Supporting Information

Mulders et al. 10.1073/pnas.0905780106 SI Materials and Methods in Opti-MEM (Invitrogen) to myoblasts, in both cases at a final Animals. Hemizygous DM500 mice, derived from the DM300– oligo concentration of 200 nM. Fresh medium was supplemented 328 line (1), express a transgenic human DM1 locus, which bears after 4 hours. After 24 h, medium was changed. RNA was a repeat segment that has expanded to Ϸ500 CTG triplets, isolated 48 h after transfection. because of intergenerational triplet-repeat instability. For the isolation of immortal DM500 myoblasts, DM500 mice were RNA Isolation. Typically, RNA from cultured cells was isolated crossed with H-2Kb-tsA58 transgenic mice (2). Homozygous using the Aurum Total RNA mini kit (guanidine-HCl/ HSALR20b mice express a (CUG)250 segment in the context of mercaptoethanol-based lysis, silica membrane binding; Bio- a human skeletal actin transcript (3). All animal experiments Rad), according to the manufacturer’s protocol. RNA from were approved by the Institutional Animal Care and Use Com- muscle tissue was isolated using TRIzol reagent (Invitrogen). mittees of the Radboud University Nijmegen and the University Alternative methods to isolate RNA from cultured cells in- of Rochester Medical Center. volved: (i) use of the TRIzol reagent, according to the manufacturer’s protocol; (ii) an oligo(dT) affinity column (Nucleo- Cell Culture. An immortal mouse myoblast cell culture expressing Trap mRNA mini kit; Macherey-Nagel) for the isolation of hDMPK (CUG)500 transcripts was derived from GPS tissue poly(A) RNA; or (iii) a TRIzol procedure preceded by a isolated from DM500 mice additionally expressing 1 copy of the proteinase K digestion of the whole cell lysate (7): in short, cells H-2Kb-tsA58 allele (4). Independent myoblast lines were ob- were lysed in 500 mM NaCl, 10 mM Tris-HCl, pH 7.2, 1.5 mM tained by ring cloning. The DM500 myoblast culture used in this MgCl2, 10 mM EDTA, 2% SDS, and 0.5 mg/mL proteinase K for study consisted of an equal mixture of 6 independent clones. 45 min at 45 °C. Nucleic acids were precipitated with 2.5 volumes Likewise, a wild-type myoblast culture was derived from wild- ethanol and collected by centrifugation. Precipitates were then type littermates from the DM500 mouse line and expressed only processed following the standard TRIzol procedure. the H-2Kb-tsA58 allele. Conditionally immortalized myoblasts were grown on gelatin- Northern Blotting. RNA was electrophoresed in a 1.2% agarose- coated dishes in DMEM (Gibco) supplemented with 20% formaldehyde denaturing gel. Depending on the source and the (vol/vol) FCS, 50 ␮g/mL gentamycin, 20 units ␥-IFN/mL (BD isolation procedure, 1 to 15 ␮g RNA per lane was loaded. RNA Biosciences) and 2% (vol/vol) chicken embryo extract (Sera was transferred to Hybond-XL nylon membrane (Amersham 32 Laboratories International) at 5% CO2 and 33 °C. Differentia- Pharmacia Biotech) and hybridized with random-primed P- tion to myotubes was induced by placing DM500 myoblasts, labeled probes (2.6 kb hDMPK cDNA (covering the entire ORF grown to confluency on Matrigel (BD Biosciences), in DMEM and 3Ј-UTR; i.e., the 3Ј part of exon 1 and all exons 2–15), 1.1 supplemented with 5% (vol/vol) horse serum (HS) and 50 ␮g/mL kb rat Gapdh cDNA or 1.1 kb mouse Mapkap1 cDNA) or gentamycin at 37 °C. These low serum conditions were continued 32P-end-labeled (CAG)9 or mouse skeletal actin-specific (MSA) for a maximum of 10 days. Spontaneous contractions appeared oligos (3). Blots were exposed to X-ray film (X-Omat AR, around 5 days of differentiation. Kodak). Quantification of signals was done by phospho-imager For the generation of human DM1 myoblast lines biopsies analysis (GS-505 or Molecular Imager FX, Bio-Rad) and ana- from quadriceps muscles were obtained during autopsies, in lyzed with Quantity One (Bio-Rad) or ImageJ software. Gapdh/ accordance with French legislation on ethical rules. Satellite GAPDH or MSA levels were used for normalization. RNA levels cells were isolated from DM1 fetal muscle as described (5). for control samples were set at 100. Myoblasts were maintained in Ham’s F-10 medium supple- ␮ mented with 20% FCS and 25 ␮g/mL gentamycin, at 5% CO2 and Semiquantitative RT-PCR Analysis. Approximately 0.5 g RNA was 37 °C. subjected to cDNA synthesis with random hexamers using the SuperScript first-strand synthesis system (Invitrogen) in a total Analysis of (CTG)n Repeat Lengths. Sizes of the expanded (CTG)n volume of 20 ␮L. One ␮L of cDNA preparation was subse- segments in the human cell lines were estimated via Southern quently used in a semiquantitative PCR analysis according to blotting of genomic DNA (5). The number of CTG triplets in standard procedures. In RTϪ control experiments, reverse tran- the normal-sized alleles was determined by PCR and DNA scriptase was omitted. A repeat-primed RT-PCR assay was sequencing. developed for the hDMPK (CUG)n segment as described (8, 9). PCR primers were designed on the basis of NCBI database AONs. The design of AONs was primarily based on open sec- sequence information (see list of primers below). Product iden- ondary structures in hDMPK mRNA as predicted by Mfold tity was confirmed by DNA sequencing. The signal for ␤-actin software (6). PS58 is a synthetic, modified RNA molecule with was used for normalization. Cycle number was 18 for ␤-actin and sequence 5Ј-CAGCAGCAGCAGCAGCAGCAG-3Ј, which car- 23–31 for other primer sets. The repeat-primed RT-PCR in exon ries full-length 2Ј-OMe-substituted ribose molecules and PT 15 was analyzed after 36 cycles. PCR products were analyzed on internucleotide linkages. All AONs used in this study, their 1.5–2.5% agarose gels, stained by ethidium bromide. Quantifi- chemistry, sequence, and position along the hDMPK transcript cation of signals was done using the Labworks 4.0 software (UVP are listed (Fig. 2A, and Table S1). All AONs were provided by BioImaging Systems). Values for control samples were set at 100. Prosensa B.V. Human DMPK mRNA levels in DM500 cells and mice were quantified with 5 independent primer sets covering almost the Oligo Transfection. Unless specified otherwise, cells were trans- entire transcript. fected with AONs complexed with polyethyleneimine (PEI; For analysis of alternative splicing, embryonic (E):adult (A) ExGen500, Fermentas), according to the manufacturer’s in- splice ratio was defined as embryonic form signal divided by structions. Typically, 5 ␮L of PEI per ␮g of AON was added in adult form signal in each sample. Splice ratio correction illus- differentiation medium to myotubes on day 5 of myogenesis or trates the effect of PS58 treatment on alternative splicing. Splice

