Houseflies As Potential Vectors for Antibiotic Resistant Bacteria THESIS

Houseflies as Potential Vectors for Antibiotic Resistant Bacteria

THESIS

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University

Wenfei Wang

Graduate Program in Food Science and Nutrition

The Ohio State University

2013

Master's Examination Committee:

Dr. Hua Wang, Advisor

Dr. Curtis Lynn Knipe

Dr. Zhongtang Yu

Copyrighted by

Wenfei Wang

2013

Abstract

The rapid emergence of antibiotic resistant (ART) pathogens is a growing public health concern. Although the roles of antibiotics in clinical medicine and food animal production have been clearly implicated, there is a growing body of evidence that commensal bacteria, environmental factors and animal hosts are also playing important roles in the emergence, dissemination and evolution of antibiotic resistance (AR).

Recently a number of insect vectors have been identified as potential carriers of ART pathogenic bacteria, suggesting that these insects may serve as an important avenue of disseminating disease-causing agents to the environment and hosts. Since horizontal gene transfer is crucial to the rapid dissemination of AR, and commensal bacteria, instead of pathogens, serve as the main avenue disseminating AR genes in microbial ecosystems, an important knowledge gap to be closed is whether the insects are also carriers of ART commensal bacteria, and whether the prevalence is correlated to the environment the insects are exposed to. Therefore, the objectives of this study were to reveal the prevalence of ART commensal bacteria from houseflies collected from agricultural and residential environments, and to analyze the genetic elements of ART commensals for an improved understanding of the risk factors associated with AR ecology.

Houseflies (Musca domestica) were sampled from four different locations: indoors and outdoors at a poultry barn; and outdoors at two residential areas. The flies were captured ii using flytraps, identified, homogenized and plated on media containing different antibiotics. Conventional and quantitative PCR were used to screen for the presence of representative antibiotic resistance-encoding genes. Representative tetr, ermr, sulr encoding genes were found in up to 18.2% and 19.2% of the commensal isolates from houseflies collected at the indoor and outdoor locations at the poultry barn. Bacterial population recovered from samples from the two residential locations had a significantly lower percentage of resistant isolates (7.1% and 0.5%, respectively). Enterococcus sp.,

Staphylococcus sp., Providencia sp., Vagococcus sp. and Alcaligenes sp. were among the identified AR gene carriers with several isolates showing resistance to multiple antibiotics and carrying multiple resistance genes. These results suggest that houseflies may serve as potential vectors disseminating AR gene-containing bacteria in the environment and to hosts. The data also indicated a potential correlation between exposure to animal facility and the prevalence of AR-gene containing bacteria in houseflies. Results from this study will contribute to an improved understanding regarding potential community risks of AR dissemination due to insects that are exposed to various environmental conditions, which is essential for public health and targeted strategies for AR mitigation.

iii

Dedication

Dedicated to my family and friends

Acknowledgments

I would like to thank Dr. Hua H. Wang, my advisor and true mentor, for her encouragement, guidance, and support throughout my undergraduate and graduate program. Thank you for sharing your thoughts and providing valuable advice on all aspects of my life. Your patience and dedication were priceless to me. I would also like to thank Dr. Lynn Knipe and Dr. Zhongtang Yu for serving as my committee members and providing helpful suggestions on my master’s studies and research. I would also like to show my appreciation for the help of Dr. Timothy Buckley, the initiator and co-author of this project, for his support and effort during all phases of this study.

I am very grateful to Ying Huang, Lu Zhang, Xiaojing Li, Xinhui Li, Linlin Xiao, Yi

Shao for their assistance and guidance during my research. I want to thank all my friends and my family for their understanding and support.

I am also thankful to OARDC SEEDS Program and The Ohio State University

Fellowship for providing financial support to make this research possible.

Vita

2002-2007…………………………………...Simba International School, Ndola - Zambia

2008-2011……………………………….B.S. Honors Biology, The Ohio State University

2008-2011………………...... International Buckeye Scholarship, The Ohio

State University

2011-2012………………………………….Student Employee, The Ohio State University

2012-Present……………………………...Graduate Student, Department of Food Science

and Technology, The Ohio State University

2012-2013…………………University Fellowship, The Ohio State University

2012-2013……………………Graduate Teaching Assistant, Department of Food Science

and Technology, The Ohio State University

Fields of Study

Major Field: Food Science and Nutrition

Table of Contents

Abstract ...... ii

Dedication ...... iv

Acknowledgments ...... v

Vita ...... vi

List of Tables ...... viii

List of Figures ...... ix

Chapter 1: Introduction and Literature Review...... 1

Chapter 2: Houseflies as Potential Vectors for Antibiotic Resistant Bacteria ...... 40

Bibliography ...... 66

vii

List of Tables

Table 1.1. Common antibiotic classes ...... 14

Table 1.2. Hospital-acquired infections by selected resistant bacteria in the U.S. (2002).

...... 29

Table 1.3. Leading foodborne pathogens in the U.S. (2000-2008)...... 30

Table 1.4. Sales and distribution of antimicrobial drugs for food-producing animals

(2010) ...... 31

Table 2.1. Primers for AR gene detection...... 58

Table 2.2. AR gene determinants and representative AR gene carriers from housefly samples ...... 61

Table 2.3. Persistence of resistance within resistant isolates ...... 63

viii

List of Figures

Figure 1.1. Representative antibiotics from natural products ...... 6

Figure 1.2. Representative antibiotics of synthetic origin ...... 9

Figure 1.3. Incidences of three antibiotic resistant pathogens since 1980 ...... 16

Figure 1.4. Main reservoirs of antibiotic resistance ...... 25

Figure 1.5. Worldwide causes of death ...... 28

Figure 1.6. Housefly lifecycle: complete metamorphosis ...... 34

Figure 2.1. Prevalence of bacteria with phenotypic resistance to antibiotics from housefly samples ...... 60

Figure 2.2. Phenotypic multidrug resistant isolates from housefly samples...... 60

Figure 2.3. Distribution of resistant isolates carrying multiple resistance genes ...... 62

Figure 2.4. AR gene pools in housefly samples...... 62

Figure 2.5. pCC1FOS™ vector map ...... 64

Figure 2.6. Agarose gel electrophoresis of Tetr sub-clones ...... 65

Chapter 1

Introduction and Literature Review

1.1 Introduction

Antibiotics were initially defined as substances or compounds (secondary metabolites) produced by certain microorganisms that could kill or inhibit the growth of other microorganisms. Today, antibiotics also include many synthetic compounds with similar functions such as β-lactams, cephalosporins and carbapenems (Khardori, 2006). Since the initial discovery, antibiotics have been broadly used in human and veterinary medicine, agricultural production and food processing, and have been essential for protecting human and animal health against pathogens. Countless once-deadly bacterial infections have been effectively treated by antibiotics, greatly enhanced the life expectancy and quality of lives of human beings worldwide. It has been recorded that as of today, more than 5000 antibiotics have been discovered and about 100 are actively used to treat human and animal infections (Khardori, 2006).

The extensive applications of antibiotics, however, have also been linked to the pervasive antibiotic resistance (AR) problem, which started shortly after the first applications of antibiotics in the 1930s when sulfonamide‐resistant Streptococcus pyogenes, methicillin‐ resistant Staphylococcus aureus (MRSA) and streptomycin‐resistant Mycobacterium tuberculosis were first isolated in hospitals (Levy and Marshall, 2004). In recent years, the rapid emergence of hospital-acquired infections by antibiotic resistant (ART) pathogens and opportunistic pathogens, such as MRSA, Clostridium difficile, vancomycin-resistant Enterococci (VRE) and fluoroquinolone-resistant Pesudomonas aeruginosa (FQRP) have become a major public health threat (Lipps, 2008; Moritz and

Hergenrother, 2007; Ciarán and LaMont, 2008).

Meanwhile, antibiotics are also widely used in agriculture, particularly in food animal production, where they are applied not only to treat diseases, but also as prophylactics to prevent and limit the spread of diseases as well as growth promoters in production (United

States General Accounting Office, 2004). When antibiotics are used as growth promoters, they are provided at low doses for an extended period of time in large groups of animals

(United States General Accounting Office, 2004). The lasting selective pressure within the food animal production ecosystem favors the microorganisms which acquired resistance determinants with increased fitness and competitive advantage over other microorganisms. In fact, numerous studies have documented multiple ART pathogens including Salmonella sp., Escherichia coli O157:H7, Campylobacter sp., Listeria monocytogenes, and MRSA from these intensive animal farming facilities and a number

2 of these pathogens have also been isolated from humans in close proximity of these facilities (Hur et al., 2011; Schroeder et al., 2002; Saenz et al., 2000; Srinivasan et al.,

2005; Lee, 2003).

Due to the rapid emergence of AR, we are facing the dilemma of eventually having no

“magical” antibiotics to effectively control infections caused by multi-drug resistant pathogens, such as MRSA, VRE, and FQRP, especially in immunocompromised patients

(Arias & Murray, 2009). In addition, even for patients who eventually recover, it takes longer and more extensive treatment for infections by resistant bacteria. It is estimated that the economic burden of AR is between $150 million to $30 billion a year in U.S., due to the loss in healthcare and productivity (Levy & Marshall, 2004). Therefore, controlling the spread of AR has become a priority for agencies and organizations such as the WHO, Centers for Disease Control and Prevention (CDC), Food and Drug

Administration (FDA) and the National Institutes of Health (WHO, 2001; Interagency

Task Force on Antimicrobial Resistance, 2011). In order to control further AR spread, the

European Union has banned the use of antibiotics as growth promoters in agriculture (Ferber,

2003; Larson, 2007). In Australia, the National Prescribing Service has gone a step further and introduced a media campaign to curtail antibiotic prescriptions for viral infections

(Wutzke et al., 2007). In North America, more stringent regulations of antibiotics use in animals have also been proposed in the Unites States (FDA, 2012).

It is now a general belief that the rapid emergence of AR is a consequence of the ubiquity of antibiotic use and misuse; that the usefulness of antibacterial agents will continue to decrease and that resistance will inevitably emerge in almost all species and against all drugs without proper targeted controls. Taking into account the accelerated emergence of resistance and the slow introduction of new effective drugs, there’s now a great need to extend the lifespan of these once “magical drugs” and to be aware of the potential recurrence of fatal bacterial infection caused by multi‐resistant superbugs. In the past, the prudent use of antibiotics has been primarily focused on whether to use antibiotics or not in clinical treatments and food animal production. But because both animals and humans inevitably will get sick, the strategy of minimizing the use of antibiotics may be not productive and even problematic, as the lack of prompt antibiotic interference or prevention can potentially lead to the development of more serious and chronic disease conditions. In fact, accumulating evidences in the past few years suggest that many risk factors contributed to the rapid development, amplification, dissemination and persistence of AR. Effective AR mitigation can only be achieved based on a comprehensive understanding of the major risk factors. This part of the study summarizes the commonly used antibiotic classes, antibiotic resistance mechanisms, its development and occurrence along the antibiotic development timeline, addresses its impact on healthcare, agriculture and the economy, and proposes potential avenues of dissemination of antibiotic determinants.

1.2 Antibiotics

1.2.1 Classes of Antibiotics

Antibiotics can be classified by their mechanisms of action (bactericidal or bacteriostatic), spectrum of activity (broad or narrow), routes of administration (oral or injection), or most of the time, by their chemical structures. The chemical structures of major classes of naturally derived antibiotics (e.g. β‐lactams, tetracyclines, macrolides, and aminoglycosides) and synthetic antibiotics are shown in Figure 1.1.and 1.2. Table 1.1 includes a brief summary of the major classes of antibiotics.

One class among the most used antibiotics in clinical therapy is the β‐lactam antibiotics, which refers to as the antibiotic agents containing a β-lactam in their molecular structure.

These antibiotics are usually bactericidal against Gram‐positive and Gram‐negative bacteria through interference with the biosynthesis of the peptidoglycan layer in bacterial cell walls by irreversibly blocking penicillin-binding proteins (PBPs), including carboxypeptidases, endopeptidases and transpeptidases. PBPs are a group of proteins that facilitate crosslinking of newly synthesized peptidoglycan to the existing cell wall structure (Fontana, 1990). Once treated with β-lactam antibiotics, susceptible bacterial cells develop a weak cell wall and are eventually subject to cell lysis. Four major classes of antibiotics and their derivatives belong to the β-lactam antibiotics category, including penicillin, cephalosporins, carbapenems and monobactams. Based on their antimicrobial activities and antibacterial spectrum, they can be further divided to different generations

5 and groups. For example, there are currently five generations of cephalosporins with differing antibacterial spectrums and activities in each generation. First generation cephalosporins have better activity against Gram-positive bacteria than Gram-negative bacteria, while each subsequent generation of cephalosporins has significantly greater

Gram-negative antimicrobial properties than the preceding generation, but with decreased activity against Gram-positive organisms, with the exception of fourth-generation cephalosporins which have true broad-spectrum activity (Okamoto et al., 1994; Caprile,

1988; Hancock and Bellido, 1992).

Figure 1.1. Representative antibiotics derived from natural products.

Due to their broad spectrum of activity, cephalosporins are one of the most widely prescribed classes of antimicrobials. The earlier generation cephalosporins are commonly used for community-acquired infections, while the later generation antibiotics, with their better spectrum of activity against Gram-negative bacteria make them useful for hospital- acquired infections or complicated community-acquired infections (Klugman et al.,

1997). In addition, cephalosporins are also commonly used in veterinary medicine and food animal production. For example, a few first and second generation cephalosporins are approved worldwide for treatment of mastitis infections in dairy cattle (Hornish and

Katarski, 2002). While another third generation cephalosporin, ceftiofur, has worldwide approvals for respiratory disease in swine, ruminants (cattle, sheep and goats) and horses and has also been approved for foot rot and metritis infections in cattle. Ceftiofur has also been approved in various countries for early mortality infections in day-old chicks and turkey poults (Hornish and Katarski, 2002).

Aminoglycosides are another type of bactericidal antibiotics. Their key structure includes an aminocyclitol ring in the molecule, with different glycosidic linkages and side chains among members in this family (Kotra et al., 2000). Aminoglycosides affect bacterial cells by displacing cations such as Mg2+ and Ca2+ on the outer bacterial membrane, disrupting normal permeability. Moreover, aminoglycosides can also be bacteriostatic, as they impair growth of bacterial cells by binding to the 30S subunit of the bacterial ribosome, inhibiting protein synthesis. Bacteria susceptible to aminoglycosides are primarily aerobic Gram-negative bacteria, such as Klebsiella sp., Enterobacter sp. and

Pseudomonas aeruginosa (Moellering, 1983). Representative members of aminoglycosides include gentamicin, kanamycin, neomycin and streptomycin. These antibiotics are primarily used when treating infections on the surface of the skin and in the respiratory system, and they are normally combined with other types of antibiotics for clinical therapy, and therapeutic treatment in veterinary medicine and food animal production (Shaikh and Allen, 1985; Silbergeld et al., 2008).

