DOCSLIB.ORG

Keratin 7 Promoter Selectively Targets Transgene Expression to Normal and Neoplastic Pancreatic Ductal Cells in Vitro and in Vivo

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Keratin 7 Promoter Selectively Targets Transgene Expression to Normal and Neoplastic Pancreatic Ductal Cells in Vitro and in Vivo The FASEB Journal • Research Communication Keratin 7 promoter selectively targets transgene expression to normal and neoplastic pancreatic ductal cells in vitro and in vivo Judit Pujal,*,1 Meritxell Huch,†,§,1 Anabel Jose´,† Ibane Abasolo,* Annie Rodolosse,*,‡ ʈ ʈ Alba Duch,*,‡ Luis Sa´nchez-Palazo´n,† Frances J. D. Smith, W. H. Irwin McLean, Cristina Fillat,†,§,2 and Francisco X. Real*,‡,¶,2 *Unitat de Biologia Cel.lular i Molecular, Institut Municipal d’Investigacio´Me`dica, Parc de Recerca Biome`dica de Barcelona, Barcelona, Spain; †Centre de Regulacio´ Geno`mica and ‡Departament de Cie`ncies Experimentals i de la Salut, Universitat Pompeu Fabra, Barcelona, Spain; §Centro de ʈ Investigacio´n Biome´dica en Red de Enfermedades Raras, Barcelona, Spain; Epithelial Genetics Group, Division of Molecular Medicine, Colleges of Life Sciences and Medicine, Dentistry, and Nursing, University of Dundee, Dundee, UK; and ¶Programa de Patología Molecular, Centro Nacional de Investigaciones Oncolo´gicas, Madrid, Spain ABSTRACT Keratin 7 is expressed in simple epithelia homodimers result from the tissue-specific expression but is expressed at low or undetectable levels in gastroin- of each family member, for example, K8/K18 in simple testinal epithelial cells. In the pancreas, it is present in epithelia (1, 2). Much evidence on keratin function has ductal but not in acinar cells. K7 mRNA is overexpressed come from the analysis of genetically modified mice (3, in pancreatic cancers. Here we use luciferase reporter 4) and from the study of mutations in human keratin assays to analyze the tissue-specific regulatory elements of genes, which are associated with inherited diseases, murine keratin 7 (Krt7) promoter in vitro and in vivo. All such as cryptogenic liver disease (5, 6). elements required for appropriate cell and tissue speci- K7 and K19 are expressed in a subset of simple ؊ ficity in reporter assays are present within the Krt7 234 epithelia; their function has not been well elucidated bp sequence. This fragment appears more selective to (3, 7). These polypeptides are of particular interest in pancreatic ductal cells than the Krt19 promoter. GC-rich the study of gastrointestinal and hepatic biology: K7/ sequences corresponding to putative Sp1, AP-2 binding K19 are expressed in a subset of cells in the pancreas, sites are essential for in vitro activity. Krt7-LacZ transgenic bile duct, kidney, breast, and bladder (1, 8). In the mice were generated to analyze in vivo activity. Sequences pancreas they are present in ductal and centroacinar located 1.5 or 0.25 kb upstream of the transcription cells but are absent from acinar and endocrine cells initiation site drive reporter expression to ductal, but not (8); in the liver they are restricted to the biliary acinar, cells in transgenic mice. LacZ mRNA was detected epithelium and are absent from hepatocytes (9). In in the pancreas as well as in additional epithelial tissues— general, K7 and K19 are coexpressed (8, 9); a remark- such as the intestine and the lung—using both promoter constructs. An AdK7Luc adenovirus was generated to able exception is the gastrointestinal epithelium, where assess targeting selectivity in vivo by intravenous injection K19 is present in all epithelial cells, whereas K7 is to immunocompetent mice and in a xenograft model of undetectable (1, 9). K7 is also regulated in the context pancreatic cancer. The ؊0.25 kb region showed pancreatic of differentiation in pancreatic ductal adenocarcinoma selectivity, high activity in pancreatic cancers, and sustained (PDAC) (10). transgene expression in xenografts. In conclusion, the krt7 The murine Krt19 promoter is suitable to drive promoter is useful to target pancreatic ductal adenocarci- transgene expression in pancreatic ductal cells as well noma cells in vitro and in vivo.