Mulders et al. www.pnas.org/cgi/content/short/0905780106 1of13 ratio correction is defined as the mock-treated embryonic:adult In Vivo Treatment and Muscle Isolation. One-year-old DM500 mice splice ratio divided by the PS58-treated embryonic:adult splice were anesthetized using isoflurane. The GPS complex was ratio for a given transcript per mock/PS58-treated muscle pair pretreated with PEI-5% glucose injections (0.3 mL insulin (i.e., per mouse). Hence, a splice ratio correction of 1.0 means syringe with a 30-gauge needle) on days 1 and 2 to improve no change in alternative splicing, while a correction Ͼ1.0 implies uptake of PS58. This pretreatment was followed by 2 injections an increase in adult splice forms. In the analysis of HSALR with 2 nmoles PS58 in a PEI-5% glucose solution at the same mRNA levels versus splicing correction, splice ratio corrections central position in the GPS muscle on days 3 and 4. In all cases, of 5 transcripts (i.e., Serca1, Mbnl1, Ttn, Clcn1, and Tnnt3) were injection volume was 40 ␮L. Mock-treated mice received exactly averaged per muscle pair. A total of 27 different muscle samples, the same treatment except that oligo PS58 was left out. Mice originating from 20 mice, were included. were killed on day 15 and individual muscles were isolated, snap The following primers were used: frozen in liquid nitrogen, and stored at Ϫ80 °C. hDMPK exon 15-F; 5Ј- GGGGGATCACAGACCATT-3Ј; Diverse treatment protocols were tested in HSALR mice. In hDMPK exon 15-R; 5Ј-TCAATGCATCCAAAACGTGGA- each case, 1 leg of a HSALR mouse was treated with 1 or 2 nmoles 3Ј; PS58, while the contralateral leg served as mock control. (i) hDMPK exon 12–exon 15-F; 5Ј- AAAGAATTCGGGAC- HSALR mice were injected twice in the GPS complex as de- CTAGAGGCACACGT-3Ј; scribed above, without PEI pretreatment. Injections took place hDMPK exon 12–exon 15-R; 5Ј- AAACTCGAGCGAA- at days 1 and 8, and tissues were isolated on day 22. Noninjected CAGGAGCAGGGAAA-3Ј; TA muscle served as negative control. (ii) TA muscle was hDMPK exon 7–exon 9-F; 5Ј- ACGGCGGAGACCTATG- injected once as described above, without PEI pretreatment, and GCAA-3Ј; muscle tissue was isolated 7 days later. (iii) TA muscle was hDMPK exon 7–exon 9-R; 5Ј- TCCCGAATGTCCGA- injected with or without PEI, followed by electroporation (13) CAGTGT-3Ј; and analyzed on day 8 or 15. hDMPK exon 1–exon 7-F; 5Ј- CGAACTGGCCCAGGA- CAAGTA-3Ј; Fluorescent in Situ Hybridization. DM500 myoblasts or myotubes hDMPK exon 1–exon 7-R; 5Ј- TACACCCAGCGCCCAC- grown on gelatin- or Matrigel-coated glass cover slips were fixed CAGT-3Ј; in 4% (wt/vol) formaldehyde in PBS for 30 min at room