Glycopeptides are another example of bactericidal antibiotics. Originated with the discovery of vancomycin in 1956, the basic structure of glycopeptide antibiotics includes a seven amino acid residue termed aglycone that is biologically active, with different amino acids at positions 1 and 3, and different substituents of the aromatic amino acid residues among members of this group (Nicoloau et al., 1999). Similar to β-lactam antibiotics, glycopeptides affect the bacterial cells by inhibiting cell wall peptidoglycan synthesis. However, in contrast to β–lactam antibiotics, glycopeptides’ mode of action includes the interaction with a substrate of the enzyme which catalyzes transglycosylase reaction, and apparently shields it from the active site of the enzyme (Reynolds, 1989).

One of the better known glycopeptides, vancomycin, has been given the most attention because of its performance in treating MRSA infections (Levine, 1987). For many years since its initial use, vancomycin has been viewed as a drug of "last resort", used only after treatment with other antibiotics had failed (Nicoloau et al., 1999). In recent years, however, vancomycin resistant organisms are becoming more common. Part of this resistance may be due to the use of glycopeptides as growth promoters in food animal

8 production. For example, until 2000, avoparcin, chemically similar to vancomycin, has been widely used around the world (except North America) as a growth promoter

(Collignon et al., 2009), and is blamed for the increased prevalence of vancomycin- resistant strains of bacteria (Acar et al., 2000; Bager et al., 1997; Collignon, 1999;

Lauderdale et al., 2007).

Figure 1.2. Representative antibiotics of synthetic origin.

Antibiotics can also be bacteriostatic, whereby they inhibit the further proliferation of susceptible bacterial cells without actually killing them. Intracellular nucleotide and/or protein synthesis are usually targeted by these types of antibiotics. For example, tetracycline and its derivatives, such as chlortetracycline, are a group of bacteriostatic antibiotics which inhibit bacterial protein synthesis by reversibly binding to the 9 prokaryotic 30S ribosomal subunit and blocking the interaction of the aminoacyl‐tRNA with bacterial ribosome (Chopra and Roberts, 2001). Depending on pharmacokinetic characteristics, tetracyclines are divided into three groups: short-acting tetracyclines

(oxytetracycline and tetracycline), intermediate-acting tetracyclines (demeclocycline) and long-acting tetracyclines (doxycycline and minocycline) (Scholar and Pratt, 2000). In general, tetracyclines are used in treatment against a broad spectrum of bacteria, including most Gram-positive and Gram-negative bacteria, with almost no major side effects (Chopra and Roberts, 2001). For example, tetracyclines have been continuously used in human therapy to treat respiratory diseases such as atypical pneumonia due to

Mycoplasma pneumonia and Chlamydia pneumonia, and other local and systemic infections such as Q fever, typhus, Lyme disease and brucellosis (Chopra and Roberts,

2001). Recently, they have also been used in prophylaxis and treatment of malaria

(Eliopoulos and Roberts, 2003).

Since the growth-promoting properties of tetracyclines were discovered in 1949

(Stockstad et al., 1949), the application of tetracyclines soon extended to food animal production, leading to the development of both chlortetracycline and oxytetracycline as animal growth promoters (Gustafson and Kiser, 1985). In the United States, these antibiotics were approved by Food and Drug Administration as feed additives in 1951

(chlortetracycline) and 1953 (oxytetracycline) (Institute of Medicine, 1998). Whilst tetracyclines continue to be used worldwide, the rapid appearance of resistance in a number of different bacteria together with the development of alternative groups of

10 antibacterial agents has limited their use. For instance, the prescription of tetracyclines to treat of infections caused by Chlamydia and of the urinary tract and the intestines have been avoided, except in patients allergic to β-lactams and macrolides, because of fear of resistance in the causative organisms (Eliopoulos and Roberts, 2003).

Another class of antibiotics, the macrolides, is also bacteriostatic, but inhibit protein synthesis by reversibly binding to the 23S rRNA in the 50S-subunit of prokaryotic ribosomes, thereby blocking the elongation of protein synthesis. Macrolide antibiotics such as erythromycin, azithromycin and clarithromycin are seen to exhibit better antimicrobial activity against Gram‐positive aerobes than Gram‐negative aerobes due to the relative impermeability of the cellular outer membrane of Gram-negative microorganisms to these hydrophobic compounds (intrinsic resistance), as indicated by the erythromycin sensitivity of Escherichia coli ribosomes in cellular systems (Hardy,

1988; Mao and Putterman, 1968). Ketolides, derivatives of macrolides, which have similar structure as erythromycin but a higher affinity for ribosomal binding, are often used to combat macrolides resistant strains (Zhanel et al., 2001). Since their discovery, macrolides and ketolides are commonly used to treat respiratory infections such as community-acquired pneumonia (CAP), pharyngitis, chronic bronchitis and ottis media, as well as skin infections in humans (Zhanel et al., 2001). In food animal production, macrolides have also been frequently applied to cattle, pigs, sheep and poultry as growth promoters (Schwarz et al., 2001). The use of these macrolides in food animal production led to concerns of emerging resistances to these antibiotics which are also used for human

11 therapy. Therefore, in order to retain the efficacy of these drugs, the European Union banned the use of two macrolides, tylosin and spiramycin, as growth promoters in

January 1999 (Schwarz et al., 2001). In the U.S., however, the FDA has only recently classified macrolides as critically important antimicrobials in human medicine and has issued a few guidances on the judicious use of these medically important drugs (FDA,

2003; FDA, 2012). The drugs, however, are still readily available for food animal producers.

1.2.2 History of the Development of Modern Antibiotics

Regarding the origins of antibiotics, many people would refer to the famous discovery of penicillin, produced by the mold Penicillium notatum, by Nobel Prize winner Alexander

Fleming in 1928, which would later be widely used in World War II and saving millions of lives ever since (Sheehan, 1984). However, the earliest discoveries for antibiotics can be dated back to the 19th century. In 1887, Rudolf Emmerich demonstrated that animals artificially infected with streptococci were protected from developing cholera; and in

1896, a French medical student, Ernest Duchesne, first discovered that the soil mold

Penicillium was able to inhibit the growth of certain bacteria (Princeton, 2005). Later,

Emmerich and Oscar Löw found pyocyanin extracted from Bacillus pycyaneus (now called Pseudomonas aeruginosa) can be used to kill bacteria that caused cholera, typhoid, diphtheria and anthrax (Emmerich and Löw, 1899).

These early discoveries prompted the search for antimicrobial agents and led to the eventual clinical introduction of natural penicillins and synthetic sulfonamides in the

1930-40s (Livermore, 2004). The success of these early antibiotics empowered people with effective weapons in the battle against bacterial infections and led to considerable excitement in medicine with the discovery of various new classes of naturally occurring and synthetic antibiotics (Table 1.1). In fact, most classes of antibiotics used today were discovered between 1940 and 1962 which is referred to as the Golden Age of antibiotic development. After that, however, the development of both synthetic and natural antibiotics stalled for almost 10 years partly because it was believed that those bacterial infections were no longer a problem while most pharmaceutical companies did not view antibiotics as a profitable market. Studies about new antibacterial agents resumed in the

1980s in response to the increasing onset of ART pathogens in clinical settings. However, despite the continuous research in antibiotic development, only three new classes of antibacterial have entered the market since 1980, which are the pseudomonic acid antibiotic mupirocin in 1985, the oxazolidinone linezolid in 2000 and the lipopeptide daptomycin in 2003 (Butler and Buss, 2006). Over the last decade, only 7 new antibacterial drugs have been launched including four synthetic drugs (i.e. Gemifloxacin,

Fosfluconazole, Ceftaroline fosamil and Telavancin) belonging to three structure classes

(quinolone, β‐lactam, and lipoglycopeptide) and three naturally derived drugs (i.e.

Daptomycin, Doripenem and Tigecycline) belonging to three classes (daptomycin, quinolone, and tetracycline) (Butler and Buss, 2006; Boucher et al., 2013).

Table 1.1: Common antibiotic classes

1.3 Antibiotic Resistance

1.3.1 History of Antibiotic Resistance

Corresponding with the discovery of antibiotics, antibiotic resistance was observed as early as the 1930s, immediately after the clinical introduction of sulfonamides, when sulfonamide‐resistant Streptococcus pyogenes emerged in military hospitals (Levy and

Marshall, 2004). Subsequently, methicilin resistant Staphylococcus aureus (MRSA) and streptomycin resistant Mycobacterium tuberculosis appeared shortly after introduction of the corresponding antibiotics (Levy and Marshall, 2004). Although these infections by resistant pathogens required strict isolation and control programs to treat, they did not 14 pose a greater public health concern as only a small population showed resistance characteristics. In fact, the US Surgeon General, Dr. William H. Stewart even made a testimony to the US Congress in 1969 “…because infectious diseases have been largely controlled in the United States, we can now close the book on infectious diseases. The war against pestilence is over.” However, no sooner than these statements were made, antibiotic resistance began to emerge, rapidly, becoming rampant in certain instances resulting in vancomycin becoming the antibiotic of last resort for the treatment of Gram- positive bacterial infections in hospitals (Livermore, 2004). After a number of years of use, nosocomial vancomycin-resistant Staphylococcus aureus and Enterococcus faecalis strains have become a common occurrence (Hayakawa et al., 2011; Hiramatsu, 1997;

Hiramatsu, 2001). As more and more antibiotics are continuously applied in various environments, this trend continued and antibiotic resistant pathogens have been detected at an accelerating speed. For example, in the mid-1980s, typically only 1% to 5% of all S. aureus isolates were methicillin-resistant, compared with 60% to 70% multidrug-resistant

MRSA found in hospitals today (Taubes, 2008). In 2007, CDC reported in the Journal of the American Medical Association that the number of serious infections caused by MRSA alone was close to 100,000 a year, with almost 19,000 related fatalities—a number that is larger than the U.S. death toll attributed to HIV/AIDS in the same year (Taubes, 2008). In addition, in 2003, over a quarter of nosocomial enterococcal infections were resistant to vancomycin, and almost 60% of hospital-acquired S. aureus infections were caused by

MRSA. This represents a 12% and 11% increase compared to the previous five year averages, respectively (CDC, 2004). In addition to MRSA, studies done in 2006 found

15 that 54.0% of the Salmonella Typhi isolates were nalidixic acid (introduced in 1967) resistant and 19.6% of Campylobacter strains were resistant to ciprofloxacin (introduced in 1987) compared to 19.2% and 12.9% respectively in 1999 (CDC, 2009; Emmerson and

Jones, 2003; NCBI, 2013).

Source: CDC

Figure 1.3 Incidences of three antibiotic resistant pathogens since 1980.

Worsening the situation were the development of multi-drug resistant bacteria which probably begun to emerge as different resistant traits started to accumulate within single resistant microorganisms and the application of combination drug therapy to treat difficult infections. For instance, multi-drug resistance were initially detected mostly among enteric and Gram-negative bacteria such as Escherichia coli, Shigella and

Salmonella in the 1950s (George, 1996), and was blamed for the re‐occurrence of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis in the

1980s (Bloom and Murray 1992; Levy and Marshall, 2004). Due to the increasing 16 resistance in bacteria, many previously affordable and effective antimicrobial treatments became unsuitable for their original usage. The growing list of outdated antibiotics includes penicillin and oxacillins against staphylococcal infection, sulfonamides and ampicillin against urinary tract infection, fluoroquinolones against gonorrhea, etc

(Livermore, 2005). Resistances to the third‐generation of clinically important antibiotics such as ceftiofur and ceftriaxone, were already found in Campylobacter jejuni,

Salmonella Newport, Shigella flexneri, and Escherichia coli O157:H7 (CDC, 2009).

Thus, the rapid increase in resistance against a wide range of different antibiotics might also be a major contributor in the emergence of multi-drug resistant bacteria.

Since 1970, reducing unnecessary clinical use of antibiotics has been adopted gradually as a strategy of combating AR problem (WHO, 2001; E.U., 2003). These practices are based on the belief that ART traits would gradually disappear, or occur at a lower frequency, when the selective pressure of antibiotics is removed. The results of such strategies, however, are less convincing. According to the data from the UK Healthy

Protection Agency and European Antimicrobial Resistance Surveillance System, the suspension of certain antibiotics did not usually lead to the reduction of the prevalence of

AR (Livermore, 2004). For example, after a 63% reduction in macrolides use in Finland between 1988 and 1994, erythromycin resistance continued to increase in Streptococcus pneumonia isolates (Livermore, 2004). In a similar case, sulfonamide‐resistant

Escherichia coli increased by 6.2% after a 98% decrease in sulfonamide prescriptions in the United Kingdom during the 1990s (Enne et al., 2001). On the other hand, the lack of

17 prompt prevention or treatment of infections at early stage may lead to the development of chronic diseases by biofilms, which are naturally resistant to antibiotic or other drug treatment (Wang and Schaffner, 2011). It is becoming recognized in recent years that simply limiting the use of antibiotics may not necessarily be the best option for AR mitigation. In the meantime, when antibiotics are applied to animals as therapy or disease prevention, or as growth promoters, ART bacteria would also develop in animals, which may be transmitted to humans via direct contact or the food chain. When regarding animal use of antibiotics, the precautionary principle also leads to reduced or discontinued use of antibiotics both in therapy and as growth promoter in many countries.

For example, new industry guidance recommended by the FDA aims at curbing the use of clinically important antibiotics in animal production as growth promoters (FDA,

2012). Although the prevalence of AR in animal feces was reduced after abolition of certain antimicrobial agents, resistance could persist at a low but detectable level for many years (Johnsen et al., 2005). In some cases, resistant enterococcal infection in humans remained undiminished after the abolition of antibiotics used as growth promoters in the European Union since 1999 (Casewell et al., 2003), while another study showed that the frequency of AR in organic farms was found not different from conventional farms despite the restricted use of antibiotics in the former (Roesch et al.,

2006).

