DOCSLIB.ORG

The Eutherian Armcx Genes Regulate Mitochondrial Trafficking in Neurons and Interact with Miro and Trak2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Eutherian Armcx Genes Regulate Mitochondrial Trafficking in Neurons and Interact with Miro and Trak2 ARTICLE Received 13 Sep 2011 | Accepted 10 Apr 2012 | Published 8 May 2012 DOI: 10.1038/ncomms1829 The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2 Guillermo López-Doménech1,*, Román Serrat1,*, Serena Mirra1, Salvatore D’Aniello2,†, Ildiko Somorjai2,†, Alba Abad3, Nathalia Vitureira1, Elena García-Arumí4, María Teresa Alonso5, Macarena Rodriguez-Prados5, Ferran Burgaya1, Antoni L. Andreu4, Javier García-Sancho5, Ramón Trullas3, Jordi Garcia-Fernàndez2 & Eduardo Soriano1 Brain function requires neuronal activity-dependent energy consumption. Neuronal energy supply is controlled by molecular mechanisms that regulate mitochondrial dynamics, including Kinesin motors and Mitofusins, Miro1-2 and Trak2 proteins. Here we show a new protein family that localizes to the mitochondria and controls mitochondrial dynamics. This family of proteins is encoded by an array of armadillo (Arm) repeat-containing genes located on the X chromosome. The Armcx cluster is unique to Eutherian mammals and evolved from a single ancestor gene (Armc10). We show that these genes are highly expressed in the developing and adult nervous system. Furthermore, we demonstrate that Armcx3 expression levels regulate mitochondrial dynamics and trafficking in neurons, and that Alex3 interacts with the Kinesin/Miro/Trak2 complex in a Ca2 + -dependent manner. Our data provide evidence of a new Eutherian-specific family of mitochondrial proteins that controls mitochondrial dynamics and indicate that this key process is differentially regulated in the brain of higher vertebrates. 1 Developmental Neurobiology and Regeneration Lab, IRB Barcelona;Parc Cientific de Barcelona, Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED, ISCIII), Department of Cell Biology, University of Barcelona, Barcelona E-08028, Spain. 2 Department of Genetics, Faculty of Biology, and Institute of Biomedicine (IBUB), University of Barcelona, Barcelona E-08028, Spain. 3 Department of Neurobiology, Institut d′Investigacions Biomèdiques de Barcelona, CSIC, IDIBAPS, Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED, ISCIII), Barcelona E-08036, Spain. 4 Department de Patologia Neuromuscular i Mitocondrial, Hospital Universitari Vall d’Hebron Institut de Recerca (VHIR), Centro de Investigación Biomédica en Red de Enfermedades Raras (CIBERER), ISCIII, Barcelona 08035, Spain. 5 Department of Molecular and Cellular Physiology, Instituto de Biología y Genética Molecular (IBGM), Universidad de Valladolid & CISC, 47003 Valladolid, Spain. *These authors contributed equally to this study. †Present address: Department of Cellular and Developmental Biology, Stazione Zoologica Anton Dohrn, Villa Comunale 80121, Napoli, Italy (S.D); Centre for Organismal Studies, Im Neuenheimer Feld 230, University of Heidelberg, 69120 Heidelberg, Germany (I.S.). Correspondence and requests for materials should be addressed to E.S. (email: [email protected]). NatURE COMMUNicatiONS | 3:814 | DOI: 10.1038/ncomms1829 | www.nature.com/naturecommunications © 2012 Macmillan Publishers Limited. All rights reserved. ARTICLE NatURE COMMUNicatiONS | DOI: 10.1038/ncomms1829 itochondrial function is vital for neuronal viability, neu- signal peptide with a potential transmembrane domain), nuclear rotransmission and neural integration1–6. Synaptic neu- localization signals and putative mitochondrial targeting sequences Mrotransmission and integration events in nervous tissue (Fig. 1b), in