DOCSLIB.ORG

Identification of Key Genes in Calcific Aortic Valve Disease Via Weighted

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Key Genes in Calcific Aortic Valve Disease Via Weighted Sun et al. BMC Med Genomics (2021) 14:135 https://doi.org/10.1186/s12920-021-00989-w RESEARCH Open Access Identifcation of key genes in calcifc aortic valve disease via weighted gene co-expression network analysis Jin‑Yu Sun1†, Yang Hua1†, Hui Shen1, Qiang Qu1, Jun‑Yan Kan1, Xiang‑Qing Kong1, Wei Sun1* and Yue‑Yun Shen2* Abstract Background: Calcifc aortic valve disease (CAVD) is the most common subclass of valve heart disease in the elderly population and a primary cause of aortic valve stenosis. However, the underlying mechanisms remain unclear. Methods: The gene expression profles of GSE83453, GSE51472, and GSE12644 were analyzed by ‘limma’ and ‘weighted gene co‑expression network analysis (WGCNA)’ package in R to identify diferentially expressed genes (DEGs) and key modules associated with CAVD, respectively. Then, enrichment analysis was performed based on Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway, DisGeNET, and TRRUST database. Protein–protein interaction network was constructed using the overlapped genes of DEGs and key modules, and we identifed the top 5 hub genes by mixed character calculation. Results: We identifed the blue and yellow modules as the key modules. Enrichment analysis showed that leukocyte migration, extracellular matrix, and extracellular matrix structural constituent were signifcantly enriched. SPP1, TNC, SCG2, FAM20A, and CD52 were identifed as hub genes, and their expression levels in calcifed or normal aortic valve samples were illustrated, respectively. Conclusions: This study suggested that SPP1, TNC, SCG2, FAM20A, and CD52 might be hub genes associated with CAVD. Further studies are required to elucidate the underlying mechanisms and provide potential therapeutic targets. Keywords: Calcifc aortic valve disease, Weighted gene co‑expression network analysis, Diferentially expressed genes, Integrated bioinformatics analysis Introduction sclerosis occurred in 26% of these patients [2, 3]. Consid- Calcifc aortic valve disease (CAVD) is the most com- ering the prolonged life expectancy and aging of the pop- mon subclass of valve heart disease in the elderly popu- ulation, the burden of CAVD is expected to substantially lation and a primary cause of aortic valve stenosis [1]. It increase from 2.5 million in 2000 to 4.5 million in 2030 was reported that the incidence of aortic valve stenosis [4], thus conferring a high economic and health burden was 2% in patients ≥ 65 years old, whereas aortic valve worldwide [5, 6]. In CAVD, the fbro-calcifc remodeling and patho- logical thickening of the aortic valve disturb pressure *Correspondence: [email protected]; [email protected] †Jin‑Yu Sun and Yang Hua contributed equally to this work overload and hemodynamic stability. Te following pro- 1 Department of Cardiology, The First Afliated Hospital of Nanjing gressive cardiac outfow obstruction and left ventricular Medical University, Nanjing 210000, China hypertrophy are likely to result in heart failure and even 2 Department of Cardiology, Liyang People’s Hospital, Liyang 213300, China premature death within a few years [4, 7]. Accumulating © The Author(s) 2021. Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creat iveco mmons. org/ licen ses/ by/4. 0/. The Creative Commons Public Domain Dedication waiver (http:// creat iveco mmons. org/ publi cdoma in/ zero/1. 0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Sun et al. BMC Med Genomics (2021) 14:135 Page 2 of 12 studies have revealed that CAVD is a complex multi- Vienna, Austria). Te probe IDs were converted into gene stage disease with sequential and interacting processes, symbols according to the annotation fle. For multiple including endothelial dysfunction/injury, lipid deposi- probes mapping to a single gene, the average expression tion, infammation, extracellular matrix remodeling, value of all its corresponding probes was used. Impor- dystrophic calcifcation, and so forth [8–10]. However, tantly, the batch efect was corrected using the combat mechanisms underlying the development or progression function of the ‘SVA’ package, which is a widely used of CAVD remain unclear, and there lacks conservative empirical Bayes method for batch correction [19]. To treatment against CAVD. Surgical or transcatheter aortic control the false discovery rate caused by multiple testing, valve replacement is the only available treatment, while the adjusted P-value was applied. After pre-processing, pharmacotherapy beyond valve replacement is still lim- DEGs between calcifed and normal aortic valve samples ited [5, 11]. were screened with a threshold of adjusted P-value < 0.05 Weighted gene co-expression network analysis and |log2 fold‐change (FC)| ≥ 0.5 by ‘limma’ package. Fur- (WGCNA) is a bioinformatics algorithm [12], which thermore, the DEGs were visualized as a volcano plot and has been widely applied to explore the changes of tran- heatmap using ‘ggplot2’ and ‘pheatmap’ package. scriptome expression patterns