—Pujal, J., Huch, M., Jose´, A., as in other tissues (11, 12), and it has been used to Abasolo, I., Rodolosse, A., Duch, A., Sa´nchez-Palazo´n, L., develop novel animal models of PDAC (13). By con- Smith, F. J. D., McLean, W. H. I., Fillat, C., Real, F. X. trast, the promoter of the gene coding for K7 has not Keratin 7 promoter selectively targets transgene expression to normal and neoplastic pancreatic ductal cells in vitro and 1 in vivo. FASEB J. 23, 1366–1375 (2009) These authors contributed equally to this work. 2 Correspondence: F.X.R., Programa de Patología Molecu- lar, Centro Nacional de Investigaciones Oncolo´gicas, Calle Key Words: cytokeratins ⅐ adenovirus ⅐ cystic fibrosis ⅐ biolu- Melchor Ferna´ndez Almagro 3, 28029-Madrid, Spain. E-mail: minescent imaging [email protected]; C.F., Centre de Regulacio´ Geno`mica-CRG, Edifici Parc de Recerca Biome`dica de Barcelona, Carrer del Dr. Aiguader, 88, 08003-Barcelona, Spain. E-mail: cristina. Keratins (k) are selectively expressed in epithelial fi[email protected] cells. In vivo, tetramers formed by pairs of 2 classes of doi: 10.1096/fj.08-115576 1366 0892-6638/09/0023-1366 © FASEB yet been characterized. A potential advantage of using GAATCTTCTTGTGA 3Ј; LacZ forward GACGTCTCGTTGCT- K7 regulatory sequences to target the expression of GCATAA, LacZ reverse CAGCAGCAGACCATTTTCAA; Krt19 Ј Ј transgenes is the fact that it has a more restricted tissue forward 5 CCTCCCGAGATTACAACCACT, Krt19 reverse 5 GGCGAGCATTGTCAATCTGT; Krt7 forward CACGAACAAG- distribution while maintaining a selective expression in GTGGAGTTGGA, Krt7 reverse TGTCTGAGATCTGCGACT- ductal cells in the pancreas. Because there is a dearth of GCA; Hprt forward GGC CAG ACT TTG TTG GAT TTG, Hprt knowledge on promoters that can target transgenes to reverse TGC GCT CAT CTT AGG CTT TGT. Total RNA was pancreatic ductal cells, the study of the K7 promoter is normalized using QuantumRNA 18S Internal Standards at a 1:4 a worthwhile endeavor. Here we analyze the murine ratio (Ambion), as indicated in the text. Krt7 promoter and identify regions required for pan- creatic ductal cell-restricted expression in vitro and Site-directed mutagenesis in vivo. In addition, we have addressed its ability to selectively drive transgene expression to the pancreas For site-directed mutagenesis, the Quick ChangeTM Site- by systemic adenoviral gene transfer (AdK7Luc) and to Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) was test the potency of this adenovirus in PDAC mouse used (Supplemental Information). PCR products were di- gested with DpnI, purified, and used for bacterial transfor- models. The regulatory sequences of murine Krt7 merit mation. Plasmids were verified by sequencing both DNA being used in additional studies to target transgenes to strands. pancreatic ductal cells, and possibly to other simple epithelial cell types. This work may contribute to im- Reporter assays proved genetic therapeutic strategies in conditions such as cystic fibrosis and PDAC. Cells were seeded in 24-well plates; 24 h later, cells were transfected using Gene Porter reagent (Gene Therapy Sys- tems, San Diego, CA, USA). pGL3-reporter plasmids (100 ng) MATERIALS AND METHODS were cotransfected with a plasmid encoding Renilla reniformes luciferase to normalize for transfection efficiency. Luciferase activity in total cell lysates, determined 48 h later, was Cell culture expressed as fold activity relative to the control plasmid after correction for transfection efficiency; in some cases results Tumor cell lines (see Supplemental Information) were main- were expressed per mg cellular protein. Experiments were tained as described elsewhere (10, 14). Human pancreatic performed in triplicate, and results were verified at least twice duct epithelial (HPDE) cells were maintained as described independently. The total amount of DNA transfected was elsewhere (15). always normalized using the corresponding empty vector. For in vitro adenoviral transduction studies, cells were Plasmid constructs seeded in triplicate at a density of 2 ϫ 104 cells/well in 96-well plates. After 24 h, cells were infected at 104 