agreement with our data indicating that Armcx genes take place at long distances from neuronal cell bodies (dendrites are targeted to. Taken together, these observations suggest that these and axons). Consequently, to ensure energy production in distal proteins have related physiological or cellular functions. Moreover, compartments, neurons orchestrate exquisite mechanisms that unusually, all Armcx-coding sequences are contained in a single regulate the transport and localization of mitochondria at active exon, whereas the Armc10 is a typical, multi-exon-containing gene synaptic sites7–11. Mitochondrial trafficking in neurons is mediated with the coding sequence split into at least eight exons. by Kinesin and Dynein motors and by several GTPases and adaptor On the basis of the above data, it is likely that the entire Armcx proteins, including Miro1/2, Trak2 or Mitofusins12–16. Mutations cluster originated in early Eutherian evolution by retrotransposition in genes encoding mitochondrial trafficking proteins often lead to of an Armc10 messenger RNA, and then by consecutive tandem neurological and neurodegenerative diseases17–19. duplication events in a rapidly evolving region of the Xq chromo- Members of the Alex protein family (Alex1–3; for arm-contain- some23, which also includes the Armcx-related G-protein-coupled ing protein lost in epithelial cancers linked to the X chromosome) receptor Gasp1–3 genes24. The precise time point for the genesis were initially described as putative tumor-suppressor genes, as their of the Armcx cluster, when key innovations of the mammalian expression is reduced in several epithelial-derived carcinomas, group took place, namely the origin of a well-developed placenta, including lung, prostate, colon and pancreas cancers20. While Alex1 or the increase in complexity of the central nervous system and and 2 are widely expressed, Alex3 is found mainly in the nervous the enlargement of the neocortex25, suggest that this cluster has system. Previously, we characterized Alex3 as a gene preferentially functions related to the above processes. Hence, the origin of the expressed in the upper layers of the developing cerebral cortex21. Armcx cluster may well have been linked to the enlargement of the A recent report described Alex3 as a Sox10-interacting protein neocortex, as marsupials are devoid of the Armcx cluster but have a that localizes in the mitochondria of OBL21 cells, and suggested a primitive placenta. novel signalling cascade between the mitochondria and the nucleus We next analysed the expression of Armcx genes during embry- through a Sox10/Alex3 protein complex22. Here, we describe the onic development and in the adult brain. At embryonic stages, evolutionary history of the Armcx cluster and provide evidence that Armc10 and Armcx3–6 genes were highly expressed in the devel- these genes encode a new family of proteins that regulates mito- oping neural tissues, neural crest derivatives and hind limbs, in chondrial dynamics and that is specific to Eutherian mammals. addition to other tissues that were specific for each gene (Supple- Furthermore, we show that Alex3 protein levels affect the dynam- mentary Fig. S5). We also found that Armc10 and Armcx1–6 genes ics and trafficking of mitochondria in neurons through interac- were widely expressed in the adult nervous tissue, especially in the tion with the Kinesin/Miro/Trak2 complex in a Ca2 + -dependent forebrain, including the cerebral cortex, hippocampus and thala- manner. We conclude that the Armcx/Arm10 genes encode a mus (Fig. 1c). We thus conclude that the Armcx genes encode for a new family of proteins that controls mitochondrial dynamics and Eutherian-specific set of proteins