in complex diseases and to identify gene modules associated with clinical fea- tures [13–15]. Compared with the standardized analy- Weighted gene co‐expression network analysis (WGCNA) sis of diferentially expressed genes (DEGs), WGCNA is WGCNA is an algorithm for constructing a co-expres- a powerful systematic analysis method to recognize the sion network, which reveals the correlation patterns higher-order correlation between genes instead of detect- across genes and provides the biologically functional ing disease-related individual genes. Our study identifed interpretations of network modules. As previously DEGs between calcifed and normal aortic valve samples described [20], we selected the top 25% most variant based on the gene expression profles of GSE83453 and genes in GSE83453 to construct a co-expression net- GSE51472, GSE12644. Moreover, WGCNA was per- work using the ‘WGCNA’ package (version 1.60). After formed on the GSE83453 dataset to screen key genes and evaluating the presence of obvious outliers by cluster modules related to CAVD. Ten, the enrichment analysis analysis, the one-step network construction function was of genes in key modules was used to explore the molecu- used to construct the co-expression network and iden- lar mechanisms underlying CAVD. Finally, we identifed tify key modules. Moreover, to identify the signifcance hub genes related to CAVD and establish a protein–pro- of each module, we summarized the module eigengene tein interaction (PPI) network. (ME) based on the frst principal component of the mod- ule expression, and the module-trait relationships were Materials and methods assessed according to the correlation between MEs and Microarray data clinical traits. Ten, we evaluated the correlation strength Te gene expression profles of GSE83453 [16], by module signifcance (MS), referring to the average GSE51472 [17], and GSE12644 [18] were acquired from absolute gene signifcance (GS) of all genes within one the Gene Expression Omnibus database. All three gene module. Notably, the GS value was determined by the expression profles were acquired from human samples. log10-transformation of the P-value in the linear regres- Dataset GSE83453 was performed based on the plat- sion between expression and clinical traits. In general, form GPL10558 (Illumina HumanHT-12 V4.0 expression the modules with the highest MS values were considered beadchip), which includes 9 calcifed aortic valve samples as the key modules. and 8 normal aortic valve samples [16]. Series GSE51472 Furthermore, we used the modulePreservation func- was performed by GPL570 (Afymetrix Human Genome tion to evaluate the preservation levels of key modules. U133 Plus 2.0 Array) and included 5 calcifed aortic Zsummary analysis combines diferent preservation sta- valve samples and 5 normal aortic valve samples [17]. tistics into one single overall measure of preservation. GSE12644, based on the GPL570 platform, included 10 According to WGCNA instruction, a higher Zsummary calcifed and 10 normal aortic valve samples (Fig. 1). value indicated the stronger the evidence that a module should be preserved: the module with Zsummary value < 2 Data pre‑processing and DEG screening indicated ‘no evidence’, 2 < ­Zsummary value < 10 indicated ‘weak evidence’, and Z value > 10 indicated strong We performed log2-transformation, background correc- summary tion, and quantile normalization on the expression pro- evidence. Additionally, to confrm the clustering ability fles of GSE83453, GSE51472, and GSE12644 using the of the key modules, we also performed principal compo- ‘linear models for microarray data (limma)’ package in R nent analysis (PCA) on the gene expression profle of the 3.6.1 software (R Foundation for Statistical Computing,
Load more

Recommended publications
  • Searching for Novel Peptide Hormones in the Human Genome Olivier Mirabeau
    Searching for novel peptide hormones in the human genome Olivier Mirabeau To cite this version: Olivier Mirabeau. Searching for novel peptide hormones in the human genome. Life Sciences [q-bio]. Université Montpellier II - Sciences et Techniques du Languedoc, 2008. English. tel-00340710 HAL Id: tel-00340710 https://tel.archives-ouvertes.fr/tel-00340710 Submitted on 21 Nov 2008 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITE MONTPELLIER II SCIENCES ET TECHNIQUES DU LANGUEDOC THESE pour obtenir le grade de DOCTEUR DE L'UNIVERSITE MONTPELLIER II Discipline : Biologie Informatique Ecole Doctorale : Sciences chimiques et biologiques pour la santé Formation doctorale : Biologie-Santé Recherche de nouvelles hormones peptidiques codées par le génome humain par Olivier Mirabeau présentée et soutenue publiquement le 30 janvier 2008 JURY M. Hubert Vaudry Rapporteur M. Jean-Philippe Vert Rapporteur Mme Nadia Rosenthal Examinatrice M. Jean Martinez Président M. Olivier Gascuel Directeur M. Cornelius Gross Examinateur Résumé Résumé Cette thèse porte sur la découverte de gènes humains non caractérisés codant pour des précurseurs à hormones peptidiques. Les hormones peptidiques (PH) ont un rôle important dans la plupart des processus physiologiques du corps humain.