1.3.2 Mechanisms of Resistance Against Antibiotics

The most common survival strategy of ART bacteria at the presence of environmental antibiotics is to reduce the concentration of the inner cellular antibiotic to the sub‐lethal level. The three major mechanisms of this strategy are reduction of permeability of the cell wall to antibiotics, expulsion of antibiotics, and destruction of antibiotics by upgrading an antibiotic‐inactivating enzymatic pathway (Livermore, 2004; Maiden,

1998). Another less frequent strategy, named target‐mediated AR, is to produce a variant target molecule of certain antibiotics that have lower binding affinity with the antibiotics but normal or near normal metabolic function (Riley et al., 1991; Leclercq and Courvalin,

1991). Bacteria develop AR mainly through three routes: intrinsically resistant

(insensitive) due to a specific natural cellular property (Alekshun and Levy, 2007), accumulate mutations of target gene under strong selective pressure and transmit the gene vertically to the offspring, and acquire resistance through horizontal transfer (Maiden,

1998). Compared to the limited cases of intrinsic resistance and the low frequency of mutation (around 10‐8‐10‐9), horizontal transfer of antibiotic resistant determinants play an important role in the rapid dissemination of AR.

1.3.3. Horizontal Gene Transfer of Antibiotic Resistance Determinants

Horizontal genetic exchange, also called lateral gene transfer, is the movement of genetic material between bacteria other than by descent. Gene comparison, phylogenetic study, together with complete genome sequence analysis provide clues that horizontal gene

19 transfer plays an integral role in the evolution of bacteria and contributes to the rapid spread of AR gene (Aminov and Mackie, 2007; Ochman et al., 2000). For example, laterally transferred sequence is estimated to account for 12.8% of the total genetic material in Escherichia coli K12 (Ochman et al., 2000). Horizontal gene transfer occurs in bacteria through three main avenues: conjugation, transformation and transduction.

Conjugation happens when two microorganisms conjoin via a proteinaceous structure such as pilus in Gram‐negative bacteria and then recipient bacterium acquires a copy of double‐stranded circular piece of DNA that has the autonomous inner cellular replication system. Conjugation in some Gram‐positive bacteria, such as enterococci, is initiated by the production of sex pheromones, which induces the clumping of donor and recipient organisms and the exchange of DNA (Chen et al., 2005). Movable genetic elements can be found on self‐transmissible plasmids, conjugative transposons, or integrons. Plasmids are extra‐chromosomal DNA that are capable of replicating independently of the genome

DNA. Self‐transmissible plasmids usually contain tra‐ genes that initiate the complex process of conjugation or transduction. Conjugative plasmids are also found to facilitate the mobility of chromosomal genes, smaller nontransferable plasmids or antibiotic mediated integrons (Hoyle et al., 2005; Nagachinta and Chen, 2009). Transposons are mobile genetic elements within the chromosomal DNA. Transposons can be divided into two groups: compound and complex, represented by IS257 and Tn21 respectively. The former group is made up of two identical insertion elements flanking a functional gene such as drug resistance genes. The movement of these transposons is induced by transposases encoded by the insertion elements. In the latter group, transposase is 20 encoded together with functional gene in a transferable structure flanked by short inverted repeats. (Henning-Sørum and Abe'e, 2002). Many conjugative transposons can mobilize co‐resident plasmids, and some can even mobilize unlinked integrated elements

(Salyers et al., 1995). An integron is a gene capture system that can be found in plasmids, chromosomes, and transposons. Integrons are composed of a gene encoding a site‐ specific integrase and a recombination site for insertion of gene cassettes. Class 1 integrons are usually related to AR (Henning-Sørum and Abe'e, 2002).

Transformation involves the uptake of naked DNA via the cell wall of a competent recipient and integration of that DNA into genome or plasmids. The permanent incorporation of recruited DNA is usually mediated by RecA through homologous recombination (Dubnau, 1999). Recombination of large fragments of DNA tends to result in gene replacement while small fragments the production of mosaic genes (Hoyle et al.,

2005). Transformation has been found in species that are perpetually competent such as

Neisseria gonorrhoeae (Spratt et al., 1992), Campylobacter (Kim et al., 2008), and

Haemophilus influenza; and species that become competent in certain stage of life cycle such as Streptococcus (Lunsford, 1998) and Bacillus subtilis (Dubnau, 1999).

Besides conjugation and transformation, AR genes can also be packaged into bacterial phage and then released into a new strain by infection during transduction. Transduction requires the microorganisms that can be transduced to contain receptors recognized by

21 bacterial phage. The DNA that can be transferred in a single event depends on the size of phage, which can be as much as 100 kilobases (Ochman et al., 2000).

The rate of horizontal gene transfer can be affected by several factors. First of all, prolonged antibiotic use could select for novel gene variants or recombinants that have higher minimum inhibition concentration (MIC). One example is the mosaic recombinant of tetW and tetO isolated from Megasphaera esldenii from tetracycline treated swine

(Aminov and Mackie, 2007). Second, the use of antibiotics at sub‐therapeutic level has been reported to accelerate horizontal gene transfer. In a study, the sub‐inhibitory concentration of tetracycline was found to enhance the transfer of resistance plasmids in

Staphylococcus aureus by up to 1000 fold (Barr et al., 1986). The similar stimulatory effect was also demonstrated in the transfer of tetr conjugative transposons Tn1545 and

Tn916 (Bahl et al., 2004). In addition, the co‐selection of AR and heavy metal resistance was noticed four decades ago and has been extensively studied since then (Stepanauskas et al., 2006).

Finally, stress could induce the mobility of transposons. Some antibiotics (mitomycin and ciprofloxacin) are found to induce the SOS response and higher efficiency of conjugative transfer of AR in Vibrio and Escherichia (Hastings et al., 2004). Last but not least, the rate of horizontal gene transfer is also affected by the size of the gene pool as well as the constitutions of donor and recipient.

1.3.4. AR Maintenance

The carriage of AR on plasmids or transposons is generally thought to impose additional metabolic cost on the host strain thus reducing bacterial fitness to the environment. Based on this concept, ART bacteria are expected to gradually disappear once the use of certain antibiotics is banned or restricted. The so called “easy‐to‐get, hard‐to‐lose phenomenon”, however, is observed in many cases contrary to our expectation. In order to better understand this unexpected phenomenon, researchers started to investigate the internal mechanism of AR persistency. Studies indicated that the negative effects of AR genes may be eliminated by compensatory mutations or counteracted by the beneficial effects of AR determinants (Bjorkman et al., 2000; Andersson, 2003; Krulwich et al., 2005). For example, mdfA and tetL would raise host’s adaption to elevated pH in the environment

(Lenski et al., 1994). Apramycin resistance plasmids would confer fitness advantage to the new host (Yates et al., 2006). In these cases, ART isolates would not disappear but rather gradually replace antibiotic susceptible isolates in the absence of any antibiotic selective pressure.

Unlike resistance encoded on plasmids or transposons, there’s little or no cost on resistant strains with mosaic resistance genes since no additional proteins need to be synthesized.

Therefore the resistance phenotype can be considered selectively neutral in these cases, which may also accounts for the persistency of ARs after the removal of selection pressure. In addition, plasmid stabilization mechanisms, such as the toxin-antitoxin (TA)

23 and TA independent mechanism described by Li et al. (2011) are also important mechanisms for persistence of resistance on plasmids.

It is also worth noting the impact of constant horizontal gene transfer between commensal and pathogenic microorganisms. The basic cellular biology, including the mechanisms of dissemination, transmission and maintenance of AR, differs little between commensal and pathogenic bacteria. Since commensal microorganisms can present in and on surfaces of a host harmlessly, commensal microorganisms would serve as a relatively stable reservoir of resistance gene. For example, high level of acquired resistance to the oldest antibiotics such as tetracycline, ampicillin can be detected in commensal bacteria even in remote area with minimal antibiotic exposure (Bartoloni et al., 2009) or in animals that never treated with antibiotics such as organic pig

(Kazimierczak et al., 2009).

1.4 AR in Agriculture

The AR challenge we experience today is mainly due to two related issues: the emergence of various multi-drug resistant pathogenic bacteria and the increased level of resistance in these resistant pathogenic bacteria. As numerous studies have found that the exposure to antibiotics can lead to the evolution of antibiotic resistant bacteria, it is widely accepted that the clinical environment is a major avenue where antibiotic resistance evolves; and restriction of the use

24 of antibiotics during clinical treatment has been the primary AR mitigation strategy.

However, beside clinical applications, antibiotics are also widely used in food animal production including livestock and poultry as growth promoters and also in plant agriculture

(Castanon, 2007, McManus, 2002). It has been reported that the amount of antibiotics used in food animal production in the U.S. accounts for 78% of total antibiotic use (Dibner &

Richards, 2005). Recent studies identified AR in both the food chain, including ready-to- consume (RTC) foods and food animals, as well as the environments, including soil and aquatic environments, suggesting that the whole ecosystem is involved in AR dissemination and persistence (Wang et al., 2006; Allen et al., 2010; Devirgiliis et al., 2010; Li & Wang,

2010; O'Connor et al., 2010).

*Witte, 2000

Figure 1.4. Main reservoirs of antibiotic resistance.*

In fact, in the past decade, the isolation and characterization of AR in foodborne pathogens have raised significant concern of the application of antibiotics in food animal and agriculture production, and the potential involvement of the food chain in the dissemination of AR to the general public. Numerous studies have reported the presence of AR in various pathogens, including but not limited to Escherichia coli O157:H7, Campylobacter spp., Salmonella spp. and Listeria monocytogenes, etc. (Johnson et al., 2007; Prazak et al., 2002; Saenz et al.,

2000). Therefore, agriculture and the environment can play a key role in the emergence, evolution and dissemination of antibiotic resistance because it connects many different aspects of the whole ecosystem together. For example, AR can be introduced into the food chain during food production with ART contamination occurring in the original materials, processing, packing and/or handling of food.

Among ART bacteria, including both ART pathogens and ART commensal bacteria, ART pathogens are the more notorious and extensively studied of the two, since they are the major causes of illnesses and result in larger economic losses. Numerous studies have analyzed their physiology, pathogenesis and resistance to antibiotics. However, pathogens only account for a small proportion of the total bacteria in foods. In contrast, the population of commensal bacteria in the microbial ecosystem is much greater. For example, previous studies done in our lab have showed that food samples, including seafood and ready-to- consume food products could contain up to 108 CFU/g ART bacteria, most of which were commensals (Wang et al., 2006). Given the fact that there are no genetic boundaries between pathogens and other commensal bacteria, these microorganisms may present a major reservoir and play a key role in the emergence, evolution and dissemination of ART

26 pathogens. However, because commensals do not directly cause diseases, their impact on food safety and public health has not been fully elucidated.

1.6 Impact of AR on Health Care and Agriculture

Due to the increasing concern that we will run out of therapeutic options to treat future resistant infections, several organizations, including the World Health Organization

(WHO), Centers for Disease Control and Prevention (CDC), and the European Union

(EU), have all stressed the need to control the spread of antibiotic resistance (Anderson et al., 2003; Fries, 2004; WHO, 2000). WHO estimated that infectious diseases are responsible for 14.9 million deaths annually in the world (Figure 1.5), and costs the U.S. alone more than $120 billion in healthcare spending. Most deaths from infectious diseases (~90%), are caused by only a handful of diseases. For example, every year 1.5 million people die from tuberculosis and another eight million are newly infected (WHO,

2011). Out of this population, 440,000 are infected with MDR-TB and 150,000 die from these resistant infections (WHO, 2011). TB also kills more adolescents and adults than any other single infection with nearly two billion people in the world having latent TB infections. In an age of vaccines, antibiotics and dramatic scientific progress, we would think these infectious diseases should have been brought under control. Yet, although the introduction of cocktails of anti-TB drugs has become an essential treatment regimen, with considerable success; however, multidrug resistance continues to compromise TB therapy throughout the world. M. tuberculosis strains (i.e., XDR strains), resistant to four

27 or more of the front-line treatments, have appeared and spread rapidly in the last decade or so (Shah et al., 2007; Sotgiu et al., 2009). And now TDR strains, which are totally drug resistant (Velayati et al., 2009), have also been reported.

Source: WHO

Figure 1.5. Worldwide causes of death.

Hospital-acquired infection is also a major contributor of infectious diseases. It is estimated that 5-10% (1-2 million) of all hospital patients develop an infection and about

90,000 of these patients die each year as a result of bacterial infections, more than half caused by bugs resistant to at least one commonly used antibiotic (IDSA, 2004). In addition, it is estimated that these resistant infections can cost the U.S. more than $20 billion a year in excess health care spending, $35 million in other societal costs and adds

8 million days patients spend in hospitals (CDC, 2011). Because of the enormous number of hospital-acquired infections, the CDC, NIH, and the medical community are

28 promoting changes in antibiotic prescribing practices and encouraging prudent use of antibiotics to reduce the selective pressure that increases the prevalence of ART microorganisms. These recommendations include renewed emphasis on preventing the spread of infection and targeting specific antibiotics for specific pathogens to limit the use of broad spectrum antibiotics (CDC, 2004). However, despite the efforts, the rising trend of antibiotic resistance did not change. Emerging evidence further suggests that the development, dissemination and persistence of ART bacteria and their resistance- encoding genes are much more complicated than previously thought.

Table 1.2. Hospital-Acquired Infections by Selected Resistant Bacteria in the U.S. (2002)*

* Source: CDC, 2004

For example, food-borne illnesses also present a major avenue for infectious diseases and antibiotic resistance. As shown in Table 1.3, food-borne bacterial pathogens account for almost 3 million illnesses every year. Also there has been continuous debate on whether application of antibiotics in agriculture will indeed lead to increases in antibiotic 29 resistance; there are still a lot of concerns that this practice will aggravate the antibiotic resistance problem since it is directly linked to the human food chain and resistance encoding genetic materials have been shown to be able to be transferred to pathogens.

Therefore, the overall impact of the food chain in AR transmission has not been fully understood, and studies on the prevalence of AR in the foodborne microbes, particularly in the dominant commensal bacteria, and the potential transmission to host ecosystems, need to be evaluated.

Table 1.3: Leading foodborne pathogens in the U.S. (2000-2008)*

*Source: CDC, 2012

Coupled with the application of antibiotics in agriculture are the financial gains of annual antibiotic sales. For example, the estimated use of antimicrobials by livestock producers for non‐therapeutic purposes in the U.S. reached 24.6 million pounds, which accounts for

70 percent of total antimicrobial sales in 2001; in which the amount of oral antibiotics alone totaled $25 billion (Christoffersen, 2006). Specifically, tetracycline, penicillin, erythromycin and other antimicrobial agents that are important for human therapies are also extensively used for non‐therapeutic purposes.