that is highly expressed in transport in neurons. neuronal tissue. Results Armcx and Armc10 genes encode for mitochondrial proteins. The Armcx cluster originated during the evolution of placentals. To study the subcellular localization of Armcx gene products, To gain insight into the function of Armcx genes, we surveyed the HEK293AD cells were transfected with complementary DNAs mouse and human genomes for similar sequences. Interestingly, a full (cDNAs) encoding full-length Armcx proteins fused to EGFP set of related genes map to the same region of the human (Xq22.1) or myc tags. In agreement with the protein domain predictions and mouse (X56/57cM) X chromosomes, with the sole exception of reported above, all the Alex proteins tested (Alex1, 2, 3 and 6) were the Armc10/SVH gene, which maps to the seventh human and the targeted mainly to mitochondria, which were visualized by cellu- fifth mouse chromosome23,24. This unusual organization prompted lar staining with MitoTracker (Fig. 1c; and Supplementary Fig. S6). us to analyse further the evolutionary genesis of this gene family Nuclear staining was also occasionally seen in individual cells. (Fig. 1a). Six homologues, named Armcx1–6 and a pseudogene (Fig. Transfection with a cDNA encoding Armc10 yielded an identical 1a), are arrayed in a single cluster in a portion of the X chromosome, pattern of mitochondrial staining (Fig. 1c). Many cells transfected which was proposed to be specific to placental mammals23,24. We with Armcx1, 2, 3 and 6 and Armc10 cDNAs showed an altered then surveyed all available vertebrate genomes and noted the absence mitochondrial network, in which mitochondria were aggregated of Armcx genes in non-Eutherian mammals, namely monotremes in the perinuclear region (Fig. 2a and Supplementary Fig. S6). We and marsupials, and in non-mammalian vertebrates, and its conclude that the Armc10/Armcx cluster encodes for a new fam- consistent presence in all Eutherian mammals, including the earliest ily of proteins targeted to mitochondria and possibly regulates the branching armadillo (Supplementary Figs S1–S3). Hence, the Armcx dynamics and distribution of these organelles. cluster originated at the beginning or early radiation of the most To gain insight into the functional role of Alex
Load more

Recommended publications
  • ARMCX3 (NM 177948) Human Untagged Clone – SC124834
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC124834 ARMCX3 (NM_177948) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: ARMCX3 (NM_177948) Human Untagged Clone Tag: Tag Free Symbol: ARMCX3 Synonyms: ALEX3; dJ545K15.2; GASP6 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_177948, the custom clone sequence may differ by one or more nucleotides ATGGGCTACGCCAGGAAAGTAGGCTGGGTGACCGCAGGCCTGGTGATTGGGGCTGGCGCCTGCTATTGCA TTTATAGACTGACTAGGGGAAGAAAACAGAACAAGGAAAAAATGGCTGAGGGTGGATCTGGGGATGTGGA TGATGCTGGGGACTGTTCTGGGGCCAGGTATAATGACTGGTCTGATGATGATGATGACAGCAATGAGAGC AAGAGTATAGTATGGTACCCACCTTGGGCTCGGATTGGGACTGAAGCTGGAACCAGAGCTAGGGCCAGGG CAAGGGCCAGGGCTACCCGGGCACGTCGGGCTGTCCAGAAACGGGCTTCCCCCAATTCAGATGATACCGT TTTGTCCCCTCAAGAGCTACAAAAGGTTCTTTGCTTGGTTGAGATGTCTGAAAAGCCTTATATTCTTGAA GCAGCTTTAATTGCTCTGGGTAACAATGCTGCTTATGCATTTAACAGAGATATTATTCGTGATCTGGGTG GTCTCCCAATTGTCGCAAAGATTCTCAATACTCGGGATCCCATAGTTAAGGAAAAGGCTTTAATTGTCCT GAATAACTTGAGTGTGAATGCTGAAAATCAGCGCAGGCTTAAAGTATACATGAATCAAGTGTGTGATGAC ACAATCACTTCTCGCTTGAACTCATCTGTGCAGCTTGCTGGACTGAGATTGCTTACAAATATGACTGTTA CTAATGAGTATCAGCACATGCTTGCTAATTCCATTTCTGACTTTTTTCGTTTATTTTCAGCGGGAAATGA AGAAACCAAACTTCAGGTTCTGAAACTCCTTTTGAATTTGGCTGAAAATCCAGCCATGACTAGGGAACTG CTCAGGGCCCAAGTACCATCTTCACTGGGCTCCCTCTTTAATAAGAAGGAGAACAAAGAAGTTATTCTTA AACTTCTGGTCATATTTGAGAACATAAATGATAATTTCAAATGGGAAGAAAATGAACCTACTCAGAATCA