viral particles (vp) A 4.5 kb fragment of Krt7 isolated from a P1-derived artificial per cell; 72 h later, luciferase was assayed as described above chromosome (PAC) 129/Sv library (16) was digested to obtain and expressed per microgram of cellular protein. fragments ranging from Ϫ3723/ϩ32 to Ϫ55/ϩ32, which were cloned into pGL3 Basic Luciferase Reporter (Promega, Madi- Electrophoretic mobility shift assays (EMSAs) son, WI, USA). A Krt19 Ϫ1970/ϩ46 luciferase reporter (12) was generated similarly. Plasmid sequences were verified in both Nuclear extracts were prepared as described (17). Double- directions. stranded oligonucleotides (Supplemental Information) were radiolabeled with 32P-dATP; EMSAs were performed with 5 Immunocytochemistry ␮g of protein in a final volume of 20 ␮l binding buffer. Mixtures were incubated with 150 fmol of labeled double- K7 expression in pancreas was assayed as described previously stranded oligonucleotides for 30 min at 4°C. For competition (8). Cells were fixed with methanol:acetone (1:1), washed experiments, a 50-fold excess of unlabeled oligonucleotides with PBS, and incubated for 1 h with RCK105 (1:5 dilution of was added for 15 min at 4°C prior to radiolabeled probes. To hybridoma supernatant) (8), a kind gift of F. C. S. Ramaekers supershift, antibodies detecting Sp1 (PEP2-G; Santa Cruz (University of Maastricht, Maastricht,The Netherlands). After Biotechnology, Santa Cruz, CA, USA), Sp3 (D-20-G, Santa washing, cells were incubated with fluorescein-labeled anti- Cruz), or AP-2 (H-79, Santa Cruz) were added for 20 min at mouse Ig (Dako, Glostrup, Denmark), washed, and mounted. 4°C, prior to addition of radiolabeled probes. DNA-protein complexes were electrophoresed, and dried gels were ex- Reverse transcriptase-polymerase chain reaction posed to phosphorimager screens. analysis (RT-PCR) Generation of transgenic reporter mice using the RNA was isolated from cultured cells or mouse tissues using the Krt7 promoter RNeasy Extraction Kit (Qiagen, Hilden, Germany), treated with DNaseI, reverse transcribed using Moloney leukemia virus re- All animal experiments were approved by Departament verse transcriptase (Ambion, Austin, TX, USA), and amplified d’Agricultura Ramaderia i Pesca (DARP), Generalitat de for 32–40 cycles according to transcript abundance.
Load more

Recommended publications
  • Identification of Trichoplein, a Novel Keratin Filament- Binding Protein
    Research Article 1081 Identification of trichoplein, a novel keratin filament- binding protein Miwako Nishizawa1,*, Ichiro Izawa1,*, Akihito Inoko1,*, Yuko Hayashi1, Koh-ichi Nagata1, Tomoya Yokoyama1,2, Jiro Usukura3 and Masaki Inagaki1,‡ 1Division of Biochemistry, Aichi Cancer Center Research Institute, 1-1 Kanokoden, Chikusa-ku, Nagoya 464-8681, Japan 2Department of Dermatology, Mie University Faculty of Medicine, 2-174 Edobashi, Tsu 514-8507, Japan 3Department of Anatomy and Cell Biology, Nagoya University School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-8550, Japan *These authors contributed equally to this work ‡Author for correspondence (e-mail: [email protected]) Accepted 29 November 2004 Journal of Cell Science 118, 1081-1090 Published by The Company of Biologists 2005 doi:10.1242/jcs.01667 Summary Keratins 8 and 18 (K8/18) are major components of the antibody in a complex with K8/18 and immunostaining intermediate filaments (IFs) of simple epithelia. We report revealed that trichoplein colocalized with K8/18 filaments here the identification of a novel protein termed in HeLa cells. In polarized Caco-2 cells, trichoplein trichoplein. This protein shows a low degree of sequence colocalized not only with K8/18 filaments in the apical similarity to trichohyalin, plectin and myosin heavy chain, region but also with desmoplakin, a constituent of and is a K8/18-binding protein. Among interactions desmosomes. In the absorptive cells of the small intestine, between trichoplein and various IF proteins that we trichoplein colocalized with K8/18 filaments at the apical tested using two-hybrid methods, trichoplein interacted cortical region, and was also concentrated at desmosomes.