    [Show full text]
  • Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1
    [CANCER RESEARCH 63, 1382–1388, March 15, 2003] Growth and Molecular Profile of Lung Cancer Cells Expressing Ectopic LKB1: Down-Regulation of the Phosphatidylinositol 3؅-Phosphate Kinase/PTEN Pathway1 Ana I. Jimenez, Paloma Fernandez, Orlando Dominguez, Ana Dopazo, and Montserrat Sanchez-Cespedes2 Molecular Pathology Program [A. I. J., P. F., M. S-C.], Genomics Unit [O. D.], and Microarray Analysis Unit [A. D.], Spanish National Cancer Center, 28029 Madrid, Spain ABSTRACT the cell cycle in G1 (8, 9). However, the intrinsic mechanism by which LKB1 activity is regulated in cells and how it leads to the suppression Germ-line mutations in LKB1 gene cause the Peutz-Jeghers syndrome of cell growth is still unknown. It has been proposed that growth (PJS), a genetic disease with increased risk of malignancies. Recently, suppression by LKB1 is mediated through p21 in a p53-dependent LKB1-inactivating mutations have been identified in one-third of sporadic lung adenocarcinomas, indicating that LKB1 gene inactivation is critical in mechanism (7). In addition, it has been observed that LKB1 binds to tumors other than those of the PJS syndrome. However, the in vivo brahma-related gene 1 protein (BRG1) and this interaction is required substrates of LKB1 and its role in cancer development have not been for BRG1-induced growth arrest (10). Similar to what happens in the completely elucidated. Here we show that overexpression of wild-type PJS, Lkb1 heterozygous knockout mice show gastrointestinal hamar- LKB1 protein in A549 lung adenocarcinomas cells leads to cell-growth tomatous polyposis and frequent hepatocellular carcinomas (11, 12). suppression. To examine changes in gene expression profiles subsequent to Interestingly, the hamartomas, but not the malignant tumors, arising in exogenous wild-type LKB1 in A549 cells, we used cDNA microarrays.
    [Show full text]
  • Signature Redacted Thesis Supervisor Certified By
    Single-Cell Transcriptomics of the Mouse Thalamic Reticular Nucleus by Taibo Li S.B., Massachusetts Institute of Technology (2015) Submitted to the Department of Electrical Engineering and Computer Science in partial fulfillment of the requirements for the degree of Master of Engineering in Electrical Engineering and Computer Science at the MASSACHUSETTS INSTITUTE OF TECHNOLOGY June 2017 @ Massachusetts Institute of Technology 2017. All rights reserved. A uthor ... ..................... Department of Electrical Engineering and Computer Science May 25, 2017 Certified by. 3ignature redacted Guoping Feng Poitras Professor of Neuroscience, MIT Signature redacted Thesis Supervisor Certified by... Kasper Lage Assistant Professor, Harvard Medical School Thesis Supervisor Accepted by . Signature redacted Christopher Terman Chairman, Masters of Engineering Thesis Committee MASSACHUSETTS INSTITUTE 0) OF TECHNOLOGY w AUG 14 2017 LIBRARIES 2 Single-Cell Transcriptomics of the Mouse Thalamic Reticular Nucleus by Taibo Li Submitted to the Department of Electrical Engineering and Computer Science on May 25, 2017, in partial fulfillment of the requirements for the degree of Master of Engineering in Electrical Engineering and Computer Science Abstract The thalamic reticular nucleus (TRN) is strategically located at the interface between the cortex and the thalamus, and plays a key role in regulating thalamo-cortical in- teractions. Current understanding of TRN neurobiology has been limited due to the lack of a comprehensive survey of TRN heterogeneity. In this thesis, I developed an integrative computational framework to analyze the single-nucleus RNA sequencing data of mouse TRN in a data-driven manner. By combining transcriptomic, genetic, and functional proteomic data, I discovered novel insights into the molecular mecha- nisms through which TRN regulates sensory gating, and suggested targeted follow-up experiments to validate these findings.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • Secretoneurin (L-18): Sc-54326