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Supporting Information
    Supporting Information Mulders et al. 10.1073/pnas.0905780106 SI Materials and Methods in Opti-MEM (Invitrogen) to myoblasts, in both cases at a final Animals. Hemizygous DM500 mice, derived from the DM300– oligo concentration of 200 nM. Fresh medium was supplemented 328 line (1), express a transgenic human DM1 locus, which bears after 4 hours. After 24 h, medium was changed. RNA was a repeat segment that has expanded to Ϸ500 CTG triplets, isolated 48 h after transfection. because of intergenerational triplet-repeat instability. For the isolation of immortal DM500 myoblasts, DM500 mice were RNA Isolation. Typically, RNA from cultured cells was isolated crossed with H-2Kb-tsA58 transgenic mice (2). Homozygous using the Aurum Total RNA mini kit (guanidine-HCl/ HSALR20b mice express a (CUG)250 segment in the context of mercaptoethanol-based lysis, silica membrane binding; Bio- a human skeletal actin transcript (3). All animal experiments Rad), according to the manufacturer’s protocol. RNA from were approved by the Institutional Animal Care and Use Com- muscle tissue was isolated using TRIzol reagent (Invitrogen). mittees of the Radboud University Nijmegen and the University Alternative methods to isolate RNA from cultured cells in- of Rochester Medical Center. volved: (i) use of the TRIzol reagent, according to the manu- facturer’s protocol; (ii) an oligo(dT) affinity column (Nucleo- Cell Culture. An immortal mouse myoblast cell culture expressing Trap mRNA mini kit; Macherey-Nagel) for the isolation of hDMPK (CUG)500 transcripts was derived from GPS tissue poly(A) RNA; or (iii) a TRIzol procedure preceded by a isolated from DM500 mice additionally expressing 1 copy of the proteinase K digestion of the whole cell lysate (7): in short, cells H-2Kb-tsA58 allele (4).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Inactive X Chromosome Is Epigenetically Unstable and Transcriptionally Labile in Breast Cancer
    Supplemental Information The inactive X chromosome is epigenetically unstable and transcriptionally labile in breast cancer Ronan Chaligné1,2,3,8, Tatiana Popova1,4, Marco-Antonio Mendoza-Parra5, Mohamed-Ashick M. Saleem5 , David Gentien1,6, Kristen Ban1,2,3,8, Tristan Piolot1,7, Olivier Leroy1,7, Odette Mariani6, Hinrich Gronemeyer*5, Anne Vincent-Salomon*1,4,6,8, Marc-Henri Stern*1,4,6 and Edith Heard*1,2,3,8 Extended Experimental Procedures Cell Culture Human Mammary Epithelial Cells (HMEC, Invitrogen) were grown in serum-free medium (HuMEC, Invitrogen). WI- 38, ZR-75-1, SK-BR-3 and MDA-MB-436 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 10% fetal bovine serum (FBS). DNA Methylation analysis. We bisulfite-treated 2 µg of genomic DNA using Epitect bisulfite kit (Qiagen). Bisulfite converted DNA was amplified with bisulfite primers listed in Table S3. All primers incorporated a T7 promoter tag, and PCR conditions are available upon request. We analyzed PCR products by MALDI-TOF mass spectrometry after in vitro transcription and specific cleavage (EpiTYPER by Sequenom®). For each amplicon, we analyzed two independent DNA samples and several CG sites in the CpG Island. Design of primers and selection of best promoter region to assess (approx. 500 bp) were done by a combination of UCSC Genome Browser (http://genome.ucsc.edu) and MethPrimer (http://www.urogene.org). All the primers used are listed (Table S3). NB: MAGEC2 CpG analysis have been done with a combination of two CpG island identified in the gene core. Analysis of RNA allelic expression profiles (based on Human SNP Array 6.0) DNA and RNA hybridizations were normalized by Genotyping console.