Ј temperature and washed with PBS including 5 mM MgCl2. Cells hDMPK exon 15 repeat-F; 5 -GGTCCTTGTAGCCGG- ϫ GAAT-3Ј; were prehybridized in 40% (vol/vol) formamide/2 SSC for 30 min at room temperature. FAM-labeled and Cy3-labeled 2Ј- hDMPK exon 15 repeat-R; 5Ј-GCGTCATGCACAA- OMe PT (CAG)7 probes were used to detect (CUG)n RNA. A GAAAGCTTT-3Ј; fluorescent (CUG)7 probe was used as negative control. Samples hDMPK exon 15 repeat-anchored; 5Ј-GGTCCTTGTAGC- were incubated o/n in 125 ␮L probe hybridization buffer (40% CGGGAATGCTGCTGCTGCTGCTGCT-3Ј; (vol/vol) formamide, 2ϫ SSC, 0.2 mg/mL BSA, 10 mg/mL ␤-actin-F; 5Ј- GCTAYGAGCTGCCTGACGG-3Ј; dextran sulfate, 2 mM vanadyl sulfate, 1 mg/mL herring sperm ␤-actin-R; 5Ј- GAGGCCAGGATGGAGCC-3Ј; DNA, 30 ng fluorescent oligo) in a humidified chamber at 37 °C. Serca1-F; 5Ј- GCTCATGGTCCTCAAGATCTCAC-3Ј (10); Cells were washed 3 times with 40% formamide/2ϫ SSC for 30 Serca1-R; 5Ј- GGGTCAGTGCCTCAGCTTTG-3Ј (10); Ј Ј min at 37 °C, followed by a wash with PBS at room temperature. Mbnl1-F; 5 - GCTGCCCAATACCAGGTCAAC-3 (10); Cells were mounted in Mowiol (Sigma-Aldrich). FISH on 8 ␮m Mbnl1-R; 5Ј- TGGTGGGAGAAATGCTGTATGC-3Ј (10); LR Ј Ј HSA gastrocnemius sections was performed as described, Ttn-F; 5 - GTGTGAGTCGCTCCAGAAACG-3 (10); except that 0.2 ng/␮L Cy3-(CAG)7 probe was present during Ttn-R; 5Ј- CCACCACAGGACCATGTTATTTC-3Ј (10); Ј Ј hybridization and sections were mounted in DAPI-containing Clcn1-F; 5 - GGAATACCTCACACTCAAGGCC-3 (11); Mowiol. Ј Ј Clcn1-R; 5 - CACGGAACACAAAGGCACTGAATGT-3 For quantification of nuclear foci, sections were stained, (11); imaged at 1,600ϫ magnification under identical exposure set- Ј Ј Tnnt3-F; 5 - TCTGACGAGGAAACTGAACAAG-3 (11); tings, and analyzed using uniform threshold settings. Images Ј Ј Tnnt3-R; 5 - TGTCAATGAGGGCTTGGAG-3 (11); were collected on a Zeiss Axioplan fluorescence microscope Ј Ј Ptbp1-F; 5 - TCTGTCCCTAATGTCCATGG-3 ; (Carl Zeiss). Pictures were captured by a Zeiss AxioCam MR Ј Ј Ptbp1-R; 5 - GCCATCTGCACAAGTGCGT-3 ; camera with Axiovision 3.1 software. In the case of DM500 Ј Ј Sdc3-F; 5 - GCTGTTGCTGCCACCGCT-3 ; myoblasts, around 50 nuclei were scored for the presence of foci; Ј Ј Sdc3-R; 5 - GGCGCCTCGGGAGTGCTA-3 ; size and intensity of foci were not considered during analysis. In Txlnb-F; 5Ј- CTCAGCCCTGCTGCCTGT-3Ј; HSALR sections, around 120 nuclei per treatment were classified Txlnb-R; 5Ј- CAGACCCATACGTGCTTATG-3Ј; in 3 groups by 2 or 3 examiners blinded to sample identity. To Mapkap1-F; 5Ј- GTCCGACGCAGCCACAGT-3Ј; be able to compare signal intensities, microscope settings were Mapkap1-R; 5Ј- CCTTCTCCCTGATTCAGTATA-3Ј. maintained constant.