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . Secretoneurin (L-18): sc-54326 BACKGROUND APPLICATIONS Secretoneurin-2 (Sg II), also known as SCG2, Chromogranin-C or CHGC, is a Secretoneurin (L-18) is recommended for detection of secretoneurin and 617 amino acid precursor protein that is cleaved to produce a 32 amino acid secretogranin II of mouse, rat and human origin by Western Blotting (start - active peptide known as Secretoneurin (or SN). Secretoneurin is a secreted ing dilution 1:200, dilution range 1:100-1:1000), immunoprecipitation [1-2 µg peptide that is thought to exert chemotaxic effects on specific cells, indicating per 100-500 µg of total protein (1 ml of cell lysate)], immunofluorescence a possible role in cellular movement in response to environmental stimuli. T he (starting dilution 1:50, dilution range 1:50-1:500) and solid phase ELISA gene encoding the Secretoneurin-2 precursor maps to human chromosome 2, (starting dilution 1:30, dilution range 1:30-1:3000). which houses over 1,400 genes and comprises nearly 8% of the human genome. Harlequin icthyosis, a rare and morbid skin deformity, is associated Secretoneurin (L-18) is also recommended for detection of secretoneurin with mutations in the chromosome 2-localized ABCA12 gene, while the lipid and secretogranin II in additional species, including equine, canine, bovine metabolic disorder sitosterolemia is associated with defects in the ABCG5 and porcine. and ABCG8 genes, which also map to chromosome 2. Suitable for use as control antibody for Sg II siRNA (h): sc-39381, Sg II siRNA (m): sc-39382, Sg II shRNA Plasmid (h): sc-39381-SH, Sg II shRNA REFERENCES Plasmid (m): sc-39382-SH, Sg II shRNA (h) Lentiviral Particles: sc-39381-V 1.
    [Show full text]
  • Genome-Wide Expression Profiling Establishes Novel Modulatory Roles
    Batra et al. BMC Genomics (2017) 18:252 DOI 10.1186/s12864-017-3635-4 RESEARCHARTICLE Open Access Genome-wide expression profiling establishes novel modulatory roles of vitamin C in THP-1 human monocytic cell line Sakshi Dhingra Batra, Malobi Nandi, Kriti Sikri and Jaya Sivaswami Tyagi* Abstract Background: Vitamin C (vit C) is an essential dietary nutrient, which is a potent antioxidant, a free radical scavenger and functions as a cofactor in many enzymatic reactions. Vit C is also considered to enhance the immune effector function of macrophages, which are regarded to be the first line of defence in response to any pathogen. The THP- 1 cell line is widely used for studying macrophage functions and for analyzing host cell-pathogen interactions. Results: We performed a genome-wide temporal gene expression and functional enrichment analysis of THP-1 cells treated with 100 μM of vit C, a physiologically relevant concentration of the vitamin. Modulatory effects of vitamin C on THP-1 cells were revealed by differential expression of genes starting from 8 h onwards. The number of differentially expressed genes peaked at the earliest time-point i.e. 8 h followed by temporal decline till 96 h. Further, functional enrichment analysis based on statistically stringent criteria revealed a gamut of functional responses, namely, ‘Regulation of gene expression’, ‘Signal transduction’, ‘Cell cycle’, ‘Immune system process’, ‘cAMP metabolic process’, ‘Cholesterol transport’ and ‘Ion homeostasis’. A comparative analysis of vit C-mediated modulation of gene expression data in THP-1cells and human skin fibroblasts disclosed an overlap in certain functional processes such as ‘Regulation of transcription’, ‘Cell cycle’ and ‘Extracellular matrix organization’, and THP-1 specific responses, namely, ‘Regulation of gene expression’ and ‘Ion homeostasis’.