    [Show full text]
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Anti-ARMCX1 Monoclonal Antibody, Clone FQS23965 (DCABH-6907) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-ARMCX1 monoclonal antibody, clone FQS23965 (DCABH-6907) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Rabbit monoclonal to ARMCX1 - N-terminal Antigen Description This gene encodes a member of the ALEX family of proteins and may play a role in tumor suppression. The encoded protein contains a potential N-terminal transmembrane domain and two Armadillo (arm) repeats. Other proteins containing the arm repeat are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is closely localized with other family members, including ALEX2 and ALEX3, on the X chromosome. Immunogen Synthetic peptide (the amino acid sequence is considered to be commercially sensitive) within Human ARMCX1 aa 1-150 (N terminal). The exact sequence is proprietary.Database link: Q9P291 Isotype IgG Source/Host Rabbit Species Reactivity Human Clone FQS23965 Purity Tissue culture supernatant Conjugate Unconjugated Applications WB, ICC/IF Positive Control Human fetal heart or fetal brain lysate, HeLa cells. Format Liquid Size 100 μl Buffer pH: 7.2; Preservative: 0.01% Sodium azide; Constituents: 50% Glycerol, 0.05% BSA, PBS Preservative 0.01% Sodium Azide Storage Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C long term. Avoid freeze / thaw cycle. Ship Shipped at 4°C. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved GENE INFORMATION
    [Show full text]
  • Atlas of Subcellular RNA Localization Revealed by APEX-Seq
    bioRxiv preprint doi: https://doi.org/10.1101/454470; this version posted October 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Atlas of Subcellular RNA Localization Revealed by APEX-seq Furqan M. Fazal1,2,3,*, Shuo Han3,4,5,*, Pornchai Kaewsapsak3,4,5, Kevin R. Parker1,2,3, Jin Xu1,2,3, Alistair N. Boettiger6, Howard Y. Chang1,2,3,7,†, Alice Y. Ting3,4,5,8,9,† 1Center for Personal Dynamics Regulomes, Stanford University School of Medicine, Stanford, CA, USA 2Department of Dermatology, Stanford University School of Medicine, Stanford, CA, USA 3Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA 4Department of Chemistry, Stanford University, Stanford, CA, USA 5Department of Biology, Stanford University, Stanford, CA, USA 6Department of Developmental Biology, Stanford University School of Medicine, CA, USA 7Howard Hughes Medical Institute 8Chan Zuckerberg Biohub, San Francisco, California, USA 9Lead contact *These authors contributed equally to this work †Corresponding authors. Email: [email protected] (A.Y.T.); [email protected] (H.Y.C.) SUMMARY We introduce APEX-seq, a method for RNA sequencing based on spatial proximity to the peroxidase enzyme APEX2. APEX-seq in nine distinct subcellular locales produced a nanometer-resolution spatial map of the human transcriptome, revealing extensive and exquisite patterns of localization for diverse RNA classes and transcript isoforms. We uncover a radial organization of the nuclear transcriptome, which is gated at the inner surface of the nuclear pore for cytoplasmic export of processed transcripts.
    [Show full text]
  • This Electronic Thesis Or Dissertation Has Been Downloaded from Explore Bristol Research
    This electronic thesis or dissertation has been downloaded from Explore Bristol Research, http://research-information.bristol.ac.uk Author: Al Ahdal, Hadil Title: Investigating the role of miR-21 in adult neurogenesis General rights Access to the thesis is subject to the Creative Commons Attribution - NonCommercial-No Derivatives 4.0 International Public License. A copy of this may be found at https://creativecommons.org/licenses/by-nc-nd/4.0/legalcode This license sets out your rights and the restrictions that apply to your access to the thesis so it is important you read this before proceeding. Take down policy Some pages of this thesis may have been removed for copyright restrictions prior to having it been deposited in Explore Bristol Research. However, if you have discovered material within the thesis that you consider to be unlawful e.g. breaches of copyright (either yours or that of a third party) or any other law, including but not limited to those relating to patent, trademark, confidentiality, data protection, obscenity, defamation, libel, then please contact [email protected] and include the following information in your message: •Your contact details •Bibliographic details for the item, including a URL •An outline nature of the complaint Your claim will be investigated and, where appropriate, the item in question will be removed from public view as soon as possible. Investigating the role of miR-21 in adult neurogenesis Hadil Mohammad Al Ahdal Faculty of Health Sciences Bristol Medical School A dissertation submitted to the University of Bristol in accordance with the requirements for award of the degree of Doctor of Philosophy in the Faculty of Health Sciences, Bristol Medical School 64,598 words Abstract MicroRNAs (miRNAs) are a class of small non-coding RNAs that act as post- transcriptional regulators and play important roles in neurodegenerative diseases and brain disorders (Nelson et al.