Western Blotting. DM1 patient 21/200 myoblasts were transfected Immunofluorescence. Frozen 8-␮m HSALR gastrocnemius sections with PS58 (200 nM) or mock transfected and 72 h later lysed in were air dried and fixed in 3% (wt/vol) formaldehyde in PBS ϫ ϫ lysis buffer (1 TBS, 1% Nonidet P-40, 1 mM PMSF and 1 including 5 mM MgCl2, both for 30 min at room temperature. Protease Inhibitory Mixture (Roche, Almere, The Netherlands) After washing with PBS for 2 minutes, sections were permeabil- on ice. Cleared lysates were separated on an 8% SDS/PAGE gel ized in 2% prechilled (Ϫ20 °C) acetone in PBS for 5 minutes, and transferred to PVDF (Amersham Pharmacia Biotech). Blots washed 5 times with PBS for 2 minutes, and then incubated in were incubated with DMPK-specific antibody B79 (12) and anti-Mbnl1 antibody A2764 (10) at 4 °C overnight. After washing ␤-tubulin monoclonal antibody E7 (Developmental Studies Hy- with PBS, sections were stained with ALEXA 488-coupled bridoma Bank, University of Iowa), followed by ECL detection. secondary antibody at room temperature for 30 min. Sections Quantification of signals was done using a GS-690 Imaging were washed with PBS and mounted in DAPI-containing Densitometer (Bio-Rad) and ImageJ software. Values for mock- Mowiol. Quantification of nuclear Mbnl1 foci was done as treated samples were set at 100. described above for (CUG)n foci.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 2of13 Intratissue Imaging. The distribution of FAM-labeled PS58 was control group were compared using an unpaired Student’s t test. imaged at different time points after injection in the GPS Analysis of (CUG)n-positive nuclei in DM500 myoblasts was complex of DM500 mice. At different time points, mice were done with an unpaired t test. Ribonuclear foci in muscle sections killed, muscles were dissected and analyzed individually. Intra- were scored independently by 2 or 3 examiners blinded to sample vital images were recorded with the Olympus OV110 whole identities and were compared using a ␹2 test. Alternative splicing mouse imaging system (Olympus). of HSALR muscle in vivo was analyzed using a paired t test. Bioinformatics. BLAST analysis of EST and genome databases Spearman’s correlation was applied to evaluate whether a cor- was done to identify mouse transcripts bearing 1 or more relation exists between DMPK mRNA level and number of CUG uninterrupted (CUG)n tracts (n Ն 6). Nucleotide query se- triplets in PS58-treated human myoblasts (Fig. 4C) and between quences of 6–50 CTG triplets were used. A list of transcripts splice ratio correction and HSALR (CUG)250 mRNA levels in bearing long (CUG)n segments in the mouse genome is given PS58-treated muscle (Fig. 5E). DMPK protein levels in human (Table S2). HomoloGene was used to identify annotated genes, myoblasts were analyzed using an unpaired t test. All values are design primers for PCR, and detect homologs among genes in presented as the mean Ϯ SEM, unless specified otherwise in the mouse and human genomes. Expression was predicted on the legend. Differences between groups were considered significant basis of UniGene information. when P Ͻ 0.05. *, P Ͻ 0.05; **, P Ͻ 0.01; ***, P Ͻ 0.001. Statistical analyses were performed with GraphPad Prism 4 Statistical Analysis. DMPK and HSALR (CUG)250 mRNA signals (Northern blots and RT-PCR) of the experimental group and software.

