflammatory skin disease with increasing prevalence, is closely associated with skin barrier defects. A cy- tokine related to disease severity and inhibition of keratinocyte differentiation is IL-31. To identify its molecular targets, IL-31–dependent gene expression was determined in three-dimensional organotypic skin models. IL-31–regulated genes are involved in the formation of an intact physical skin barrier. Many of these genes were poorly induced during differentiation as a consequence of IL-31 treatment, resulting in increased penetrability to allergens and irritants. Furthermore, studies employing cell-sorted skin equivalents in SCID/NOD mice demonstrated enhanced transepidermal water loss following s.c. administration of IL-31. We identified the IL-1 cytokine network as a downstream effector of IL-31 signaling. Anakinra, an IL-1R antagonist, blocked the IL-31 effects on skin differentiation. In addition to the effects on the physical barrier, IL-31 stimulated the expression of antimicrobial peptides, thereby inhibiting bacterial growth on the three-dimensional organotypic skin models. This was evident already at low doses of IL-31, insufficient to interfere with the physical barrier. Together, these findings demonstrate that IL-31 affects keratinocyte differentiation in multiple ways and that the IL-1 cytokine network is a major downstream effector of IL-31 signaling in deregulating the physical skin barrier.
    [Show full text]
  • The Importance of Inherited and Acquired Keratin Alterations in Liver Disease
    Department of Internal Medicine I, University Hospital Ulm Prof. Dr. Seufferlein The importance of inherited and acquired keratin alterations in liver disease Dissertation presented to the Medical Faculty of Ulm University to obtain the degree Doctor of Human Biology Nurdan Güldiken From Erzincan, Turkey 2014 Current Dean: Prof. Dr. Thomas Wirth Thesis reviewers: 1st reviewer: PD Dr. Pavel Strnad 2nd reviewer: Prof. Dr. biol. hum. Uwe Knippschild Date of doctorate awarded: 06.06.2014 To my parents and Ümit, TABLE OF CONTENTS ABBREVIATIONS………………………………………………………………….…...….IV 1. INTRODUCTION ....................................................................................................1 1.1. CYTOSKELETON AND INTERMEDIATE FILAMENTS ........................................................1 1.2. KERATINS-IFS OF EPITHELIAL CELLS ...........................................................................4 1.3. KERATIN EXPRESSION IN HEALTH AND DISEASES.........................................................4 1.4. MECHANICAL AND NON-MECHANICAL FUNCTION OF KERATINS ..................................5 1.5. POSTTRANSLATIONAL MODIFICATIONS OF KERATINS...................................................6 1.6. KERATINS-ASSOCIATED PROTEINS AND FUNCTIONS.....................................................6 1.7. KERATINS AS STRESS INDUCIBLE PROTEINS .................................................................7 1.8. TRANSGENIC ANIMALS AND HUMAN ASSOCIATION STUDIES REVEAL IMPORTANCE OF KERATINS IN THE LIVER ...............................................................................................7
    [Show full text]