Table 1.4. Sales and distribution of antimicrobial drugs for food-producing animals (2010)*

* Source: FDA, 2011 31

1.7 Insects as Reservoirs and Vectors for Dissemination of Antibiotic Resistant Bacteria

Insects comprise one of the most diverse taxa of life, and include more than a million described species representing more than half of all known living organisms. (Chapman,

2006; Wilson, 1992) Insects are a class of invertebrates within the arthropod phylum that have a chitinous exoskeleton, a three-part body (head, thorax and abdomen), three pairs of jointed legs, compound eyes and one pair of antennae. Because of their immediacy with human environments, insects have been known to have a close relationship, whether beneficial or harmful, with humans. For example, while some insects can be regarded as pests (i.e. houseflies, mosquitoes, fleas, etc.) others are viewed as having beneficial roles

(i.e. bees and butterflies). Insects are also no strangers to the research field. In fact, insects have played important roles in biological research. For example, because of its small size, short generation time and high fecundity, the common fruit fly Drosophila melanogaster is used as a model organism for studies in the genetics of higher eukaryotes. Hence, it was an essential part in studies looking into principles like genetic linkage, interactions between genes, chromosomal genetics, development, behavior and evolution (Pierce, 2006).

Given its vast diversity of species and its close interaction with humans, it is surprising that only relatively limited information is available regarding impact of insects and the implications of insect-associated bacteria on human health. For example, in spite of the importance of antibiotic-resistant bacteria in modern medicine, only a few insect species

32 have been screened for them; i.e. antibiotic-resistant human pathogens were found to be carried by flies and cockroaches in hospitals and other urban settings (Pai et al., 2004,

2005; Rahuma et al., 2005; Macovei and Zurek, 2006), with several studies suggesting the insect gut may also serve as a mixing ground for bacterial genes (Allen et al., 2009).

In addition, insects may also apply selection pressures for antibiotic resistance through their diet. Oil fly larvae, for example, that had no known exposure to antibiotics were found to carry antibiotic-resistant bacteria that might have been selected from commensal bacteria by a general cell stress response incited by solvent exposure (Kadavy et al.,

2000). Finally, as highly successful invasive organisms, insects are potential convenient dissemination vehicles for ART pathogens and AR genes. So when an insect invades a new environment, the pathogen it is carrying along have the potential to invade as well

(Vasanthakumar et al., 2008).

1.7.1 Houseflies

The housefly (Musca domestica) is a fly belonging to the suborder of Cyclorrhapha. It is, by far, the most common of all domestic flies, accounting for about 91% of all flies in human habitations, and one of the most widely distributed insects, found in all over the world (Larrain and Salas, 2008). It is considered by the FDA as a pest that can carry serious pathogens and diseases. The adult houseflies are about 0.3–0.5 inch long with gray thoraxes and four longitudinal dark lines on the back. Female houseflies are slightly larger than the males, and have a much larger space between their red compound eyes.

Each female fly can lay approximately 500 eggs in several batches of about 75 to 150 33

(Amano, 1985). Within a day, larvae (maggots) hatch from the eggs; they live and usually feed on (usually dead and decaying) organic material, such as garbage or feces.

At the end of their third instar, the maggots crawl to a dry, cool place and transform into pupae and the adult flies will then emerge from the pupae. This whole cycle is known as complete metamorphosis (Krafsur, 1985). The adults live from two weeks to a month in the wild, or longer in benign laboratory conditions. Having emerged from the pupae, the flies cease to grow; small flies are not necessarily young flies, but are instead the result of getting insufficient food during the larval stage. Houseflies depend on warm temperatures; generally, the warmer the temperature, the faster the flies will develop and reproduce

(Lysyk, 1991).

Figure 1.6. Housefly lifecycle: complete metamorphosis.

The potential reproductive capacity of houseflies is tremendous. Scientists have calculated that a pair of flies beginning reproduction in April may be progenitors, under optimal conditions and if all were to live, of 191,010,000,000,000,000,000 flies by

August (Bennett, 2003). In colder climates, however, houseflies survive only with humans. They have a tendency to aggregate and are difficult to dispose of. They are capable of carrying over 100 pathogens, such as those causing typhoid, cholera, salmonellosis, bacillary dysentery and tuberculosis, and parasitic worms (Ostrolenk and

Welch, 1942; Levine and Levine, 1991; Förster et al., 2009; Lord, 1904). Some strains have also become immune to most common insecticides (Keiding, 1975).

Houseflies feed on liquid or semi-liquid substances beside solid material which has been softened by saliva or vomit. Because of their large intake of food, they deposit feces constantly, one of the factors that make this insect a dangerous carrier of pathogens.

Although they are domestic flies, usually confined to human habitations, they can fly for several miles from the breeding place. The ability of housefly larvae to feed and develop in a wide range of decaying organic matter is also important for recycling of nutrients in nature. In fact, some researchers have even suggested that this adaptation may be exploited to combat with ever-increasing amount of waste (Miller et al., 1974). Housefly larvae can be mass-reared in a controlled manner in animal manure, thus reducing the bulk of waste and minimizing environmental risks of its disposal. Harvested maggots may be then used as feed for animal nutrition. Nevertheless, houseflies remain one of the most important insects in human habitations and can have a huge impact on human health.

1.8.2 Houseflies and Antibiotic Resistance

As mentioned earlier, houseflies commonly develop in large numbers in animal manure, and this is a serious problem requiring control. Although the housefly species does not bite, the control of Musca domestica is vital to human health and comfort in many areas of the world. The most important damage related with this insect is the annoyance and the indirect damage produced by the potential transmission of pathogens (viruses, bacteria, fungi, protozoa, and nematodes) including antibiotic resistant bacteria associated with these pathogens (Ostrolenk and Welch, 1942; Levine and Levine, 1991; Förster et al.,

2009). Pathogenic organisms are picked up by flies from garbage, sewage and other sources of filth, and then transferred on their mouthparts, through their vomitus, feces and contaminated external body parts to human and animal food. Of particular concern is the movement of flies from animal or human feces to food that will be eaten uncooked by humans. Also, when consumed by flies, some pathogens can be harbored in the mouthparts or alimentary canal for several days, and then be transmitted when flies defecate or regurgitate (Capinera, 2010). In situations where plumbing is lacking, such as open latrines, serious health problems can develop, especially if there are outdoor food markets, hospitals, or slaughter houses nearby. Among the pathogens commonly transmitted by houseflies are Yersinia pseudotuberculosis (Zurek et al., 2001),

Escherichia coli O157:H7 (Alam and Zurek, 2004), Helicobacter pylori (Grubel et al.,

1997), Salmonella (Mian et al., 2002), and Campylobacter jejuni (Shane et al., 1985).

These flies are most commonly linked to outbreaks of diarrhea and shigellosis, but also

36 are implicated in transmission of food poisoning, typhoid fever, dysentery, tuberculosis, anthrax, ophthalmia, and parasitic worms.

In terms of antibiotic resistant bacteria carried by houseflies, only a limited number of studies are available, and almost all of these studies focused only on resistant pathogens or opportunistic pathogens. For example, a study evaluating the prevalence of resistant pathogenic bacteria carried by houseflies collected in hospitals and urban environments in Libya were able to isolate varying levels of bacterial species from collected houseflies resistant to different antibiotics including Escherichia coli, Salmonella, Klebsiella spp., and Pseudomonas spp. (Rahuma et al., 2005). In another study, Macovei et al. (2006) reported the detection of tetM and ermB genes in Enterococci sp. carried by houseflies collected in local restaurants. During a subsequent study examining the potential of transfer of ART bacteria by houseflies, Macovei et al. (2008) demonstrated that houseflies collected in a cattle feedlot were able to contaminate RTC beef patties with antibiotic resistant bacteria even in a short time of exposure (0.5h). In addition, several studies looking at the horizontal transfer of AR genes were also able to demonstrate the occurrence of AR gene transfer from among resistant bacteria in the housefly alimentary canal. These studies suggest the capability of houseflies to carry and transfer ART pathogens to different environments and hosts, and the housefly gut as a suitable environment for horizontal transfer for AR genes among representative pathogens (e.g.

Escherichia coli and Enterococcus sp.).

1.8.3 Evolution of AR Research Focus and Methods

For a long time, the attention on ART bacteria has been concentrated on several

“emphasized” organisms, such as pathogens or opportunistic pathogens of clinical importance. However, as previously mentioned, pathogens only account for a scant portion of the bacteria involved in AR dissemination. Therefore, a major scientific gap exists and the role of the wide range of commensal bacteria predominant in the agriculture ecosystem should be studied to provide us with a more comprehensive picture. Second, standard procedures should be developed and perfected to reflect true magnitude of ART bacteria in tested samples and to minimize statistical biases. For instance, a more precise estimation of resistance prevalence can be obtained by using total plate count without enrichment step and other new methods.

Last but not least, the advantages and limitations of different detection methods need to be analyzed before any conclusions are made. Convention PCR was first adopted by

Roustam Aminov to identify tetr gene. Although contamination has always been a practical problem that relates with the validity of PCR result, nowadays, PCR has been adopted by many scientists as a fast, accurate, and sensitive detection of AR genes in pathogenic as well as commensal bacteria. In addition, real‐time PCR could be used in the quantitative study of a particular gene in a microbial population and/or whole environmental sample, while molecular techniques including gene cloning and building genetic libraries would be useful tools to detect any new resistance determinants.

Generally speaking, the combination of different research methods is usually adopted in the study of AR.

1.9 Knowledge gaps

AR in agriculture has been one of the hot topics in the battle against the evolution and spread of AR. Identification of risk factors in AR development, dissemination and persistence would not only contribute to a more comprehensive picture but also essential for the development of targeted strategies to control the exacerbating AR problem.

Besides the knowledge gaps mentioned above, several critical questions to AR have not been fully answered and need to be considered in the future. First, to what extent does agriculture and food animal production contribute to the emergence of AR? And to what extent can the increase of AR be ascribed to antibiotic use in agriculture? Second, what are the major avenues of dissemination of AR from one major environment to another

(e.g. agriculture to clinical/residential)? For example, would insect vectors serve as major carriers and transmitters of resistance determinants? To be more specific, what is the prevalence of resistant bacteria among housefly carriers and is there a difference in resistance profiles from houseflies collected at different environmental locations? Finally, what is the practical approach or recommendation to eliminate or reduce current AR based on the study of insects as vectors of AR?

Chapter 2

Houseflies as Potential Vectors for Antibiotic Resistant Bacteria

INTRODUCTION

The rapid emergence of antibiotic resistant (ART) pathogens has become a major public health concern (Feinmen, 1998; Levy, 1998; Witte, 1998; Jungkind et al., 1995).

According to NIH, resistant pathogens contribute to more than 90,000 deaths/year in

Hospital Acquired Infections (HAIs) alone in the United States (IDSA, 2004). Besides clinical applications, antibiotics have also been widely used in agriculture. In fact, about

70% of all antibiotics used in the U.S. are for non-therapeutic feed supplements (UCS,

2001), and many of these drugs are also approved for use in clinical therapy. Numerous studies have reported multiple ART pathogens including Salmonella sp., Escherichia coli

O157:H7, Campylobacter sp., Listeria monocytogenes, and MRSA from animal farming facilities and a number of these pathogens were also isolated from humans in close proximity of these environments (Hur et al., 2011; Schroeder et al., 2002; Saenz et al.,

2000; Srinivasan et al., 2005; Lee, 2003).

However, despite the extensive studies on ART pathogens in the past decades, the lack of proper understanding on major routes and mechanisms of AR emergence, dissemination and persistence likely contributed to the incompetence in the battle against AR.

Particularly, the impact of commensal bacteria, which account for the majority of the microbial population, on the development of AR, has been overlooked. Given that horizontal gene transfer is crucial to the rapid dissemination of AR, these dominant organisms in microbial ecosystems likely have played a key role in the emergence of

ART pathogens. Therefore, identification of major avenues involved in disseminating

ART bacteria, as well as resistant gene carriers, is critical for a better understanding of

AR dissemination and important for the development of targeted control strategies for resistance.

One of the potential avenues of dissemination and reservoir of AR genes in the environment is through insects that are commonly associated with human and animal habitats. The ability of insects to carry and transfer pathogens has been well documented

(Vasanthakumar et al., 2008; Greenberg, 1973; Olsen, 1998; Echeverria et al., 1983;

Fotedar, 2001), and several studies screening for the presence of antibiotic resistant pathogens carried within insects were able to isolate and identify specific resistant pathogens within insect hosts. For example, antibiotic-resistant human pathogens were found to be carried by flies, cockroaches and even bees in various environments (Pai et al., 2004, 2005; Rahuma et al., 2005; Macovei and Zurek, 2006; Evans, 2003), with several studies suggesting that the insect gut may also serve as a mixing ground for

41 bacterial genes (Allen et al., 2009). In addition, antibiotic resistance genes were found to be able to transfer conjugally from Escherichia coli to Yersinia pestis, the causal agent of the Black Plague, within its flea host (Hinnebusch et al., 2002). Insects may also apply selective pressures for antibiotic resistance through their diet. Oil fly larvae, for example, that had no known exposure to antibiotics were found to carry antibiotic-resistant bacteria that might have been selected from commensal bacteria by a general cell stress response incited by solvent exposure (Kadavy et al., 2000). It is well established that when an insect invades a new environment, the pathogen it carried along has the potential to invade as well (Vasanthakumar et al., 2008). Accordingly, as highly successful invasive organisms, insects are potential convenient vehicles for the dissemination of ART pathogens and AR genes. Since commensal bacteria are now recognized as the major carriers and contributing factors in the development, circulation and evolution of antibiotic resistance, understanding the prevalence of ART commensal bacteria carried by various insects becomes important for proper risk assessment.

The housefly (Musca domestica), one of the most populated and common insects in the world, have been well documented to be a massive carrier and reservoir of both pathogenic and commensal bacteria (Ostrolenk and Welch, 1942; Levine and Levine,

1991; Förster et al., 2009; Lord, 1904). Houseflies often breed in areas associated with human and animal wastes, and adult houseflies are capable of flying up to 20 miles from their developmental sites. Consequently, houseflies can build up in very large populations on animal farms and can readily disperse from farms to residential settings. FDA also

42 characterized houseflies as an important contributing factor in the dissemination of various infectious foodborne diseases, e.g. cholera, shigellosis and salmonellosis, and one of the most important hygiene pests worldwide (Olsen et al., 2001). Recent studies focused on houseflies in agricultural and food service settings have suggested that ART opportunistic pathogens can also be transmitted from animal feedlots to food and humans through housefly vectors. For example, a study assessing the carriage of ART

Enterococcus sp. from houseflies collected in restaurants revealed that up to 65.8% and

78.3% of the tetr and ermr Enterococcus faecalis isolates carried tetM and ermB genes, respectively (Macovei et al., 2006). In a subsequent study, scientists were also able to illustrate the potential of houseflies collected in cattle feedlots to contaminate ready-to- eat food with ART Enterococci spp. (Macovei et al., 2008). While a variety of ART pathogenic and opportunistic pathogens have been isolated in houseflies collected from agricultural and food service environments. Due to their direct public health relevance, the prevalence of ART commensal bacteria in houseflies, is yet to be determined. It is well-established that these bacteria can play a key role in the emergence, evolution and dissemination of genetic elements, including AR genes, in microbial ecosystems

(Shoemker et al., 2001; Andremont 2003; Nandi et al., 2004; Wang et al., 2006;

Marshall, 2009; Wang, 2009).