1. Seznec H, et al. (2000) Transgenic mice carrying large human genomic sequences with 11. Kanadia RN, et al. (2003) A muscleblind knockout model for myotonic dystrophy. expanded CTG repeat mimic closely the DM CTG repeat intergenerational and somatic Science 302:1978–1980. instability. Hum Mol Genet 9:1185–1194. 12. Groenen PJ, et al. (2000) Constitutive and regulated modes of splicing produce six 2. Jat PS, et al. (1991) Direct derivation of conditionally immortal cell lines from an major myotonic dystrophy protein kinase (DMPK) isoforms with distinct properties. H-2Kb-tsA58 transgenic mouse. Proc Natl Acad Sci USA 88:5096–5100. Hum Mol Genet 9:605–616. 3. Mankodi A, et al. (2000) Myotonic dystrophy in transgenic mice expressing an ex- 13. Wheeler TM, Lueck JD, Swanson MS, Dirksen RT, Thornton CA (2007) Correction of panded CUG repeat. Science 289:1769–1772. ClC-1 splicing eliminates chloride channelopathy and myotonia in mouse models of 4. Morgan JE, et al. (1994) Myogenic cell lines derived from transgenic mice carrying a myotonic dystrophy. J Clin Invest 117:3952–3957. thermolabile T antigen: A model system for the derivation of tissue-specific and 14. Jasinska AJ, Kozlowski P, Krzyzosiak WJ (2008) Expression characteristics of triplet mutation-specific cell lines. Dev Biol 162:486–498. repeat-containing RNAs and triplet repeat-interacting proteins in human tissues. Acta 5. Furling D, Lemieux D, Taneja K, Puymirat J (2001) Decreased levels of myotonic Biochim Pol 55:1–8. dystrophy protein kinase (DMPK) and delayed differentiation in human myotonic 15. Rozanska M, et al. (2007) CAG and CTG repeat polymorphism in exons of human genes dystrophy myoblasts. Neuromuscul Disord 11:728–735. shows distinct features at the expandable loci. Hum Mutat 28:451–458. 6. Mathews DH, Sabina J, Zuker M, Turner DH (1999) Expanded sequence dependence of 16. Jasinska A, et al. (2003) Structures of trinucleotide repeats in human transcripts and thermodynamic parameters improves prediction of RNA secondary structure. JMol their functional implications. Nucleic Acids Res 31:5463–5468. Biol 288:911–940. 7. Langlois MA, Lee NS, Rossi JJ, Puymirat J (2003) Hammerhead ribozyme-mediated 17. Tian B, Mukhopadhyay R, Mathews MB (2005) Polymorphic CUG repeats in human destruction of nuclear foci in myotonic dystrophy myoblasts. Mol Ther 7:670–680. mRNAs and their effects on gene expression. RNA Biol 2:149–156. 8. Matsuura T, Ashizawa T (2002) Polymerase chain reaction amplification of expanded 18. Collins JR, et al. (2003) An exhaustive DNA micro-satellite map of the human genome ATTCT repeat in spinocerebellar ataxia type 10. Ann Neurol 51:271–272. using high performance computing. Genomics 82:10–19. 9. Warner JP, et al. (1996) A general method for the detection of large CAG repeat 19. Koob MD, et al. (1999) An untranslated CTG expansion causes a novel form of expansions by fluorescent PCR. J Med Genet 33:1022–1026. spinocerebellar ataxia (SCA8). Nat Genet 21:379–384. 10. Lin X, et al. (2006) Failure of MBNL1-dependent post-natal splicing transitions in 20. Rudnicki DD, et al. (2007) Huntington’s disease–like 2 is associated with CUG repeat- myotonic dystrophy. Hum Mol Genet 15:2087–2097. containing RNA foci. Ann Neurol 61:272–282.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 3of13 + TRIzol