    [Show full text]
  • Proteomic Expression Profile in Human Temporomandibular Joint
    diagnostics Article Proteomic Expression Profile in Human Temporomandibular Joint Dysfunction Andrea Duarte Doetzer 1,*, Roberto Hirochi Herai 1 , Marília Afonso Rabelo Buzalaf 2 and Paula Cristina Trevilatto 1 1 Graduate Program in Health Sciences, School of Medicine, Pontifícia Universidade Católica do Paraná (PUCPR), Curitiba 80215-901, Brazil; [email protected] (R.H.H.); [email protected] (P.C.T.) 2 Department of Biological Sciences, Bauru School of Dentistry, University of São Paulo, Bauru 17012-901, Brazil; [email protected] * Correspondence: [email protected]; Tel.: +55-41-991-864-747 Abstract: Temporomandibular joint dysfunction (TMD) is a multifactorial condition that impairs human’s health and quality of life. Its etiology is still a challenge due to its complex development and the great number of different conditions it comprises. One of the most common forms of TMD is anterior disc displacement without reduction (DDWoR) and other TMDs with distinct origins are condylar hyperplasia (CH) and mandibular dislocation (MD). Thus, the aim of this study is to identify the protein expression profile of synovial fluid and the temporomandibular joint disc of patients diagnosed with DDWoR, CH and MD. Synovial fluid and a fraction of the temporomandibular joint disc were collected from nine patients diagnosed with DDWoR (n = 3), CH (n = 4) and MD (n = 2). Samples were subjected to label-free nLC-MS/MS for proteomic data extraction, and then bioinformatics analysis were conducted for protein identification and functional annotation. The three Citation: Doetzer, A.D.; Herai, R.H.; TMD conditions showed different protein expression profiles, and novel proteins were identified Buzalaf, M.A.R.; Trevilatto, P.C.
    [Show full text]
  • Chemical Agent and Antibodies B-Raf Inhibitor RAF265
    Supplemental Materials and Methods: Chemical agent and antibodies B-Raf inhibitor RAF265 [5-(2-(5-(trifluromethyl)-1H-imidazol-2-yl)pyridin-4-yloxy)-N-(4-trifluoromethyl)phenyl-1-methyl-1H-benzp{D, }imidazol-2- amine] was kindly provided by Novartis Pharma AG and dissolved in solvent ethanol:propylene glycol:2.5% tween-80 (percentage 6:23:71) for oral delivery to mice by gavage. Antibodies to phospho-ERK1/2 Thr202/Tyr204(4370), phosphoMEK1/2(2338 and 9121)), phospho-cyclin D1(3300), cyclin D1 (2978), PLK1 (4513) BIM (2933), BAX (2772), BCL2 (2876) were from Cell Signaling Technology. Additional antibodies for phospho-ERK1,2 detection for western blot were from Promega (V803A), and Santa Cruz (E-Y, SC7383). Total ERK antibody for western blot analysis was K-23 from Santa Cruz (SC-94). Ki67 antibody (ab833) was from ABCAM, Mcl1 antibody (559027) was from BD Biosciences, Factor VIII antibody was from Dako (A082), CD31 antibody was from Dianova, (DIA310), and Cot antibody was from Santa Cruz Biotechnology (sc-373677). For the cyclin D1 second antibody staining was with an Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) (1:200 dilution). The pMEK1 fluorescence was developed using the Alexa Fluor 488 chicken anti-rabbit IgG second antibody (1:200 dilution).TUNEL staining kits were from Promega (G2350). Mouse Implant Studies: Biopsy tissues were delivered to research laboratory in ice-cold Dulbecco's Modified Eagle Medium (DMEM) buffer solution. As the tissue mass available from each biopsy was limited, we first passaged the biopsy tissue in Balb/c nu/Foxn1 athymic nude mice (6-8 weeks of age and weighing 22-25g, purchased from Harlan Sprague Dawley, USA) to increase the volume of tumor for further implantation.