Therefore, the objectives of this research are to examine the prevalence of ART commensal bacteria and AR gene pools in houseflies and and the correlation between

ART bacteria and AR gene prevalence in different environmental settings.

MATERIALS AND METHODS

1. Housefly Sampling

Housefly samples were collected at four different locations using fly traps (Olson

Products Inc.): indoor and outdoor of a poultry teaching farm (poultry indoor & poultry outdoor) and two outside residential locations (A & B), all in Columbus-Ohio. Unlike commercial farming facilities, antibiotics were not known to be used within the teaching poultry farm facility. The fly traps were setup at each location for a period of three days before they were collected. Four rounds of samples were collected in a span of twelve months. The 1st and 2nd round samples were collected on the 19th and 27th of September

2010, and included samples from poultry indoor, poultry outdoor and residential location

A. The last two rounds of samples were collected on the 22nd and 29th of August 2011, and included samples from the residential location B. Each residential location is about 5 miles from the poultry farm. Houseflies caught in each location were treated as a composite sample and analyzed within 6 hours of collection under sterile conditions.

2. Enumeration of total and ART bacteria

Each composite sample was weighed and aseptically placed in separate disposable stomacher bags (4.5''×9'', Fisher Scientific, USA) containing a specific volume of sterile

0.1% peptone water solution. The amount of peptone water added was adjusted according to each sample weight to keep an equal concentration (0.0135g/mL). Bagged samples were then homogenized by grinding the sample in a stomacher for 120 sec at high speed to extract both the external and internal bacteria from the houseflies. The homogenized 44 solutions were then serially diluted and plated on non-selective Brain Heart Infusion agar

(BHI, Becton, Dickinson and Company, Sparks, MD) for total cultivable bacteria count and on selective BHI agar containing either 16 μg/ml of tetracycline (Fisher Biotech, Fair

Lawn, NJ) or 100 μg/ml of erythromycin (Fisher Scientific) for total ART bacteria count.

All media contained 100 μg/ml of cycloheximide (Fisher Biotech) to inhibit the growth of molds and yeasts.

3. Determination of Multi-drug resistance profiles

Within each sample, 100 resistant isolates were randomly selected from each antibiotic plate, and transferred onto either tetracycline or erythromycin plates, and two new BHI

Agar plates containing either 4 μg/ml of cefotaxime (Sigma-Aldrich, St. Louis, MO), or

152 μg/ml of sulfamethoxazole (Sigma-Aldrich) with 8 μg/ml trimetoprim (Sigma-

Aldrich). The phenotypic multi-drug resistance is determined by visible growth of the same isolate on at least two different antibiotic plates.

4. Detection of AR-encoding genes and identification of AR gene carriers

DNA of all the isolates selected for single and multi-drug resistance analyses were extracted according to Li and Wang (2010), and conventional PCR method described by

Wang et. al (2006) were applied to each isolate to screen for AR-encoding genes. A total of 11 tetr, ermr, sulr, ctxr genes were used to screen for AR determinants, and the respective PCR primers are listed in Table 2.1. All PCR amplicons were analyzed by gel electrophoresis and approximately 20% of positive amplicons were also confirmed by

DNA sequencing (Geospiza, Inc. Seattle, WA) and compared with corresponding AR- encoding genes published in the NCBI database. Representative positive AR-encoding gene isolates were identified using conventional PCR to amplify a 1.5 kb 16S rRNA gene fragment. The ART isolates were then identified by comparing the 16S rRNA gene sequences with corresponding sequences in the NCBI database.

5. Quantification of AR gene pools

The prevalence of 16S rRNA gene pool and six resistance gene pools in housefly samples were also examined by quantitative PCR analysis using total DNA extracts from each composite sample as template according to methods described by Yu and Morrison

(2004). The respective qPCR primers and probes used in this step are listed in Table 2.1.

6. Determination of persistence of AR genes within resistant isolates

A total of 37 isolates containing either tetracycline or erythromycin resistant-encoding genes were randomly selected and individually inoculated into culture tubes containing

5mL BHI broth with no antibiotics and incubated for 12 h at 37°C. After each incubation period of 12 hours, each isolate (1% by volume) would be transferred into a new culture tube containing fresh 5mL BHI broth and incubated again at 37°C for 12 h. This step was repeated for a period of 30 days. All the isolates were then plated onto both BHI media with no antibiotics and on BHI media supplemented with either tetracycline or erythromycin and incubated for 24 h at 37°C. CFUs of both types of media were determined for all isolates and 100 colonies growing on BHI media from each isolate

46 were selected and transferred onto BHI media supplemented with the corresponding antibiotic the isolate is resistant to. The persistence and stability of AR genes within these isolates were then determined by comparing the CFU and percentage of colony growth between the two types of media (i.e. BHI media with no antibiotics and BHI media supplemented with corresponding antibiotics).

7. Construction and screening of metagenomic libraries for resistance determinants.

The metagenomic libraries were constructed using phenotypically resistant tetracycline isolates from housefly samples collected at the poultry indoor location. A total of 10 isolates were used and their DNA were extracted using commercial kit (MO BIO

Laboratories, Inc). DNA extracts were fragmented, and DNA strands between 25-40 kb were selected and were ligated into pCC1FOS vector according to manufacturer’s instruction (CopyControl Fosmid Library Production Kit; Epicentre). Escherichia coli

Epi300 (Epicentre) was used as the host for the vector and recombinant fosmid. The packaged clones were plated onto either Luria-Bertani (LB) agar supplemented with chloramphenicol (12.5 ug/ml) or LB agar supplemented with tetracycline (16 ug/ml), and incubated for 24 h at 37°C to screen for . Each recombinant clone growing on either type of media were isolated and were inoculated into 3 ml LB broth plus either chloramphenicol (12.5 ug/ml) or tetracycline (16 ug/ml) (i.e. clones growing on LB media with chloramphenicol would be inoculated into LB broth with tetracycline, and vice versa), and incubated for 24 h at 37°C with shaking. Although the breakpoint for resistance to tetracycline has been debated, it was reported that a common genetic basis

47 for tetracycline resistance in E. coli resulted in a MIC of >16 ug/ml. Nine fosmid clones with resistance to both chloramphenicol and tetracycline were confirmed. The sizes of the fosmids of the recombinant clones were then evaluated by extraction under methods described by Sambrook and Russell (2001). All fosmids greater than 30kb were then further cloned through a sub-cloning step.

Sub-cloning of Recombinant Clones: seven restriction enzymes (BamHI, EcoRI,

HindIII, KpnI, SacI, XbaI, XhoI) were used to determine the digestion profile of confirmed fosmids, with KpnI showing the most appropriate DNA size for sub-cloning with the pBlueScript II SK (+) vector (~3 kb). All nine fosmids digested by KpnI were ligated into pBlueScript II SK (+) vector and chemically transformed (i.e. heat shock) into DH5α competent cells. Transformed cells were plated onto both LB media supplemented with X-Gal (20 mg/ml) ampicillin (100 ug/ml) and tetracycline (16 ug/ml) and incubated for 24 h at 37°C . White sub-clones growing on either type of plate were then isolated and confirmed by inoculation into LB broth supplemented with the other type of antibiotic. A total of 23 sub-clones out of the 10 original strains with resistance to both ampicillin and tetracycline were isolated and the results were confirmed by re- transformation (i.e. extraction of sub-clone plasmid and transformed into DH5α competent cells again). The sizes of inserts from the recombinant plasmids of all 23 clones were then evaluated by restriction enzyme digestion using KpnI.

Identification and analysis of resistance determinants: eight clones with ~7kb inserts were sent for sequencing and the data from sequencing was then used to BLAST (Basic

Local Alignment Search Tool) for identification of the resistance determinants.

RESULTS

1. Prevalence of ART bacteria in housefly samples

Bacteria phenotypically resistant to tetracycline and erythromycin were detected in all the samples examined, and the bacteria count of total cultivable, Tetr and Ermr bacteria varied among samples, ranging from 106 to 109 CFU/g houseflies, in different locations

(Fig. 2.1). Overall, the levels of total and ART bacteria detected in samples near the poultry farming facility were higher than those in both residential locations.

2. Multi-drug resistance profiles of Isolates

The results of multiple ART phenotype assessment showed that resistance to multiple antibiotics was commonly found in isolates recovered from samples collected near the poultry farming facility. As shown in Fig. 2.2, more than 50% of all the isolates collected from indoor and outdoor locations are resistant to at least 3 different antibiotics. The percentages of bacteria resistant to all four antibiotics were also observed to be very high in poultry indoor samples, 46.88%, whereas those from residential locations were much

49 lower, ranging from 0 to 10%. Thus, the relationship between multiple AR phenotypes and different environmental locations were clearly observed in this case.

3. Detection of AR-encoding genes and identification of representative AR gene carriers

Overall, 1681 ART isolates from all four rounds of sample collection were screened for the presence of 11 tetr, ermr, ctxr and sulr genes. Among those, 7 genes, including tetK, tetL, tetM, tetS, sul2, ermB, and ermC were detected in part or all of the samples collected (Table 2.2). 230 out of 1229 (18.71%) and 19 out of 452 (4.20%) ART isolates were found to harbor at least one of the AR genes screened in samples collected near the poultry farming facility (indoor and outdoor of poultry barn), and from residential locations, respectively. These data indicated a potential correlation between the prevalence of these AR genes and the exposure to the animal farming facility. As Table

2.2 shows, the majority of isolates identified in this study that carried at least one positive

AR-encoding gene are Providencia spp., Enterococcus spp., and Proteus spp.; and these organisms belongs to either Enterobacteriace or lactic acid bacteria.

4. Prevalence of AR gene pools

As illustrated in Fig. 2.4, AR gene pools were detected in all housefly samples. It can be observed that the sizes of AR gene pools of samples collected near the poultry farming facility were bigger than those of residential samples.

5. Stability of AR genes within resistant isolates

Overall, isolates with resistance to tetracycline showed higher % recovery in both methods than isolates resistant to erythromycin (Table 2.3). In fact, as illustrated in Table

2.3, after a transfer period of 30 days under no antibiotic pressure, 17 out of the 36 isolates had more than 80% of their progenies retained, most of which are tetracycline resistant, with 10 isolates showing more than 95% recovery.

6. Construction of metagenomic library and identification of tetracycline resistance- encoding genes

Nine clones with resistance to both tetracycline and chloramphenicol were isolated after ligation with pCC1FOS vector and packaging in Escherichia coli Epi300 cells. All nine clones showed a recombinant fosmid size >40kb after extraction (Fig. 2.5). After the subsequent sub-cloning step, 23 sub-clones with resistance to both ampicillin and tetracycline were recovered and confirmed by re-transformation. The plasmid sizes of 8 sub-clones were determined, after digestion using restriction enzyme KpnI, to be ~7kb

(Fig. 2.6). Currently, all 8 sub-clones are under sequencing in order to identify the responsible gene for their tetracycline resistance determinants.

DISCUSSION

The rapid emergence of ART pathogens has led to the decreased effectiveness of antibiotics which have resulted in infections that are more difficult to treat and higher 51 economic costs. Many actions have been taken by government agencies to control the spread of AR. For example, the European Union has banned the use of several antibiotics as non-therapeutic feed supplements in the food animal production industry, however, studies demonstrated that even with these restricted applications, ART bacteria and residues still persist in these environments (Livermore, 2004). Emerging evidences have identified commensal bacteria, which accounts for the majority of the bacterial population, as a critical factor in the AR ecosystem. Given that horizontal gene transfer is crucial to the rapid dissemination of AR, these dominant organisms in the microbial ecosystem likely have played a key role in the emergence of ART pathogens. Recent studies have demonstrated the impact of food chain in disseminating AR to humans, and host (animal and human) intestinal tract plays an important role in ART bacteria proliferation even without direct exposure to antibiotics. Human and animal feces were found the major reservoir of AR genes (Li and Wang, 2010; Zhang et al., 2011). Oral antibiotic administration directly exposes the gut microbiota to the selective pressure, and has recently been identified as a major risk factor for AR development and dissemination

(Zhang et al., 2013) in the ecosystem. Further studies revealing additional risk factors and avenues in AR dissemination are important for the development of targeted control strategies.

Data from this study illustrated that insects, such as houseflies, which develop in human and animal waste and other decaying organic materials, can play an important role in the development and dissemination of these ART commensal bacteria in agricultural and

52 urban environments. Several past studies have demonstrated the rapid contamination of houseflies residing in a contaminated environment; they have also been identified as important vectors and reservoirs of various bacteria, including human pathogens

(Ostrolenk and Welch, 1942; Levine and Levine, 1991; Förster et al., 2009; Lord, 1904).

However, only a few studies have examined the potential of houseflies to carry and transfer ART bacteria to different hosts and food, and in these cases, only specific bacterial groups and species were examined. In this study, houseflies collected from different agricultural and urban environments were investigated and the prevalence of

ART commensal bacteria was determined. Results from the ART bacterial count (Fig.

2.1), prevalence of multi-drug resistant isolates (Fig. 2.2 and Fig. 2.3) and prevalence of detected AR genes (Table 2.2) and quantification AR gene pools (Fig. 2.4) all showed a potential correlation between the prevalence of ART bacteria and AR-encoding genes in houseflies, and exposure to animal farming facilities. In addition, samples collected in this study were in locations that were independent of any antibiotic usage, which indicates that the prevalence of these ART bacteria, which could reach up to 109 CFU/g houseflies in some samples (Fig. 2.1), is independent of exposure to antibiotics but related to exposure to animal feces. Similar results whereby resistant populations were detected under no direct exposure of antibiotics were also demonstrated in humans by

Zhang et al. (2011) and in animals by Alexander et al. (2008). So the existence of environmental ART bacteria is potentially influenced by many other factors including animal hosts and feedlot operations, and not necessarily by direct antibiotic exposure.

Therefore, new targeted strategies, in addition to the reduction of antibiotic usage, are required for the effective control of AR prevalence.