TRIzol Prot K oligo(dT) affinity

Mock PS57 PS58 Mock PS57 PS58 Mock PS58

hDMPK

mDMPK

Gapdh

100

0 mRNA level (%) mRNA mDMPK hDMPK

Fig. S1. Three additional techniques to isolate expanded (CUG)n RNA after silencing by PS58. DM500 myotubes were cultured for 5 days and then mock treated, treated with 200 nM PS58, or with control oligo PS57. RNA was isolated 48 h after start of transfection using (i) TRIzol, (ii) a proteinase K-TRIzol method, or (iii) the NucleoTrap mRNA mini kit, which employs an oligo(dT) afﬁnity column. RNA detection and quantiﬁcation using Northern blotting was done as described in Materials and Methods. For i and ii, a representative blot of 1 of 2 independent experiments is shown.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 4of13 A

PS58 PS113 Mock RT-

Ptbp1 (CUG)6 63 77 100

Sdc3 (CUG)6 53 61 100

Txlnb (CUG)9 54 69 100

Mapkap1 (CUG)26 26 72 100

β-Actin

200 nM 40 nM 8 nM 1.6 nM 0.32 nM Mock RT-

Mapkap1 (CUG)26 40 31 48 49 78 100

β-Actin

100

50 mRNA level (%) mRNA 0

8 nM Mock 40 nM 50 pM 10 pM 200 nM 0.32 nM

Fig. S2. Mouse transcripts bearing short (CUG)n segments are only mildly affected by PS58. (A) DM500 myotubes were cultured for 5 days and transfected with 200 nM PS58, control oligo PS113, or mock treated. Forty-eight hours posttransfection, RNA was isolated and semiquantitative RT-PCR was performed to measure levels of (CUG)n-containing transcripts (Table S2). In all RT-PCR analyses, the (CUG)n tract was present in the amplicon (tract size verified by sequencing). Numerals indicate relative abundance to mock samples, using ␤-actin levels for normalization (mock values set at 100). A representative result of 2 independent experiments is shown. (B) DM500 myotubes were transfected with a concentration series of PS58 (0.01–200 nM) or mock treated. Mapkap1 (CUG)26 RNA levels were measured via semiquantitative RT-PCR using ␤-actin levels for normalization (mock values set at 100). (C) Independently, Northern blotting using total RNA, a Mapkap1 cDNA probe, and a Gapdh probe for normalization essentially confirmed these findings.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 5of13 Mock PS58 RT-

A Serca1 E

E Mbnl1 A

Ttn

E Clcn1 A

E Tnnt3 A

Fig. S3. No effect of PS58 on alternative splicing in WT myotubes. WT myotubes were cultured for 5 days and transfected with 200 nM PS58 or mock treated. Forty-eight hours posttransfection, RNA was isolated and RT-PCR was performed to examine alternative splice modes of 5 different transcripts. Quantiﬁcation of adult (A) and embryonic (E) splice forms was done as described in Materials and Methods. Numerals indicate the embryonic (E):adult (A) splice ratio in each lane. No signiﬁcant differences in alternative splicing were observed between mock-treated and PS58-treated myotubes (n ϭ 4; P ϭ 0.76; the results shown here illustrate data from 1 of 4 experiments). Besides, these data also demonstrate that alternative splice modes displayed in fully differentiated skeletal muscle in vivo (10) cannot be obtained in this in vitro myogenesis cell model.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 6of13 A 1 day time point 14 day time point brightfield fluorescence AB GPS complex fluorescence CD E gastroc. fluorescence FG H I plantaris

JK L soleus

MN O tibialis

B ABC PS58-FAM FITC DAPI merge DEF Mock

FITC DAPI merge

Fig. S4. Localization and spreading of PS58 oligo after injection in mouse GPS muscle. (A) On 2 consecutive days, fluorescently labeled PS58 was injected in the GPS complex of DM500 mice. One or 14 days after the second injection, presence of fluorescence in muscle tissue was examined using a small-animal imaging system. Oligo was detected in a nonhomogeneous fashion throughout the gastrocnemius, plantaris, and soleus muscle. In general, signal after 14 days was weaker than after 1 day, suggesting breakdown or clearance of the oligo. PS58 could also be detected in the tibialis anterior, but signal was extremely weak. [Scale bars, 5 mm (A–H and J–O) and 50 ␮m (I)]. (B) Fluorescently labeled PS58 was injected on 2 consecutive days in the left GPS complex of DM500 mice. The right complex was mock injected. Sixteen days after the second oligo injection, tissue sections of the GPS complex and tibialis were stained with DAPI and analyzed by fluorescence microscopy. PS58 was found concentrated in cell nuclei in the GPS sections. Focal areas of fluorescence in mock-treated muscle represent collections of autofluorescent pigment (lipofuscin), as demonstrated by fluorescence emission across a broad spectrum of wavelengths. In tibialis sections only autofluorescence was detected (not shown). (Scale bars, 30 ␮m.) A representative result from 3 independent experiments is shown.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 7of13 mRNA segment

gastrocnemius plantaris level (%)