    [Show full text]
  • Pflugers Final
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Serveur académique lausannois A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Sylvain Pradervand2, Annie Mercier Zuber1, Gabriel Centeno1, Olivier Bonny1,3,4 and Dmitri Firsov1,4 1 - Department of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland 2 - DNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland 3 - Service of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland 4 – these two authors have equally contributed to the study to whom correspondence should be addressed: Dmitri FIRSOV Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925406 Fax: ++ 41-216925355 e-mail: [email protected] and Olivier BONNY Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925417 Fax: ++ 41-216925355 e-mail: [email protected] 1 Abstract The distal parts of the renal tubule play a critical role in maintaining homeostasis of extracellular fluids. In this review, we present an in-depth analysis of microarray-based gene expression profiles available for microdissected mouse distal nephron segments, i.e., the distal convoluted tubule (DCT) and the connecting tubule (CNT), and for the cortical portion of the collecting duct (CCD) (Zuber et al., 2009). Classification of expressed transcripts in 14 major functional gene categories demonstrated that all principal proteins involved in maintaining of salt and water balance are represented by highly abundant transcripts. However, a significant number of transcripts belonging, for instance, to categories of G protein-coupled receptors (GPCR) or serine-threonine kinases exhibit high expression levels but remain unassigned to a specific renal function.
    [Show full text]
  • 1 Novel Expression Signatures Identified by Transcriptional Analysis
    ARD Online First, published on October 7, 2009 as 10.1136/ard.2009.108043 Ann Rheum Dis: first published as 10.1136/ard.2009.108043 on 7 October 2009. Downloaded from Novel expression signatures identified by transcriptional analysis of separated leukocyte subsets in SLE and vasculitis 1Paul A Lyons, 1Eoin F McKinney, 1Tim F Rayner, 1Alexander Hatton, 1Hayley B Woffendin, 1Maria Koukoulaki, 2Thomas C Freeman, 1David RW Jayne, 1Afzal N Chaudhry, and 1Kenneth GC Smith. 1Cambridge Institute for Medical Research and Department of Medicine, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK 2Roslin Institute, University of Edinburgh, Roslin, Midlothian, EH25 9PS, UK Correspondence should be addressed to Dr Paul Lyons or Prof Kenneth Smith, Department of Medicine, Cambridge Institute for Medical Research, Addenbrooke’s Hospital, Hills Road, Cambridge, CB2 0XY, UK. Telephone: +44 1223 762642, Fax: +44 1223 762640, E-mail: [email protected] or [email protected] Key words: Gene expression, autoimmune disease, SLE, vasculitis Word count: 2,906 The Corresponding Author has the right to grant on behalf of all authors and does grant on behalf of all authors, an exclusive licence (or non-exclusive for government employees) on a worldwide basis to the BMJ Publishing Group Ltd and its Licensees to permit this article (if accepted) to be published in Annals of the Rheumatic Diseases and any other BMJPGL products to exploit all subsidiary rights, as set out in their licence (http://ard.bmj.com/ifora/licence.pdf). http://ard.bmj.com/ on September 29, 2021 by guest. Protected copyright. 1 Copyright Article author (or their employer) 2009.