The antibiotics used in this study are also commonly used as growth promoters in animal husbandry. For example, tetracycline resistant (tetr) bacteria are very prevalent in agricultural environments; more than 40 kinds of tetracycline resistant (tetr) genes have thus far been characterized (Brown, et al., 2008), and the detectable tetr gene clusters have shown to be different in different types of samples and species of food animals.

Macovei et al. (2006) have reported the detection of tetM and ermB genes in Enterococci sp. carried by houseflies collected in local restaurants. In a subsequent study, Macovei et al. (2008) demonstrated that houseflies collected in a cattle feedlot were able to contaminate RTE beef patties with antibiotic resistant bacteria even in a short time of exposure (0.5h). In this study, 7 resistance-encoding genes including ermB ermC, tetM, tetS, tetK, tetL, and sul2 representing 3 different antibiotics were detected in housefly samples collected near the poultry farm (indoor and outdoor) and in residential areas. The prevalence of these AR determinants varied between locations in each round of sample collection as shown in Table 3. We were unable to detect any cefotaxime resistant (ctxr) encoding genes (blaTEM, blaCMY and blaCTX) in any of the samples. This could be due to the limitations of the enumeration and cultivation method and the types of AR-encoding genes that were used as evident from the AR gene pool data. In addition, tetK, which encoded efflux pump proteins as the resistance mechanism, was detected and accounted for about half of tetr isolates in the outdoor samples. Previous studies reported that genes encoding for efflux pumps, like the tetK gene, which was found in an Enterococcus

54 faecalis strain of human origin (Roberts & Hillier, 1990), were only detected at high levels in soil samples, but absent in the gut environment of food production animals.

Although we did not detect tetK genes in other housefly samples, we believe that the interactions of houseflies with animal waste and manure may be one pathway this gene can get transferred from poultry litter to houseflies and to other environment and hosts.

The potential of houseflies to carry bacteria that are resistant to multiple antibiotics have also been reported. Macovei et al. (2006) were able to show that many of the Enterococci sp. isolates carried by houseflies were phenotypically resistant to tetracycline and erythromycin. The same phenomenon was also observed in this study. Houseflies collected near the poultry farming facility carried high percentages of tetr and ermr isolates. As shown in Fig. 2.2, more than 50% of these isolates are resistant to at least 3 types of antibiotics tested. Furthermore, positive AR-encoding genes were also detected in some of these isolates (Fig. 2.3), corresponding to their multiple drug resistant phenotypes. Some of these AR-encoding genes, such as tetr (tetM) and ermr (ermB) genes, are often associated with mobile genetic elements including plasmids and transposons, and thus, could be transferred via HGT to other types of bacteria in different environments. For instance, Akhtar et al. (2009) demonstrated the horizontal transfer of tetM resistance gene among Enterococci sp. in the housefly gut. Other evidences have also indicated that these resistance genes could be transmitted from poultry to humans

(van den Bogaard, et al., 2001) or from animals to the environment (Santamaría, et al.,

2011). Based on 16S rRNA gene sequencing analysis, the representative AR gene

55 carriers detected in this study, some of which containing multiple AR-encoding genes, were identified. Enterococcus sp., Providencia sp. and Proteus sp. were among the predominant genera detected which belong to Enterobacteriaceae and lactic acid bacteria groups. Some of these bacteria, for example, Providencia spp., can also become opportunistic pathogens causing human infections. Furthermore, from the stability assessment done in this study, we can see that resistance determinants of these isolates can also be well retained, with nearly half of the isolates tested showing more than 80% recovery of their progenies after 30 days of growth under no antibiotic pressure. As the human colon microbial ecosystem provides excellent conditions for horizontal gene transfer, the capability of houseflies to carry various ART bacteria and AR genes only helps to introduce greater risks of human exposure to these resistant populations.

Because overall only a small percent of the ART bacteria were detected to contain the

AR gene examined in this study, we further used metagenomic approach to identify additional resistance-determinants from the samples. While several sub-clones are being assessed in this study, this approach will be applied to more isolates to further understand the AR ecology.

In conclusion, this study shows that houseflies collected from different environmental locations are all capable of carrying ART bacteria at a high level. Exposure of houseflies to animal farming facilities resulted in greater prevalence of ART bacteria and AR- encoding genes; and there is a great capability of houseflies to carry multi-drug resistant

56 bacteria. Furthermore, evidences are provided by this study that direct exposure to antibiotics is not required to detect resistant bacterial populations. Consequently, houseflies may play a significant role in the dissemination of AR to various environments.

Table 2.1. Primers for AR gene detection (Conventional and Quantitative)

Primer Sequence (5’-3’) Tm (℃) Size (bp) Reference

bla F CATTTCCGTGTCGCCCTTATTC TEM Dallenne, et 60 800 al., 2010 blaTEM R CGTTCATCCATAGTTGCCTGAC

bla F GACAGCCTCTTTCTCCACA CMY-2 Zhao, et al., 50 1143 2001 blaCMY-2 R TGGAACGAAGGCTACGTA

bla F ATGTGCAGYACCAGTAARGT CTX Mugnaioli, et 50 593 al., 2005 blaCTX F TGGGTRAARTARGTSACCAGA

sul1 F CGGCGTGGGCTACCTGAACG Kerrn, et al., 50 433 2002 sul1 R GCCGATCGCGTGAAGTTCCG

sul2 F GCAGGCGCGTAAGCTGA Barbolla, et al., 60 657 2004 sul2 R GGCTCGTGTGTGCGGATG

ermB F TGGTATTCCAAATGCGTAATG Malhotra- 62 745 Kumar, et al., ermB R CTGTGGTATGGCGGGTAAGT 2005

ermC F TCAAAACATAATATAGATAAA Arpin, et al., 50 642 1999 ermC R GCTAATATTGTTTAAATCGTCAAT

tetK F AGGATAGCCATGGCTACAAG Li and Wang, 50 980 2010 tetK R ACAAGGAGTAGGATCTGCTG

tetL F TTGGATCGATAGTAGCC Li and Wang, 50 908 2010 tetL R GTAACCAGCCAACTAATGAC

tetM F GTGGACAAAGGTACAACGAG Li and Wang, 50 406 2010 tetM R CGGTAAAGTTCGTCACACAC

tetS F GAACGCCAGAGAGGTATT Li and Wang, 50 1050 2010 tetS R TACCTCCATTTGGACCTCAC

Primer and Probe Sequence Reference

tet(L) real FP CGTCTCATTACCTGATATTGC Li and Wang, tet(L) real RP AGGAGTAACCTTTTGATGCC 2010 tet(L) probe AACCACCTGCGAGTACAAACTGG

tet(M) real FP GAACATCGTAGACACTCAATTG Li and Wang, tet(M) real RP CAAACAGGTTCACCGG 2010 tet(M) probe CGGTGTATTCAAGAATATCGTAGTG

ermB real FP GAAAGCCRTGCGTCTGACATC Zhang et al., ermB real RP CGAGACTTGAGTGTGCAAGAGC 2011 ermB probe ACCTTGGATATTCACCGAACACTAG

sul1 real FP CACCTTCGACCCGAAG Zhang et al., sul1 real RP TTGAAGGTTCGACAGCACG 2011 sul1 probe TCGACGAGATTGTGCGGTTCTTCG

sul2 real FP GATATTCGCGGTTTTCCAGA Zhang et al., sul2 real RP CAAAGAACGCCGCAATGT 2011 sul2 probe ATCATCTGCCAAACTCGTCGTTATGC

blaTEM real FP CACTATTCTCAGAATGACTTGGT Lachmayr et blaTEM real RP TGCATAATTCTCTTACTGTCATG al., 2009 blaTEM probe CCAGTCACAGAAAAGCATCTTACGG

IND OUT RES

CFU/g) 9 10

BacteriaCount (log 6 Con Tet Erm Con Tet Erm Con Tet Erm Con Tet Erm Round 1 Round 2 Round 3 Round 4

Figure 2.1. Prevalence of bacteria with phenotypic resistance to antibiotics from housefly samples. (IND: indoor, OUT: outdoor, RES: residential; Con: control, Tet: tetracycline, Erm: erythromycin)

Figure 2.2. Phenotypic multidrug resistant isolates from housefly samples. (IND: indoor, OUT: outdoor, RES: residential; 3 AR: resistant to 3 antibiotics, 4 AR: resistance to 4 antibiotics)

120

100

Total # of positive isolates 80

Multiple-resistant isolates 60

40 Numberofisolates

0 Indoor Outdoor Residential 1 Residential 2 Fig. 2.3. Distribution of resistant isolates carrying multiple resistance genes.

8 1I

7 1O 1R1 6

copies/g) 2I

10 5 2O 4 2R1

Pool (log Pool 3 3I 3O 2 3R2

1 16S rRNA and Antibiotic Resistance Gene Resistance Antibiotic and rRNA 16S 0 16S erm B sul 1 sul 2 tet M tet L

Fig. 2.4. AR gene pools in housefly samples. (1I, 1O, 1R1: First round indoor, outdoor and residential area 1 samples; 2I, 2O, 2R1: Second round indoor, outdoor and residential area 1 samples; 3I, 3O, 3R2: Third round indoor, outdoor and residential area 2 samples) 61

Table 2.3. Persistence of resistance within resistant isolates.

Detected Recovery by Recovery by Colony Isolate # AR Gene CFU/g (%) Transfer (%) OS1-19 70 79 OS2-5 66 80 OS1-25 89 97 OS1-29 79 85 OS1-6 95 98 OS1-15 95 96 OS1-37 75 83 OS1-1 86 90 tetR OS1-28 94 96 OS1-36 94 99 RS1-21 97 100 OS1-32 84 91 3IT-28 88 93 2RT-41 99 100 1OT-80 93 98 1OT-74 98 100 1OT-35 96 99 OS2-39 34 57 OS2-15 44 63 RS1-49 33 60 RS1-1 28 46 IS2-38 40 58 RS1-17 22 37 IS1-49 22 41 RS1-4 35 54 OS2-38 48 69 ermR 3IT-27 29 39 2RE-3 62 82 2OE-35 31 45 2RT-12 33 57 2IE-10 21 40 2OT-78 46 62 1IE-47 53 74 3IE-4 41 55 2OT-80 37 48 3OE-33 34 37

Fig. 2.5. pCC1FOS™ Vector Map.

Fig. 2.6. Agarose gel electrophoresis of Tetr sub-clones.

a: Plasmid of eight sub-clones extracted after transformation

b: Plasmid of eight sub-clones after restriction enzyme (KpnI) digestion

Bibliography

Acar, J. et al. 2000. Avoparcin and virginiamycin as animal growth promoters: A plea for science in decision-making. Clinical Microbiology and Infection. 6(9): 477–482.

Akhtar, M. et al. 2009. Horizontal transfer of the tetracycline resistance gene tetM mediated by pCF10 among Enterococcus faecalis in the house fly (Musca domestica L.) alimentary canal. Microb Ecol. 58: 509-518.

Alam, M. J., and L. Zurek. 2004. Association of Escherichia coli O157:H7 with houseflies on a cattle farm. Appl. Environ. Microbiol. 70:7578–7580.

Alekshun, M. N. and S. B. Levy. 2007. Molecular mechanisms of antibacterial multidrug resistance. Cell. 128(6): 1037‐1050.

Alexander, T. W. et al. 2008. Effect of Subtherapeutic Administration of Antibiotics on the Prevalence of Antibiotic-Resistant Escherichia coli Bacteria in Feedlot Cattle. Appl. Environ. Microbiol. 74(14): 4405-4416.

Allen, H. K. et al. 2009. Resident Microbiota of the Gypsy Moth Midgut Harbors Antibiotic Resistance Determinants. DNA & Cell Biology. 28(3): 109-117.

Allen, H. K. et al. 2010. Call of the wild: antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 8: 251-259.

Amano, K. 1985. Breeding of the house fly, Musca domestica, (Diptera; Muscidae) in fresh dung of cattle fed on pasture grass. Applied Entomological Zoology. 20: 143-150.

Aminov, R. I. and R. I. Mackie. 2007. Evolution and ecology of antibiotic resistance genes. FEMS Microbiol Lett. 271(2): 147‐161.

Anderson, A.D. et al. 2003. Public health consequences of use of antimicrobial agents in agriculture. In: Knobler, S.L., Lemon, S.M., Najafi, M., Burroughs, T. (Eds.), Forum on Emerging Infections: The Resistance Phenomenon in Microbes and Infectious Disease Vectors. Implications for Human Health and Strategies for Containment—Workshop Summary. Board on Global Health, Institute of Medicine, Appendix A, pp. 231–243. 66

Andersson, D. I. 2003. Persistence of antibiotic resistant bacteria. Current Opinion in Microbiology. 6: 452‐456.

Andremont, A. 2003. Commensal Flora May Play Key Role in Spreading Antibiotic Resistance. ASM News. 69(12): 601-607.

Arias, C. A. and B. E. Murray. 2009. Antibiotic-Resistant Bugs in the 21st Century — A Clinical Super-Challenge. N Engl J Med. 360: 439-443.

Arpin, C. et al. 1999. Emergence of mefA and mefE genes in beta-haemolytic streptococci and pneumococci in France. J. Antimicrob. Chemother. 44(1): 133-134.

Bager, F. et al. 1997. Avoparcin used as a growth promoter is associated with the occurrence of vancomycin-resistant Enterococcus faecium on Danish poultry and pig farms. Preventive Veterinary Medicine. 31(1–2): 95–112.

Bahl, M. I. et al. 2004 Effect of tetracycline on transfer and establishment of the tetracycline‐inducible conjugative transposon Tn916 in the guts of gnotobiotic rats. Appl Environ Microbiol. 70(2): 758‐764.

Barbolla, R. et al. 2004. Class 1 Integrons Increase Trimethoprim-Sulfamethoxazole MICs against Epidemiologically Unrelated Stenotrophomonas maltophilia Isolates. Antimicrob. Agents Chemother. 48(2): 666-669.

Barr, V. et al. 1986. Beta‐lactam antibiotics increase the frequency of plasmid transfer in Staphylococcus aureus. J Antimicrob Chemother. 17(4): 409‐413.

Bartoloni, A. et al. 2009. Antibiotic resistance in a very remote Amazonas community. Int J Antimicrob Agents. 33(2): 125‐129.

Bennett S. M. 2003. Housefly. http://www.the-piedpiper.co.uk/th6a.htm

Bjorkman, J. et al. 2000. Effects of environment on compensatory mutations to ameliorate costs of antibiotic resistance. Science. 287(5457): 1479‐1482.

Bloom, B.R. and C.J. Murray. 1992. Tuberculosis: commentary on a reemergent killer. Science. 257(5073): 1055‐1064.