Mock PS58 Mock PS58

35 ± 1 (p<0.001) 15

47 ± 2 (p<0.01) > 15

> 50 ± 3 (p<0.01) > 12 15

50 ± 5 (p<0.01) 7 9

76 ± 7 (p=0.07) 17

β-Actin

Fig. S5. RT-PCR analysis of silencing of individual hDMPK mRNA segments in DM500 mice following PS58 administration. DM500 mice were injected with PS58 or mock injected in the GPS complex. Fifteen days after injection, muscles were isolated and processed for RT-PCR analysis using primer pairs (arrows) covering 5 distinct segments of the hDMPK transcript. Representative results for gastrocnemius and plantaris are shown on the Left. Silencing was quantiﬁed per segment (arrowheads), using the ␤-actin signal for normalization, setting mock levels at 100. Per segment, levels from 3 injected mice (including 3 different types of muscle: gastrocnemius, plantaris, and soleus) were averaged (Right column). (See also Fig. 5A).

Mulders et al. www.pnas.org/cgi/content/short/0905780106 8of13 foci + diffuse diffuse large Mbnl1 foci Mbnl1 staining Mbnl1 staining

nuclei (%) 20

0 Mock PS58

Fig. S6. Localization of Mbnl1 protein in cell nuclei after PS58 treatment. GPS muscle of HSALR mice was injected with PS58 or mock injected. Gastrocnemius muscle was isolated and sections were processed for immunoﬂuorescence using an antibody against Mbnl1. Mbnl1 staining was observed in every cell nucleus. Three categories of Mbnl1 localization were scored (Top panels). PS58-treated muscle showed markedly less nuclei with large foci and more nuclei with diffuse Mbnl1 staining, although this distribution did not reach statistical signiﬁcance (n ϭ 2, P ϭ 0.09, ␹2 test).

Mulders et al. www.pnas.org/cgi/content/short/0905780106 9of13 P = 0.08 * ** 100 ** *

50 embryonic form (%)

0 Serca1 Mbnl1 Ttn Clcn1 Tnnt3

Mock PS58

Fig. S7. Correction of aberrant splicing upon silencing of (CUG)250 mRNA by PS58 in HSALR mice. TA muscles of 4 mice were electroporated with PS58 in 1 leg and mock treated in the contralateral one. After 8 days, TA muscles were dissected and RNA was isolated. Northern blotting showed that HSA (CUG)250 mRNA levels in PS58-treated muscles were 51 Ϯ 7% compared to mock-treated muscles. Quantiﬁcation of aberrant splicing was performed via RT-PCR for 5 transcripts known to be aberrantly spliced in DM1 (see Fig. 5D). Embryonic splice form levels were signiﬁcantly lowered for 4 out of 5 transcripts (n ϭ 4).

Mulders et al. www.pnas.org/cgi/content/short/0905780106 10 of 13 Table S1. Sequences and characteristics of AONs used in this study Oligo Chemistry Sequence (5Ј– Ͼ3Ј) Position mRNA/pre-mRNA

PS40 RNA 2ЈOMe PT GAGGGGCGUCCAGGGAUCCG Intron 14–exon 15 Pre-mRNA PS41 RNA 2ЈOMe PT GCGUCCAGGGAUCCGGACCG Intron 14–exon 15 Pre-mRNA PS42 RNA 2ЈOMe PT CAGGGAUCCGGACCGGAUAG Exon 15 Pre-mRNA PS56 DNA CAGCAGCAGCAGCAGCAGCAG Repeat in exon 15 mRNA/pre-mRNA PS57 RNA 2ЈOMe PT CUGCUGCUGCUGCUGCUGCUG NA NA PS58 RNA 2ЈOMe PT CAGCAGCAGCAGCAGCAGCAG Repeat in exon 15 mRNA/pre-mRNA PS59 RNA 2ЈOMe PT UGAGUUGGCCGGCGUGGGCC ESE exon 15 mRNA/pre-mRNA PS60 RNA 2ЈOMe PT UUCUAGGGUUCAGGGAGCGCGG ESE exon 15 mRNA/pre-mRNA PS61 RNA 2ЈOMe PT ACUGGAGCUGGGCGGAGACCC ESE exon 15 mRNA/pre-mRNA PS62 RNA 2ЈOMe PT CUCCCCGGCCGCUAGGGGGC ESE exon 15 mRNA/pre-mRNA PS113 DNA PT GAGCCGCCTCAGCCGCACCTC Exon 1 mRNA/pre-mRNA PS114 DNA PT GAAGTCGGCCACGTACTTGTC Exon 1 mRNA/pre-mRNA PS115 DNA PT GGAGTCGAAGACAGTTCTAGG Exon 15 mRNA/pre-mRNA PS116 DNA PT GGTACACAGGACTGGAGCTGG Exon 15 mRNA/pre-mRNA