    [Show full text]
  • Human Epithelial Cell Intermediate Filaments: Isolation, Purification, and Characterization
    Human Epithelial Cell Intermediate Filaments: Isolation, Purification, and Characterization MARTHA WHITMAN AYNARDI, PETER M. STEINERT, and ROBERT D. GOLDMAN Department of Biological Sciences, Carnegie-Mellon University, Pittsburgh, Pennsylvania 15213; Dermatology Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20205; and Department of Cell Biology and Anatomy, Northwestern University Medical School, Chicago, Illinois 60611 ABSTRACT Intermediate filaments (IF) isolated from human epithelial cells (HeLa) can be disassembled in 8 M urea and reassembled in phosphate-buffered solutions containing >0.1 mg/ml IF protein. Eight proteins were associated with HeLa IF after several disassembly- reassembly cycles as determined by sodium dodecyl sulfate gel electrophoresis (SDS PAGE). A rabbit antiserum directed against HeLa IF contained antibodies to most of these proteins. The immunofluorescence pattern that was seen in HeLa cells with this antiserum is complex. It consisted of a juxtanuclear accumulation of IF protein and a weblike array of cytoplasmic fibers extending to the cell border. Following preadsorption with individual HeLa IF proteins, the immunofluorescence pattern in HeLa cells was altered to suggest the presence of at least two distinct IF networks. The amino acid composition and a-helix content (-38%) of HeLa IF proteins was similar to the values obtained for other IF proteins. One-dimensional peptide maps show extensive homology between the major HeLa IF protein of 55,000-mol-wt and a similar 55,000-mol-wt protein obtained from hamster fibroblasts (BHK-21) . HeLa 55,000-mol- wt homopolymer IF assembled under conditions similar to those required for BHK-21 55,000- mol-wt homopolymers. Several other proteins present in HeLa IF preparations may be keratin- like structural proteins.
    [Show full text]
  • Filaments and Phenotypes
    F1000Research 2019, 8(F1000 Faculty Rev):1703 Last updated: 30 SEP 2019 REVIEW Filaments and phenotypes: cellular roles and orphan effects associated with mutations in cytoplasmic intermediate filament proteins [version 1; peer review: 2 approved] Michael W. Klymkowsky Molecular, Cellular & Developmental Biology, University of Colorado, Boulder, Boulder, CO, 80303, USA First published: 30 Sep 2019, 8(F1000 Faculty Rev):1703 ( Open Peer Review v1 https://doi.org/10.12688/f1000research.19950.1) Latest published: 30 Sep 2019, 8(F1000 Faculty Rev):1703 ( https://doi.org/10.12688/f1000research.19950.1) Reviewer Status Abstract Invited Reviewers Cytoplasmic intermediate filaments (IFs) surround the nucleus and are 1 2 often anchored at membrane sites to form effectively transcellular networks. Mutations in IF proteins (IFps) have revealed mechanical roles in epidermis, version 1 muscle, liver, and neurons. At the same time, there have been phenotypic published surprises, illustrated by the ability to generate viable and fertile mice null for 30 Sep 2019 a number of IFp-encoding genes, including vimentin. Yet in humans, the vimentin (VIM) gene displays a high probability of intolerance to loss-of-function mutations, indicating an essential role. A number of subtle F1000 Faculty Reviews are written by members of and not so subtle IF-associated phenotypes have been identified, often the prestigious F1000 Faculty. They are linked to mechanical or metabolic stresses, some of which have been found commissioned and are peer reviewed before to be ameliorated by the over-expression of molecular chaperones, publication to ensure that the final, published version suggesting that such phenotypes arise from what might be termed “orphan” effects as opposed to the absence of the IF network per se, an idea is comprehensive and accessible.