    [Show full text]
  • Karla Alejandra Vizcarra Zevallos Análise Da Função De Genes
    Karla Alejandra Vizcarra Zevallos Análise da função de genes candidatos à manutenção da inativação do cromossomo X em humanos Dissertação apresentada ao Pro- grama de Pós‐Graduação Inter- unidades em Biotecnologia USP/ Instituto Butantan/ IPT, para obtenção do Título de Mestre em Ciências. São Paulo 2017 Karla Alejandra Vizcarra Zevallos Análise da função de genes candidatos à manutenção da inativação do cromossomo X em humanos Dissertação apresentada ao Pro- grama de Pós‐Graduação Inter- unidades em Biotecnologia do Instituto de Ciências Biomédicas USP/ Instituto Butantan/ IPT, para obtenção do Título de Mestre em Ciências. Área de concentração: Biotecnologia Orientadora: Profa. Dra. Lygia da Veiga Pereira Carramaschi Versão corrigida. A versão original eletrônica encontra-se disponível tanto na Biblioteca do ICB quanto na Biblioteca Digital de Teses e Dissertações da USP (BDTD) São Paulo 2017 UNIVERSIDADE DE SÃO PAULO Programa de Pós-Graduação Interunidades em Biotecnologia Universidade de São Paulo, Instituto Butantan, Instituto de Pesquisas Tecnológicas Candidato(a): Karla Alejandra Vizcarra Zevallos Título da Dissertação: Análise da função de genes candidatos à manutenção da inativação do cromossomo X em humanos Orientador: Profa. Dra. Lygia da Veiga Pereira Carramaschi A Comissão Julgadora dos trabalhos de Defesa da Dissertação de Mestrado, em sessão pública realizada a ........./......../.........., considerou o(a) candidato(a): ( ) Aprovado(a) ( ) Reprovado(a) Examinador(a): Assinatura: ..............................................................................
    [Show full text]
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Joint Profiling of Chromatin Accessibility and CAR-T Integration Site Analysis at Population and Single-Cell Levels
    Joint profiling of chromatin accessibility and CAR-T integration site analysis at population and single-cell levels Wenliang Wanga,b,c,d, Maria Fasolinoa,b,c,d, Benjamin Cattaua,b,c,d, Naomi Goldmana,b,c,d, Weimin Konge,f,g, Megan A. Fredericka,b,c,d, Sam J. McCrighta,b,c,d, Karun Kiania,b,c,d, Joseph A. Fraiettae,f,g,h, and Golnaz Vahedia,b,c,d,f,1 aDepartment of Genetics, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; bInstitute for Immunology, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; cEpigenetics Institute, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; dInstitute for Diabetes, Obesity and Metabolism, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; eDepartment of Microbiology, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; fAbramson Family Cancer Center, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; gCenter for Cellular Immunotherapies, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104; and hParker Institute for Cancer Immunotherapy, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104 Edited by Anjana Rao, La Jolla Institute for Allergy and Immunology, La Jolla, CA, and approved January 30, 2020 (received for review November 3, 2019) Chimeric antigen receptor (CAR)-T immunotherapy has yielded tumor killing. To determine the extent to which these two sce- impressive results in several B cell malignancies, establishing itself narios occur in vivo, it is essential to simultaneously determine as a powerful means to redirect the natural properties of T lym- T cell fate and map where CAR-T vectors integrate into the phocytes.
    [Show full text]