All are specific for the hDMPK transcript (see Fig. 2A for locations). Except PS56, all AONs are modified throughout as indicated: 2ЈOMe ϭ 2Ј-O-methyl sugar modification; PT, phosphorothioate backbone modification; ESE, putative exonic splicing enhancer; NA, not applicable.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 11 of 13 Table S2. Mouse transcripts containing (CUG)n segments (n > 6) Expression in skeletal Gene name CUG muscle Tested in RT-PCR (abbreviated) Gene name (full) triplet no. (Unigene) (comments)

Mapkap1 Mitogen-Activated Protein Kinase 26–29 Yes Yes Associated Protein 1 Fgd4 FYVE, RhoGEF and PH Domain 21 No No (repeat only in transcript Containing 4 variant gamma) Hsd3b6 Hydroxy-Delta-5-Steroid 15–16 ϩ 6NoNo Dehydrogenase, 3 Beta- and Steroid Delta-Isomerase 6 Greb1 Gene Regulated by Estrogen in 9–17 No No Breast Cancer Protein Pcolce Procollagen C-Endopeptidase 12 (8 ϩ 5) Yes No (repeat starts at fourth Enhancer Protein nucleotide) Mllt3 Mixed Lineage-Leukemia 8–9 Yes No (repeat only in transcript Translocation to 3 Homolog variant 1); also large

(UAG)1–3(CAG)6–7 repeat Txlnb Taxilin Beta 9 Yes Yes Tacc1 Transforming, Acidic Coiled-Coil 8NoNo Containing Protein 1 Armcx6 Armadillo Repeat Containing, 7NoNo X-linked 6 Sdc3 Syndecan 3 6 Yes Yes Ptbp1 Polypyrimidine Tract Binding 6 Yes Yes Protein 1

A bioinformatic approach was used to identify mouse transcripts with uninterrupted (CUG)n segments. A representative, but not necessarily complete, list of long (CUG)n tracts (n Ն 6) in the mouse genome is shown here. Repeat polymorphisms are listed. Four transcripts were tested in RT-PCR (far right column).

Mulders et al. www.pnas.org/cgi/content/short/0905780106 12 of 13 Table S3. Human transcripts containing (CUG)n segments (n > 10) Gene name CUG CUG triplet (abbreviated) Gene name (full) triplet no. Refs Comments no. in mouse

TCF4 Transcription Factor 4 25–28 14 In intron 2 RPL14 Ribosomal Protein L14 4–22 15, 16, 17 - 4 NOTCH4 NOTCH4 5–13 15, 16, 17 - 5 LRP8 Low-Density Lipoprotein Receptor-Related 11–12 15, 16 - 4 Protein 8 PDCD1 Programmed Cell Death 1 10–11 15, 16 - 3 MAP3K4 Mitogen-Activated Protein Kinase Kinase 10–11 15, 18 - 5 Kinase 4 PAPSS2 3Ј-Phosphoadenosine 5Ј-Phosphosulfate 8–11 15, 16, 17 - 2 Synthase 2 CHRNA3 Cholinergic Receptor, Nicotinic, Alpha 3 6–11 15, 16, 17 - 2 BPGM 2,3-Bisphosphoglycerate Mutase 7–10 15, 16, 17 - 2 BRI3BP Bri3 Binding Protein 9–10 17 - 4 LTBP3 Latent Transforming Growth Factor Beta 10 16 - 3 Binding Protein 3 DMPK Myotonic Dystrophy Protein Kinase 5–37 16, 17 Expanded in DM1 2 SCA8 Spinocerebellar Ataxia 8 16–37 16, 19 Composite CUA/CUG ND repeat; expanded in SCA8 JPH3 Junctophilin-3 6–28 20 Expanded in ND Huntington’s disease-like 2 (HDL2)

Summary of human transcripts containing long (CUG)n segments (n Ն 10) previously described (14–20). Database analysis showed that none of these (CUG)n tracts were actually conserved in mouse (column far right). ND, not determined.

Mulders et al. www.pnas.org/cgi/content/short/0905780106 13 of 13