    [Show full text]
  • In Silico Analysis of Gene Expression Data from Bald Frontal and Haired Occipital Scalp to Identify Candidate Genes in Male Androgenetic Alopecia
    Archives of Dermatological Research (2019) 311:815–824 https://doi.org/10.1007/s00403-019-01973-2 ORIGINAL PAPER In silico analysis of gene expression data from bald frontal and haired occipital scalp to identify candidate genes in male androgenetic alopecia A. Premanand1 · B. Reena Rajkumari1 Received: 5 September 2018 / Revised: 6 July 2019 / Accepted: 30 August 2019 / Published online: 11 September 2019 © Springer-Verlag GmbH Germany, part of Springer Nature 2019 Abstract Androgenetic alopecia (AGA) is a progressive dermatological disorder of frontal and vertex scalp hair loss leading to bald- ness in men. This study aimed to identify candidate genes involved in AGA through an in silico search strategy. The gene expression profle GS36169, which contains microarray gene expression data from bald frontal and haired occipital scalps of fve men with AGA, was downloaded from the Gene Expression Omnibus (GEO) database. The diferential gene expression analysis for all fve subjects was carried out separately by PUMA package in R and identifed 32 diferentially expressed genes (DEGs) common to all fve subjects. Gene ontology (GO) biological process and pathway- enrichment analyses of the DEGs were conducted separately for the up-regulated and down-regulated genes. ReactomeFIViz app was utilized to construct the protein functional interaction network for the DEGs. Through GO biological process and pathway analysis on the clusters of the Reactome FI network, we found that the down-regulated DEGs participate in Wnt signaling, TGF-beta signaling,
    [Show full text]
  • Keratin 7, Clone RCK105
    Keratin 7, 54 kD, clone RCK105 Monoclonal Antibody Catalog No.: MON3007 Quantity: 1 ml Specificity The monoclonal antibody RCK 105 is specifically reactive with keratin 7. In immunoblots, it reacts specifically with the 54 kD keratin protein (keratin 7). It shows cross reactivity with keratin 7 from human, hamster, mouse and potaroo kangaroo. Immunogen: cell line T24. Immunoglobulin type Murine IgG1 Use The antibody is useful for staining of Cytokeratin 7 in frozen sections. Cytokeratin 7 was found to occur in the columnar and glandular epithelium of the lung, cervix, breast, bile ducts, larger collecting ducts of the kidney and in mesothelium, but is absent from gastro-intestinal epithelium, hepatocytes, proximal and distal tubules of the kidney and myoepithelium. Keratin 7 could not be detected in the stratified epithelia of the skin, tongue, oesophagus or cervix but strongly stained urinary bladder transitional epithelium. The chain specific antibody to keratin 18 (M9) is able to distinguish between squamous cell carcinomas (M9 negative) on one hand, and adeno-carcinomas and mesotheliomas (M9 positive) on the other hand. The antibody to keratin 7 makes a subdivision within this latter group of tumors possible. Several types of adenocarcinomas of the gastro-intestinal tract and of the urinary tract are negative with RCK 105, while adenocarcinomas of the mammary gland, ovary and lung are positive. Instructions for use For immunohistochemistry on frozen sections fixation with acetone for 2 min. at -20°C is recommended. Working dilution: 1:5-1:10. Optimal dilution should be tested by serial dilutions. This antibody is also useful for Western blotting when applied undiluted although lesser amount of antibody could be sufficient therefore we recommend that each customer determines the optimal working dilution.
    [Show full text]
  • Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network
    The Journal of Immunology Control of the Physical and Antimicrobial Skin Barrier by an IL-31–IL-1 Signaling Network Kai H. Ha¨nel,*,†,1,2 Carolina M. Pfaff,*,†,1 Christian Cornelissen,*,†,3 Philipp M. Amann,*,4 Yvonne Marquardt,* Katharina Czaja,* Arianna Kim,‡ Bernhard Luscher,€ †,5 and Jens M. Baron*,5 Atopic dermatitis, a chronic inflammatory skin disease with increasing prevalence, is closely associated with skin barrier defects. A cy- tokine related to disease severity and inhibition of keratinocyte differentiation is IL-31. To identify its molecular targets, IL-31–dependent gene expression was determined in three-dimensional organotypic skin models. IL-31–regulated genes are involved in the formation of an intact physical skin barrier. Many of these genes were poorly induced during differentiation as a consequence of IL-31 treatment, resulting in increased penetrability to allergens and irritants. Furthermore, studies employing cell-sorted skin equivalents in SCID/NOD mice demonstrated enhanced transepidermal water loss following s.c. administration of IL-31. We identified the IL-1 cytokine network as a downstream effector of IL-31 signaling. Anakinra, an IL-1R antagonist, blocked the IL-31 effects on skin differentiation. In addition to the effects on the physical barrier, IL-31 stimulated the expression of antimicrobial peptides, thereby inhibiting bacterial growth on the three-dimensional organotypic skin models. This was evident already at low doses of IL-31, insufficient to interfere with the physical barrier. Together, these findings demonstrate that IL-31 affects keratinocyte differentiation in multiple ways and that the IL-1 cytokine network is a major downstream effector of IL-31 signaling in deregulating the physical skin barrier.