Boucher, H. W., et al. 2013. 10 × '20 Progress—Development of New Drugs Active Against Gram-Negative Bacilli: An Update From the Infectious Diseases Society of America. Clin Infect Dis. 56(12): 1685-1694.

Brown, M. G. et al. 2008. Tet 42, a Novel Tetracycline Resistance Determinant Isolated from Deep Terrestrial Subsurface Bacteria. Antimicrob. Agents Chemother. 52(12): 4518-4521.

Butler, M.S. and A.D. Buss. 2006. Natural products‐‐the future scaffolds for novel antibiotics? Biochem Pharmacol. 71(7): 919‐929.

Capinera, J. 2010. Insects and Wildlife: Arthropods and their Relationships with Wild Vertebrate Animals. Wiley Blackwell. ISBN-10-1444333003.

Caprile, K. A. 1988. The cephalosporin antimicrobial agents: a comprehensive review. J. Vet. Pharmacol. Therap. 11:1-32.

Casewell, M., et al. 2003. The European ban on growth‐promoting antibiotics and emerging consequences for human and animal health. J Antimicrob Chemother. 52(2): 159‐161.

Castanon, J. I. 2007. History of the use of antibiotic as growth promoters in European poultry feeds. Poult. Sci. 86: 2466-2471.

CDC. 2004. 12 steps to prevent antimicrobial resistance among long-term care residents. http://www.cdc.gov/drugresistance/healthcare/ltc/12steps_ltc.htm.

CDC. 2004. National Nosocomial Infection Surveillance (NNIS) System Report, Data Summary from January 1992 - June 2004, Issued October 2004. Am J. Infect. Cont. 32:470-485.

CDC. 2009. National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS): Human Isolates Final Report, 2009.

CDC. 2011. Antimicrobial Resistance Posing Growing Health Threat. Press Release, CDC Online Newsroom. http://www.cdc.gov/media/releases/2011/p0407_antimicrobialresistance.html

CDC. 2012. CDC Fact Sheet: Pathogens causing US foodborne illnesses, hospitalizations, and deaths, 2000–2008. http://www.cdc.gov/foodborneburden/PDFs/pathogens-complete-list-01-12.pdf 68

Chapman, A. D. 2006. Numbers of living species in Australia and the World. Canberra: Australian Biological Resources Study. p.60. ISBN 978-0-642-56850-2.

Chen, I. et al. 2005. The ins and outs of DNA transfer in bacteria. Science. 310(5753): 1456‐1460.

Chopra, I. and M. Roberts. 2001. Tetracycline Antibiotics: Mode of Action, Epidemiology of Bacterial Resistance Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiol. Mol. Biol. Rev. 65(2):232-260.

Christoffersen, R.E. 2006. Antibiotics‐‐an investment worth making? Nat Biotechnol. 24(12): 1512‐1514.

Ciarán, P. K. and J. T. LaMont. 2008. Clostridium difficile — More Difficult Than Ever. N Engl J Med. 359: 1932-1940.

Collignon P., et al. 2009.World Health Organization Ranking of Antimicrobials According to Their Importance in Human Medicine: A Critical Step for Developing Risk Management Strategies for the Use of Antimicrobials in Food Production Animals. Clinical Infectious Diseases. 49:132–41.

Collignon, P. J. 1999. Vancomycin-resistant enterococci and use of avoparcin in animal feed: is there a link?. Med J Aust. 171(3): 144–146.

Dallenne, C. et al. 2010. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 65:490-495.

Devirgiliis, C. et al. 2010. Identification of tetracycline- and erythromycin-resistant Gram-positive cocci within the fermenting microflora of an Italian dairy food product. J. Appl. Microbiol. 109: 313-323.

Dibner, J. J., and J. D. Richards. 2005. Antibiotic growth promoters in agriculture: history and mode of action. Poult. Sci. 84: 634-643.

Dubnau, D. 1999. DNA uptake in bacteria. Annu Rev Microbiol. 53: 217‐244.

E.U. 2003. Opinion of the Scientific Steering Committee on Antimicrobial Resistance.

Echeverria, P. et al. 1983. Flies as a source of enteric pathogens in a rural village in Thailand. Applied and Environmental Microbiology. 46: 32–36.

Eliopoulos, G. M. and M. C. Roberts. 2003. Tetracycline Therapy: Update. Clin Infect Dis. 36(4): 462-467.

Emmerich, R. and O. Löw. 1899. Bakteriolytische Enzyme als Ursache der erworbenen Immunität und die Heilung von Infectionskrankheiten durch dieselben. Zeitschr. F. Hygiene. 31: 1‐65.

Emmerson, A. M. and A. M. Jones. 2003. The quinolones: decades of development and use. Journal of Antimicrobial Chemotherapy. 51(Suppl s1): 13-20.

Enne V.I., et al. 2001. Persistence of sulphonamide resistance in Escherichia coli in the UK despite national prescribing restriction. Lancet. 357(9265): 1325‐1328.

Evans, J. D. 2003. Diverse origins of tetracycline resistance in the honey bee bacterial pathogen Paenibacillus larvae. Journal of Invertebrate Pathology. 83: 46–50.

FDA. 2003. Guidance for Industry #152: Evaluating the Safety of Antimicrobial New Animal Drugs with Regard to Their Microbiological Effects on Bacteria of Human Health Concern. http://www.fda.gov/downloads/AnimalVeterinary/GuidanceComplianceEnforcement/Gui danceforIndustry/UCM052519.pdf

FDA. 2011. 2010 Summary Report on Antimicrobials Sold or Distributed for Use in Food-Producing Animals. http://www.fda.gov/downloads/ForIndustry/UserFees/AnimalDrugUserFeeActADUFA/U CM277657.pdf

FDA. 2012. Guidance for Industry #209: The Judicious Use of Medically Important Antimicrobial Drugs in Food-Producing Animals. http://www.fda.gov/downloads/animalveterinary/guidancecomplianceenforcement/guidan ceforindustry/ucm216936.pdf

FDA. 2012. Guidance for Industry #213: New Animal Drugs and New Animal Drug Combination Products Administered in or on Medicated Feed or Drinking Water of Food-Producing Animals: Recommendations for Drug Sponsors for Voluntarily Aligning Product Use Conditions with GFI #209. http://www.fda.gov/downloads/AnimalVeterinary/GuidanceComplianceEnforcement/Gui danceforIndustry/UCM299624.pdf 70

Feinmen, S. E. 1998. Antibiotics in animal feed: drug resistance revisited. Am Soc Microbiol News. 64: 24-30.

Ferber, D. 2003. Antibiotic resistance. WHO advises kicking the livestock antibiotic habit. Science. 301: 1027.

Fontana, R., P. Canepari, M. M. Lleo, and G. Satta. 1990. Mechanisms of resistance of enterococci to beta-lactam antibiotics. Eur. J. Clin. Microbiol. Infect. Dis. 9:103-105.

Förster, M., S. Klimpel, K. Sievert. 2009. The house fly (Musca domestica) as a potential vector of metazoan parazites caught in a pig-pen in Germany. Veterinary Parasitology 160(1-2): 163–167.

Fotedar, R. 2001. Vector potential of houseflies (Musca domestica) in the transmission of Vibrio cholerae in India. Acta Tropica. 78: 31–34.

Fries, R. 2004. Conclusions and activities of previous expert groups: the Scientific Steering Committee of the EU.J Vet Med B Infect Dis Vet Public Health. 51:403-7.

George, A.M. 1996. Multidrug resistance in enteric and other gram‐negative bacteria. FEMS Microbiol Lett. 139(1): 1‐10.

Greenberg, B. 1973. Flies and Disease, Vol. 2: Biology and Disease Transmission. Princeton, NJ: Princeton University Press.

Grubel, P. et al. 1997. Vector potential of houseflies (Musca domestica) for Helicobacter pylori. J. Clin. Microbiol. 35:1300–1303.

Gustafson, R. H., and J. S. Kiser. 1985. Nonmedical uses of the tetracyclines, p.405– 446. In J. J. Hlavka and J. H. Boothe (ed.), Handbook of experimental pharmacology, vol. 78. Springer-Verlag KG, Berlin, Germany.

Hancock, R. E. W. and F. Bellido. 1992. Factors involved in the enhanced efficacy against Gram-negative bacteria of fourth generation cephalosporins. J. Antimicrob. Chemother. 29(suppl A): 1-6.

Hardy, D. J., et al. 1988. Comparative in vitro activities of new 14-, 15-, and 16- membered macrolides. Antimicrob Agents Chemother. 32: 1710-1719.

Hastings, P. J., S. M. Rosenberg and A. Slack. 2004. Antibiotic‐induced lateral transfer of antibiotic resistance. Trends Microbiol. 12(9): 401‐404.

Hayakawa K., D. et al. 2011. Growing prevalence of vancomycin-resistant Enterococcus faecalis in the region with the highest prevalence of vancomycin-resistant Staphylococcus aureus. Infect Control Hosp Epidemiol. 32(9): 922-924.

Henning Sørum, T. M. L'. Abe'e. - L. 2002. Antibiotic resistance in food‐related bacteria - a result of interfering with the global web of bacterial genetics. International Journal of Food Microbiology. 78: 43‐56.

Hinnebusch, B.J. et al. 2002. High-frequency conjugative transfer of antibiotic resistance genes to Yersinia pestis in the flea midgut. Mol Microbiol. 46: 349–354.

Hiramatsu K., N. Aritaka, H. Hanaki, et al. 1997. Dissemination in Japanese hospitals of strains of Staphylococcus aureus heterogeneously resistant to vancomycin. Lancet. 350: 1668–1671.

Hiramatsu, K. 2001. Vancomycin-resistant Staphylococcus aureus: a new model of antibiotic resistance. Lancet. 1(3): 147–155.

Hornish, R. E. and S. F. Katarski. 2002. Cephalosporins in Veterinary Medicine – Ceftiofur Use in Food Animals. Current Topics in Medicinal Chemistry. 2(7): 717-731.

Hoyle, D. V. et al. 2005. Molecular epidemiology of antimicrobial‐resistant commensal Escherichia coli strains in a cohort of newborn calves. Appl Environ Microbiol. 71(11): p. 6680‐6688.

Hur, J., C. Jawale, and J. H. Lee. 2011. Antimicrobial resistance of Salmonella isolated from food animals: A review. Food Research International. 45(2): 819-830.

Infectious Diseases Society of America (IDSA). 2004. Bad bugs, no drugs. http://www.idsociety.org/uploadedFiles/IDSA/Policy_and_Advocacy/Current_Topics_an d_Issues/Antimicrobial_Resistance/10x20/Images/Bad%20Bugs%20no%20Drugs.pdf

Institute of Medicine, Division of Health Promotion and Disease Prevention. 1998. Report of a study. Human health risks with the subtherapeutic use of penicillin or tetracyclines in animal feed. National Academy Press, Washington, D.C.

Interagency Task Force on Antimicrobial Resistance. 2011. A public health action plan to combat antimicrobial resistance. http://www.cdc.gov/drugresistance/pdf/2010/Interagency-Action-Plan-PreClearance-03- 2011.pdf.

Johnsen, P.J., et al. 2005. Persistence of animal and human glycopeptide‐resistant enterococci on two Norwegian poultry farms formerly exposed to avoparcin is associated with a widespread plasmid‐mediated vanA element within a polyclonal Enterococcus faecium population. Appl Environ Microbiol. 71(1): 159‐168.

Johnson, J. R. et al. 2007. Antimicrobial drug-resistant Escherichia coli from humans and poultry products, Minnesota and Wisconsin, 2002-2004. Emerging Infect. Dis. 13: 838-846.

Jungkind, D. L. et al. 1995. Antimicrobial resistance — a crisis in health care. Adv Exp Med Biol. 390:1-248.

Kadavy, D.R. et al. 2000. Natural antibiotic resistance of bacteria isolated from larvae of the oil fly, Helaeomyia petrolei. Appl Environ Microbiol. 66: 4615–4619.

Kazimierczak, K. A. et al. 2009. Tetracycline resistome of the organic pig gut. Appl Environ Microbiol. 75(6): 1717-1722.

Keiding, J. 1975. Problems of housefly (Musca domestica) control due to multi- resistance to insecticides. Journal of Hygiene, Epidemiology, Microbiology and Immunology. 19(3): 340–355.

Kerrn, M. B. et al. 2002. Susceptibility of Danish Escherichia coli strains isolated from urinary tract infections and bacteraemia, and distribution of sul genes conferring sulphonamide resistance. J. Antimicrob. Chemother. 50(4): 513-516.

Khardori, N. 2006. Antibiotics‐‐past, present, and future. Med Clin North Am. 90(6): 1049‐1076.

Kim, J.S., et al. 2008. Differential effects of temperature on natural transformation to erythromycin and nalidixic acid resistance in Campylobacter coli. Appl Environ Microbiol. 74(19): 6121‐6125.

Klugman, K. et al. 1997. The role of fourth-generation cephalosporins in the treatment of infections caused by penicillin-resistant streptococci. Clinical Microbiology and Infection. 3(1): 48–60. 73

Kotra, L. P., J. Haddad, and S. Mobashery. 2000. Aminoglycosides: perspectives on mechanisms of action and resistance and strategies to counter resistance. Antimicrob. Agents Chemother. 44: 3249-3256.

Krafsur, E.S. et al. 1985. Age structure and reproductive biology of a natural house fly (Diptera: Muscidae) population. Environmental Entomology. 14: 159-164.

Krulwich, T. A. et al. 2005. Do physiological roles foster persistence of drug/multidrug efflux transporters? A case study. Nat Rev Microbiol. 3(7): 566‐572.

Lachmayr, K. L. et al. 2009. Quantifying nonspecific TEM beta-lactamase (blaTEM) genes in a wastewater stream. Appl. Environ. Microbiol. 75:203-211.

Larraín, P. S. and Salas C. F. 2008. House fly (Musca domestica L.) (Diptera: Muscidae) development in different types of manure. Chilean Journal of Agricultural Research. 68(2): 192-197.

Larson, E. 2007. Community factors in the development of antibiotic resistance. Annu. Rev. Public Health. 28:435-447.

Lauderdale, T. L. et al. 2007. Effect of banning vancomycin analogue avoparcin on vancomycin-resistant enterococci in chicken farms in Taiwan. Environmental microbiology. 9(3): 819–823.

Leclercq, R. and P. Courvalin. 1991. Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification. Antimicrob Agents Chemother. 35(7): 1267‐1272.

Lee J. H. 2003. Methicillin (Oxacillin)-Resistant Staphylococcus aureus Strains Isolated from Major Food Animals and Their Potential Transmission to Humans. Appl. Environ. Microbiol. 69(11): 6489-6494.