    [Show full text]
  • Network-Based Prediction of Drug Combinations
    Corrected: Publisher correction ARTICLE https://doi.org/10.1038/s41467-019-09186-x OPEN Network-based prediction of drug combinations Feixiong Cheng1,2,3,4,5, Istvań A. Kovacś1,2 & Albert-Laszló ́Barabasí1,2,6,7 Drug combinations, offering increased therapeutic efficacy and reduced toxicity, play an important role in treating multiple complex diseases. Yet, our ability to identify and validate effective combinations is limited by a combinatorial explosion, driven by both the large number of drug pairs as well as dosage combinations. Here we propose a network-based methodology to identify clinically efficacious drug combinations for specific diseases. By 1234567890():,; quantifying the network-based relationship between drug targets and disease proteins in the human protein–protein interactome, we show the existence of six distinct classes of drug–drug–disease combinations. Relying on approved drug combinations for hypertension and cancer, we find that only one of the six classes correlates with therapeutic effects: if the targets of the drugs both hit disease module, but target separate neighborhoods. This finding allows us to identify and validate antihypertensive combinations, offering a generic, powerful network methodology to identify efficacious combination therapies in drug development. 1 Center for Complex Networks Research and Department of Physics, Northeastern University, Boston, MA 02115, USA. 2 Center for Cancer Systems Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02215, USA. 3 Genomic Medicine Institute, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 44106, USA. 4 Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine, Case Western Reserve University, Cleveland, OH 44195, USA. 5 Case Comprehensive Cancer Center, Case Western Reserve University School of Medicine, Cleveland, OH 44106, USA.
    [Show full text]
  • Development of Network-Based Analysis Methods with Application to the Genetic Component of Asthma Yuanlong Liu
    Development of network-based analysis methods with application to the genetic component of asthma Yuanlong Liu To cite this version: Yuanlong Liu. Development of network-based analysis methods with application to the genetic com- ponent of asthma. Human genetics. Université Sorbonne Paris Cité, 2017. English. NNT : 2017US- PCC329. tel-02466418 HAL Id: tel-02466418 https://tel.archives-ouvertes.fr/tel-02466418 Submitted on 4 Feb 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Thèse de doctorat de l’Université Sorbonne Paris Cité Préparé à l’Université Paris Diderot ÉCOLE DOCTORALE PIERRE LOUIS DE SANTÉ PUBLIQUE À PARIS ÉPIDÉMIOLOGIE ET SCIENCES DE L’INFORMATION BIOMÉDICALE (ED 393) Unité de recherche: UMR 946 - Variabilité Génétique et Maladies Humaines DOCTORAT Spécialité: Epidémiologie Génétique Yuanlong LIU Development of network-based analysis methods with application to the genetic component of asthma Thèse dirigée par Florence DEMENAIS Présentée et soutenue publiquement à Paris le 13 Novembre 2017 JURY M. Bertram MÜLLER-MYHSOK Professeur, Technische Universität München Rapporteur Mme Kristel VAN STEEN Professeur, Université de Liège Rapporteur M. Benno SCHWIKOWSKI Directeur de Recherche, Institut Pasteur Examinateur M. Mohamed NADIF Professeur, Université Paris-Descartes Examinateur M.
    [Show full text]
  • Catecholamine Storage Vesicles: Role of Core Protein Genetic Polymorphisms in Hypertension
    Curr Hypertens Rep (2011) 13:36–45 DOI 10.1007/s11906-010-0170-y Catecholamine Storage Vesicles: Role of Core Protein Genetic Polymorphisms in Hypertension Kuixing Zhang & Yuqing Chen & Gen Wen & Manjula Mahata & Fangwen Rao & Maple M. Fung & Sucheta Vaingankar & Nilima Biswas & Jiaur R. Gayen & Ryan S. Friese & Sushil K. Mahata & Bruce A. Hamilton & Daniel T. O’Connor Published online: 24 November 2010 # The Author(s) 2010. This article is published with open access at Springerlink.com Abstract Hypertension is a complex trait with deranged heritability and individuals with the most extreme blood autonomic control of the circulation. The sympathoadrenal pressure values in the population to study hypertension. system exerts minute-to-minute control over cardiac output and vascular tone. Catecholamine storage vesicles (or Keywords Genetics . Hypertension . Catecholamine . chromaffin granules) of the adrenal medulla contain Granins . Blood pressure . CHGA . CHGB . SCG2 . remarkably high concentrations of chromogranins/secretog- Heritability ranins (or “granins”), catecholamines, neuropeptide Y, adenosine triphosphate (ATP), and Ca2+. Within secretory granules, granins are co-stored with catecholamine neuro- Introduction: The Sympathoadrenal System transmitters and co-released upon stimulation of the and Granins regulated secretory pathway. The principal granin family members, chromogranin A (CHGA), chromogranin B The sympathoadrenal system exerts minute-to-minute con- (CHGB), and secretogranin II (SCG2), may have evolved trol over cardiac output and vascular tone. Genes governing from shared ancestral exons by gene duplication. This catecholaminergic processes may play a role in the article reviews human genetic variation at loci encoding the development of hypertension. Catecholamine storage major granins and probes the effects of such polymor- vesicles (or chromaffin granules) of the adrenal medulla phisms on blood pressure, using twin pairs to probe (Fig.