    [Show full text]
  • The Importance of Inherited and Acquired Keratin Alterations in Liver Disease
    Department of Internal Medicine I, University Hospital Ulm Prof. Dr. Seufferlein The importance of inherited and acquired keratin alterations in liver disease Dissertation presented to the Medical Faculty of Ulm University to obtain the degree Doctor of Human Biology Nurdan Güldiken From Erzincan, Turkey 2014 Current Dean: Prof. Dr. Thomas Wirth Thesis reviewers: 1st reviewer: PD Dr. Pavel Strnad 2nd reviewer: Prof. Dr. biol. hum. Uwe Knippschild Date of doctorate awarded: 06.06.2014 To my parents and Ümit, TABLE OF CONTENTS ABBREVIATIONS………………………………………………………………….…...….IV 1. INTRODUCTION ....................................................................................................1 1.1. CYTOSKELETON AND INTERMEDIATE FILAMENTS ........................................................1 1.2. KERATINS-IFS OF EPITHELIAL CELLS ...........................................................................4 1.3. KERATIN EXPRESSION IN HEALTH AND DISEASES.........................................................4 1.4. MECHANICAL AND NON-MECHANICAL FUNCTION OF KERATINS ..................................5 1.5. POSTTRANSLATIONAL MODIFICATIONS OF KERATINS...................................................6 1.6. KERATINS-ASSOCIATED PROTEINS AND FUNCTIONS.....................................................6 1.7. KERATINS AS STRESS INDUCIBLE PROTEINS .................................................................7 1.8. TRANSGENIC ANIMALS AND HUMAN ASSOCIATION STUDIES REVEAL IMPORTANCE OF KERATINS IN THE LIVER ...............................................................................................7
    [Show full text]
  • SUPPORTING INFORMATION for Regulation of Gene Expression By
    SUPPORTING INFORMATION for Regulation of gene expression by the BLM helicase correlates with the presence of G4 motifs Giang Huong Nguyen1,2, Weiliang Tang3, Ana I. Robles1, Richard P. Beyer4, Lucas T. Gray5, Judith A. Welsh1, Aaron J. Schetter1, Kensuke Kumamoto1,6, Xin Wei Wang1, Ian D. Hickson2,7, Nancy Maizels5, 3,8 1 Raymond J. Monnat, Jr. and Curtis C. Harris 1Laboratory of Human Carcinogenesis, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, U.S.A; 2Department of Medical Oncology, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, University of Oxford, Oxford, U.K.; 3Department of Pathology, University of Washington, Seattle, WA U.S.A.; 4 Center for Ecogenetics and Environmental Health, University of Washington, Seattle, WA U.S.A.; 5Department of Immunology and Department of Biochemistry, University of Washington, Seattle, WA U.S.A.; 6Department of Organ Regulatory Surgery, Fukushima Medical University, Fukushima, Japan; 7Cellular and Molecular Medicine, Nordea Center for Healthy Aging, University of Copenhagen, Denmark; 8Department of Genome Sciences, University of WA, Seattle, WA U.S.A. SI Index: Supporting Information for this manuscript includes the following 19 items. A more detailed Materials and Methods section is followed by 18 Tables and Figures in order of their appearance in the manuscript text: 1) SI Materials and Methods 2) Figure S1. Study design and experimental workflow. 3) Figure S2. Immunoblot verification of BLM depletion from human fibroblasts. 4) Figure S3. PCA of mRNA and miRNA expression in BLM-depleted human fibroblasts. 5) Figure S4. qPCR confirmation of mRNA array data. 6) Table S1. BS patient and control detail.
    [Show full text]