Lenski, R. E. et al. 1994. Genetic analysis of a plasmid‐encoded, host genotype‐specific enhancement of bacterial fitness. J Bacteriol. 176(11): 3140‐3147.

Levine J. F. 1987. Vancomycin: a review. Med Clin North Am. 71(6):1135-1145.

Levine, O. S. and M. M. Levine. 1991. House flies (Musca domestica) as mechanical vectors of shigellosis. Reviews of Infectious Diseases. 13(4): 688–696.

Levy SB. 1998. The challenge of antibiotic resistance. Sci Am. 278: 46-53.

Levy, S.B. and B. Marshall. 2004. Antibacterial resistance worldwide: causes, challenges and responses. Nat Med. 10(12): 122‐129.

Li, X. and H. H. Wang. 2010. Tetracycline Resistance Associated with Commensal Bacteria from Representative Ready-to-Consume Deli and Restaurant Foods. Journal of Food Protection. 73(10): 1841-1848.

Lipps, G. 2008. Plasmids: current research and future trends. Caister Academic Pr, Norwich, UK.

Livermore, D. 2004. Can better prescribing turn the tide of resistance? Nat Rev Microbiol. 2(1): 73‐78.

Livermore, D.M. 2005. Minimising antibiotic resistance. Lancet. 5(7): 450‐459.

Lord F. T. and M. D. Boston. 1904. Flies and tuberculosis. Boston Medical and Surgical Journal 151: 651-654.

Lunsford, R.D. 1998. Streptococcal transformation: essential features and applications of a natural gene exchange system. Plasmid. 39(1): 10‐20.

Lysyk T. J. 1991. Effects of temperature, food, and sucrose feeding on longevity of the house fly (Diptera: Muscidae). Environmental Entomology. 20: 1176-1180.

Macovei, L. et al. 2008. Potential of houseflies to contaminate ready-to-eat food with antibiotic-resistant Enterococci. Journal of Food Protection. 71(2): 435–439.

Macovei, L., and Zurek, L. 2006. Ecology of antibiotic resistance genes: characterization of enterococci from houseflies collected in food settings. Appl Environ Microbiol. 72: 4028–4035.

Maiden, M.C. 1998. Horizontal genetic exchange, evolution, and spread of antibiotic resistance in bacteria. Clin Infect Dis. 27(Suppl 1): S12‐20.

Malhotra-Kumar, S. et al. 2005. Multiplex PCR for simultaneous detection of macrolide and tetracycline resistance determinants in streptococci. Antimicrob. Agents Chemother. 49:4798-4800.

Mao, J. C. H. and M. Putterman. 1968. Accumulation in Gram-positive and Gram- negative bacteria as a mechanism of resistance to erythromycin. J. Bacteriol. 95: 1111- 1117.

Marshall, B. M., D. J. Ochieng, S. B. Levy. 2009. Commensals: Underappreciated Reservoir of Antibiotic Resistance. Microbe. 4(5): 231-238.

McManus, P. S. et al. 2002. Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40: 443-465.

Mian, L. S., H. Maag, and J. V. Tacal. 2002. Isolation of Salmonella from muscoid flies at commercial animal establishments in San Bernardino County, California. J. Vector Ecol. 27:82–85.

Miller B. F., J. S. Teotia and T. O. Thatcher. 1974. Digestion of poultry manure by Musca domestica. British Poultry Science. 15(2): 231.

Moellering, R. C., Jr. 1983. In vitro antibacterial activity of the aminoglycoside antibiotics. Rev. Infect. Dis. 5(suppl.): S212-S232.

Moritz, E. M., and P. J. Hergenrother. 2007. Toxin-antitoxin systems are ubiquitous and plasmid-encoded in vancomycin-resistant enterococci. Proc. Natl. Acad. Sci. U. S. A. 104:311-316.

Mugnaioli, C. et al. 2005. Dissemination of CTX-M-type extended-spectrum beta- lactamase genes to unusual hosts. J. Clin. Microbiol. 43:4183-4185.

Nagachinta, S. and J. Chen. 2009. Integron‐mediated antibiotic resistance in Shiga toxin‐producing Escherichia coli. J Food Prot. 72(1): 21‐27.

Nandi, S. et al. 2004. Gram-positive bacteria are a major reservoir of Class 1 antibiotic resistance integrons in poultry litter. PNAS. 101(18): 7118-7122.

NCBI. 2013. Ciprofloxacin. http://www.ncbi.nlm.nih.gov/mesh/68002939. Accessed 8/1/2013.

Nicolaou, K. C., et al. 1999. Chemistry, Biology, and Medicine of the Glycopeptide Antibiotics. Angew. Chem. Int. Ed. 38: 2096-2152.

Ochman, H. et al. 2000. Lateral gene transfer and the nature of bacterial innovation. Nature. 405(6784): 299‐304.

O'Connor, L. et al. 2010. The characterization of Listeria spp. isolated from food products and the food-processing environment. Lett. Appl. Microbiol. 51: 490-498.

Okamoto, M. P. et al. 1994. Cefepime: a new fourth-generation cephalosporin. American Journal of Health-System Pharmacy. 51(4): 463-477.

Olsen, A. R. 1998. Regulatory action criteria for filth and other extraneous materials. III. Review of flies and foodborne enteric diseases. Regulatory Toxicology and Pharmacology. 28: 199–211.

Olsen, A.R. et al. 2001. Regulatory action criteria for filth and other extraneous materials: V. Strategy for evaluating hazardous and nonhazardous filth. Regul. Toxicol. Pharmacol. 33: 363– 392.

Ostrolenk, M. and H. Welch. 1942. The house fly as a vector of food poisoning organisms in food producing establishments. American Journal of Public Health. 32(5): 487–494.

Pai, H. H., Chen, W. C., and Peng, C. F. 2004. Cockroaches as potential vectors of nosocomial infections. Infect Control Hosp Epidemiol. 25:979–984

Pai, H. H., Chen, W. C., and Peng, C. F. 2005. Isolation of bacteria with antibiotic resistance from household cockroaches (Periplaneta americana and Blattella germanica). Acta Trop. 93: 259–265

Pierce, B. A. 2006. Genetics: A Conceptual Approach, 2nd ed. New York: W.H. Freeman and Company. p.87. ISBN 0-7167-8881-0.

Prazak, M. A. et al. 2002. Antimicrobial resistance of Listeria monocytogenes isolated from various cabbage farms and packing sheds in Texas. J. Food Prot. 65: 1796-1799.

Princeton. 2005. http://www.molbio.princeton.edu/courses/mb427/2001/projects/02/antibiotics.htm#Introd uction.

Rahuma, N. et al. 2005. Carriage by the housefly (Musca domestica) of multiple antibiotic-resistant bacteria that are potentially pathogenic to humans, in hospital and other urban environments in Misurata, Libya. Ann Trop Med Parasitol. 99: 795–802. 77

Reynolds, P. E. 1989. Structure, Biochemistry and Mechanism of Action of Glycopeptide Antibiotics. Eur. J. Clin. Microbiol. Infect. Dis. 8(11): 943-950.

Riley, G., et al.1991. Penicillin resistance in Neisseria meningitidis. N Engl J Med. 324(14): 997.

Roberts, M. C. and S. L. Hillier. 1990. Genetic basis of tetracycline resistance in urogenital bacteria. Antimicrob. Agents Chemother. 34(2): 261-264.

Roesch, M., et al. 2006. Comparison of antibiotic resistance of udder pathogens in dairy cows kept on organic and on conventional farms. J Dairy Sci. 89(3): 989‐997.

Saenz Y. et al. 2000. Antibiotic resistance in Campylobacter strains isolated from animals, foods, and humans in Spain in 1997–1998. Antimicrob Agents Chemother. 44:267-71.

Salyers, A.A., et al. 1995. Conjugative transposons: an unusual and diverse set of integrated gene transfer elements. Microbiol Rev. 59(4): 579‐590.

Sambrook, J. and D. W. Russell. 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbour, New York

Santamaría, J. et al. 2011. Detection and diversity evaluation of tetracycline resistance genes in grassland-based production systems in Colombia, South America. Frontier in Microbiology. 2: 1-10.

Scholar, E. M. and Pratt W. B. 2000. The Antimicrobial Drugs, 2nd ed. Oxford University Press, USA. p. 189. ISBN-10: 0195125290

Schroeder, C. M. et al. 2002. Antimicrobial resistance of Escherichia coli O157 isolated from humans, cattle, swine, and food. Applied and Environmental Microbiology. 68: 576–81.

Schwarz, S., C. Kehrenberg. and T. R. Walsh. 2001. Use of antimicrobial agents in veterinary medicine and food animal production. International Journal of Antimicrobial Agents. 17(6): 431–437.

Shah, N. S. et al. 2007. Worldwide emergence of extensively drug-resistant tuberculosis. Emerg. Infect. Dis. 13: 380-387.

Shaikh, B. and E. H. Allen. 1985. Overview of physical-chemical methods for determining aminoglycoside antibiotics in tissues and fluids of food-producing animals. J Assoc Off Anal Chem. 68(5):1007-1013.

Shane, S. M., M. S. Montrose, and K. S. Harrington. 1985. Transmission of Campylobacter jejuni by the housefly (Musca domestica). Avian Dis. 29:384–399.

Sheehan J. C. 1984. The Enchanted Ring: The Untold Story of Penicillin. Boston: The MIT Press. 248.

Shoemaker, N. B. et al. 2001 Evidence for extensive resistance gene transfer among Bacteroides spp. and among Bacteroides and other genera in the human colon. Appl Environ Microbiol. 67(2): 561‐8.

Silbergeld, E. K., J. Graham, and L. B. Price. 2008. Industrial Food Animal Production, Antimicrobial Resistance, and Human Health. Annu. Rev. Public Health 2008. 29:151–69

Sotgiu, G. et al. 2009. Epidemiology and clinical management of XDR-TB: a systematic review by TBNET. Eur. Respir. J. 33: 871-881.

Spratt, B.G., et al. 1992. Role of interspecies transfer of chromosomal genes in the evolution of penicillin resistance in pathogenic and commensal Neisseria species. J Mol Evol. 34(2): 115‐125.

Srinivasan V. et al. 2005. Prevalence of Antimicrobial Resistance Genes in Listeria monocytogenes Isolated from Dairy Farms. Foodborne Pathogens and Disease. 2(3): 201- 211.

Stepanauskas R. et al. 2006. Coselection for microbial resistance to metals and antibiotics in freshwater microcosms. Environ Microbiol. 8(9): 1510‐1514.

Stockstad, E. L. R. et al. 1949. The multiple nature of the animal protein factor. J. Biol. Chem. 180:647–654.

Taubes G. 2008. The bacteria fight back. Science. 321(5887): 356-361.

Union of Concerned Scientists (UCS). 2001. Hogging it: Estimates of antimicrobial abuse in livestock (2001). http://www.ucsusa.org/assets/documents/food_and_agriculture/hog_front.pdf

United States General Accounting Office. 2004. Federal agencies need to better focus efforts to address risk to humans from antibiotic use in animals. Report to Congressional Requesters. http://www.gao.gov/new.items/d04490.pdf. van den Bogaard A. E. et al. 2001. Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. Journal of Antimicrobial Chemotherapy. 47: 763-771.

Vasanthakumar, A. I. 2008. Gut microbiota of an invasive subcortical beetle, Agrilus planipennis Fairmaire, across various life stages. Environ Entomol. 37: 1344–1353.

Velayati, A. A. et al. 2009. Emergence of new forms of totally drug-resistant tuberculosis bacilli: super extensively drug-resistant tuberculosis or totally drug-resistant strains in Iran. Chest. 136: 420-425.

Wang H. H. and D. W. Schaffner. 2011. Antibiotic Resistance: How Much Do We Know and Where Do We Go from Here? Appl. Environ. Microbiol. 77(20): 7093-7095.

Wang, H. H. 2009. Commensal bacteria, microbial ecosystems, and horizontal gene transmission: adjusting our focus for strategic breakthroughs against antibiotic resistance. Food-borne microbes: shaping the host ecosystem. pp.267-281. ISBN 978-1-55581-405-2

Wang, H. H. et al. 2006. Food commensal microbes as a potentially important avenue in transmitting antibiotic resistance genes. FEMS Microbiol. Lett. 254: 226-231.

WHO. 2000. WHO Global Principless for the Containment of Antimicrobial Resistance in Animals Treated for Food: Report of a WHO Consultation, Geneva, Switzerland, June 5-9, 2000.

WHO. 2001. Monitoring antimicrobial usage in food animals for the protection of human health, WHO consultation. Oslo, Norway, Sep 10-13, 2001.

WHO. 2001. WHO Global Strategy for Containment of Antimicrobial Resistance.

WHO. 2011. Tuberculosis MDR-TB & XDR-TB 2011 Progress Report. http://www.who.int/tb/challenges/mdr/factsheet_mdr_progress_march2011.pdf

Wilson, E.O. 1992. The Diversity of Life. W.W. Norton & Co., New York.

Witte, W. 1998. Medical consequences of antibiotic use in agriculture. Science. 279: 996-997.

Witte, W. 2000. Ecological impact of antibiotic use in animals on different complex microflora: environment. International Journal of Antimicrobial Agents. 14(4): 321-325.

Wutzke, S. E. et al. 2007. Evaluation of a national programme to reduce inappropriate use of antibiotics for upper respiratory tract infections: effects on consumer awareness, beliefs, attitudes and behaviour in Australia. Health. Promot. Int. 22:53-64.

Yates, C.M., et al. 2006. Enhancement of bacterial competitive fitness by apramycin resistance plasmids from non‐pathogenic Escherichia coli. Biol Lett,. 2(3): 463‐465.

Zhanel, G. G., et al. 2001. Review of Macrolides and Ketolides. Drugs. 61(4): 443-498.

Zhang, L. et al. 2011. Acquired Antibiotic Resistance: Are We Born with It? Appl. Environ. Microbiol. 77(20): 7134-7141.

Zhang, L. et al. 2013. Antibiotic Administration Routes Significantly Influence the Levels of Antibiotic Resistance in Gut Microbiota. AAC. doi:10.1128/AAC.00670-13.

Zhao, S. et al. 2001. Identification and expression of cephamycinase bla(CMY) genes in Escherichia coli and Salmonella isolates from food animals and ground meat. Antimicrob. Agents Chemother. 45:3647-3650. doi: 10.1128/AAC.45.12.3647-3650.2001.

Zurek, L., S. S. Denning, C. Schal, and D. W. Watson. 2001. Vector competence of Musca domestica (Diptera: Muscidae) for Yersinia pseudotuberculosis. J. Med. Entomol. 38:333–336.