    [Show full text]
  • Targeted Mutation of Secretogranin-2 Disrupts Sexual Behavior and Reproduction in Zebrafish
    Targeted mutation of secretogranin-2 disrupts sexual behavior and reproduction in zebrafish Kimberly Mitchella, Wo Su Zhanga, Chunyu Lua, Binbin Taob, Lu Chenb, Wei Hub,1, and Vance L. Trudeaua,1 aDepartment of Biology, University of Ottawa, Ottawa, ON K1N 6N5, Canada; and bState Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, The Innovation Academy of Seed Design, Chinese Academy of Sciences, 430072 Wuhan, China Edited by R. Michael Roberts, University of Missouri, Columbia, MO, and approved April 24, 2020 (received for review February 3, 2020) † The luteinizing hormone surge is essential for fertility as it triggers forms, dopamine, gamma-aminobutyric acid (GABA), neuropeptide- ovulation in females and sperm release in males. We previously Y, and recent research has focused on gonadotropin-inhibitory reported that secretoneurin-a, a neuropeptide derived from the pro- hormone (7), kisspeptins (8), and tachykinins (9), as in mammalian cessing of secretogranin-2a (Scg2a), stimulates luteinizing hormone re- model systems. lease, suggesting a role in reproduction. Here we provide evidence that Fish, while sharing numerous similarities with mammals, offer mutation of the scg2a and scg2b genes using TALENs in zebrafish unique features that can provide alternative strategies for the dis- reduces sexual behavior, ovulation, oviposition, and fertility. Large- covery of new regulatory systems critical for reproduction and in- scale spawning within-line crossings (n = 82 to 101) were conducted. novative ways in which to enhance fertility. To varying degrees, teleost Wild-type (WT) males paired with WT females successfully spawned in species have lost the hypothalamo-hypophysial portal system typical 62% of the breeding trials.
    [Show full text]
  • Chromogranin C (SCG2) (NM 003469) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC117954 Chromogranin C (SCG2) (NM_003469) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Chromogranin C (SCG2) (NM_003469) Human Untagged Clone Tag: Tag Free Symbol: SCG2 Synonyms: CHGC; EM66; SgII; SN Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Chromogranin C (SCG2) (NM_003469) Human Untagged Clone – SC117954 Fully Sequenced ORF: >OriGene ORF within SC117954 sequence for NM_003469 edited (data generated by NextGen Sequencing) ATGGCTGAAGCAAAGACCCACTGGCTTGGAGCAGCCCTGTCTCTTATCCCTTTAATTTTC CTCATCTCTGGGGCTGAAGCAGCTTCATTTCAGAGAAACCAGCTGCTTCAGAAAGAACCA GACCTCAGGTTGGAAAATGTCCAAAAGTTTCCCAGTCCTGAAATGATCAGGGCTTTGGAG TACATAGAAAACCTCCGACAACAAGCTCATAAGGAAGAAAGCAGCCCAGATTATAATCCC TACCAAGGTGTCTCTGTCCCCCTTCAGCAAAAAGAAAATGGCGATGAAAGCCACTTGCCC GAGAGGGATTCACTGAGTGAAGAAGACTGGATGAGAATAATACTCGAAGCTTTGAGACAG GCTGAAAATGAGCCTCAGTCTGCACCAAAAGAAAATAAGCCCTATGCCTTGAATTCAGAA AAGAACTTTCCAATGGACATGAGTGATGATTATGAGACACAGCAGTGGCCAGAAAGAAAG CTTAAGCACATGCAATTCCCTCCTATGTATGAAGAGAATTCCAGGGATAACCCCTTTAAA CGCACAAATGAAATAGTGGAGGAACAATATACTCCTCAAAGCCTTGCTACATTGGAATCT GTCTTCCAAGAGCTGGGGAAACTGACAGGACCAAACAACCAGAAACGTGAGAGGATGGAT
    [Show full text]